#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R1	80835	hgsc.bcm.edu	37	1	6631122	6631122	+	Silent	SNP	G	G	A	rs375985047		TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr1:6631122G>A	ENST00000333172.6	+	2	538	c.345G>A	c.(343-345)acG>acA	p.T115T	TAS1R1_ENST00000328191.4_Silent_p.T115T|TAS1R1_ENST00000351136.3_Silent_p.T115T	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	115					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGTATGCCACGCTGAGAGTGC	0.562																																					p.T115T		Atlas-SNP	.											.	TAS1R1	76	.	0			c.G345A						.	G	,	3,4403	6.2+/-15.9	0,3,2200	189.0	167.0	174.0		345,345	-10.0	0.0	1		174	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TAS1R1	NM_138697.3,NM_177540.2	,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,	115/842,115/588	6631122	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	80835	exon2			TGCCACGCTGAGA		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.345G>A	chr1.hg19:g.6631122G>A		111.0	0.0		56.0	41.0	NM_177540	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	hg19	CCDS81.1	.	.	.	.	.	.	.	.	.	.	G	4.906	0.168440	0.09339	6.81E-4	0.0	ENSG00000173662	ENST00000411823;ENST00000415267	.	.	.	5.08	-10.0	0.00425	.	.	.	.	.	T	0.21550	0.0519	.	.	.	0.31514	N	0.663209	.	.	.	.	.	.	T	0.14392	-1.0474	4	.	.	.	.	3.7175	0.08444	0.3702:0.3424:0.2037:0.0836	.	.	.	.	H	41	.	.	R	+	2	0	TAS1R1	6553709	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-5.044000	0.00157	-1.700000	0.01414	-0.827000	0.03088	CGC	.	.		0.562	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
NFYC	4802	hgsc.bcm.edu	37	1	41215315	41215315	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr1:41215315G>C	ENST00000308733.5	+	3	254	c.248G>C	c.(247-249)cGa>cCa	p.R83P	NFYC_ENST00000440226.3_Missense_Mutation_p.R83P|NFYC_ENST00000372652.1_Missense_Mutation_p.R83P|NFYC_ENST00000447388.3_Missense_Mutation_p.R83P|NFYC_ENST00000456393.2_Missense_Mutation_p.R83P|NFYC_ENST00000372653.1_Missense_Mutation_p.R83P|NFYC_ENST00000427410.2_Intron|NFYC_ENST00000372651.1_Missense_Mutation_p.R83P|NFYC_ENST00000425457.2_Missense_Mutation_p.R83P|NFYC_ENST00000372654.1_Missense_Mutation_p.R83P			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	83					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			TTGACTCTTCGAGCCTGGATT	0.478																																					p.R83P		Atlas-SNP	.											.	NFYC	39	.	0			c.G248C						.						92.0	92.0	92.0					1																	41215315		2203	4300	6503	SO:0001583	missense	4802	exon4			CTCTTCGAGCCTG	U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.248G>C	chr1.hg19:g.41215315G>C	ENSP00000312617:p.Arg83Pro	85.0	0.0		77.0	52.0	NM_001142587	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	ENST00000308733.5	hg19		.	.	.	.	.	.	.	.	.	.	G	18.40	3.616119	0.66672	.	.	ENSG00000066136	ENST00000447388;ENST00000425457;ENST00000453631;ENST00000456393;ENST00000372654;ENST00000372653;ENST00000372669;ENST00000372652;ENST00000372651;ENST00000440226;ENST00000525290;ENST00000530965;ENST00000416859;ENST00000308733	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9	5.85	4.93	0.64822	Histone-fold (2);Transcription factor CBF/NF-Y/archaeal histone (1);	0.000000	0.85682	D	0.000000	T	0.65059	0.2655	H	0.98238	4.18	0.80722	D	1	B;B;B;B;B;P	0.45634	0.064;0.005;0.021;0.004;0.004;0.863	B;B;B;B;B;B	0.43701	0.04;0.004;0.016;0.002;0.002;0.428	T	0.79412	-0.1814	10	0.87932	D	0	.	14.7411	0.69455	0.0:0.1457:0.8543:0.0	.	83;83;83;83;83;83	Q13952;Q5T6K9;Q13952-3;F8VWM3;Q13952-2;B4DUS6	NFYC_HUMAN;.;.;.;.;.	P	83;83;83;83;83;83;83;83;83;83;83;59;83;83	ENSP00000404427:R83P;ENSP00000396620:R83P;ENSP00000397647:R83P;ENSP00000408867:R83P;ENSP00000361738:R83P;ENSP00000361737:R83P;ENSP00000361754:R83P;ENSP00000361736:R83P;ENSP00000361734:R83P;ENSP00000414299:R83P;ENSP00000436710:R83P;ENSP00000433413:R59P;ENSP00000409219:R83P;ENSP00000312617:R83P	ENSP00000312617:R83P	R	+	2	0	NFYC	40987902	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.402000	0.97298	1.465000	0.48006	-0.175000	0.13238	CGA	.	.		0.478	NFYC-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000020802.1	NM_014223	
ZNF648	127665	hgsc.bcm.edu	37	1	182025619	182025619	+	Silent	SNP	G	G	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr1:182025619G>A	ENST00000339948.3	-	2	1734	c.1527C>T	c.(1525-1527)tgC>tgT	p.C509C		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AGGCCCTGCCGCACTCGGCAC	0.622																																					p.C509C	NSCLC(71;908 1374 5429 20458 35642)	Atlas-SNP	.											.	ZNF648	111	.	0			c.C1527T						.						96.0	80.0	85.0					1																	182025619		2203	4300	6503	SO:0001819	synonymous_variant	127665	exon2			CCTGCCGCACTCG	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1527C>T	chr1.hg19:g.182025619G>A		118.0	0.0		214.0	127.0	NM_001009992	B2RP16	Silent	SNP	ENST00000339948.3	hg19	CCDS30952.1																																																																																			.	.		0.622	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
UCHL5	51377	hgsc.bcm.edu	37	1	192992059	192992059	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr1:192992059G>T	ENST00000367455.4	-	9	1078	c.843C>A	c.(841-843)taC>taA	p.Y281*	UCHL5_ENST00000367449.1_Nonsense_Mutation_p.Y280*|UCHL5_ENST00000367451.4_Nonsense_Mutation_p.Y307*|UCHL5_ENST00000367454.1_Nonsense_Mutation_p.Y280*|UCHL5_ENST00000367448.1_Nonsense_Mutation_p.Y280*|UCHL5_ENST00000367452.4_Nonsense_Mutation_p.Y156*|UCHL5_ENST00000530098.2_Nonsense_Mutation_p.Y157*	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	281					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						AACATACCTTGTATCTTTTTA	0.308																																					p.Y281X		Atlas-SNP	.											.	UCHL5	41	.	0			c.C843A						.						96.0	102.0	100.0					1																	192992059		2203	4299	6502	SO:0001587	stop_gained	51377	exon9			TACCTTGTATCTT		CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.843C>A	chr1.hg19:g.192992059G>T	ENSP00000356425:p.Tyr281*	84.0	0.0		141.0	8.0	NM_015984	Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Nonsense_Mutation	SNP	ENST00000367455.4	hg19	CCDS1378.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	19.84|19.84|19.84	3.901743|3.901743|3.901743	0.72754|0.72754|0.72754	.|.|.	.|.|.	ENSG00000116750|ENSG00000116750|ENSG00000116750	ENST00000449480;ENST00000443327;ENST00000416915|ENST00000420791|ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000367452;ENST00000530098;ENST00000391991	.|.|.	.|.|.	.|.|.	5.59|5.59|5.59	-1.04|-1.04|-1.04	0.10068|0.10068|0.10068	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|.	0.35098|0.35098|.	0.0920|0.0920|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.41538|0.41538|.	-0.9503|-0.9503|.	3|3|.	.|.|0.07482	.|.|T	.|.|0.82	-26.5188|-26.5188|-26.5188	13.362|13.362|13.362	0.60661|0.60661|0.60661	0.343:0.0:0.657:0.0|0.343:0.0:0.657:0.0|0.343:0.0:0.657:0.0	.|.|.	.|.|.	.|.|.	.|.|.	K|K|X	69;137;63|172|281;280;320;307;280;280;156;157;271	.|.|.	.|.|ENSP00000356418:Y280X	Q|T|Y	-|-|-	1|2|3	0|0|2	UCHL5|UCHL5|UCHL5	191258682|191258682|191258682	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.884000|0.884000|0.884000	0.51177|0.51177|0.51177	0.588000|0.588000|0.588000	0.23924|0.23924|0.23924	-0.090000|-0.090000|-0.090000	0.12462|0.12462|0.12462	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	CAA|ACA|TAC	.	.		0.308	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086318.3	NM_015984	
OR2L5	81466	hgsc.bcm.edu	37	1	248185504	248185504	+	Silent	SNP	G	G	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr1:248185504G>C	ENST00000355281.1	+	1	255	c.255G>C	c.(253-255)ctG>ctC	p.L85L	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CTGATTTTCTGTATGGAAACA	0.448																																					p.L85L		Atlas-SNP	.											.	.	.	.	0			c.G255C						.																																			SO:0001819	synonymous_variant	81466	exon1			TTTTCTGTATGGA		CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.255G>C	chr1.hg19:g.248185504G>C		63.0	0.0		170.0	106.0	NM_001258284	Q6IF04	Silent	SNP	ENST00000355281.1	hg19	CCDS58068.1																																																																																			.	.		0.448	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096851.1		
PTCD3	55037	hgsc.bcm.edu	37	2	86362000	86362000	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr2:86362000A>C	ENST00000254630.7	+	21	1734	c.1668A>C	c.(1666-1668)aaA>aaC	p.K556N	SNORD94_ENST00000386037.1_RNA	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	556					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						CTGATATCAAATCTGCGTATG	0.468																																					p.K556N		Atlas-SNP	.											.	PTCD3	51	.	0			c.A1668C						.						137.0	144.0	142.0					2																	86362000		2203	4300	6503	SO:0001583	missense	55037	exon21			TATCAAATCTGCG		CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.1668A>C	chr2.hg19:g.86362000A>C	ENSP00000254630:p.Lys556Asn	212.0	0.0		267.0	108.0	NM_017952	A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	hg19	CCDS33235.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.435297	0.43224	.	.	ENSG00000132300	ENST00000254630	T	0.33865	1.39	5.71	-3.79	0.04320	.	0.088162	0.85682	D	0.000000	T	0.50480	0.1618	M	0.72576	2.205	0.34460	D	0.701648	D;D	0.76494	0.999;0.999	D;D	0.71656	0.973;0.974	T	0.58842	-0.7565	10	0.27785	T	0.31	-19.6377	14.1648	0.65469	0.4333:0.0:0.5667:0.0	.	147;556	Q96EY7-2;Q96EY7	.;PTCD3_HUMAN	N	556	ENSP00000254630:K556N	ENSP00000254630:K556N	K	+	3	2	PTCD3	86215511	0.986000	0.35501	0.383000	0.26132	0.202000	0.24057	0.600000	0.24104	-0.668000	0.05296	-0.250000	0.11733	AAA	.	.		0.468	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329854.1	NM_017952	
TTN	7273	hgsc.bcm.edu	37	2	179647562	179647562	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr2:179647562A>G	ENST00000591111.1	-	18	3295	c.3071T>C	c.(3070-3072)gTc>gCc	p.V1024A	TTN_ENST00000359218.5_Missense_Mutation_p.V978A|TTN_ENST00000460472.2_Missense_Mutation_p.V978A|TTN_ENST00000342992.6_Missense_Mutation_p.V1024A|TTN_ENST00000342175.6_Missense_Mutation_p.V978A|TTN_ENST00000589042.1_Missense_Mutation_p.V1024A|TTN_ENST00000360870.5_Missense_Mutation_p.V1024A|RP11-88L24.4_ENST00000582038.2_RNA			Q8WZ42	TITIN_HUMAN	titin	32577	Ig-like 3.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGATGTGCTGACGGTTCCAGC	0.493																																					p.V1024A		Atlas-SNP	.											.	TTN	18412	.	0			c.T3071C						.						86.0	71.0	76.0					2																	179647562		2203	4300	6503	SO:0001583	missense	7273	exon18			GTGCTGACGGTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3071T>C	chr2.hg19:g.179647562A>G	ENSP00000465570:p.Val1024Ala	105.0	0.0		150.0	58.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	15.58	2.875864	0.51695	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60064	0.2240	N	0.03930	-0.32	0.34740	D	0.730685	D;D;D;D;D	0.69078	0.978;0.978;0.978;0.978;0.997	P;P;P;P;D	0.66084	0.829;0.829;0.829;0.829;0.941	T	0.75872	-0.3164	9	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	978;978;978;1024;1024	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	A	1024;978;978;978;978;1024	ENSP00000343764:V1024A;ENSP00000434586:V978A;ENSP00000340554:V978A;ENSP00000352154:V978A;ENSP00000354117:V1024A	ENSP00000340554:V978A	V	-	2	0	TTN	179355807	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	9.307000	0.96226	2.371000	0.80710	0.533000	0.62120	GTC	.	.		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TRIP12	9320	hgsc.bcm.edu	37	2	230655847	230655847	+	Silent	SNP	T	T	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr2:230655847T>C	ENST00000283943.5	-	29	4489	c.4311A>G	c.(4309-4311)ttA>ttG	p.L1437L	TRIP12_ENST00000389045.3_Silent_p.L1167L|TRIP12_ENST00000389044.4_Silent_p.L1485L	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1437					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TACCGTGCCATAACTCATCAT	0.378																																					p.L1437L		Atlas-SNP	.											.	TRIP12	207	.	0			c.A4311G						.						194.0	180.0	185.0					2																	230655847		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon29			GTGCCATAACTCA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4311A>G	chr2.hg19:g.230655847T>C		97.0	0.0		132.0	57.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.		0.378	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022658	32022658	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:32022658A>G	ENST00000396556.2	-	1	136	c.14T>C	c.(13-15)gTc>gCc	p.V5A	OSBPL10_ENST00000438237.2_Missense_Mutation_p.V5A|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	5					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		TGTGCCCTGGACTGCCCTCTC	0.771																																					p.V5A		Atlas-SNP	.											.	OSBPL10	160	.	0			c.T14C						.						2.0	3.0	2.0					3																	32022658		967	1954	2921	SO:0001583	missense	114884	exon1			CCCTGGACTGCCC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.14T>C	chr3.hg19:g.32022658A>G	ENSP00000379804:p.Val5Ala	30.0	0.0		44.0	13.0	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	hg19	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	8.089	0.774075	0.16051	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.22539	1.95;2.23	3.68	3.68	0.42216	.	0.394326	0.15996	N	0.234551	T	0.08758	0.0217	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34825	-0.9813	10	0.02654	T	1	.	9.4284	0.38595	0.1093:0.0:0.8907:0.0	.	5;5	B4E212;Q9BXB5	.;OSB10_HUMAN	A	5	ENSP00000379804:V5A;ENSP00000406124:V5A	ENSP00000379804:V5A	V	-	2	0	OSBPL10	31997662	0.985000	0.35326	1.000000	0.80357	0.255000	0.26057	1.534000	0.36051	0.920000	0.36970	-0.711000	0.03637	GTC	.	.		0.771	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
COL7A1	1294	hgsc.bcm.edu	37	3	48630101	48630101	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:48630101C>A	ENST00000328333.8	-	7	985	c.878G>T	c.(877-879)cGg>cTg	p.R293L	COL7A1_ENST00000454817.1_Missense_Mutation_p.R293L	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	293	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACCCCGCAGCCGCACACTGGT	0.617																																					p.R293L		Atlas-SNP	.											.	COL7A1	320	.	0			c.G878T						.						62.0	61.0	61.0					3																	48630101		2203	4300	6503	SO:0001583	missense	1294	exon7			CGCAGCCGCACAC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.878G>T	chr3.hg19:g.48630101C>A	ENSP00000332371:p.Arg293Leu	45.0	0.0		42.0	24.0	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	hg19	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	6.375	0.437386	0.12104	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.56611	0.45;0.45	4.5	-0.437	0.12272	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.489800	0.04529	N	0.385986	T	0.27489	0.0675	N	0.03608	-0.345	0.09310	N	0.999999	B	0.18461	0.028	B	0.17433	0.018	T	0.16129	-1.0413	10	0.39692	T	0.17	.	3.8677	0.09024	0.2905:0.3712:0.0:0.3383	.	293	Q02388	CO7A1_HUMAN	L	293	ENSP00000332371:R293L;ENSP00000412569:R293L	ENSP00000332371:R293L	R	-	2	0	COL7A1	48605105	0.004000	0.15560	0.077000	0.20336	0.462000	0.32619	0.013000	0.13310	-0.007000	0.14345	0.462000	0.41574	CGG	.	.		0.617	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
COL6A6	131873	hgsc.bcm.edu	37	3	130284086	130284086	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:130284086G>T	ENST00000358511.6	+	3	941	c.910G>T	c.(910-912)Ggg>Tgg	p.G304W	COL6A6_ENST00000453409.2_Missense_Mutation_p.G304W	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	304	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCCCCGAACTGGGAAGGCCTA	0.478																																					p.G304W		Atlas-SNP	.											.	COL6A6	497	.	0			c.G910T						.						70.0	72.0	71.0					3																	130284086		1857	4099	5956	SO:0001583	missense	131873	exon3			CGAACTGGGAAGG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.910G>T	chr3.hg19:g.130284086G>T	ENSP00000351310:p.Gly304Trp	152.0	0.0		187.0	69.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085166	0.36758	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.84944	-1.92;-1.92	5.01	4.14	0.48551	von Willebrand factor, type A (3);	0.195557	0.36374	N	0.002628	D	0.94258	0.8156	H	0.95712	3.71	0.49582	D	0.999808	D	0.89917	1.0	D	0.91635	0.999	D	0.95405	0.8493	10	0.87932	D	0	.	13.3765	0.60741	0.0775:0.0:0.9225:0.0	.	304	A6NMZ7	CO6A6_HUMAN	W	304	ENSP00000351310:G304W;ENSP00000399236:G304W	ENSP00000351310:G304W	G	+	1	0	COL6A6	131766776	1.000000	0.71417	0.189000	0.23252	0.005000	0.04900	7.150000	0.77403	1.250000	0.43966	-0.258000	0.10820	GGG	.	.		0.478	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
FNDC3B	64778	hgsc.bcm.edu	37	3	172052790	172052790	+	Silent	SNP	G	G	T	rs139505585	byFrequency	TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:172052790G>T	ENST00000336824.4	+	15	1797	c.1698G>T	c.(1696-1698)acG>acT	p.T566T	FNDC3B_ENST00000415807.2_Silent_p.T566T|FNDC3B_ENST00000416957.1_Silent_p.T566T	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	566	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TTGTTTGTACGACGAGTCCTG	0.463																																					p.T566T		Atlas-SNP	.											.	FNDC3B	118	.	0			c.G1698T						.						213.0	204.0	207.0					3																	172052790		2203	4300	6503	SO:0001819	synonymous_variant	64778	exon15			TTGTACGACGAGT	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1698G>T	chr3.hg19:g.172052790G>T		136.0	0.0		238.0	66.0	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	hg19	CCDS3217.1																																																																																			.	G|0.998;A|0.002		0.463	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
ZNF639	51193	hgsc.bcm.edu	37	3	179047483	179047483	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:179047483A>T	ENST00000326361.3	+	5	581	c.136A>T	c.(136-138)Aga>Tga	p.R46*	ZNF639_ENST00000484866.1_Nonsense_Mutation_p.R46*|ZNF639_ENST00000496856.1_Nonsense_Mutation_p.R46*|ZNF639_ENST00000466663.1_3'UTR	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	46					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CTGTTCTATGAGACAGCCAGA	0.279																																					p.R46X		Atlas-SNP	.											.	ZNF639	45	.	0			c.A136T						.						100.0	106.0	104.0					3																	179047483		2203	4289	6492	SO:0001587	stop_gained	51193	exon5			TCTATGAGACAGC	BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.136A>T	chr3.hg19:g.179047483A>T	ENSP00000325634:p.Arg46*	305.0	0.0		537.0	148.0	NM_016331	A9X3Z9|D3DNR3	Nonsense_Mutation	SNP	ENST00000326361.3	hg19	CCDS3227.1	.	.	.	.	.	.	.	.	.	.	A	41	8.666350	0.98908	.	.	ENSG00000121864	ENST00000496856;ENST00000491818;ENST00000481587;ENST00000326361;ENST00000466264;ENST00000484866;ENST00000494234	.	.	.	6.13	4.91	0.64330	.	0.171784	0.40728	N	0.001030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6953	0.28592	0.7896:0.1414:0.069:0.0	.	.	.	.	X	46	.	ENSP00000325634:R46X	R	+	1	2	ZNF639	180530177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.222000	0.51223	2.364000	0.80123	0.524000	0.50904	AGA	.	.		0.279	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348855.1	NM_016331	
ADIPOQ	9370	hgsc.bcm.edu	37	3	186570987	186570987	+	Missense_Mutation	SNP	C	C	T	rs372597136		TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:186570987C>T	ENST00000412955.2	+	2	281	c.140C>T	c.(139-141)cCg>cTg	p.P47L	ADIPOQ_ENST00000320741.2_Missense_Mutation_p.P47L|ADIPOQ_ENST00000444204.2_Missense_Mutation_p.P47L|ADIPOQ-AS1_ENST00000422718.1_RNA			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	47	Collagen-like.				adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		CCAGGGCATCCGGGCCATAAT	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17067	0.0		0.0	False		,,,				2504	0.001				p.P47L		Atlas-SNP	.											.	ADIPOQ	35	.	0			c.C140T						.	C	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	38.0	41.0	40.0		140,140	5.2	1.0	3		40	0,8600		0,0,4300	no	missense,missense	ADIPOQ	NM_001177800.1,NM_004797.3	98,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	47/245,47/245	186570987	1,13005	2203	4300	6503	SO:0001583	missense	9370	exon3			GGCATCCGGGCCA	D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.140C>T	chr3.hg19:g.186570987C>T	ENSP00000405611:p.Pro47Leu	320.0	0.0		598.0	176.0	NM_001177800	Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	hg19	CCDS3284.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616746	0.87359	2.27E-4	0.0	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	D;D;D	0.98684	-5.07;-5.07;-5.07	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.99227	0.9731	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99250	1.0887	10	0.72032	D	0.01	.	16.6188	0.84924	0.0:1.0:0.0:0.0	.	47	Q15848	ADIPO_HUMAN	L	47	ENSP00000405611:P47L;ENSP00000320709:P47L;ENSP00000389814:P47L	ENSP00000320709:P47L	P	+	2	0	ADIPOQ	188053681	0.950000	0.32346	1.000000	0.80357	0.873000	0.50193	2.609000	0.46317	2.616000	0.88540	0.655000	0.94253	CCG	.	.		0.617	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797	
FRYL	285527	hgsc.bcm.edu	37	4	48581248	48581248	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr4:48581248A>T	ENST00000503238.1	-	20	2269	c.2270T>A	c.(2269-2271)cTc>cAc	p.L757H	FRYL_ENST00000537810.1_Missense_Mutation_p.L757H|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Missense_Mutation_p.L757H|FRYL_ENST00000358350.4_Missense_Mutation_p.L757H			O94915	FRYL_HUMAN	FRY-like	757					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AGGGCAATAGAGCAAAGTAGT	0.318																																					p.L757H		Atlas-SNP	.											.	FRYL	242	.	0			c.T2270A						.						72.0	65.0	68.0					4																	48581248		1834	4078	5912	SO:0001583	missense	285527	exon23			CAATAGAGCAAAG	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2270T>A	chr4.hg19:g.48581248A>T	ENSP00000426064:p.Leu757His	99.0	0.0		101.0	48.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518817	0.64634	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.06294	3.32;3.32;3.32;3.32	6.17	6.17	0.99709	.	0.000000	0.56097	U	0.000021	T	0.17831	0.0428	L	0.41492	1.28	0.80722	D	1	D;P	0.76494	0.999;0.836	D;B	0.77557	0.99;0.376	T	0.02059	-1.1221	10	0.30078	T	0.28	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	757;757	F2Z2S2;O94915	.;FRYL_HUMAN	H	757	ENSP00000426064:L757H;ENSP00000351113:L757H;ENSP00000441114:L757H;ENSP00000421584:L757H	ENSP00000351113:L757H	L	-	2	0	FRYL	48276005	1.000000	0.71417	0.999000	0.59377	0.449000	0.32228	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	CTC	.	.		0.318	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
PIK3R1	5295	hgsc.bcm.edu	37	5	67590433	67590433	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr5:67590433C>T	ENST00000521381.1	+	12	2111	c.1495C>T	c.(1495-1497)Cag>Tag	p.Q499*	PIK3R1_ENST00000274335.5_Nonsense_Mutation_p.Q499*|PIK3R1_ENST00000396611.1_Nonsense_Mutation_p.Q499*|PIK3R1_ENST00000521657.1_Nonsense_Mutation_p.Q499*|PIK3R1_ENST00000523872.1_Nonsense_Mutation_p.Q136*|PIK3R1_ENST00000336483.5_Nonsense_Mutation_p.Q229*|PIK3R1_ENST00000320694.8_Nonsense_Mutation_p.Q199*	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	499					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AGAACAGTGCCAGACCCAAGA	0.338			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.Q499X		Atlas-SNP	.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1	869	.	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.C1495T						.						72.0	72.0	72.0					5																	67590433		2203	4300	6503	SO:0001587	stop_gained	5295	exon12			CAGTGCCAGACCC	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1495C>T	chr5.hg19:g.67590433C>T	ENSP00000428056:p.Gln499*	126.0	0.0		143.0	57.0	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Nonsense_Mutation	SNP	ENST00000521381.1	hg19	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	C	37	6.058175	0.97246	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000521409;ENST00000336483;ENST00000519025;ENST00000523872	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-24.6309	19.2559	0.93945	0.0:1.0:0.0:0.0	.	.	.	.	X	499;499;499;499;199;136;229;172;136	.	ENSP00000274335:Q499X	Q	+	1	0	PIK3R1	67626189	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.609000	0.82925	2.861000	0.98227	0.650000	0.86243	CAG	.	.		0.338	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130778197	130778197	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr5:130778197T>G	ENST00000509018.1	-	23	3660	c.3455A>C	c.(3454-3456)aAa>aCa	p.K1152T	RAPGEF6_ENST00000296859.6_Missense_Mutation_p.K1160T|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.K875T|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.K1165T|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.K1202T|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.K1152T|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.K1160T	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1152					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TTCAGATGATTTGGCTGATCT	0.443																																					p.K1165T	Melanoma(168;435 1955 13113 13877 23213)	Atlas-SNP	.											.	RAPGEF6	361	.	0			c.A3494C						.						167.0	155.0	159.0					5																	130778197		2203	4300	6503	SO:0001583	missense	51735	exon25			GATGATTTGGCTG	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3455A>C	chr5.hg19:g.130778197T>G	ENSP00000421684:p.Lys1152Thr	97.0	0.0		117.0	47.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	hg19	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852456	0.71719	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000514667	T;T;T;T;T;T;T	0.30714	1.74;1.65;1.65;1.73;1.53;1.52;1.83	5.94	4.75	0.60458	Ras guanine nucleotide exchange factor, domain (1);	0.043748	0.85682	D	0.000000	T	0.48241	0.1489	M	0.66939	2.045	0.80722	D	1	P;B;D;B;D;P;B	0.60160	0.929;0.262;0.987;0.034;0.971;0.891;0.262	P;B;P;B;P;P;B	0.59825	0.645;0.11;0.864;0.038;0.752;0.812;0.158	T	0.47573	-0.9107	10	0.56958	D	0.05	.	12.2595	0.54642	0.0:0.0669:0.0:0.9331	.	1160;1160;1152;875;1202;1165;1152	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	T	1152;1165;1160;1160;1165;875;1152;1202	ENSP00000421684:K1152T;ENSP00000309298:K1165T;ENSP00000426081:K1160T;ENSP00000296859:K1160T;ENSP00000426910:K875T;ENSP00000311419:K1152T;ENSP00000426948:K1202T	ENSP00000426948:K1202T	K	-	2	0	RAPGEF6;FNIP1	130806096	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	5.345000	0.65987	1.028000	0.39785	0.460000	0.39030	AAA	.	.		0.443	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
PHACTR2	9749	hgsc.bcm.edu	37	6	144095324	144095324	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr6:144095324C>T	ENST00000427704.2	+	8	1658	c.1528C>T	c.(1528-1530)Cga>Tga	p.R510*	PHACTR2_ENST00000440869.2_Nonsense_Mutation_p.R521*|PHACTR2_ENST00000367582.3_Nonsense_Mutation_p.R441*|PHACTR2_ENST00000367584.4_Nonsense_Mutation_p.R498*|PHACTR2_ENST00000305766.6_Nonsense_Mutation_p.R430*	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	510							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		GCAGGAAATCCGACAACAAAT	0.398																																					p.R521X	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	Atlas-SNP	.											.	PHACTR2	99	.	0			c.C1561T						.						115.0	109.0	111.0					6																	144095324		1924	4136	6060	SO:0001587	stop_gained	9749	exon8			GAAATCCGACAAC	AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.1528C>T	chr6.hg19:g.144095324C>T	ENSP00000391763:p.Arg510*	149.0	0.0		103.0	84.0	NM_001100164	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Nonsense_Mutation	SNP	ENST00000427704.2	hg19	CCDS47492.1	.	.	.	.	.	.	.	.	.	.	C	42	9.255489	0.99115	.	.	ENSG00000112419	ENST00000367584;ENST00000427704;ENST00000305766;ENST00000440869;ENST00000367582	.	.	.	6.17	4.27	0.50696	.	0.112278	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7605	0.28948	0.4225:0.5016:0.0:0.0759	.	.	.	.	X	498;510;430;521;441	.	ENSP00000305530:R430X	R	+	1	2	PHACTR2	144137017	0.908000	0.30866	1.000000	0.80357	0.992000	0.81027	1.032000	0.30178	1.575000	0.49775	0.655000	0.94253	CGA	.	.		0.398	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721	
LPA	4018	hgsc.bcm.edu	37	6	160966486	160966486	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr6:160966486T>C	ENST00000316300.5	-	33	5428	c.5384A>G	c.(5383-5385)gAt>gGt	p.D1795G	LPA_ENST00000447678.1_Missense_Mutation_p.D1795G			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4303	Kringle 16. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GAGAGGGATATCACAGTAGTC	0.388																																					p.D1795G		Atlas-SNP	.											LPA,NS,carcinoma,0,2	LPA	237	.	0			c.A5384G						.						102.0	110.0	107.0					6																	160966486		2203	4300	6503	SO:0001583	missense	4018	exon34			GGGATATCACAGT	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5384A>G	chr6.hg19:g.160966486T>C	ENSP00000321334:p.Asp1795Gly	47.0	0.0		48.0	39.0	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	hg19	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	t	1.788	-0.480251	0.04383	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.65178	-0.14;-0.14	2.7	2.7	0.31948	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.52435	0.1734	L	0.52759	1.655	0.28141	N	0.929788	D	0.71674	0.998	D	0.71184	0.972	T	0.37934	-0.9684	9	0.11485	T	0.65	.	8.5172	0.33253	0.0:0.0:0.0:1.0	.	4303	P08519	APOA_HUMAN	G	1795	ENSP00000321334:D1795G;ENSP00000395608:D1795G	ENSP00000321334:D1795G	D	-	2	0	LPA	160886476	1.000000	0.71417	0.992000	0.48379	0.044000	0.14063	4.212000	0.58514	1.253000	0.44018	0.155000	0.16302	GAT	.	.		0.388	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
HOXA11	3207	hgsc.bcm.edu	37	7	27224475	27224475	+	Missense_Mutation	SNP	G	G	C	rs577175554	byFrequency	TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr7:27224475G>C	ENST00000006015.3	-	1	360	c.289C>G	c.(289-291)Ccc>Gcc	p.P97A	HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000520360.1_RNA|HOXA11-AS_ENST00000522674.1_RNA|RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000479766.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	97					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						GCCGCGCTGGGCGCCTGCAGG	0.662			T	NUP98	CML																																p.P97A		Atlas-SNP	.		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	.	HOXA11	29	.	0			c.C289G						.						32.0	38.0	36.0					7																	27224475		2202	4299	6501	SO:0001583	missense	3207	exon1			CGCTGGGCGCCTG		CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.289C>G	chr7.hg19:g.27224475G>C	ENSP00000006015:p.Pro97Ala	41.0	0.0		56.0	8.0	NM_005523	A4D190	Missense_Mutation	SNP	ENST00000006015.3	hg19	CCDS5411.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864827	0.32977	.	.	ENSG00000005073	ENST00000006015	T	0.39592	1.07	5.49	2.32	0.28847	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.324752	0.32836	N	0.005595	T	0.21468	0.0517	N	0.17838	0.53	0.36129	D	0.845991	B	0.06786	0.001	B	0.08055	0.003	T	0.10543	-1.0625	10	0.32370	T	0.25	.	3.0466	0.06155	0.2858:0.0:0.4128:0.3014	.	97	P31270	HXA11_HUMAN	A	97	ENSP00000006015:P97A	ENSP00000006015:P97A	P	-	1	0	HOXA11	27191000	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.473000	0.35387	1.313000	0.45069	0.650000	0.86243	CCC	.	.		0.662	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1		
LAMB4	22798	hgsc.bcm.edu	37	7	107706863	107706863	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr7:107706863C>A	ENST00000388781.3	-	20	2712	c.2629G>T	c.(2629-2631)Ggg>Tgg	p.G877W	LAMB4_ENST00000205386.4_Missense_Mutation_p.G877W|LAMB4_ENST00000388780.3_Missense_Mutation_p.G877W	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	877	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AAGCATGACCCTGTCTCAGGA	0.463																																					p.G877W		Atlas-SNP	.											.	LAMB4	253	.	0			c.G2629T						.						69.0	64.0	66.0					7																	107706863		2203	4300	6503	SO:0001583	missense	22798	exon20			ATGACCCTGTCTC	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2629G>T	chr7.hg19:g.107706863C>A	ENSP00000373433:p.Gly877Trp	136.0	0.0		200.0	88.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716510	0.68844	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	T;T;T	0.67523	-0.27;-0.27;-0.27	4.92	4.92	0.64577	EGF-like, laminin (3);	0.000000	0.51477	D	0.000085	D	0.89001	0.6591	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93114	0.6519	10	0.87932	D	0	.	18.299	0.90157	0.0:1.0:0.0:0.0	.	877	A4D0S4	LAMB4_HUMAN	W	877	ENSP00000205386:G877W;ENSP00000373433:G877W;ENSP00000373432:G877W	ENSP00000205386:G877W	G	-	1	0	LAMB4	107494099	1.000000	0.71417	0.992000	0.48379	0.581000	0.36288	7.092000	0.76930	2.556000	0.86216	0.563000	0.77884	GGG	.	.		0.463	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
PDLIM2	64236	hgsc.bcm.edu	37	8	22451394	22451394	+	Missense_Mutation	SNP	G	G	T	rs200868327	byFrequency	TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr8:22451394G>T	ENST00000397760.4	+	10	1430	c.1030G>T	c.(1030-1032)Gca>Tca	p.A344S	PDLIM2_ENST00000409417.1_Missense_Mutation_p.A344S|PDLIM2_ENST00000308354.7_Missense_Mutation_p.A594S|PDLIM2_ENST00000397761.2_Missense_Mutation_p.A344S|PDLIM2_ENST00000339162.7_3'UTR|PDLIM2_ENST00000265810.4_Intron|AC037459.4_ENST00000430850.2_Intron|PDLIM2_ENST00000409141.1_3'UTR|PDLIM2_ENST00000448520.1_3'UTR			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	344	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		GCGCTACTCCGCACCTGCCAC	0.637																																					p.A594S		Atlas-SNP	.											PDLIM2_ENST00000308354,NS,carcinoma,0,1	PDLIM2	42	.	0			c.G1780T						.						28.0	20.0	23.0					8																	22451394		2153	4225	6378	SO:0001583	missense	64236	exon10			TACTCCGCACCTG	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.1030G>T	chr8.hg19:g.22451394G>T	ENSP00000380867:p.Ala344Ser	40.0	1.0		60.0	27.0	NM_021630	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	hg19		.	.	.	.	.	.	.	.	.	.	G	8.015	0.758446	0.15846	.	.	ENSG00000120913	ENST00000308354;ENST00000397760;ENST00000397761;ENST00000409417	T;T;T;T	0.12984	3.51;2.63;2.63;2.63	4.71	-0.668	0.11392	Zinc finger, LIM-type (1);	0.985121	0.08185	N	0.984841	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.38908	-0.9639	10	0.66056	D	0.02	.	1.1387	0.01761	0.3392:0.1358:0.3724:0.1526	.	344	Q96JY6	PDLI2_HUMAN	S	594;344;344;344	ENSP00000312634:A594S;ENSP00000380867:A344S;ENSP00000380868:A344S;ENSP00000387084:A344S	ENSP00000312634:A594S	A	+	1	0	PDLIM2	22507339	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	0.242000	0.18087	-0.533000	0.06323	0.478000	0.44815	GCA	.	.		0.637	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
SMARCA2	6595	hgsc.bcm.edu	37	9	2101571	2101571	+	Splice_Site	SNP	A	A	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr9:2101571A>C	ENST00000382203.1	+	22	3289	c.3080A>C	c.(3079-3081)gAa>gCa	p.E1027A	SMARCA2_ENST00000357248.2_Splice_Site_p.E1027A|SMARCA2_ENST00000349721.2_Splice_Site_p.E1027A|SMARCA2_ENST00000382194.1_Splice_Site_p.E1027A			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1027					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTTTTAAAGGAATCCTTTGCT	0.274																																					p.E1027A		Atlas-SNP	.											.	SMARCA2	313	.	0			c.A3080C						.						40.0	45.0	43.0					9																	2101571		2200	4294	6494	SO:0001630	splice_region_variant	6595	exon22			TAAAGGAATCCTT	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3079-1A>C	chr9.hg19:g.2101571A>C		694.0	0.0		445.0	322.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	hg19	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.417151	0.83449	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.71	5.71	0.89125	.	0.116735	0.56097	D	0.000022	D	0.86535	0.5956	M	0.69248	2.105	0.80722	D	1	B;D;P	0.56035	0.003;0.974;0.956	B;D;D	0.70487	0.02;0.969;0.931	D	0.86605	0.1869	10	0.48119	T	0.1	-23.5939	15.9892	0.80188	1.0:0.0:0.0:0.0	.	628;1027;1027	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	A	1027	ENSP00000265773:E1027A;ENSP00000349788:E1027A;ENSP00000371638:E1027A;ENSP00000371629:E1027A	ENSP00000265773:E1027A	E	+	2	0	SMARCA2	2091571	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.698000	0.91311	2.180000	0.69256	0.533000	0.62120	GAA	.	.		0.274	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	Missense_Mutation
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	50.0	1.0		57.0	4.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
ASPN	54829	hgsc.bcm.edu	37	9	95237030	95237030	+	Missense_Mutation	SNP	A	A	C	rs143279922		TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr9:95237030A>C	ENST00000375544.3	-	2	393	c.150T>G	c.(148-150)gaT>gaG	p.D50E	ASPN_ENST00000395538.3_Missense_Mutation_p.D50E|ASPN_ENST00000450139.2_Missense_Mutation_p.D22E|CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_Missense_Mutation_p.D50E	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	50	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						TGTCCtcatcatcatcatcat	0.398																																					p.D50E		Atlas-SNP	.											.	ASPN	52	.	0			c.T150G						.						112.0	102.0	105.0					9																	95237030		2203	4300	6503	SO:0001583	missense	54829	exon2			CTCATCATCATCA	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.150T>G	chr9.hg19:g.95237030A>C	ENSP00000364694:p.Asp50Glu	65.0	0.0		112.0	7.0	NM_001193335	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	hg19		.	.	.	.	.	.	.	.	.	.	A	2.759	-0.258312	0.05791	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.52983	0.64;0.69;0.69	3.41	-5.95	0.02241	.	1.551710	0.03954	N	0.288946	T	0.32645	0.0836	L	0.40543	1.245	0.09310	N	1	B;B	0.32245	0.361;0.001	B;B	0.27380	0.079;0.001	T	0.11941	-1.0567	10	0.22109	T	0.4	.	7.6964	0.28598	0.4608:0.1193:0.4198:0.0	.	50;50	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	E	50;50;50;22	ENSP00000364694:D50E;ENSP00000364693:D50E;ENSP00000378909:D50E	ENSP00000364693:D50E	D	-	3	2	ASPN	94276851	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.911000	0.01583	-2.152000	0.00794	-2.339000	0.00246	GAT	.	.		0.398	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
UBAC1	10422	hgsc.bcm.edu	37	9	138838155	138838155	+	Silent	SNP	C	C	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr9:138838155C>A	ENST00000371756.3	-	5	721	c.504G>T	c.(502-504)gcG>gcT	p.A168A	UBAC1_ENST00000465873.1_5'Flank	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	168					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		CTGGGTTCAGCGCTAACAGCT	0.512																																					p.A168A	NSCLC(78;973 1398 27381 29552 42415)	Atlas-SNP	.											.	UBAC1	40	.	0			c.G504T						.						111.0	101.0	104.0					9																	138838155		2203	4300	6503	SO:0001819	synonymous_variant	10422	exon5			GTTCAGCGCTAAC	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.504G>T	chr9.hg19:g.138838155C>A		83.0	0.0		129.0	53.0	NM_016172	O75500|Q9UMW7	Silent	SNP	ENST00000371756.3	hg19	CCDS35177.1																																																																																			.	.		0.512	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172	
EDRF1	26098	hgsc.bcm.edu	37	10	127451995	127451995	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr10:127451995G>T	ENST00000356792.4	+	25	3903	c.3671G>T	c.(3670-3672)gGc>gTc	p.G1224V	C10orf137_ENST00000337623.3_Missense_Mutation_p.G1190V	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		1224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CACCTGCTGGGCCAGCTTGCC	0.547																																					p.G1224V		Atlas-SNP	.											.	C10orf137	153	.	0			c.G3671T						.						69.0	55.0	60.0					10																	127451995		2203	4300	6503	SO:0001583	missense	26098	exon25			TGCTGGGCCAGCT																												ENST00000356792.4:c.3671G>T	chr10.hg19:g.127451995G>T	ENSP00000349244:p.Gly1224Val	26.0	0.0		46.0	21.0	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	hg19	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757724	0.31137	.	.	ENSG00000107938	ENST00000356792;ENST00000337623	.	.	.	5.13	-1.03	0.10102	.	0.607701	0.16352	N	0.218167	T	0.24736	0.0600	N	0.08118	0	0.33979	D	0.647688	B;B;B	0.30361	0.062;0.277;0.018	B;B;B	0.30943	0.069;0.122;0.043	T	0.23261	-1.0193	9	0.36615	T	0.2	.	10.7402	0.46149	0.6238:0.0:0.3762:0.0	.	1224;571;1190	Q3B7T1;Q5VZQ1;Q3B7T1-5	EDRF1_HUMAN;.;.	V	1224;1190	.	ENSP00000336727:G1190V	G	+	2	0	C10orf137	127441985	0.808000	0.29022	0.916000	0.36221	0.659000	0.38960	1.370000	0.34238	-0.088000	0.12506	-0.251000	0.11542	GGC	.	.		0.547	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
MUC2	4583	hgsc.bcm.edu	37	11	1092885	1092885	+	Silent	SNP	G	G	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr11:1092885G>A	ENST00000441003.2	+	30	4731	c.4704G>A	c.(4702-4704)acG>acA	p.T1568T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.T1569T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCACCACCACGGTGaccccaa	0.637																																					p.T1568T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,+1,2	MUC2	614	.	0			c.G4704A						.						124.0	160.0	148.0					11																	1092885		1964	3666	5630	SO:0001819	synonymous_variant	4583	exon30			CACCACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4704G>A	chr11.hg19:g.1092885G>A		33.0	0.0		49.0	6.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CRY2	1408	hgsc.bcm.edu	37	11	45882443	45882443	+	Missense_Mutation	SNP	G	G	T	rs369560580		TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr11:45882443G>T	ENST00000443527.2	+	4	597	c.575G>T	c.(574-576)cGc>cTc	p.R192L	CRY2_ENST00000473199.1_Intron|CRY2_ENST00000417225.2_Missense_Mutation_p.R110L	NM_021117.3	NP_066940.2	Q49AN0	CRY2_HUMAN	cryptochrome circadian clock 2	171					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|glucose homeostasis (GO:0042593)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of sodium-dependent phosphate transport (GO:2000118)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|FAD binding (GO:0071949)|phosphatase binding (GO:0019902)|single-stranded DNA binding (GO:0003697)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(2)	15						ACATACAAGCGCTTTCAGGCC	0.582																																					p.R192L	Esophageal Squamous(106;91 1499 8126 12599 39610)	Atlas-SNP	.											.	CRY2	61	.	0			c.G575T						.						116.0	110.0	112.0					11																	45882443		2203	4299	6502	SO:0001583	missense	1408	exon4			ACAAGCGCTTTCA	AB014558	CCDS7915.2, CCDS44576.1	11p11.2	2014-01-17	2014-01-17		ENSG00000121671	ENSG00000121671			2385	protein-coding gene	gene with protein product		603732	"""cryptochrome 2 (photolyase-like)"""			8909283	Standard	NM_021117		Approved		uc010rgn.2	Q49AN0	OTTHUMG00000153225	ENST00000443527.2:c.575G>T	chr11.hg19:g.45882443G>T	ENSP00000406751:p.Arg192Leu	66.0	0.0		89.0	39.0	NM_021117	B4DH32|B4DZD6|O75148|Q8IV71	Missense_Mutation	SNP	ENST00000443527.2	hg19	CCDS7915.2	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653622	0.88056	.	.	ENSG00000121671	ENST00000417225;ENST00000443527	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	L	0.52364	1.645	0.80722	D	1	B;B	0.30146	0.27;0.117	B;B	0.35899	0.106;0.213	T	0.55192	-0.8179	9	0.21014	T	0.42	-27.4279	20.5792	0.99380	0.0:0.0:1.0:0.0	.	192;110	B4DZD6;Q49AN0-2	.;.	L	110;192	.	ENSP00000397419:R110L	R	+	2	0	CRY2	45839019	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.873000	0.98535	0.561000	0.74099	CGC	.	.		0.582	CRY2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330235.2	NM_021117	
C11orf80	79703	hgsc.bcm.edu	37	11	66563768	66563768	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr11:66563768G>A	ENST00000360962.4	+	6	657	c.650G>A	c.(649-651)aGa>aAa	p.R217K	C11orf80_ENST00000346672.4_Missense_Mutation_p.R62K|C11orf80_ENST00000532565.2_5'UTR|C11orf80_ENST00000540737.1_Missense_Mutation_p.R51K|C11orf80_ENST00000527368.1_3'UTR|C11orf80_ENST00000525449.2_Missense_Mutation_p.R62K|C11orf80_ENST00000527634.1_5'UTR	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	217										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						GAAAAGCCCAGAACCTTGATG	0.348																																					p.R217K		Atlas-SNP	.											.	C11orf80	31	.	0			c.G650A						.						120.0	112.0	115.0					11																	66563768		1847	4089	5936	SO:0001583	missense	79703	exon6			AGCCCAGAACCTT			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.650G>A	chr11.hg19:g.66563768G>A	ENSP00000354227:p.Arg217Lys	137.0	0.0		195.0	82.0	NM_024650	Q9H677	Missense_Mutation	SNP	ENST00000360962.4	hg19	CCDS53664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.43|14.43	2.534340|2.534340	0.45073|0.45073	.|.	.|.	ENSG00000173715|ENSG00000173715	ENST00000532089|ENST00000525908;ENST00000360962;ENST00000346672;ENST00000528340;ENST00000540737;ENST00000525449	.|T;T	.|0.33865	.|1.39;1.39	5.48|5.48	2.17|2.17	0.27698|0.27698	.|.	.|0.338753	.|0.25566	.|N	.|0.029800	T|T	0.27629|0.27629	0.0679|0.0679	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999991|0.999991	.|P	.|0.46912	.|0.886	.|B	.|0.44278	.|0.445	T|T	0.08889|0.08889	-1.0700|-1.0700	5|10	.|0.56958	.|D	.|0.05	-6.0338|-6.0338	8.8409|8.8409	0.35142|0.35142	0.088:0.3007:0.6113:0.0|0.088:0.3007:0.6113:0.0	.|.	.|51	.|E9PKZ8	.|.	K|K	43|168;217;62;51;51;62	.|ENSP00000432039:R168K;ENSP00000354227:R217K	.|ENSP00000317408:R62K	E|R	+|+	1|2	0|0	C11orf80|C11orf80	66320344|66320344	0.002000|0.002000	0.14202|0.14202	0.815000|0.815000	0.32552|0.32552	0.758000|0.758000	0.43043|0.43043	0.240000|0.240000	0.18042|0.18042	0.620000|0.620000	0.30215|0.30215	0.650000|0.650000	0.86243|0.86243	GAA|AGA	.	.		0.348	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
ENDOD1	23052	hgsc.bcm.edu	37	11	94823356	94823356	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr11:94823356G>T	ENST00000278505.4	+	1	383	c.265G>T	c.(265-267)Ggc>Tgc	p.G89C		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	89						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				ccctgcgcccggcggcgccgA	0.746																																					p.G89C		Atlas-SNP	.											.	ENDOD1	26	.	0			c.G265T						.						2.0	3.0	3.0					11																	94823356		1503	3353	4856	SO:0001583	missense	23052	exon1			GCGCCCGGCGGCG	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.265G>T	chr11.hg19:g.94823356G>T	ENSP00000278505:p.Gly89Cys	55.0	0.0		93.0	36.0	NM_015036	A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	hg19	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	G	8.532	0.871215	0.17322	.	.	ENSG00000149218	ENST00000278505	T	0.68025	-0.3	4.45	0.566	0.17317	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.758048	0.11438	N	0.564087	T	0.56187	0.1968	M	0.61703	1.905	0.09310	N	1	B	0.28760	0.221	B	0.24848	0.056	T	0.53486	-0.8432	10	0.66056	D	0.02	-11.7638	2.2712	0.04091	0.1901:0.5049:0.1498:0.1552	.	89	O94919	ENDD1_HUMAN	C	89	ENSP00000278505:G89C	ENSP00000278505:G89C	G	+	1	0	ENDOD1	94463004	0.000000	0.05858	0.001000	0.08648	0.108000	0.19459	0.483000	0.22292	0.212000	0.20703	0.650000	0.86243	GGC	.	.		0.746	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
CCDC168	643677	hgsc.bcm.edu	37	13	103382043	103382043	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr13:103382043C>T	ENST00000322527.2	-	1	7116	c.7117G>A	c.(7117-7119)Gat>Aat	p.D2373N		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2373																	AAGTTGATATCGTCATGATGA	0.403																																					p.D7002N		Atlas-SNP	.											.	.	.	.	0			c.G21004A						.						92.0	97.0	95.0					13																	103382043		692	1591	2283	SO:0001583	missense	643677	exon4			TGATATCGTCATG		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7117G>A	chr13.hg19:g.103382043C>T	ENSP00000320232:p.Asp2373Asn	199.0	0.0		249.0	117.0	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	hg19		.	.	.	.	.	.	.	.	.	.	C	8.274	0.814089	0.16537	.	.	ENSG00000175820	ENST00000322527	T	0.04083	3.71	4.93	-1.47	0.08772	.	1.764990	0.03678	N	0.245035	T	0.03959	0.0111	L	0.32530	0.975	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.43426	-0.9392	10	0.11485	T	0.65	-0.0765	4.9311	0.13917	0.1508:0.4022:0.0:0.447	.	2373	Q8NDH2	CC168_HUMAN	N	2373	ENSP00000320232:D2373N	ENSP00000320232:D2373N	D	-	1	0	CCDC168	102180044	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.038000	0.12144	-0.310000	0.08766	-0.742000	0.03525	GAT	.	.		0.403	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
HECTD1	25831	hgsc.bcm.edu	37	14	31642418	31642418	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr14:31642418A>G	ENST00000399332.1	-	6	1588	c.1100T>C	c.(1099-1101)aTa>aCa	p.I367T	HECTD1_ENST00000553700.1_Missense_Mutation_p.I367T	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	367					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AATACAATCTATAAGCTGCCG	0.403																																					p.I367T		Atlas-SNP	.											.	HECTD1	159	.	0			c.T1100C						.						98.0	92.0	94.0					14																	31642418		1860	4109	5969	SO:0001583	missense	25831	exon6			CAATCTATAAGCT	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1100T>C	chr14.hg19:g.31642418A>G	ENSP00000382269:p.Ile367Thr	169.0	0.0		207.0	76.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527963	0.85706	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	T;T;T	0.34472	1.36;1.36;1.36	6.07	6.07	0.98685	Ankyrin repeat-containing domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55800	0.1943	L	0.60455	1.87	0.80722	D	1	P	0.50156	0.932	P	0.61397	0.888	T	0.56780	-0.7922	10	0.87932	D	0	-22.5587	16.635	0.85050	1.0:0.0:0.0:0.0	.	367	Q9ULT8	HECD1_HUMAN	T	367	ENSP00000450697:I367T;ENSP00000382269:I367T;ENSP00000452015:I367T	ENSP00000261312:I367T	I	-	2	0	HECTD1	30712169	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.307000	0.96226	2.330000	0.79161	0.477000	0.44152	ATA	.	.		0.403	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
ABHD12B	145447	hgsc.bcm.edu	37	14	51352570	51352570	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr14:51352570G>A	ENST00000337334.2	+	7	634	c.619G>A	c.(619-621)Ggc>Agc	p.G207S	PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000395752.1_Missense_Mutation_p.G100S|ABHD12B_ENST00000353130.1_Missense_Mutation_p.G130S|ABHD12B_ENST00000554241.1_3'UTR	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B	207							hydrolase activity (GO:0016787)	p.G207R(1)|p.G130R(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					GGCAAGAAGTGGCATCACTCC	0.522																																					p.G207S		Atlas-SNP	.											ABHD12B,NS,carcinoma,0,1	ABHD12B	53	.	2	Substitution - Missense(2)	lung(2)	c.G619A						.						196.0	178.0	184.0					14																	51352570		2203	4300	6503	SO:0001583	missense	145447	exon7			AGAAGTGGCATCA	BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.619G>A	chr14.hg19:g.51352570G>A	ENSP00000336693:p.Gly207Ser	124.0	0.0		162.0	66.0	NM_001206673	Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Missense_Mutation	SNP	ENST00000337334.2	hg19	CCDS55916.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278002	0.80692	.	.	ENSG00000131969	ENST00000353130;ENST00000337334;ENST00000395752	T;T;T	0.64260	-0.09;0.85;-0.09	5.76	5.76	0.90799	.	0.104019	0.64402	D	0.000002	T	0.63200	0.2491	M	0.66506	2.035	0.58432	D	0.999993	B;B	0.27068	0.149;0.167	B;B	0.35607	0.206;0.138	T	0.60393	-0.7272	10	0.39692	T	0.17	-17.8351	11.1522	0.48466	0.0837:0.0:0.9163:0.0	.	207;130	Q7Z5M8;Q7Z5M8-2	AB12B_HUMAN;.	S	130;207;100	ENSP00000343951:G130S;ENSP00000336693:G207S;ENSP00000379101:G100S	ENSP00000336693:G207S	G	+	1	0	ABHD12B	50422320	1.000000	0.71417	0.999000	0.59377	0.601000	0.36947	3.010000	0.49559	2.890000	0.99128	0.655000	0.94253	GGC	.	.		0.522	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411030.1		
WDR25	79446	hgsc.bcm.edu	37	14	100995511	100995511	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr14:100995511G>A	ENST00000335290.6	+	6	1605	c.1379G>A	c.(1378-1380)cGg>cAg	p.R460Q	WDR25_ENST00000402312.3_Missense_Mutation_p.R460Q|WDR25_ENST00000554998.1_Missense_Mutation_p.R460Q|WDR25_ENST00000542471.2_Missense_Mutation_p.R203Q|WDR25_ENST00000557502.1_3'UTR	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	460										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				TGGCCCTACCGGATGAGCAGA	0.627																																					p.R460Q		Atlas-SNP	.											.	WDR25	37	.	0			c.G1379A						.						86.0	65.0	72.0					14																	100995511		2203	4300	6503	SO:0001583	missense	79446	exon6			CCTACCGGATGAG	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.1379G>A	chr14.hg19:g.100995511G>A	ENSP00000334148:p.Arg460Gln	90.0	0.0		89.0	36.0	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	hg19	CCDS32157.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.986745|3.986745	0.74589|0.74589	.|.	.|.	ENSG00000176473|ENSG00000176473	ENST00000555201|ENST00000554998;ENST00000402312;ENST00000335290;ENST00000542471	.|T;T;T;T	.|0.01287	.|5.05;5.05;5.05;5.05	3.64|3.64	2.73|2.73	0.32206|0.32206	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.245106	.|0.30630	.|U	.|0.009202	T|T	0.01320|0.01320	0.0043|0.0043	L|L	0.31065|0.31065	0.9|0.9	0.37246|0.37246	D|D	0.906361|0.906361	.|P;B	.|0.50272	.|0.933;0.27	.|B;B	.|0.42087	.|0.375;0.01	T|T	0.67941|0.67941	-0.5540|-0.5540	5|10	.|0.41790	.|T	.|0.15	.|.	7.1378|7.1378	0.25537|0.25537	0.217:0.0:0.783:0.0|0.217:0.0:0.783:0.0	.|.	.|203;460	.|Q64LD2-2;Q64LD2	.|.;WDR25_HUMAN	R|Q	68|460;460;460;203	.|ENSP00000450661:R460Q;ENSP00000385540:R460Q;ENSP00000334148:R460Q;ENSP00000441903:R203Q	.|ENSP00000334148:R460Q	G|R	+|+	1|2	0|0	WDR25|WDR25	100065264|100065264	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	4.116000|4.116000	0.57871|0.57871	2.033000|2.033000	0.60031|0.60031	0.563000|0.563000	0.77884|0.77884	GGA|CGG	.	.		0.627	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
CYFIP1	23191	hgsc.bcm.edu	37	15	22960851	22960851	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr15:22960851T>A	ENST00000313077.7	+	18	2169	c.2044T>A	c.(2044-2046)Ttc>Atc	p.F682I	CYFIP1_ENST00000435939.2_Missense_Mutation_p.F251I|CYFIP1_ENST00000560848.1_Missense_Mutation_p.F682I	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCTCACCAGGTTCAACAAGCA	0.527																																					p.F682I		Atlas-SNP	.											.	CYFIP1	159	.	0			c.T2044A						.						86.0	71.0	76.0					15																	22960851		2203	4300	6503	SO:0001583	missense	23191	exon18			ACCAGGTTCAACA	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2044T>A	chr15.hg19:g.22960851T>A	ENSP00000324549:p.Phe682Ile	67.0	0.0		87.0	32.0	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	hg19	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	T	36	5.703608	0.96812	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.26957	1.7;1.7	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000001	T	0.56819	0.2011	M	0.87038	2.855	0.80722	D	1	D;D;P	0.76494	0.994;0.999;0.744	D;D;P	0.75020	0.985;0.962;0.482	T	0.64635	-0.6361	10	0.66056	D	0.02	-35.2083	15.887	0.79258	0.0:0.0:0.0:1.0	.	710;251;682	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	I	682;710;251	ENSP00000324549:F682I;ENSP00000405956:F251I	ENSP00000324549:F682I	F	+	1	0	CYFIP1	20512292	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.862000	0.87013	2.208000	0.71279	0.533000	0.62120	TTC	.	.		0.527	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
ABCC6	368	hgsc.bcm.edu	37	16	16244619	16244619	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr16:16244619T>C	ENST00000205557.7	-	30	4248	c.4219A>G	c.(4219-4221)Aaa>Gaa	p.K1407E		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1407	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	AGGAGCTGTTTCTGGCCCACG	0.597																																					p.K1407E		Atlas-SNP	.											.	ABCC6	110	.	0			c.A4219G						.						36.0	32.0	33.0					16																	16244619		2197	4300	6497	SO:0001583	missense	368	exon30			GCTGTTTCTGGCC	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4219A>G	chr16.hg19:g.16244619T>C	ENSP00000205557:p.Lys1407Glu	169.0	0.0		134.0	109.0	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	hg19	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.666544	0.67814	.	.	ENSG00000091262	ENST00000205557;ENST00000205558	D	0.94723	-3.5	4.36	4.36	0.52297	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.45361	U	0.000364	D	0.96907	0.8990	M	0.86502	2.82	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70487	0.969;0.969	D	0.97034	0.9752	10	0.87932	D	0	.	9.7455	0.40444	0.0:0.0:0.3183:0.6817	.	1407;1407	O95255;A8Y988	MRP6_HUMAN;.	E	1407;345	ENSP00000205557:K1407E	ENSP00000205557:K1407E	K	-	1	0	ABCC6	16152120	0.927000	0.31430	1.000000	0.80357	0.884000	0.51177	0.904000	0.28491	1.750000	0.51863	0.448000	0.29417	AAA	.	.		0.597	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
MED1	5469	hgsc.bcm.edu	37	17	37566444	37566444	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr17:37566444C>T	ENST00000300651.6	-	17	2253	c.2030G>A	c.(2029-2031)cGc>cAc	p.R677H	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TATTTCCATGCGGGGTGAGCC	0.463										HNSCC(31;0.082)																											p.R677H	Pancreas(21;279 768 2492 4877 24026)	Atlas-SNP	.											MED1,colon,carcinoma,0,2	MED1	123	.	0			c.G2030A						.						92.0	96.0	94.0					17																	37566444		2203	4300	6503	SO:0001583	missense	5469	exon17			TCCATGCGGGGTG	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2030G>A	chr17.hg19:g.37566444C>T	ENSP00000300651:p.Arg677His	75.0	0.0		132.0	62.0	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	hg19	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311544	0.60414	.	.	ENSG00000125686	ENST00000300651	T	0.55930	0.49	5.59	5.59	0.84812	.	.	.	.	.	T	0.61590	0.2359	L	0.27053	0.805	0.54753	D	0.999985	D	0.76494	0.999	D	0.64506	0.926	T	0.63620	-0.6596	9	0.56958	D	0.05	-6.1628	19.593	0.95523	0.0:1.0:0.0:0.0	.	677	Q15648	MED1_HUMAN	H	677	ENSP00000300651:R677H	ENSP00000300651:R677H	R	-	2	0	MED1	34819970	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.956000	0.63645	2.629000	0.89072	0.561000	0.74099	CGC	.	.		0.463	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774	
RNF213	57674	hgsc.bcm.edu	37	17	78327346	78327346	+	Silent	SNP	G	G	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr17:78327346G>A	ENST00000582970.1	+	34	10601	c.10458G>A	c.(10456-10458)gaG>gaA	p.E3486E	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Silent_p.E1559E|RNF213_ENST00000508628.2_Silent_p.E3535E	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3486					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACGGCCATGAGGAGGCGATGG	0.597																																					p.E3486E		Atlas-SNP	.											.	RNF213	766	.	0			c.G10458A						.						78.0	65.0	70.0					17																	78327346		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon34			CCATGAGGAGGCG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10458G>A	chr17.hg19:g.78327346G>A		159.0	0.0		165.0	67.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	hg19	CCDS58606.1																																																																																			.	.		0.597	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
PAK4	10298	hgsc.bcm.edu	37	19	39668341	39668341	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr19:39668341G>T	ENST00000593690.1	+	10	1939	c.1512G>T	c.(1510-1512)atG>atT	p.M504I	PAK4_ENST00000599470.1_Missense_Mutation_p.M351I|PAK4_ENST00000360442.3_Missense_Mutation_p.M504I|PAK4_ENST00000358301.3_Missense_Mutation_p.M504I|PAK4_ENST00000321944.4_Missense_Mutation_p.M414I|PAK4_ENST00000599386.1_Missense_Mutation_p.M351I|PAK4_ENST00000435673.2_Missense_Mutation_p.M504I	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	504	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			TGGGGATAATGGTGATTGAGA	0.612																																					p.M504I		Atlas-SNP	.											.	PAK4	40	.	0			c.G1512T						.						145.0	117.0	127.0					19																	39668341		2203	4300	6503	SO:0001583	missense	10298	exon8			GATAATGGTGATT	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.1512G>T	chr19.hg19:g.39668341G>T	ENSP00000469413:p.Met504Ile	156.0	0.0		215.0	72.0	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	ENST00000593690.1	hg19	CCDS12528.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812824	0.90707	.	.	ENSG00000130669	ENST00000358301;ENST00000321944;ENST00000358801;ENST00000542377;ENST00000435673;ENST00000360442	T;T;T	0.59906	0.23;0.23;0.23	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53417	0.1795	N	0.02708	-0.52	0.80722	D	1	P;D;D	0.60160	0.935;0.987;0.982	D;P;D	0.66979	0.926;0.891;0.948	T	0.67960	-0.5535	10	0.87932	D	0	.	15.9831	0.80127	0.0:0.0:1.0:0.0	.	414;351;504	O96013-4;O96013-3;O96013	.;.;PAK4_HUMAN	I	504;351;308;260;504;504	ENSP00000351049:M504I;ENSP00000392753:M504I;ENSP00000353625:M504I	ENSP00000326864:M351I	M	+	3	0	PAK4	44360181	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	9.578000	0.98200	2.629000	0.89072	0.555000	0.69702	ATG	.	.		0.612	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
ZNF222	7673	hgsc.bcm.edu	37	19	44535978	44535978	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr19:44535978A>T	ENST00000187879.8	+	4	313	c.151A>T	c.(151-153)Atc>Ttc	p.I51F	ZNF222_ENST00000391960.3_Missense_Mutation_p.I91F|ZNF223_ENST00000591793.1_Intron	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				AGGAGGCAAGATCCAAACTGA	0.488																																					p.I91F		Atlas-SNP	.											.	ZNF222	90	.	0			c.A271T						.						75.0	72.0	73.0					19																	44535978		2203	4300	6503	SO:0001583	missense	7673	exon4			GGCAAGATCCAAA	AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.151A>T	chr19.hg19:g.44535978A>T	ENSP00000187879:p.Ile51Phe	220.0	0.0		360.0	104.0	NM_001129996	G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	ENST00000187879.8	hg19	CCDS33045.1	.	.	.	.	.	.	.	.	.	.	A	9.200	1.028126	0.19512	.	.	ENSG00000159885	ENST00000391960;ENST00000187879	T;T	0.05925	3.37;5.64	2.14	-0.166	0.13351	Krueppel-associated box (3);	.	.	.	.	T	0.05044	0.0135	N	0.08118	0	0.09310	N	1	D;D	0.63880	0.987;0.993	P;P	0.59221	0.854;0.791	T	0.27502	-1.0072	9	0.11182	T	0.66	.	2.8703	0.05615	0.4398:0.2504:0.3098:0.0	.	91;51	G5E9B9;Q9UK12	.;ZN222_HUMAN	F	91;51	ENSP00000375822:I91F;ENSP00000187879:I51F	ENSP00000187879:I51F	I	+	1	0	ZNF222	49227818	0.000000	0.05858	0.000000	0.03702	0.740000	0.42216	0.738000	0.26158	-0.127000	0.11661	0.172000	0.16884	ATC	.	.		0.488	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2		
CFAP61	26074	hgsc.bcm.edu	37	20	20340921	20340921	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr20:20340921A>G	ENST00000245957.5	+	27	3657	c.3581A>G	c.(3580-3582)gAg>gGg	p.E1194G	C20orf26_ENST00000377309.2_3'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1194										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		AACCCGACTGAGAAGCCCAGG	0.448											OREG0025807	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1194G		Atlas-SNP	.											.	C20orf26	188	.	0			c.A3581G						.						156.0	162.0	160.0					20																	20340921		2203	4300	6503	SO:0001583	missense	26074	exon27			CGACTGAGAAGCC																												ENST00000245957.5:c.3581A>G	chr20.hg19:g.20340921A>G	ENSP00000245957:p.Glu1194Gly	146.0	0.0	740	195.0	77.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	hg19	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	a	14.15	2.450779	0.43531	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.12039	2.72	5.12	4.03	0.46877	.	0.138345	0.32868	N	0.005542	T	0.15046	0.0363	L	0.59436	1.845	0.80722	D	1	B	0.13594	0.008	B	0.14578	0.011	T	0.02646	-1.1129	10	0.51188	T	0.08	.	10.0311	0.42101	0.9184:0.0:0.0816:0.0	.	1194	Q8NHU2	CT026_HUMAN	G	1134;1160;1194	ENSP00000245957:E1194G	ENSP00000245957:E1194G	E	+	2	0	C20orf26	20288921	1.000000	0.71417	0.935000	0.37517	0.028000	0.11728	3.356000	0.52269	0.911000	0.36747	0.451000	0.29950	GAG	.	.		0.448	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
SOGA1	140710	hgsc.bcm.edu	37	20	35443555	35443555	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr20:35443555C>T	ENST00000357779.3	-	5	1902	c.1576G>A	c.(1576-1578)Gca>Aca	p.A526T	SOGA1_ENST00000456801.2_Missense_Mutation_p.A367T|SOGA1_ENST00000237536.4_Missense_Mutation_p.A764T|SOGA1_ENST00000279034.6_Missense_Mutation_p.A526T			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	526					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						AGGTCTTTTGCCAGAAGAATC	0.478																																					p.A764T		Atlas-SNP	.											.	SOGA1	136	.	0			c.G2290A						.						100.0	106.0	104.0					20																	35443555		1950	4147	6097	SO:0001583	missense	140710	exon5			CTTTTGCCAGAAG	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1576G>A	chr20.hg19:g.35443555C>T	ENSP00000350424:p.Ala526Thr	94.0	0.0		146.0	68.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	hg19		.	.	.	.	.	.	.	.	.	.	C	13.16	2.155308	0.38021	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.07	3.07	0.35406	.	0.727131	0.13028	N	0.419568	T	0.26774	0.0655	N	0.22421	0.69	0.24024	N	0.996135	B	0.31949	0.348	B	0.32980	0.156	T	0.17561	-1.0365	10	0.21540	T	0.41	-15.2489	7.49	0.27456	0.1714:0.7398:0.0:0.0887	.	526	O94964-4	.	T	764;526;367;526	ENSP00000237536:A764T;ENSP00000279034:A526T;ENSP00000413886:A367T;ENSP00000350424:A526T	ENSP00000237536:A764T	A	-	1	0	KIAA0889	34876969	0.965000	0.33210	1.000000	0.80357	0.685000	0.39939	1.152000	0.31663	0.670000	0.31165	0.462000	0.41574	GCA	.	.		0.478	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
TIAM1	7074	hgsc.bcm.edu	37	21	32492952	32492952	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr21:32492952T>C	ENST00000286827.3	-	29	4981	c.4510A>G	c.(4510-4512)Atc>Gtc	p.I1504V	TIAM1_ENST00000541036.1_Missense_Mutation_p.I1444V	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1504					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TCACTGAGGATGTCTGTCTCC	0.577																																					p.I1504V		Atlas-SNP	.											.	TIAM1	522	.	0			c.A4510G						.						128.0	104.0	112.0					21																	32492952		2203	4300	6503	SO:0001583	missense	7074	exon29			TGAGGATGTCTGT		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4510A>G	chr21.hg19:g.32492952T>C	ENSP00000286827:p.Ile1504Val	57.0	0.0		78.0	34.0	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	hg19	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.400062	0.83120	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.60548	0.18;0.27	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.72145	0.3424	L	0.58101	1.795	0.58432	D	0.999992	D;D	0.67145	0.996;0.994	D;D	0.77557	0.99;0.978	T	0.74630	-0.3601	10	0.59425	D	0.04	.	14.9878	0.71362	0.0:0.0:0.0:1.0	.	1444;1504	F5GZ53;Q13009	.;TIAM1_HUMAN	V	1504;1444	ENSP00000286827:I1504V;ENSP00000441570:I1444V	ENSP00000286827:I1504V	I	-	1	0	TIAM1	31414823	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.586000	0.82596	1.927000	0.55829	0.533000	0.62120	ATC	.	.		0.577	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
MAPK1	5594	hgsc.bcm.edu	37	22	22160239	22160239	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr22:22160239T>C	ENST00000215832.6	-	3	580	c.392A>G	c.(391-393)tAc>tGc	p.Y131C	MAPK1_ENST00000544786.1_Missense_Mutation_p.Y131C|MAPK1_ENST00000398822.3_Missense_Mutation_p.Y131C	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	131	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	GAGGATCTGGTAGAGAAAATA	0.438																																					p.Y131C		Atlas-SNP	.											.	MAPK1	38	.	0			c.A392G						.						207.0	193.0	198.0					22																	22160239		2203	4300	6503	SO:0001583	missense	5594	exon3			ATCTGGTAGAGAA	M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.392A>G	chr22.hg19:g.22160239T>C	ENSP00000215832:p.Tyr131Cys	124.0	0.0		174.0	69.0	NM_002745	A8CZ64	Missense_Mutation	SNP	ENST00000215832.6	hg19	CCDS13795.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419991	0.83559	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.47528	0.84;0.84;0.84	4.77	4.77	0.60923	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62060	0.2397	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65656	-0.6115	10	0.87932	D	0	0.523	14.7475	0.69499	0.0:0.0:0.0:1.0	.	131;131	A8CZ64;P28482	.;MK01_HUMAN	C	131;119;131;131	ENSP00000215832:Y131C;ENSP00000381803:Y131C;ENSP00000440842:Y131C	ENSP00000215832:Y131C	Y	-	2	0	MAPK1	20490239	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.778000	0.85637	2.131000	0.65755	0.528000	0.53228	TAC	.	.		0.438	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2		
NEFH	4744	hgsc.bcm.edu	37	22	29885876	29885876	+	Silent	SNP	G	G	A	rs59890097|rs532587474	byFrequency	TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr22:29885876G>A	ENST00000310624.6	+	4	2280	c.2247G>A	c.(2245-2247)aaG>aaA	p.K749K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	755	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCCCAGAGAAGGCCAAGTCCC	0.552																																					p.K749K		Atlas-SNP	.											.	NEFH	178	.	0			c.G2247A						.						99.0	98.0	99.0					22																	29885876		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			AGAGAAGGCCAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2247G>A	chr22.hg19:g.29885876G>A		6.0	0.0		141.0	18.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TTLL1	25809	hgsc.bcm.edu	37	22	43464505	43464505	+	Silent	SNP	C	C	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr22:43464505C>T	ENST00000266254.7	-	5	654	c.414G>A	c.(412-414)aaG>aaA	p.K138K	TTLL1_ENST00000331018.7_Silent_p.K138K	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	138	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TGCCACAAGGCTTCATGATCC	0.527																																					p.K138K		Atlas-SNP	.											.	TTLL1	41	.	0			c.G414A						.						196.0	192.0	193.0					22																	43464505		2203	4300	6503	SO:0001819	synonymous_variant	25809	exon5			ACAAGGCTTCATG	AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.414G>A	chr22.hg19:g.43464505C>T		118.0	0.0		117.0	35.0	NM_012263	B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Silent	SNP	ENST00000266254.7	hg19	CCDS14043.1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.310605	0.23821	.	.	ENSG00000100271	ENST00000495814	.	.	.	5.54	0.973	0.19710	.	.	.	.	.	T	0.61464	0.2349	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58075	-0.7700	4	.	.	.	.	12.5566	0.56257	0.0:0.7525:0.0:0.2475	.	.	.	.	N	64	.	.	S	-	2	0	TTLL1	41794449	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.042000	0.30303	0.201000	0.20466	0.655000	0.94253	AGC	.	.		0.527	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319659.1	NM_012263	
MAGEB4	4115	hgsc.bcm.edu	37	X	30261048	30261048	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chrX:30261048C>A	ENST00000378982.2	+	1	992	c.796C>A	c.(796-798)Cca>Aca	p.P266T	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	266	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CAGTGATCCCCCACGCTATCA	0.493																																					p.P266T		Atlas-SNP	.											.	MAGEB4	75	.	0			c.C796A						.						69.0	66.0	67.0					X																	30261048		2202	4300	6502	SO:0001583	missense	4115	exon1			GATCCCCCACGCT		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.796C>A	chrX.hg19:g.30261048C>A	ENSP00000368266:p.Pro266Thr	117.0	0.0		158.0	135.0	NM_002367	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	hg19	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742817	0.30865	.	.	ENSG00000120289	ENST00000378982	T	0.04706	3.57	3.22	1.38	0.22167	.	0.659026	0.12938	U	0.426810	T	0.19846	0.0477	M	0.88031	2.925	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.08911	-1.0699	10	0.72032	D	0.01	.	3.321	0.07050	0.2543:0.6002:0.0:0.1454	.	266	O15481	MAGB4_HUMAN	T	266	ENSP00000368266:P266T	ENSP00000368266:P266T	P	+	1	0	MAGEB4	30170969	0.008000	0.16893	0.002000	0.10522	0.009000	0.06853	0.225000	0.17757	0.234000	0.21139	-0.192000	0.12808	CCA	.	.		0.493	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
NLGN1	22871	hgsc.bcm.edu	37	3	173996654	173996654	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr3:173996654delT	ENST00000457714.1	+	6	1292	c.863delT	c.(862-864)cttfs	p.L288fs	NLGN1_ENST00000361589.4_Frame_Shift_Del_p.L288fs|NLGN1_ENST00000401917.3_Frame_Shift_Del_p.L328fs|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Frame_Shift_Del_p.L288fs	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	305					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CCCATAGGACTTTTTCAACGA	0.363																																					p.L288fs		Atlas-INDEL	.											.	NLGN1	209	.	0			c.862delC						.						43.0	45.0	44.0					3																	173996654		2200	4299	6499	SO:0001589	frameshift_variant	22871	exon6			.	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.863delT	chr3.hg19:g.173996654delT	ENSP00000392500:p.Leu288fs	40.0	0.0		54.0	17.0	NM_014932	Q9UPT2	Frame_Shift_Del	DEL	ENST00000457714.1	hg19	CCDS3222.1																																																																																			.	.		0.363	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
ATP10B	23120	hgsc.bcm.edu	37	5	160047635	160047644	+	Frame_Shift_Del	DEL	CTGGCCAGGT	CTGGCCAGGT	-	rs535143119		TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	CTGGCCAGGT	CTGGCCAGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr5:160047635_160047644delCTGGCCAGGT	ENST00000327245.5	-	15	2972_2981	c.2126_2135delACCTGGCCAG	c.(2125-2136)gacctggccaggfs	p.DLAR709fs	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	709					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R712G(1)|p.A711A(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAACTCAGGCCTGGCCAGGTCTGTGGCTGG	0.629																																					p.709_712del		Atlas-INDEL	.											.	ATP10B	201	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|ovary(1)	c.2127_2136del						.																																			SO:0001589	frameshift_variant	23120	exon15			.	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2126_2135delACCTGGCCAG	chr5.hg19:g.160047635_160047644delCTGGCCAGGT	ENSP00000313600:p.Asp709fs	63.0	0.0		97.0	39.0	NM_025153	Q9H725	Frame_Shift_Del	DEL	ENST00000327245.5	hg19	CCDS43394.1																																																																																			.	.		0.629	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
ZNF227	7770	hgsc.bcm.edu	37	19	44739013	44739014	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr19:44739013_44739014insT	ENST00000313040.7	+	6	635_636	c.430_431insT	c.(430-432)attfs	p.I144fs	ZNF227_ENST00000589005.1_Frame_Shift_Ins_p.I93fs|ZNF227_ENST00000391961.2_Frame_Shift_Ins_p.I93fs	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				AGGTGACTCTATTCAGGTTTCT	0.386																																					p.I144fs		Atlas-INDEL	.											.	ZNF227	62	.	0			c.430_431insT						.																																			SO:0001589	frameshift_variant	7770	exon6			.	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.432dupT	chr19.hg19:g.44739015_44739015dupT	ENSP00000321049:p.Ile144fs	397.0	0.0		733.0	196.0	NM_182490	B3KRU7|B7Z5P9	Frame_Shift_Ins	INS	ENST00000313040.7	hg19	CCDS12636.1																																																																																			.	.		0.386	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
PTDSS1	9791	hgsc.bcm.edu	37	8	97332514	97332514	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACW-01A-11D-A40R-10	TCGA-DD-AACW-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	990f7ea9-6799-410e-b224-27e27a625fb7	5dcdade5-76ff-4909-8133-c9f73a19baf7	g.chr8:97332514delG	ENST00000517309.1	+	10	1440	c.1114delG	c.(1114-1116)ggafs	p.G372fs	PTDSS1_ENST00000455950.2_Frame_Shift_Del_p.G226fs|PTDSS1_ENST00000522072.1_Frame_Shift_Del_p.G169fs	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	372					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CATAAAATTTGGACAAGATCT	0.388																																					p.F371fs		Atlas-INDEL	.											.	PTDSS1	70	.	0			c.1113delT						.						260.0	243.0	249.0					8																	97332514		2203	4300	6503	SO:0001589	frameshift_variant	9791	exon10			.	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1114delG	chr8.hg19:g.97332514delG	ENSP00000430548:p.Gly372fs	144.0	0.0		163.0	67.0	NM_014754	E5RFC5|Q9BUQ5	Frame_Shift_Del	DEL	ENST00000517309.1	hg19	CCDS6271.1																																																																																			.	.		0.388	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2		
