#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MASP2	10747	hgsc.bcm.edu	37	1	11087077	11087077	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:11087077A>C	ENST00000400897.3	-	11	1941	c.1926T>G	c.(1924-1926)agT>agG	p.S642R	RP4-635E18.8_ENST00000607145.1_RNA	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	642	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		TCTCTGTTTCACTATCTAGAA	0.488																																					p.S642R	GBM(35;611 746 20780 22741 36496)	Atlas-SNP	.											.	MASP2	71	.	0			c.T1926G						.						194.0	188.0	190.0					1																	11087077		2203	4300	6503	SO:0001583	missense	10747	exon11			TGTTTCACTATCT	X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.1926T>G	chr1.hg19:g.11087077A>C	ENSP00000383690:p.Ser642Arg	196.0	0.0		105.0	94.0	NM_006610	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	ENST00000400897.3	hg19	CCDS123.1	.	.	.	.	.	.	.	.	.	.	A	0.918	-0.716889	0.03206	.	.	ENSG00000009724	ENST00000400897	D	0.88277	-2.36	5.11	-3.3	0.05003	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.827292	0.10853	N	0.626999	T	0.70072	0.3182	N	0.12502	0.225	0.21933	N	0.999464	B	0.06786	0.001	B	0.11329	0.006	T	0.57791	-0.7750	10	0.12103	T	0.63	.	1.801	0.03071	0.309:0.1146:0.3538:0.2226	.	642	O00187	MASP2_HUMAN	R	642	ENSP00000383690:S642R	ENSP00000383690:S642R	S	-	3	2	MASP2	11009664	0.000000	0.05858	0.001000	0.08648	0.203000	0.24098	-1.615000	0.02055	-0.528000	0.06366	0.460000	0.39030	AGT	.	.		0.488	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610	
RAVER2	55225	hgsc.bcm.edu	37	1	65243500	65243500	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:65243500T>A	ENST00000294428.3	+	3	589	c.511T>A	c.(511-513)Tgt>Agt	p.C171S	RAVER2_ENST00000430964.2_5'Flank|RAVER2_ENST00000371072.4_Missense_Mutation_p.C171S			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	171	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TATTGAGAGATGTTTTCTGGT	0.393																																					p.C171S		Atlas-SNP	.											.	RAVER2	56	.	0			c.T511A						.						234.0	212.0	219.0					1																	65243500		1877	4109	5986	SO:0001583	missense	55225	exon3			GAGAGATGTTTTC	AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.511T>A	chr1.hg19:g.65243500T>A	ENSP00000294428:p.Cys171Ser	109.0	0.0		116.0	40.0	NM_018211	Q6P141|Q9NPV7	Missense_Mutation	SNP	ENST00000294428.3	hg19		.	.	.	.	.	.	.	.	.	.	T	19.48	3.836107	0.71373	.	.	ENSG00000162437	ENST00000371072;ENST00000294428	T;T	0.15834	2.39;2.39	5.41	5.41	0.78517	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.055297	0.85682	D	0.000000	T	0.23094	0.0558	L	0.52266	1.64	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.81914	0.995;0.977	T	0.01557	-1.1325	10	0.49607	T	0.09	-37.1727	10.6242	0.45497	0.0:0.0751:0.0:0.9249	.	171;171	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	S	171	ENSP00000360112:C171S;ENSP00000294428:C171S	ENSP00000294428:C171S	C	+	1	0	RAVER2	65016088	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	5.947000	0.70242	2.036000	0.60181	0.533000	0.62120	TGT	.	.		0.393	RAVER2-201	KNOWN	basic	protein_coding	protein_coding		NM_018211	
TRMT13	54482	hgsc.bcm.edu	37	1	100614954	100614954	+	3'UTR	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:100614954T>C	ENST00000370141.2	+	0	2030				LRRC39_ENST00000370137.1_Intron|LRRC39_ENST00000342895.3_Intron|LRRC39_ENST00000370138.1_Silent_p.T330T	NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)						tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										ATGTATATATTGTCAGAATCT	0.284																																					p.T330T		Atlas-SNP	.											.	LRRC39	37	.	0			c.A990G						.																																			SO:0001624	3_prime_UTR_variant	127495	exon10			ATATATTGTCAGA	BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.*578T>C	chr1.hg19:g.100614954T>C		343.0	1.0		372.0	169.0	NM_001256385	Q5VVL0|Q9NW65	Silent	SNP	ENST00000370141.2	hg19	CCDS765.1																																																																																			.	.		0.284	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029919.1	NM_019083	
HMGCS2	3158	hgsc.bcm.edu	37	1	120293471	120293471	+	Missense_Mutation	SNP	C	C	A	rs587593961		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:120293471C>A	ENST00000369406.3	-	9	1530	c.1481G>T	c.(1480-1482)cGa>cTa	p.R494L	HMGCS2_ENST00000544913.2_Missense_Mutation_p.R452L	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	494					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)	p.R494P(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		CTCGTCCACTCGCTCCAGGTA	0.512																																					p.R494L		Atlas-SNP	.											HMGCS2,NS,carcinoma,0,1	HMGCS2	58	.	1	Substitution - Missense(1)	lung(1)	c.G1481T						.						77.0	67.0	71.0					1																	120293471		2203	4300	6503	SO:0001583	missense	3158	exon9			TCCACTCGCTCCA	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1481G>T	chr1.hg19:g.120293471C>A	ENSP00000358414:p.Arg494Leu	94.0	0.0		100.0	38.0	NM_005518	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	ENST00000369406.3	hg19	CCDS905.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486286	0.63962	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	T;T	0.77489	-1.1;-1.1	5.3	0.203	0.15195	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.630492	0.14933	N	0.289963	T	0.59756	0.2217	L	0.57536	1.79	0.36290	D	0.856322	P;P	0.42620	0.785;0.611	B;B	0.40741	0.339;0.116	T	0.57911	-0.7729	10	0.54805	T	0.06	-0.9426	9.2302	0.37432	0.0:0.6239:0.0:0.3761	.	452;494	B7Z8R3;P54868	.;HMCS2_HUMAN	L	494;452	ENSP00000358414:R494L;ENSP00000439495:R452L	ENSP00000358414:R494L	R	-	2	0	HMGCS2	120094994	0.833000	0.29383	0.988000	0.46212	0.601000	0.36947	0.944000	0.29043	0.062000	0.16340	-0.291000	0.09656	CGA	.	.		0.512	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518	
PAPPA2	60676	hgsc.bcm.edu	37	1	176563805	176563805	+	Silent	SNP	C	C	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:176563805C>T	ENST00000367662.3	+	3	2229	c.1065C>T	c.(1063-1065)agC>agT	p.S355S	PAPPA2_ENST00000367661.3_Silent_p.S355S	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	355					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TCTTGATTAGCCACAGTCGCT	0.587																																					p.S355S		Atlas-SNP	.											.	PAPPA2	665	.	0			c.C1065T						.						60.0	63.0	62.0					1																	176563805		2120	4233	6353	SO:0001819	synonymous_variant	60676	exon3			GATTAGCCACAGT	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1065C>T	chr1.hg19:g.176563805C>T		98.0	0.0		114.0	55.0	NM_021936	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	hg19	CCDS41438.1																																																																																			.	.		0.587	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
CACNA1E	777	hgsc.bcm.edu	37	1	181687238	181687238	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:181687238C>A	ENST00000367573.2	+	12	1573	c.1573C>A	c.(1573-1575)Ctg>Atg	p.L525M	CACNA1E_ENST00000357570.5_Missense_Mutation_p.L476M|CACNA1E_ENST00000526775.1_Missense_Mutation_p.L525M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.L525M|CACNA1E_ENST00000360108.3_Missense_Mutation_p.L525M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.L476M|CACNA1E_ENST00000367567.4_Missense_Mutation_p.L132M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	525					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GGAGATGTCCCTGAAGATGTA	0.478																																					p.L525M		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C1573A						.						107.0	102.0	104.0					1																	181687238		1879	4105	5984	SO:0001583	missense	777	exon12			ATGTCCCTGAAGA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1573C>A	chr1.hg19:g.181687238C>A	ENSP00000356545:p.Leu525Met	33.0	0.0		35.0	17.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068543	0.76301	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.99051	-5.37;-5.37;-5.37;-5.37;-5.37;-5.37;-5.37	5.57	4.66	0.58398	.	0.227161	0.39475	N	0.001354	D	0.98664	0.9552	M	0.68317	2.08	0.47441	D	0.999429	D;D	0.61080	0.989;0.989	P;P	0.61201	0.885;0.885	D	0.98939	1.0790	10	0.87932	D	0	.	7.1635	0.25677	0.0:0.7135:0.0:0.2865	.	525;525	Q15878-2;Q15878-3	.;.	M	525;525;476;476;132;525;525	ENSP00000356542:L525M;ENSP00000434814:L525M;ENSP00000350183:L476M;ENSP00000351101:L476M;ENSP00000356539:L132M;ENSP00000353222:L525M;ENSP00000356545:L525M	ENSP00000350183:L476M	L	+	1	2	CACNA1E	179953861	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	2.401000	0.44513	1.357000	0.45904	0.655000	0.94253	CTG	.	.		0.478	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
TRMT1L	81627	hgsc.bcm.edu	37	1	185113145	185113145	+	Silent	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:185113145T>A	ENST00000367506.5	-	6	940	c.672A>T	c.(670-672)ccA>ccT	p.P224P	TRMT1L_ENST00000367504.3_Silent_p.P68P	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	224					adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						TTTCCTTAGGTGGTTTAGCAG	0.333																																					p.P224P		Atlas-SNP	.											.	TRMT1L	50	.	0			c.A672T						.						70.0	71.0	71.0					1																	185113145		2203	4299	6502	SO:0001819	synonymous_variant	81627	exon6			CTTAGGTGGTTTA	AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.672A>T	chr1.hg19:g.185113145T>A		121.0	0.0		127.0	54.0	NM_030934	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Silent	SNP	ENST00000367506.5	hg19	CCDS1366.1																																																																																			.	.		0.333	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934	
ZNF281	23528	hgsc.bcm.edu	37	1	200377908	200377908	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:200377908T>G	ENST00000294740.3	-	2	1050	c.926A>C	c.(925-927)aAa>aCa	p.K309T	ZNF281_ENST00000367353.1_Missense_Mutation_p.K309T|ZNF281_ENST00000367352.3_Missense_Mutation_p.K273T	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	309					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						ACTATGAATTTTCTCATGTCT	0.423																																					p.K309T		Atlas-SNP	.											.	ZNF281	74	.	0			c.A926C						.						153.0	157.0	155.0					1																	200377908		2203	4300	6503	SO:0001583	missense	23528	exon2			TGAATTTTCTCAT	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.926A>C	chr1.hg19:g.200377908T>G	ENSP00000294740:p.Lys309Thr	60.0	0.0		68.0	35.0	NM_012482	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	ENST00000294740.3	hg19	CCDS1402.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.747800	0.69533	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352;ENST00000537759	T;T;T	0.12147	2.71;2.71;2.71	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.32133	0.0819	L	0.48260	1.515	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.01998	-1.1232	10	0.72032	D	0.01	-13.719	15.8694	0.79101	0.0:0.0:0.0:1.0	.	273;309	A6NF48;Q9Y2X9	.;ZN281_HUMAN	T	309;309;273;14	ENSP00000294740:K309T;ENSP00000356322:K309T;ENSP00000356321:K273T	ENSP00000294740:K309T	K	-	2	0	ZNF281	198644531	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.896000	0.87350	2.137000	0.66172	0.533000	0.62120	AAA	.	.		0.423	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482	
ITPKB	3707	hgsc.bcm.edu	37	1	226923497	226923497	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:226923497G>T	ENST00000272117.3	-	1	1662	c.1663C>A	c.(1663-1665)Cct>Act	p.P555T	ITPKB_ENST00000429204.1_Missense_Mutation_p.P555T|ITPKB_ENST00000366784.1_Missense_Mutation_p.P555T			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	555					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CTCAGGAAAGGCTTGTCCGGA	0.612																																					p.P555T	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.C1663A						.						49.0	45.0	46.0					1																	226923497		2203	4300	6503	SO:0001583	missense	3707	exon2			GGAAAGGCTTGTC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1663C>A	chr1.hg19:g.226923497G>T	ENSP00000272117:p.Pro555Thr	52.0	0.0		73.0	28.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	hg19	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068080	0.55539	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.26373	1.81;1.81;1.74	5.54	3.42	0.39159	.	0.275088	0.35291	N	0.003305	T	0.16085	0.0387	N	0.24115	0.695	0.09310	N	1	B	0.24721	0.11	B	0.19148	0.024	T	0.15607	-1.0431	10	0.33940	T	0.23	-0.7294	10.6339	0.45554	0.0:0.1325:0.6724:0.1951	.	555	P27987	IP3KB_HUMAN	T	555	ENSP00000272117:P555T;ENSP00000411152:P555T;ENSP00000355748:P555T	ENSP00000272117:P555T	P	-	1	0	ITPKB	224990120	0.794000	0.28838	0.024000	0.17045	0.874000	0.50279	1.132000	0.31418	0.591000	0.29711	0.491000	0.48974	CCT	.	.		0.612	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
RGS7	6000	hgsc.bcm.edu	37	1	241262053	241262053	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr1:241262053C>T	ENST00000407727.1	-	2	87	c.88G>A	c.(88-90)Gtc>Atc	p.V30I	RGS7_ENST00000366565.1_Missense_Mutation_p.V30I|RGS7_ENST00000366564.1_Missense_Mutation_p.V30I|RGS7_ENST00000331110.7_Missense_Mutation_p.V4I|RGS7_ENST00000366562.4_Missense_Mutation_p.V30I|RGS7_ENST00000446183.2_5'UTR|RGS7_ENST00000348120.2_Missense_Mutation_p.V30I|RGS7_ENST00000366563.1_Missense_Mutation_p.V30I|RGS7_ENST00000401882.1_Missense_Mutation_p.V30I			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	30					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CGTGCTATGACGTCTTCCATC	0.328																																					p.V30I		Atlas-SNP	.											RGS7,NS,carcinoma,0,1	RGS7	308	.	0			c.G88A						.						144.0	128.0	134.0					1																	241262053		2203	4300	6503	SO:0001583	missense	6000	exon3			CTATGACGTCTTC	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.88G>A	chr1.hg19:g.241262053C>T	ENSP00000384428:p.Val30Ile	53.0	0.0		41.0	16.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	hg19		.	.	.	.	.	.	.	.	.	.	C	8.300	0.819614	0.16607	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000348120;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T	0.28255	1.63;1.74;1.73;1.72;1.62;1.73;1.73;1.62	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000002	T	0.08582	0.0213	N	0.00538	-1.39	0.80722	D	1	B;B;B;B;B	0.24483	0.015;0.104;0.006;0.026;0.012	B;B;B;B;B	0.20577	0.008;0.03;0.006;0.03;0.014	T	0.31530	-0.9940	10	0.02654	T	1	.	14.5808	0.68288	0.0:1.0:0.0:0.0	.	4;30;30;30;30	B7Z257;P49802-4;P49802-2;P49802-5;P49802-3	.;.;.;.;.	I	4;30;30;30;30;30;30;30	ENSP00000331485:V4I;ENSP00000355523:V30I;ENSP00000355522:V30I;ENSP00000355521:V30I;ENSP00000341242:V30I;ENSP00000355520:V30I;ENSP00000384428:V30I;ENSP00000385508:V30I	ENSP00000331485:V4I	V	-	1	0	RGS7	239328676	0.882000	0.30256	0.999000	0.59377	0.983000	0.72400	1.642000	0.37207	2.572000	0.86782	0.655000	0.94253	GTC	.	.		0.328	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
ABCG5	64240	hgsc.bcm.edu	37	2	44041655	44041655	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr2:44041655G>C	ENST00000260645.1	-	12	1862	c.1723C>G	c.(1723-1725)Ctt>Gtt	p.L575V	ABCG5_ENST00000543989.1_Missense_Mutation_p.L180V|ABCG5_ENST00000405322.1_Missense_Mutation_p.L404V	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	575	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TTGACTACAAGAATCTCACTG	0.303																																					p.L575V		Atlas-SNP	.											.	ABCG5	72	.	0			c.C1723G						.						77.0	78.0	78.0					2																	44041655		2202	4295	6497	SO:0001583	missense	64240	exon12			CTACAAGAATCTC	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1723C>G	chr2.hg19:g.44041655G>C	ENSP00000260645:p.Leu575Val	209.0	0.0		217.0	92.0	NM_022436	Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	hg19	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861447	0.71949	.	.	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	T;T;T	0.73897	-0.79;-0.79;-0.79	5.22	4.35	0.52113	ABC-2 type transporter (1);	0.398249	0.25762	N	0.028476	D	0.82733	0.5101	L	0.59436	1.845	0.58432	D	0.999998	D;D	0.89917	0.996;1.0	D;D	0.87578	0.944;0.998	T	0.82841	-0.0258	10	0.46703	T	0.11	.	13.4448	0.61134	0.0756:0.0:0.9244:0.0	.	404;575	E7EX35;Q9H222	.;ABCG5_HUMAN	V	575;404;180	ENSP00000260645:L575V;ENSP00000384513:L404V;ENSP00000445107:L180V	ENSP00000260645:L575V	L	-	1	0	ABCG5	43895159	1.000000	0.71417	0.978000	0.43139	0.939000	0.58152	6.653000	0.74382	1.427000	0.47276	0.650000	0.86243	CTT	.	.		0.303	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436	
VRK2	7444	hgsc.bcm.edu	37	2	58386604	58386604	+	Missense_Mutation	SNP	G	G	C	rs201610023		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr2:58386604G>C	ENST00000435505.2	+	16	2048	c.1303G>C	c.(1303-1305)Gat>Cat	p.D435H	VRK2_ENST00000412104.2_3'UTR|VRK2_ENST00000440705.2_Missense_Mutation_p.D412H|FANCL_ENST00000403295.3_3'UTR|VRK2_ENST00000340157.4_Missense_Mutation_p.D435H|FANCL_ENST00000233741.4_3'UTR|FANCL_ENST00000402135.3_3'UTR|VRK2_ENST00000417641.2_3'UTR			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	435	Interaction with MAP3K7.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						GCCTCATCAAGATTTTACCAG	0.368																																					p.D435H		Atlas-SNP	.											.	VRK2	46	.	0			c.G1303C						.						65.0	67.0	66.0					2																	58386604		2203	4299	6502	SO:0001583	missense	7444	exon13			CATCAAGATTTTA	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.1303G>C	chr2.hg19:g.58386604G>C	ENSP00000408002:p.Asp435His	174.0	0.0		178.0	71.0	NM_001130480	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	hg19	CCDS1859.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.246002	0.59103	.	.	ENSG00000028116	ENST00000435505;ENST00000340157;ENST00000440705	T;T;T	0.07444	3.19;3.19;3.19	6.02	4.21	0.49690	.	0.374960	0.27109	N	0.020889	T	0.13030	0.0316	M	0.61703	1.905	0.19945	N	0.999947	P	0.50272	0.933	P	0.47206	0.541	T	0.10753	-1.0616	10	0.66056	D	0.02	-4.9525	7.7025	0.28632	0.0818:0.0:0.7563:0.1619	.	435	Q86Y07	VRK2_HUMAN	H	435;435;412	ENSP00000408002:D435H;ENSP00000342381:D435H;ENSP00000398323:D412H	ENSP00000342381:D435H	D	+	1	0	VRK2	58240108	0.658000	0.27402	0.002000	0.10522	0.151000	0.21798	2.440000	0.44855	0.863000	0.35553	0.650000	0.86243	GAT	.	G|0.999;A|0.001		0.368	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296	
CNOT11	55571	hgsc.bcm.edu	37	2	101883295	101883295	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr2:101883295C>G	ENST00000289382.3	+	5	1355	c.1192C>G	c.(1192-1194)Ctg>Gtg	p.L398V		NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	398					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)											TTTCTCTGTCCTGGTCAATAT	0.388																																					p.L398V		Atlas-SNP	.											.	.	.	.	0			c.C1192G						.						164.0	158.0	160.0					2																	101883295		2203	4300	6503	SO:0001583	missense	55571	exon5			TCTGTCCTGGTCA	AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.1192C>G	chr2.hg19:g.101883295C>G	ENSP00000289382:p.Leu398Val	101.0	0.0		127.0	56.0	NM_017546	Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	hg19	CCDS2050.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.019308|4.019308	0.75275|0.75275	.|.	.|.	ENSG00000158435|ENSG00000158435	ENST00000289382|ENST00000420107	.|.	.|.	.|.	5.95|5.95	4.14|4.14	0.48551|0.48551	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79003|0.79003	0.4373|0.4373	M|M	0.93062|0.93062	3.375|3.375	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.76494|.	0.999|.	D|.	0.74348|.	0.983|.	T|T	0.81835|0.81835	-0.0750|-0.0750	9|5	0.87932|.	D|.	0|.	-19.833|-19.833	8.0245|8.0245	0.30430|0.30430	0.0:0.7141:0.1421:0.1437|0.0:0.7141:0.1421:0.1437	.|.	398|.	Q9UKZ1|.	CB029_HUMAN|.	V|R	398|77	.|.	ENSP00000289382:L398V|.	L|P	+|+	1|2	2|0	C2orf29|C2orf29	101249727|101249727	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.988000|0.988000	0.76386|0.76386	3.848000|3.848000	0.55903|0.55903	1.514000|1.514000	0.48869|0.48869	0.655000|0.655000	0.94253|0.94253	CTG|CCT	.	.		0.388	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546	
COL3A1	1281	hgsc.bcm.edu	37	2	189875435	189875435	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr2:189875435G>A	ENST00000304636.3	+	50	4243	c.4073G>A	c.(4072-4074)cGa>cAa	p.R1358Q	COL3A1_ENST00000317840.5_Missense_Mutation_p.R1055Q	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1358	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GCATTCCTTCGACTTCTCTCC	0.433																																					p.R1358Q		Atlas-SNP	.											.	COL3A1	292	.	0			c.G4073A						.						97.0	95.0	96.0					2																	189875435		2203	4300	6503	SO:0001583	missense	1281	exon50			TCCTTCGACTTCT	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.4073G>A	chr2.hg19:g.189875435G>A	ENSP00000304408:p.Arg1358Gln	133.0	0.0		142.0	49.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	hg19	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	35	5.441598	0.96187	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.76968	-1.06;-1.06	5.29	5.29	0.74685	Fibrillar collagen, C-terminal (3);	0.000000	0.47455	D	0.000238	D	0.85204	0.5643	L	0.50847	1.595	0.33052	D	0.532905	D	0.89917	1.0	D	0.87578	0.998	D	0.85832	0.1392	10	0.31617	T	0.26	.	18.9332	0.92574	0.0:0.0:1.0:0.0	.	1358	P02461	CO3A1_HUMAN	Q	1358;1055	ENSP00000304408:R1358Q;ENSP00000315243:R1055Q	ENSP00000304408:R1358Q	R	+	2	0	COL3A1	189583680	1.000000	0.71417	0.986000	0.45419	0.877000	0.50540	9.869000	0.99810	2.481000	0.83766	0.655000	0.94253	CGA	.	.		0.433	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
HSPD1	3329	hgsc.bcm.edu	37	2	198353917	198353917	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr2:198353917A>C	ENST00000388968.3	-	9	1291	c.1024T>G	c.(1024-1026)Tta>Gta	p.L342V	HSPD1_ENST00000345042.2_Missense_Mutation_p.L342V	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	342					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			ACTTTTCCTAAGTCATGAGGC	0.398																																					p.L342V		Atlas-SNP	.											.	HSPD1	68	.	0			c.T1024G						.						58.0	57.0	58.0					2																	198353917		2203	4300	6503	SO:0001583	missense	3329	exon9			TTCCTAAGTCATG	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.1024T>G	chr2.hg19:g.198353917A>C	ENSP00000373620:p.Leu342Val	327.0	0.0		424.0	176.0	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Missense_Mutation	SNP	ENST00000388968.3	hg19	CCDS33357.1	.	.	.	.	.	.	.	.	.	.	A	18.61	3.662082	0.67700	.	.	ENSG00000144381	ENST00000388968;ENST00000345042;ENST00000536745	D;D	0.84516	-1.86;-1.86	4.99	4.99	0.66335	.	0.108901	0.64402	D	0.000005	D	0.94245	0.8152	H	0.96996	3.92	0.80722	D	1	B;B;B	0.31910	0.016;0.346;0.001	B;P;B	0.50570	0.207;0.644;0.009	D	0.95072	0.8205	10	0.87932	D	0	-6.7849	14.971	0.71235	1.0:0.0:0.0:0.0	.	333;342;342	B7Z597;B3GQS7;P10809	.;.;CH60_HUMAN	V	342;342;198	ENSP00000373620:L342V;ENSP00000340019:L342V	ENSP00000340019:L342V	L	-	1	2	HSPD1	198062162	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.316000	0.79007	1.994000	0.58287	0.397000	0.26171	TTA	.	.		0.398	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
RNF123	63891	hgsc.bcm.edu	37	3	49737930	49737930	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr3:49737930A>T	ENST00000327697.6	+	14	1280	c.1136A>T	c.(1135-1137)aAg>aTg	p.K379M	RNF123_ENST00000432042.1_Missense_Mutation_p.K233M	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	379					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GATTGCCTCAAGCAGTTGATG	0.587																																					p.K379M		Atlas-SNP	.											.	RNF123	100	.	0			c.A1136T						.						104.0	95.0	98.0					3																	49737930		2203	4300	6503	SO:0001583	missense	63891	exon14			GCCTCAAGCAGTT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1136A>T	chr3.hg19:g.49737930A>T	ENSP00000328287:p.Lys379Met	107.0	0.0		189.0	46.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	hg19	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.780438	0.90195	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.77358	-0.8;-1.09	5.4	5.4	0.78164	.	0.235838	0.42682	N	0.000675	T	0.80177	0.4575	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;0.998	D;P	0.68192	0.956;0.888	T	0.82874	-0.0241	10	0.66056	D	0.02	-32.2121	14.5929	0.68383	1.0:0.0:0.0:0.0	.	233;379	C9J266;Q5XPI4	.;RN123_HUMAN	M	379;379;233	ENSP00000328287:K379M;ENSP00000392443:K233M	ENSP00000328287:K379M	K	+	2	0	RNF123	49712934	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.792000	0.75125	2.045000	0.60652	0.533000	0.62120	AAG	.	.		0.587	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
POLQ	10721	hgsc.bcm.edu	37	3	121206681	121206681	+	Silent	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr3:121206681A>G	ENST00000264233.5	-	16	5225	c.5097T>C	c.(5095-5097)aaT>aaC	p.N1699N		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1699					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTTTTACTTCATTATTAGAAG	0.313								DNA polymerases (catalytic subunits)																													p.N1699N	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.T5097C						.						72.0	77.0	75.0					3																	121206681		2203	4300	6503	SO:0001819	synonymous_variant	10721	exon16			TACTTCATTATTA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.5097T>C	chr3.hg19:g.121206681A>G		88.0	0.0		81.0	38.0	NM_199420	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	hg19	CCDS33833.1																																																																																			.	.		0.313	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
MYLK	4638	hgsc.bcm.edu	37	3	123444795	123444795	+	Silent	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr3:123444795C>A	ENST00000475616.1	-	9	1646	c.1647G>T	c.(1645-1647)ctG>ctT	p.L549L	MYLK_ENST00000360304.3_Silent_p.L549L|MYLK_ENST00000359169.1_Silent_p.L549L|MYLK_ENST00000346322.5_Silent_p.L480L|MYLK_ENST00000360772.3_Silent_p.L549L			Q15746	MYLK_HUMAN	myosin light chain kinase	549	Ig-like C2-type 4.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ACTCACCATTCAGCAGCCAAG	0.592																																					p.L549L		Atlas-SNP	.											.	MYLK	224	.	0			c.G1647T						.						44.0	48.0	47.0					3																	123444795		2203	4300	6503	SO:0001819	synonymous_variant	4638	exon12			ACCATTCAGCAGC	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1647G>T	chr3.hg19:g.123444795C>A		502.0	1.0		459.0	210.0	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	hg19	CCDS46896.1																																																																																			.	.		0.592	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
PLSCR4	57088	hgsc.bcm.edu	37	3	145912237	145912237	+	Silent	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr3:145912237G>A	ENST00000354952.2	-	9	1191	c.951C>T	c.(949-951)ttC>ttT	p.F317F	PLSCR4_ENST00000493382.1_Silent_p.F317F|PLSCR4_ENST00000446574.2_Silent_p.F317F|PLSCR4_ENST00000383083.2_Silent_p.F227F|PLSCR4_ENST00000433593.2_Silent_p.F212F	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	317					cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)			kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						CAAAATACATGAAGTCCTGAA	0.338																																					p.F317F		Atlas-SNP	.											.	PLSCR4	44	.	0			c.C951T						.						111.0	112.0	111.0					3																	145912237		2203	4300	6503	SO:0001819	synonymous_variant	57088	exon9			ATACATGAAGTCC	AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.951C>T	chr3.hg19:g.145912237G>A		73.0	0.0		74.0	34.0	NM_020353	A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Silent	SNP	ENST00000354952.2	hg19	CCDS3133.1																																																																																			.	.		0.338	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355172.1	NM_020353	
FXR1	8087	hgsc.bcm.edu	37	3	180666182	180666182	+	Silent	SNP	A	A	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr3:180666182A>T	ENST00000357559.4	+	5	702	c.318A>T	c.(316-318)atA>atT	p.I106I	FXR1_ENST00000445140.2_Silent_p.I106I|FXR1_ENST00000480918.1_Silent_p.I93I|FXR1_ENST00000491062.1_Silent_p.I57I|FXR1_ENST00000468861.1_Silent_p.I21I|FXR1_ENST00000305586.7_Silent_p.I21I	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	106	Agenet-like 2.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			ACAATGAAATAGTCACATTTG	0.328																																					p.I106I		Atlas-SNP	.											.	FXR1	75	.	0			c.A318T						.						51.0	52.0	52.0					3																	180666182		2203	4300	6503	SO:0001819	synonymous_variant	8087	exon5			TGAAATAGTCACA	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.318A>T	chr3.hg19:g.180666182A>T		122.0	0.0		114.0	11.0	NM_001013438	A8K9B8|Q7Z450|Q8N6R8	Silent	SNP	ENST00000357559.4	hg19	CCDS3238.1																																																																																			.	.		0.328	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
CPZ	8532	hgsc.bcm.edu	37	4	8594614	8594614	+	Silent	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:8594614C>A	ENST00000360986.4	+	1	228	c.54C>A	c.(52-54)gcC>gcA	p.A18A	CPZ_ENST00000506287.1_3'UTR|CPZ_ENST00000382480.2_5'UTR|CPZ_ENST00000315782.6_Silent_p.A18A	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	18					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TCGCCGCTGCCCGGCCGGGGT	0.716																																					p.A18A		Atlas-SNP	.											.	CPZ	95	.	0			c.C54A						.						2.0	3.0	3.0					4																	8594614		1721	3580	5301	SO:0001819	synonymous_variant	8532	exon1			CGCTGCCCGGCCG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.54C>A	chr4.hg19:g.8594614C>A		119.0	0.0		137.0	50.0	NM_003652	O00520|Q96MX2	Silent	SNP	ENST00000360986.4	hg19	CCDS33953.1																																																																																			.	.		0.716	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
BEND4	389206	hgsc.bcm.edu	37	4	42122083	42122083	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:42122083T>C	ENST00000502486.1	-	5	1954	c.1375A>G	c.(1375-1377)Aca>Gca	p.T459A	BEND4_ENST00000504360.1_Intron	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	459	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						CGGAGGCATGTTACTTTAACT	0.527																																					p.T459A		Atlas-SNP	.											.	BEND4	67	.	0			c.A1375G						.						91.0	94.0	93.0					4																	42122083		2034	4192	6226	SO:0001583	missense	389206	exon5			GGCATGTTACTTT	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.1375A>G	chr4.hg19:g.42122083T>C	ENSP00000421169:p.Thr459Ala	98.0	0.0		121.0	46.0	NM_207406	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	hg19	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.121107	0.77436	.	.	ENSG00000188848	ENST00000411720;ENST00000502486	T	0.39997	1.05	5.87	5.87	0.94306	BEN domain (2);	0.050017	0.85682	D	0.000000	T	0.37489	0.1005	N	0.08118	0	0.80722	D	1	P;P	0.48503	0.891;0.911	P;P	0.51516	0.543;0.672	T	0.45920	-0.9228	10	0.72032	D	0.01	-11.2362	16.5764	0.84681	0.0:0.0:0.0:1.0	.	381;459	Q6ZU67-3;Q6ZU67	.;BEND4_HUMAN	A	330;459	ENSP00000421169:T459A	ENSP00000412495:T330A	T	-	1	0	BEND4	41816840	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.655000	0.83696	2.371000	0.80710	0.533000	0.62120	ACA	.	.		0.527	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
FRYL	285527	hgsc.bcm.edu	37	4	48517192	48517192	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:48517192A>C	ENST00000503238.1	-	53	7789	c.7790T>G	c.(7789-7791)aTt>aGt	p.I2597S	FRYL_ENST00000358350.4_Missense_Mutation_p.I2597S|FRYL_ENST00000537810.1_Missense_Mutation_p.I2597S|FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	2597					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TAAATCAAGAATTCCTTGACA	0.398																																					p.I2597S		Atlas-SNP	.											.	FRYL	242	.	0			c.T7790G						.						126.0	118.0	120.0					4																	48517192		1852	4087	5939	SO:0001583	missense	285527	exon56			TCAAGAATTCCTT	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.7790T>G	chr4.hg19:g.48517192A>C	ENSP00000426064:p.Ile2597Ser	91.0	0.0		94.0	37.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	5.870	0.344747	0.11126	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810	T;T;T	0.21031	2.03;2.03;2.04	5.96	4.75	0.60458	.	1.325240	0.05140	N	0.494071	T	0.13970	0.0338	L	0.31207	0.915	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.40098	-0.9581	10	0.05959	T	0.93	.	4.0903	0.09967	0.6404:0.1888:0.1708:0.0	.	2597;2597	O94915;F5GX82	FRYL_HUMAN;.	S	2597	ENSP00000426064:I2597S;ENSP00000351113:I2597S;ENSP00000441114:I2597S	ENSP00000351113:I2597S	I	-	2	0	FRYL	48211949	1.000000	0.71417	0.566000	0.28421	0.973000	0.67179	3.550000	0.53691	1.036000	0.39998	0.477000	0.44152	ATT	.	.		0.398	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
TBC1D9	23158	hgsc.bcm.edu	37	4	141555157	141555157	+	Silent	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:141555157T>C	ENST00000442267.2	-	16	2765	c.2691A>G	c.(2689-2691)ttA>ttG	p.L897L		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	897	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TTTCATCTAATAACTGGAACA	0.473																																					p.L897L		Atlas-SNP	.											.	TBC1D9	198	.	0			c.A2691G						.						62.0	62.0	62.0					4																	141555157		1946	4151	6097	SO:0001819	synonymous_variant	23158	exon16			ATCTAATAACTGG	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2691A>G	chr4.hg19:g.141555157T>C		99.0	0.0		104.0	45.0	NM_015130	A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	hg19	CCDS47136.1																																																																																			.	.		0.473	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
GAB1	2549	hgsc.bcm.edu	37	4	144381524	144381524	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:144381524A>T	ENST00000262994.4	+	8	1989	c.1687A>T	c.(1687-1689)Agg>Tgg	p.R563W	GAB1_ENST00000505913.1_Missense_Mutation_p.R460W|GAB1_ENST00000262995.4_Missense_Mutation_p.R593W	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	563					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					TAGCTCTTCCAGGTTTCCCAT	0.393																																					p.R593W		Atlas-SNP	.											.	GAB1	80	.	0			c.A1777T						.						125.0	124.0	125.0					4																	144381524		2203	4300	6503	SO:0001583	missense	2549	exon9			TCTTCCAGGTTTC	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1687A>T	chr4.hg19:g.144381524A>T	ENSP00000262994:p.Arg563Trp	75.0	0.0		78.0	32.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	hg19	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.162266	0.78226	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000505913	T;T;T	0.16457	2.34;2.34;2.34	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.49254	-0.8959	10	0.72032	D	0.01	-2.3457	15.9132	0.79488	1.0:0.0:0.0:0.0	.	563;593	Q13480;Q13480-2	GAB1_HUMAN;.	W	593;563;460	ENSP00000262995:R593W;ENSP00000262994:R563W;ENSP00000424554:R460W	ENSP00000262994:R563W	R	+	1	2	GAB1	144600974	1.000000	0.71417	0.945000	0.38365	0.516000	0.34256	8.962000	0.93254	2.154000	0.67381	0.482000	0.46254	AGG	.	.		0.393	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
FSTL5	56884	hgsc.bcm.edu	37	4	162307202	162307202	+	Silent	SNP	G	G	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:162307202G>C	ENST00000306100.5	-	16	2677	c.2241C>G	c.(2239-2241)tcC>tcG	p.S747S	FSTL5_ENST00000536695.1_Silent_p.S746S|FSTL5_ENST00000379164.4_Silent_p.S746S|FSTL5_ENST00000427802.2_Silent_p.S737S|RP11-234O6.2_ENST00000508189.1_RNA	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	747						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CTTCAGTAAAGGATGGTTGAA	0.408																																					p.S747S		Atlas-SNP	.											.	FSTL5	207	.	0			c.C2241G						.						89.0	86.0	87.0					4																	162307202		2203	4300	6503	SO:0001819	synonymous_variant	56884	exon16			AGTAAAGGATGGT	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2241C>G	chr4.hg19:g.162307202G>C		117.0	0.0		123.0	55.0	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Silent	SNP	ENST00000306100.5	hg19	CCDS3802.1																																																																																			.	.		0.408	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
CEP44	80817	hgsc.bcm.edu	37	4	175220276	175220276	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:175220276G>A	ENST00000503780.1	+	3	418	c.4G>A	c.(4-6)Gca>Aca	p.A2T	CEP44_ENST00000296519.4_Missense_Mutation_p.A2T|CEP44_ENST00000457424.2_Missense_Mutation_p.A2T|CEP44_ENST00000426172.1_Missense_Mutation_p.A2T	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	2						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						TTAAGTAATGGCAACAGGTGA	0.373																																					p.A2T		Atlas-SNP	.											.	CEP44	35	.	0			c.G4A						.						98.0	99.0	99.0					4																	175220276		2203	4300	6503	SO:0001583	missense	80817	exon3			GTAATGGCAACAG	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.4G>A	chr4.hg19:g.175220276G>A	ENSP00000423153:p.Ala2Thr	76.0	0.0		73.0	20.0	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	hg19	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737048	0.69304	.	.	ENSG00000164118	ENST00000503780;ENST00000505124;ENST00000457424;ENST00000514712;ENST00000515299;ENST00000503053;ENST00000426172;ENST00000296519	T;T;T;T;T	0.59224	0.33;0.28;0.35;0.28;0.33	4.89	4.89	0.63831	.	0.333285	0.27402	N	0.019536	T	0.72779	0.3503	M	0.66297	2.02	0.41418	D	0.987788	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.74372	-0.3687	10	0.49607	T	0.09	.	13.4893	0.61386	0.0785:0.0:0.9215:0.0	.	2;2	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	T	2	ENSP00000423153:A2T;ENSP00000389427:A2T;ENSP00000421128:A2T;ENSP00000408221:A2T;ENSP00000296519:A2T	ENSP00000296519:A2T	A	+	1	0	CEP44	175456851	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	4.383000	0.59600	2.255000	0.74692	0.585000	0.79938	GCA	.	.		0.373	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
BRIX1	55299	hgsc.bcm.edu	37	5	34922835	34922835	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr5:34922835T>C	ENST00000336767.5	+	6	835	c.472T>C	c.(472-474)Tgt>Cgt	p.C158R	BRIX1_ENST00000506023.1_3'UTR	NM_018321.3	NP_060791.3	Q8TDN6	BRX1_HUMAN	BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)	158	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				ribosome biogenesis (GO:0042254)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						GACTGGAAACTGTTTGAAAGG	0.348																																					p.C158R		Atlas-SNP	.											.	BRIX1	21	.	0			c.T472C						.						108.0	114.0	112.0					5																	34922835		2203	4300	6503	SO:0001583	missense	55299	exon6			GGAAACTGTTTGA		CCDS34143.1	5p13.2	2009-09-25	2009-09-25	2009-09-25	ENSG00000113460	ENSG00000113460			24170	protein-coding gene	gene with protein product			"""brix domain containing 2"""	BXDC2		12477932	Standard	NM_018321		Approved	BRIX, FLJ11100	uc003jja.3	Q8TDN6	OTTHUMG00000162021	ENST00000336767.5:c.472T>C	chr5.hg19:g.34922835T>C	ENSP00000338862:p.Cys158Arg	270.0	0.0		261.0	91.0	NM_018321	A8K0P5|Q3ZTT4|Q8N453|Q96DH1	Missense_Mutation	SNP	ENST00000336767.5	hg19	CCDS34143.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469739	0.84533	.	.	ENSG00000113460	ENST00000336767	T	0.21734	1.99	6.16	6.16	0.99307	Brix domain (3);Anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.54951	0.1890	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;0.988	D;P	0.83275	0.996;0.899	T	0.62407	-0.6861	10	0.66056	D	0.02	-14.0109	16.8061	0.85666	0.0:0.0:0.0:1.0	.	158;158	B4E0B8;Q8TDN6	.;BRX1_HUMAN	R	158	ENSP00000338862:C158R	ENSP00000338862:C158R	C	+	1	0	BRIX1	34958592	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.552000	0.82192	2.367000	0.80283	0.528000	0.53228	TGT	.	.		0.348	BRIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366826.2	NM_018321	
SETD9	133383	hgsc.bcm.edu	37	5	56212656	56212656	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr5:56212656T>G	ENST00000285947.2	+	6	1213	c.827T>G	c.(826-828)gTt>gGt	p.V276G	SETD9_ENST00000475908.1_3'UTR|SETD9_ENST00000541720.1_Intron	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	276	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)										CTTCGATGTGTTGTTCTTGTC	0.333																																					p.V276G		Atlas-SNP	.											.	.	.	.	0			c.T827G						.						165.0	155.0	159.0					5																	56212656		2203	4300	6503	SO:0001583	missense	133383	exon6			GATGTGTTGTTCT	BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.827T>G	chr5.hg19:g.56212656T>G	ENSP00000285947:p.Val276Gly	68.0	0.0		77.0	35.0	NM_153706	F5H713	Missense_Mutation	SNP	ENST00000285947.2	hg19	CCDS3972.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324164	0.81580	.	.	ENSG00000155542	ENST00000285947	T	0.47869	0.83	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73291	-0.4029	10	0.87932	D	0	-13.6371	14.8803	0.70528	0.0:0.0:0.0:1.0	.	276	Q8NE22	CE035_HUMAN	G	276	ENSP00000285947:V276G	ENSP00000285947:V276G	V	+	2	0	C5orf35	56248413	1.000000	0.71417	0.954000	0.39281	0.980000	0.70556	7.204000	0.77872	1.927000	0.55829	0.477000	0.44152	GTT	.	.		0.333	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132304.2	NM_153706	
DIAPH1	1729	hgsc.bcm.edu	37	5	140958709	140958709	+	Silent	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr5:140958709T>C	ENST00000398557.4	-	9	1019	c.879A>G	c.(877-879)gaA>gaG	p.E293E	DIAPH1_ENST00000253811.6_Silent_p.E293E|DIAPH1_ENST00000398566.3_Silent_p.E284E|DIAPH1_ENST00000389057.5_Silent_p.E284E|DIAPH1_ENST00000520569.1_Silent_p.E239E|DIAPH1_ENST00000389054.3_Silent_p.E293E|DIAPH1_ENST00000398562.2_Silent_p.E284E|DIAPH1_ENST00000518047.1_Silent_p.E284E	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	293	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGAAACGTTCCACTTCAT	0.463																																					p.E293E		Atlas-SNP	.											.	DIAPH1	64	.	0			c.A879G						.						261.0	270.0	267.0					5																	140958709		1905	4122	6027	SO:0001819	synonymous_variant	1729	exon9			GAAACGTTCCACT	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.879A>G	chr5.hg19:g.140958709T>C		160.0	0.0		169.0	76.0	NM_005219	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Silent	SNP	ENST00000398557.4	hg19	CCDS43374.1																																																																																			.	.		0.463	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
FLT4	2324	hgsc.bcm.edu	37	5	180040034	180040034	+	Silent	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr5:180040034G>A	ENST00000261937.6	-	25	3486	c.3408C>T	c.(3406-3408)gcC>gcT	p.A1136A	FLT4_ENST00000502649.1_Silent_p.A1136A|FLT4_ENST00000393347.3_Silent_p.A1136A	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCAGCTCCGGGGCCCTCATCC	0.657																																					p.A1136A	Colon(97;1075 1466 27033 27547 35871)	Atlas-SNP	.											.	FLT4	356	.	0			c.C3408T						.						56.0	66.0	62.0					5																	180040034		2203	4300	6503	SO:0001819	synonymous_variant	2324	exon25			CTCCGGGGCCCTC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3408C>T	chr5.hg19:g.180040034G>A		85.0	0.0		89.0	34.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	hg19	CCDS4457.1																																																																																			.	.		0.657	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
AARS2	57505	hgsc.bcm.edu	37	6	44275036	44275037	+	Missense_Mutation	DNP	TG	TG	AA			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr6:44275036_44275037TG>AA	ENST00000244571.4	-	6	991_992	c.989_990CA>TT	c.(988-990)aCA>aTT	p.T330I	TMEM151B_ENST00000438774.2_3'UTR|RP11-444E17.6_ENST00000505802.1_3'UTR	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGACACTGAGTGTGCGGATGTG	0.644																																					p.T330T|p.T330I		Atlas-SNP	.											.	AARS2	77	.	0			c.A990T|c.C989T						.																																			SO:0001583	missense	57505	exon6			ACTGAGTGTGCGG|CTGAGTGTGCGGA	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.989_990delinsAA	chr6.hg19:g.44275036_44275037delinsAA	ENSP00000244571:p.Thr330Ile	56.0|57.0	0.0		70.0	25.0|24.0	NM_020745		Silent|Missense_Mutation	SNP	ENST00000244571.4	hg19	CCDS34464.1																																																																																			.	.		0.644	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
GPR110	266977	hgsc.bcm.edu	37	6	46975013	46975013	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr6:46975013A>G	ENST00000371253.2	-	12	2724	c.2509T>C	c.(2509-2511)Ttt>Ctt	p.F837L	GPR110_ENST00000283297.5_Missense_Mutation_p.F640L|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	837					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						AGTATTCCAAAGCATAAGATA	0.328																																					p.F837L		Atlas-SNP	.											.	GPR110	102	.	0			c.T2509C						.						53.0	53.0	53.0					6																	46975013		2203	4300	6503	SO:0001583	missense	266977	exon12			TTCCAAAGCATAA	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2509T>C	chr6.hg19:g.46975013A>G	ENSP00000360299:p.Phe837Leu	370.0	0.0		340.0	150.0	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	hg19	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	A	19.65	3.866864	0.72065	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	T;T	0.54866	0.55;0.55	5.61	5.61	0.85477	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000012	T	0.45216	0.1331	M	0.66939	2.045	0.40239	D	0.977934	P	0.48294	0.908	B	0.44224	0.444	T	0.56619	-0.7949	10	0.87932	D	0	-19.0121	13.8418	0.63444	1.0:0.0:0.0:0.0	.	837	Q5T601	GP110_HUMAN	L	837;640	ENSP00000360299:F837L;ENSP00000283297:F640L	ENSP00000283297:F640L	F	-	1	0	GPR110	47082972	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.047000	0.76599	2.254000	0.74563	0.533000	0.62120	TTT	.	.		0.328	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
DST	667	hgsc.bcm.edu	37	6	56494214	56494214	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr6:56494214T>C	ENST00000361203.3	-	28	3683	c.3676A>G	c.(3676-3678)Aga>Gga	p.R1226G	DST_ENST00000446842.2_Missense_Mutation_p.R900G|DST_ENST00000518935.1_Missense_Mutation_p.R900G|DST_ENST00000370765.6_Missense_Mutation_p.R900G|DST_ENST00000312431.6_Missense_Mutation_p.R1226G|DST_ENST00000370754.5_Missense_Mutation_p.R1404G|DST_ENST00000370788.2_Missense_Mutation_p.R1226G|DST_ENST00000244364.6_Missense_Mutation_p.R900G|DST_ENST00000370769.4_Missense_Mutation_p.R1226G|DST_ENST00000421834.2_Missense_Mutation_p.R1226G			Q03001	DYST_HUMAN	dystonin	1226					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AATACCTGTCTCTTTTCATCT	0.328																																					p.R900G		Atlas-SNP	.											.	DST	1427	.	0			c.A2698G						.						121.0	112.0	115.0					6																	56494214		2203	4300	6503	SO:0001583	missense	667	exon18			CCTGTCTCTTTTC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3676A>G	chr6.hg19:g.56494214T>C	ENSP00000354508:p.Arg1226Gly	84.0	0.0		78.0	32.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	T	18.23	3.578853	0.65878	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;D;T;T;T;D;T;T	0.84070	1.07;-0.06;-0.07;0.03;0.88;-1.56;0.01;-0.09;-0.34;-1.8;-0.82;-0.16	5.7	3.1	0.35709	.	0.000000	0.56097	D	0.000029	D	0.84593	0.5506	L	0.54323	1.7	0.29256	N	0.871649	P;D;P;P;P;D;P;P	0.63880	0.651;0.993;0.651;0.61;0.896;0.989;0.651;0.73	B;D;B;B;P;D;B;P	0.72338	0.104;0.977;0.104;0.191;0.653;0.946;0.104;0.467	D	0.86361	0.1717	9	0.62326	D	0.03	.	13.6407	0.62249	0.0:0.0:0.3557:0.6442	.	1226;1226;1404;900;900;900;1226;900	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	G	900;1404;1226;1226;900;1226;1226;1226;900;1266;900;900	ENSP00000244364:R900G;ENSP00000359790:R1404G;ENSP00000359805:R1226G;ENSP00000400883:R1226G;ENSP00000393645:R900G;ENSP00000307959:R1226G;ENSP00000359824:R1226G;ENSP00000354508:R1226G;ENSP00000404924:R900G;ENSP00000431030:R1266G;ENSP00000359801:R900G;ENSP00000431003:R900G	ENSP00000244364:R900G	R	-	1	2	DST	56602173	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.296000	0.51802	0.953000	0.37825	0.533000	0.62120	AGA	.	.		0.328	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
UTRN	7402	hgsc.bcm.edu	37	6	144783861	144783861	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr6:144783861G>T	ENST00000367545.3	+	22	2925	c.2925G>T	c.(2923-2925)gaG>gaT	p.E975D		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	975					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGGCTCTGGAGAAAAATGTTC	0.333																																					p.E975D		Atlas-SNP	.											.	UTRN	327	.	0			c.G2925T						.						61.0	71.0	67.0					6																	144783861		2202	4300	6502	SO:0001583	missense	7402	exon22			TCTGGAGAAAAAT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2925G>T	chr6.hg19:g.144783861G>T	ENSP00000356515:p.Glu975Asp	222.0	0.0		189.0	79.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	hg19	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811625	0.32053	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.34859	1.34	5.36	4.49	0.54785	.	0.123547	0.36066	N	0.002801	T	0.11922	0.0290	L	0.32530	0.975	0.80722	D	1	B	0.32031	0.352	B	0.25759	0.063	T	0.05037	-1.0910	10	0.17832	T	0.49	.	13.6806	0.62481	0.074:0.0:0.926:0.0	.	975	P46939	UTRO_HUMAN	D	975	ENSP00000356515:E975D	ENSP00000356499:E975D	E	+	3	2	UTRN	144825554	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.721000	0.54941	1.243000	0.43853	0.655000	0.94253	GAG	.	.		0.333	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
UTRN	7402	hgsc.bcm.edu	37	6	144808683	144808683	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr6:144808683G>T	ENST00000367545.3	+	28	3822		c.e28-1			NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin						aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CTCCATTCCAGTCTCTGGAAT	0.403																																					.		Atlas-SNP	.											.	UTRN	327	.	0			c.3823-1G>T						.						58.0	64.0	62.0					6																	144808683		2203	4300	6503	SO:0001630	splice_region_variant	7402	exon28			ATTCCAGTCTCTG	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3823-1G>T	chr6.hg19:g.144808683G>T		59.0	0.0		74.0	34.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Splice_Site	SNP	ENST00000367545.3	hg19	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521423	0.64747	.	.	ENSG00000152818	ENST00000367545	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4129	0.94683	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UTRN	144850376	1.000000	0.71417	0.996000	0.52242	0.459000	0.32528	9.813000	0.99286	2.652000	0.90054	0.655000	0.94253	.	.	.		0.403	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		Intron
SP8	221833	hgsc.bcm.edu	37	7	20823935	20823935	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr7:20823935G>C	ENST00000361443.4	-	3	1684	c.1447C>G	c.(1447-1449)Ccc>Gcc	p.P483A	SP8_ENST00000418710.2_Missense_Mutation_p.P501A	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	483					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						CGGTGCCCGGGCTCGGGGGGC	0.736																																					p.P501A		Atlas-SNP	.											.	SP8	43	.	0			c.C1501G						.						2.0	2.0	2.0					7																	20823935		1465	3031	4496	SO:0001583	missense	221833	exon2			GCCCGGGCTCGGG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.1447C>G	chr7.hg19:g.20823935G>C	ENSP00000354482:p.Pro483Ala	15.0	0.0		22.0	6.0	NM_182700	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	hg19	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553651	0.65425	.	.	ENSG00000164651	ENST00000297210;ENST00000418710;ENST00000361443	T;T	0.12147	2.71;2.73	4.55	4.55	0.56014	.	0.166648	0.41500	U	0.000870	T	0.14141	0.0342	L	0.46157	1.445	0.37703	D	0.92428	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.04796	-1.0926	10	0.66056	D	0.02	.	12.4376	0.55608	0.0:0.1686:0.8314:0.0	.	483;483	Q7Z615;Q8IXZ3	.;SP8_HUMAN	A	459;501;483	ENSP00000408792:P501A;ENSP00000354482:P483A	ENSP00000297210:P459A	P	-	1	0	SP8	20790460	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.513000	0.35823	2.361000	0.80049	0.655000	0.94253	CCC	.	.		0.736	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
LIMK1	3984	hgsc.bcm.edu	37	7	73521439	73521439	+	Silent	SNP	C	C	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr7:73521439C>G	ENST00000336180.2	+	8	1032	c.981C>G	c.(979-981)gtC>gtG	p.V327V	LIMK1_ENST00000538333.3_Silent_p.V293V|LIMK1_ENST00000418310.1_Silent_p.V357V	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	327					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	TCCGCGTAGTCTGCCGGCCAC	0.682																																					p.V327V		Atlas-SNP	.											.	LIMK1	55	.	0			c.C981G						.						38.0	36.0	37.0					7																	73521439		2203	4299	6502	SO:0001819	synonymous_variant	3984	exon8			CGTAGTCTGCCGG	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.981C>G	chr7.hg19:g.73521439C>G		78.0	0.0		92.0	39.0	NM_002314	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Silent	SNP	ENST00000336180.2	hg19	CCDS5563.1																																																																																			.	.		0.682	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
HIP1	3092	hgsc.bcm.edu	37	7	75174049	75174049	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr7:75174049T>A	ENST00000336926.6	-	27	2736	c.2710A>T	c.(2710-2712)Atg>Ttg	p.M904L	HIP1_ENST00000434438.2_Missense_Mutation_p.M853L	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	904	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.|Important for actin binding. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GAACACACCATTAGCTCCTCA	0.527			T	PDGFRB	CMML																																p.M904L		Atlas-SNP	.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	91	.	0			c.A2710T						.						127.0	115.0	119.0					7																	75174049		2203	4300	6503	SO:0001583	missense	3092	exon27			ACACCATTAGCTC	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2710A>T	chr7.hg19:g.75174049T>A	ENSP00000336747:p.Met904Leu	87.0	0.0		101.0	34.0	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	hg19	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	T	15.87	2.960048	0.53400	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.38887	1.11;1.11	5.6	4.42	0.53409	I/LWEQ (4);	0.036491	0.85682	D	0.000000	T	0.40473	0.1118	L	0.56769	1.78	0.45318	D	0.998316	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.005	T	0.28902	-1.0029	10	0.72032	D	0.01	-29.6369	11.6222	0.51124	0.0:0.0:0.1493:0.8507	.	853;904	E7ES17;O00291	.;HIP1_HUMAN	L	904;853	ENSP00000336747:M904L;ENSP00000410300:M853L	ENSP00000336747:M904L	M	-	1	0	HIP1	75011985	1.000000	0.71417	0.900000	0.35374	0.985000	0.73830	4.906000	0.63293	0.926000	0.37118	0.533000	0.62120	ATG	.	.		0.527	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
SLC26A4	5172	hgsc.bcm.edu	37	7	107350597	107350597	+	Missense_Mutation	SNP	C	C	G	rs397516428		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr7:107350597C>G	ENST00000265715.3	+	19	2412	c.2188C>G	c.(2188-2190)Cag>Gag	p.Q730E	SLC26A4_ENST00000543100.1_Missense_Mutation_p.Q299E|SLC26A4_ENST00000544569.1_Missense_Mutation_p.Q317E|SLC26A4_ENST00000541474.1_Missense_Mutation_p.Q291E	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	730					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						ACTCTATCTACAGAACCAAGT	0.363									Pendred syndrome																												p.Q730E		Atlas-SNP	.											.	SLC26A4	117	.	0			c.C2188G						.						109.0	101.0	104.0					7																	107350597		2203	4300	6503	SO:0001583	missense	5172	exon19	Familial Cancer Database	Goiter-Deafness syndrome	TATCTACAGAACC	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.2188C>G	chr7.hg19:g.107350597C>G	ENSP00000265715:p.Gln730Glu	130.0	0.0		134.0	62.0	NM_000441	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	hg19	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858313	0.32791	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.95001	-3.19;-3.5;-3.55;-3.58	5.51	5.51	0.81932	.	0.216865	0.39146	N	0.001458	D	0.87103	0.6094	N	0.08118	0	0.29625	N	0.845925	B;B;B	0.09022	0.002;0.002;0.0	B;B;B	0.09377	0.004;0.003;0.001	T	0.77027	-0.2740	10	0.23302	T	0.38	.	15.287	0.73835	0.0:0.8604:0.1396:0.0	.	291;317;730	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	E	730;291;317;299	ENSP00000265715:Q730E;ENSP00000439743:Q291E;ENSP00000437427:Q317E;ENSP00000441209:Q299E	ENSP00000265715:Q730E	Q	+	1	0	SLC26A4	107137833	0.741000	0.28217	1.000000	0.80357	0.988000	0.76386	0.614000	0.24314	2.747000	0.94245	0.650000	0.86243	CAG	.	.		0.363	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
WDR91	29062	hgsc.bcm.edu	37	7	134874129	134874129	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr7:134874129T>C	ENST00000354475.4	-	12	1766	c.1735A>G	c.(1735-1737)Aca>Gca	p.T579A	WDR91_ENST00000344400.5_Missense_Mutation_p.T579A|WDR91_ENST00000423565.1_Missense_Mutation_p.T544A	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	579										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						GCTGCCCCTGTGACCAGCAGG	0.468																																					p.T579A		Atlas-SNP	.											.	WDR91	82	.	0			c.A1735G						.						124.0	105.0	111.0					7																	134874129		2203	4300	6503	SO:0001583	missense	29062	exon12			CCCCTGTGACCAG	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1735A>G	chr7.hg19:g.134874129T>C	ENSP00000346466:p.Thr579Ala	127.0	0.0		140.0	53.0	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	hg19	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746033	0.69418	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	T;T;T	0.66815	-0.23;-0.23;-0.23	4.62	3.44	0.39384	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.138419	0.64402	D	0.000003	T	0.71804	0.3383	M	0.64630	1.985	0.54753	D	0.999984	D	0.58268	0.982	P	0.54544	0.755	T	0.72544	-0.4261	10	0.54805	T	0.06	-12.018	10.8422	0.46722	0.1414:0.0:0.0:0.8586	.	579	A4D1P6	WDR91_HUMAN	A	579;579;544	ENSP00000340877:T579A;ENSP00000346466:T579A;ENSP00000392555:T544A	ENSP00000340877:T579A	T	-	1	0	WDR91	134524669	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.936000	0.70153	0.875000	0.35847	0.533000	0.62120	ACA	.	.		0.468	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
ATAD2	29028	hgsc.bcm.edu	37	8	124335222	124335222	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr8:124335222T>C	ENST00000287394.5	-	27	4194	c.4087A>G	c.(4087-4089)Att>Gtt	p.I1363V	ATAD2_ENST00000521903.1_Missense_Mutation_p.I681V	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1363					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TGCCGATAAATACATTGGCTG	0.308																																					p.I1363V		Atlas-SNP	.											.	ATAD2	160	.	0			c.A4087G						.						149.0	140.0	143.0					8																	124335222		2203	4300	6503	SO:0001583	missense	29028	exon27			GATAAATACATTG	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.4087A>G	chr8.hg19:g.124335222T>C	ENSP00000287394:p.Ile1363Val	86.0	0.0		338.0	273.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	hg19	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.923980	0.73213	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	D;T	0.94330	-3.4;1.07	5.66	5.66	0.87406	.	0.251992	0.43919	N	0.000514	D	0.91901	0.7436	M	0.71206	2.165	0.45035	D	0.998055	P	0.49559	0.925	B	0.38683	0.279	D	0.92303	0.5851	10	0.51188	T	0.08	-20.9848	15.5544	0.76180	0.0:0.0:0.0:1.0	.	1363	Q6PL18	ATAD2_HUMAN	V	1363;681	ENSP00000287394:I1363V;ENSP00000429213:I681V	ENSP00000287394:I1363V	I	-	1	0	ATAD2	124404403	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.212000	0.58514	2.143000	0.66587	0.533000	0.62120	ATT	.	.		0.308	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
FAM135B	51059	hgsc.bcm.edu	37	8	139263244	139263244	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr8:139263244C>A	ENST00000395297.1	-	6	552	c.382G>T	c.(382-384)Gct>Tct	p.A128S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	128										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGTGCCCCAGCCACATCCCTC	0.577										HNSCC(54;0.14)																											p.A128S		Atlas-SNP	.											.	FAM135B	423	.	0			c.G382T						.						86.0	98.0	94.0					8																	139263244		2152	4250	6402	SO:0001583	missense	51059	exon6			CCCCAGCCACATC	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.382G>T	chr8.hg19:g.139263244C>A	ENSP00000378710:p.Ala128Ser	84.0	0.0		310.0	45.0	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	hg19	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	5.616	0.298356	0.10622	.	.	ENSG00000147724	ENST00000395297;ENST00000160713	T	0.13538	2.58	5.61	1.61	0.23674	.	0.291323	0.31601	N	0.007368	T	0.03390	0.0098	N	0.02539	-0.55	0.09310	N	1	B	0.18461	0.028	B	0.21360	0.034	T	0.38993	-0.9635	10	0.07482	T	0.82	-12.3262	2.0699	0.03611	0.1163:0.4419:0.2154:0.2264	.	128	Q49AJ0	F135B_HUMAN	S	128	ENSP00000378710:A128S	ENSP00000160713:A128S	A	-	1	0	FAM135B	139332426	0.737000	0.28175	0.931000	0.37212	0.587000	0.36485	0.433000	0.21477	0.310000	0.22990	0.655000	0.94253	GCT	.	.		0.577	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
PTK2	5747	hgsc.bcm.edu	37	8	141745494	141745494	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr8:141745494T>C	ENST00000522684.1	-	22	2115	c.1886A>G	c.(1885-1887)aAt>aGt	p.N629S	PTK2_ENST00000517887.1_Missense_Mutation_p.N673S|PTK2_ENST00000519465.1_Missense_Mutation_p.N257S|PTK2_ENST00000521059.1_Missense_Mutation_p.N629S|PTK2_ENST00000535192.1_Missense_Mutation_p.N629S|PTK2_ENST00000519419.1_Missense_Mutation_p.N673S|PTK2_ENST00000395218.2_Missense_Mutation_p.N629S|PTK2_ENST00000538769.1_Missense_Mutation_p.N297S|MIR151A_ENST00000521276.1_RNA|PTK2_ENST00000340930.3_Missense_Mutation_p.N629S	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	629	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GATTACATCATTGTTCTTCAC	0.443																																					p.N651S		Atlas-SNP	.											.	PTK2	311	.	0			c.A1952G						.						171.0	145.0	154.0					8																	141745494		2203	4300	6503	SO:0001583	missense	5747	exon22			ACATCATTGTTCT	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1886A>G	chr8.hg19:g.141745494T>C	ENSP00000429911:p.Asn629Ser	106.0	0.0		218.0	153.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	hg19	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.238905	0.79800	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207	D;D;D;D;D;D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.51	5.51	0.81932	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75287	0.3829	N	0.11651	0.15	0.58432	D	0.999999	P;P;B;P;B;P;B;B;B;B	0.48162	0.906;0.883;0.16;0.887;0.092;0.861;0.16;0.094;0.019;0.008	P;P;B;P;B;B;B;B;B;B	0.49953	0.627;0.49;0.096;0.52;0.151;0.438;0.09;0.171;0.029;0.011	T	0.73780	-0.3875	10	0.16896	T	0.51	.	15.6208	0.76805	0.0:0.0:0.0:1.0	.	629;324;549;629;651;629;581;477;297;257	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	S	629;629;257;673;629;581;629;550;324;301;629;297;673;327;475	ENSP00000429911:N629S;ENSP00000438009:N629S;ENSP00000429170:N257S;ENSP00000429082:N673S;ENSP00000429474:N629S;ENSP00000378644:N629S;ENSP00000428492:N301S;ENSP00000341189:N629S;ENSP00000445742:N297S;ENSP00000429129:N673S;ENSP00000430603:N327S	ENSP00000341189:N629S	N	-	2	0	PTK2	141814676	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.859000	0.86982	2.098000	0.63641	0.533000	0.62120	AAT	.	.		0.443	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
CDKN2A	1029	hgsc.bcm.edu	37	9	21971108	21971108	+	Missense_Mutation	SNP	C	C	A	rs11552822		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr9:21971108C>A	ENST00000304494.5	-	2	520	c.250G>T	c.(250-252)Gac>Tac	p.D84Y	CDKN2A_ENST00000494262.1_Missense_Mutation_p.D33Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.D84Y|CDKN2A_ENST00000479692.2_Missense_Mutation_p.D33Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.D33Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.R98L|CDKN2A_ENST00000530628.2_Missense_Mutation_p.R98L|CDKN2A_ENST00000497750.1_Missense_Mutation_p.D33Y|CDKN2A_ENST00000498124.1_Missense_Mutation_p.D84Y|CDKN2A_ENST00000498628.2_Missense_Mutation_p.D33Y|CDKN2A_ENST00000579122.1_Missense_Mutation_p.D84Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.R139L|RP11-145E5.5_ENST00000404796.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	84			D -> E (in a bladder tumor).|D -> H (in non-small cell lung carcinoma). {ECO:0000269|PubMed:8060323}.|D -> N (in an esophagus, a head and neck and a lung tumor).|D -> Y (in CMM2; also found in a lung and a prostate tumor; dbSNP:rs11552822). {ECO:0000269|PubMed:10874641}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.D84Y(11)|p.D84N(7)|p.D84fs*63(2)|p.D84H(2)|p.H83fs*2(2)|p.R139Q(2)|p.D84fs*1(1)|p.D84_F90del(1)|p.R139L(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGGGCAGCGTCGTGCACGGGT	0.741	D84Y(DU145_PROSTATE)|D84Y(LK2_LUNG)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.R98L		Atlas-SNP	.											CDKN2A_ENST00000498124,left_upper_lobe,carcinoma,0,3	CDKN2A	4810	.	1396	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(23)|Deletion - Frameshift(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(283)|skin(175)|central_nervous_system(170)|lung(154)|urinary_tract(91)|bone(74)|soft_tissue(57)|oesophagus(54)|upper_aerodigestive_tract(52)|pleura(51)|ovary(36)|kidney(32)|breast(32)|pancreas(30)|biliary_tract(15)|thyroid(13)|NS(12)|stomach(12)|prostate(11)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|genital_tract(1)	c.G293T	GRCh37	CM085316|CM990358	CDKN2A	M	rs11552822	.						13.0	16.0	15.0					9																	21971108		2178	4258	6436	SO:0001583	missense	1029	exon2			CAGCGTCGTGCAC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.250G>T	chr9.hg19:g.21971108C>A	ENSP00000307101:p.Asp84Tyr	113.0	0.0		104.0	43.0	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	hg19	CCDS6510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.137500|5.137500	0.94517|0.94517	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000304494;ENST00000446177|ENST00000361570;ENST00000530628	D;D|D;D	0.94232|0.84070	-3.38;-3.38|-1.8;-1.73	5.93|5.93	5.93|5.93	0.95920|0.95920	Ankyrin repeat-containing domain (4);|.	.|0.000000	.|0.30428	.|N	.|0.009646	D|D	0.87744|0.87744	0.6254|0.6254	L|L	0.32530|0.32530	0.975|0.975	0.49213|0.49213	D|D	0.999766|0.999766	D|D	0.89917|0.89917	1.0|1.0	D|D	0.97110|0.91635	1.0|0.999	D|D	0.88398|0.88398	0.3013|0.3013	9|10	0.02654|0.87932	T|D	1|0	-18.6892|-18.6892	19.1221|19.1221	0.93367|0.93367	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	rs11552822|rs11552822	84|139	P42771|Q8N726	CD2A1_HUMAN|CD2A2_HUMAN	Y|L	84|139;98	ENSP00000307101:D84Y;ENSP00000394932:D84Y|ENSP00000355153:R139L;ENSP00000432664:R98L	ENSP00000307101:D84Y|ENSP00000355153:R139L	D|R	-|-	1|2	0|0	CDKN2A|CDKN2A	21961108|21961108	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	6.879000|6.879000	0.75572|0.75572	2.808000|2.808000	0.96608|0.96608	0.655000|0.655000	0.94253|0.94253	GAC|CGA	.	C|1.000;|0.000		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
UBE2R2	54926	hgsc.bcm.edu	37	9	33922747	33922747	+	IGR	SNP	A	A	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr9:33922747A>T	ENST00000263228.3	+	0	4075				UBAP2_ENST00000379235.1_Missense_Mutation_p.L307M|UBAP2_ENST00000539807.1_Missense_Mutation_p.L823M|UBAP2_ENST00000379239.4_Missense_Mutation_p.L801M|UBAP2_ENST00000379238.1_Missense_Mutation_p.L1068M|UBAP2_ENST00000360802.1_Missense_Mutation_p.L1068M|UBAP2_ENST00000449054.1_Missense_Mutation_p.L1068M	NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2						protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		TGGGCTGGCAAGATGTGTAGG	0.657																																					p.L1068M		Atlas-SNP	.											.	UBAP2	82	.	0			c.T3202A						.						65.0	75.0	71.0					9																	33922747		2203	4300	6503	SO:0001628	intergenic_variant	55833	exon28			CTGGCAAGATGTG	AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797		chr9.hg19:g.33922747A>T		56.0	0.0		69.0	37.0	NM_018449	D3DRL5|Q9NX64	Missense_Mutation	SNP	ENST00000263228.3	hg19	CCDS6546.1	.	.	.	.	.	.	.	.	.	.	A	12.50	1.957106	0.34565	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379235;ENST00000379239;ENST00000539807;ENST00000351580	T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63	5.65	2.4	0.29515	.	0.065811	0.64402	N	0.000006	T	0.28699	0.0711	N	0.20357	0.565	0.80722	D	1	P;P;P;P	0.42785	0.565;0.79;0.79;0.686	B;B;B;B	0.40256	0.324;0.324;0.324;0.133	T	0.02345	-1.1173	10	0.28530	T	0.3	-5.8834	7.6108	0.28129	0.1029:0.0:0.7484:0.1487	.	823;801;977;1068	F5H2U4;A6NCA8;F5H2C8;Q5T6F2	.;.;.;UBAP2_HUMAN	M	1068;1068;1068;977;307;801;823;502	ENSP00000368540:L1068M;ENSP00000416932:L1068M;ENSP00000354039:L1068M;ENSP00000368537:L307M;ENSP00000368541:L801M;ENSP00000439329:L823M	ENSP00000259602:L502M	L	-	1	2	UBAP2	33912747	1.000000	0.71417	0.997000	0.53966	0.341000	0.28922	2.938000	0.48987	0.291000	0.22468	0.533000	0.62120	TTG	.	.		0.657	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052118.1	NM_017811	
FOXE1	2304	hgsc.bcm.edu	37	9	100616728	100616728	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr9:100616728G>A	ENST00000375123.3	+	1	1193	c.532G>A	c.(532-534)Gcc>Acc	p.A178T		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	178	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				cgccgccgccgccgccATCTT	0.791																																					p.A178T		Atlas-SNP	.											.	FOXE1	19	.	0			c.G532A						.						2.0	2.0	2.0					9																	100616728		529	1359	1888	SO:0001583	missense	2304	exon1			GCCGCCGCCGCCA	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.532G>A	chr9.hg19:g.100616728G>A	ENSP00000364265:p.Ala178Thr	123.0	0.0		212.0	14.0	NM_004473	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	hg19	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930555	0.52866	.	.	ENSG00000178919	ENST00000375123	D	0.93953	-3.32	3.94	3.02	0.34903	.	0.612880	0.14474	U	0.317365	D	0.83087	0.5178	L	0.34521	1.04	0.22571	N	0.998979	P	0.47253	0.892	B	0.30251	0.113	T	0.72969	-0.4130	10	0.13108	T	0.6	.	6.9037	0.24297	0.0993:0.1791:0.7216:0.0	.	178	O00358	FOXE1_HUMAN	T	178	ENSP00000364265:A178T	ENSP00000364265:A178T	A	+	1	0	FOXE1	99656549	0.087000	0.21565	0.898000	0.35279	0.822000	0.46500	0.422000	0.21296	0.758000	0.33059	0.557000	0.71058	GCC	.	.		0.791	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1		
RABL6	55684	hgsc.bcm.edu	37	9	139733868	139733868	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr9:139733868C>A	ENST00000311502.7	+	12	1924	c.1688C>A	c.(1687-1689)gCa>gAa	p.A563E	RABL6_ENST00000371663.4_Missense_Mutation_p.A564E|RABL6_ENST00000371675.3_Missense_Mutation_p.A448E|RABL6_ENST00000357466.2_Intron|RABL6_ENST00000432842.2_3'UTR			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	563					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCCATTGCTGCACAAATGCTG	0.642																																					p.A564E		Atlas-SNP	.											.	.	.	.	0			c.C1691A						.						36.0	43.0	40.0					9																	139733868		2124	4246	6370	SO:0001583	missense	55684	exon12			TTGCTGCACAAAT	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1688C>A	chr9.hg19:g.139733868C>A	ENSP00000311134:p.Ala563Glu	124.0	0.0		146.0	98.0	NM_001173988	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	ENST00000311502.7	hg19	CCDS48058.1	.	.	.	.	.	.	.	.	.	.	.	14.65	2.598707	0.46318	.	.	ENSG00000196642	ENST00000371663;ENST00000311502;ENST00000371675;ENST00000435930	T;T;T;T	0.64618	-0.1;-0.11;-0.1;-0.1	4.46	4.46	0.54185	.	0.290065	0.34725	N	0.003737	T	0.73690	0.3619	L	0.57536	1.79	0.36204	D	0.850934	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.983;0.963	T	0.75156	-0.3417	10	0.21014	T	0.42	-27.9152	15.6762	0.77326	0.0:1.0:0.0:0.0	.	357;564;563	B1AMX5;Q3YEC7-2;Q3YEC7	.;.;PARF_HUMAN	E	564;563;448;357	ENSP00000360727:A564E;ENSP00000311134:A563E;ENSP00000360740:A448E;ENSP00000408442:A357E	ENSP00000311134:A563E	A	+	2	0	C9orf86	138853689	0.874000	0.30092	0.999000	0.59377	0.253000	0.25986	4.122000	0.57910	2.037000	0.60232	0.462000	0.41574	GCA	.	.		0.642	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
RABL6	55684	hgsc.bcm.edu	37	9	139733888	139733888	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr9:139733888A>C	ENST00000311502.7	+	12	1944	c.1708A>C	c.(1708-1710)Atg>Ctg	p.M570L	RABL6_ENST00000371663.4_Missense_Mutation_p.M571L|RABL6_ENST00000371675.3_Missense_Mutation_p.M455L|RABL6_ENST00000357466.2_Intron|RABL6_ENST00000432842.2_3'UTR			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	570					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GTCCTTCGTCATGGATGACCC	0.647																																					p.M571L		Atlas-SNP	.											.	.	.	.	0			c.A1711C						.						36.0	41.0	39.0					9																	139733888		2124	4243	6367	SO:0001583	missense	55684	exon12			TTCGTCATGGATG	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1708A>C	chr9.hg19:g.139733888A>C	ENSP00000311134:p.Met570Leu	129.0	0.0		166.0	108.0	NM_001173988	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	ENST00000311502.7	hg19	CCDS48058.1	.	.	.	.	.	.	.	.	.	.	.	18.14	3.558594	0.65538	.	.	ENSG00000196642	ENST00000371663;ENST00000311502;ENST00000371675;ENST00000435930	T;T;T;T	0.74632	-0.59;-0.62;-0.61;-0.86	4.46	3.29	0.37713	.	0.000000	0.85682	D	0.000000	D	0.82857	0.5128	M	0.78049	2.395	0.58432	D	0.999993	D;P;P	0.56746	0.977;0.91;0.855	D;D;P	0.69654	0.965;0.909;0.813	T	0.79533	-0.1764	10	0.29301	T	0.29	-35.0482	10.0402	0.42153	0.8298:0.1702:0.0:0.0	.	364;571;570	B1AMX5;Q3YEC7-2;Q3YEC7	.;.;PARF_HUMAN	L	571;570;455;364	ENSP00000360727:M571L;ENSP00000311134:M570L;ENSP00000360740:M455L;ENSP00000408442:M364L	ENSP00000311134:M570L	M	+	1	0	C9orf86	138853709	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	5.018000	0.64054	0.562000	0.29204	-0.648000	0.03929	ATG	.	.		0.647	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
ADARB2	105	hgsc.bcm.edu	37	10	1405703	1405703	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr10:1405703G>T	ENST00000381312.1	-	3	922	c.597C>A	c.(595-597)caC>caA	p.H199Q	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	199					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		ccATGGCCAGGTGCGCCTGGC	0.711																																					p.H199Q		Atlas-SNP	.											.	ADARB2	95	.	0			c.C597A						.						18.0	18.0	18.0					10																	1405703		2199	4299	6498	SO:0001583	missense	105	exon3			GGCCAGGTGCGCC	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.597C>A	chr10.hg19:g.1405703G>T	ENSP00000370713:p.His199Gln	115.0	0.0		131.0	55.0	NM_018702	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	hg19	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627245	0.28978	.	.	ENSG00000185736	ENST00000381312	T	0.25085	1.82	5.15	1.07	0.20283	.	0.046737	0.85682	N	0.000000	T	0.27063	0.0663	M	0.70595	2.14	0.80722	D	1	B	0.13145	0.007	B	0.17722	0.019	T	0.06391	-1.0829	10	0.52906	T	0.07	-23.5633	10.1953	0.43051	0.1288:0.2205:0.6507:0.0	.	199	Q9NS39	RED2_HUMAN	Q	199	ENSP00000370713:H199Q	ENSP00000370713:H199Q	H	-	3	2	ADARB2	1395703	1.000000	0.71417	0.531000	0.27976	0.776000	0.43924	2.332000	0.43903	-0.302000	0.08869	-1.134000	0.01955	CAC	.	.		0.711	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
CUBN	8029	hgsc.bcm.edu	37	10	17087153	17087153	+	Silent	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr10:17087153C>A	ENST00000377833.4	-	25	3590	c.3525G>T	c.(3523-3525)acG>acT	p.T1175T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1175	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGATATGAACGTGCCGCTTG	0.478																																					p.T1175T		Atlas-SNP	.											.	CUBN	515	.	0			c.G3525T						.						158.0	147.0	151.0					10																	17087153		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon25			TATGAACGTGCCG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.3525G>T	chr10.hg19:g.17087153C>A		162.0	0.0		158.0	63.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.		0.478	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CUBN	8029	hgsc.bcm.edu	37	10	17113590	17113590	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr10:17113590T>G	ENST00000377833.4	-	19	2525	c.2460A>C	c.(2458-2460)gaA>gaC	p.E820D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	820	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTCCAGTTAATTCATCCCCGC	0.408																																					p.E820D		Atlas-SNP	.											.	CUBN	515	.	0			c.A2460C						.						50.0	52.0	52.0					10																	17113590		2203	4300	6503	SO:0001583	missense	8029	exon19			AGTTAATTCATCC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2460A>C	chr10.hg19:g.17113590T>G	ENSP00000367064:p.Glu820Asp	34.0	0.0		35.0	15.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.293445	0.40594	.	.	ENSG00000107611	ENST00000377833	T	0.18502	2.21	5.31	-3.33	0.04958	CUB (5);	0.629948	0.12957	N	0.425337	T	0.10035	0.0246	L	0.34521	1.04	0.09310	N	1	B	0.30439	0.279	B	0.31869	0.137	T	0.33599	-0.9862	10	0.23891	T	0.37	.	6.1085	0.20087	0.1057:0.5383:0.1506:0.2054	.	820	O60494	CUBN_HUMAN	D	820	ENSP00000367064:E820D	ENSP00000367064:E820D	E	-	3	2	CUBN	17153596	0.004000	0.15560	0.005000	0.12908	0.827000	0.46813	-0.095000	0.11077	-0.522000	0.06417	0.411000	0.27672	GAA	.	.		0.408	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CTNNA3	29119	hgsc.bcm.edu	37	10	69407267	69407267	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr10:69407267G>A	ENST00000433211.2	-	2	179	c.5C>T	c.(4-6)tCa>tTa	p.S2L	CTNNA3_ENST00000545309.1_Missense_Mutation_p.S2L|CTNNA3_ENST00000373744.4_Missense_Mutation_p.S2L	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TGTTTCAGCTGACATGCTGCC	0.388																																					p.S2L		Atlas-SNP	.											.	CTNNA3	401	.	0			c.C5T						.						138.0	130.0	133.0					10																	69407267		2203	4300	6503	SO:0001583	missense	29119	exon2			TCAGCTGACATGC	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.5C>T	chr10.hg19:g.69407267G>A	ENSP00000389714:p.Ser2Leu	54.0	0.0		55.0	26.0	NM_013266		Missense_Mutation	SNP	ENST00000433211.2	hg19	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680412	0.47886	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309;ENST00000330298;ENST00000540598	T;T;T;T	0.60171	1.37;1.37;0.49;0.21	5.71	5.71	0.89125	.	0.254034	0.23736	N	0.045067	T	0.52370	0.1730	L	0.43152	1.355	0.31834	N	0.624397	B;P;B	0.35575	0.437;0.51;0.041	B;B;B	0.33620	0.14;0.167;0.023	T	0.65393	-0.6179	10	0.87932	D	0	-4.4896	16.7673	0.85527	0.0:0.0:1.0:0.0	.	2;2;2	F2Z2R0;Q9UI47-2;Q9UI47	.;.;CTNA3_HUMAN	L	2	ENSP00000389714:S2L;ENSP00000362849:S2L;ENSP00000441444:S2L;ENSP00000330570:S2L	ENSP00000330570:S2L	S	-	2	0	CTNNA3	69077273	1.000000	0.71417	0.984000	0.44739	0.442000	0.32017	5.536000	0.67180	2.688000	0.91661	0.655000	0.94253	TCA	.	.		0.388	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
KIF11	3832	hgsc.bcm.edu	37	10	94373259	94373259	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr10:94373259A>T	ENST00000260731.3	+	8	1005	c.915A>T	c.(913-915)agA>agT	p.R305S		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	305	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTGTAGAAAGAACACCTCATG	0.428																																					p.R305S	Colon(47;212 1003 2764 4062 8431)	Atlas-SNP	.											.	KIF11	58	.	0			c.A915T						.						98.0	99.0	99.0					10																	94373259		2203	4300	6503	SO:0001583	missense	3832	exon8			AGAAAGAACACCT	X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.915A>T	chr10.hg19:g.94373259A>T	ENSP00000260731:p.Arg305Ser	107.0	0.0		96.0	43.0	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Missense_Mutation	SNP	ENST00000260731.3	hg19	CCDS7422.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.993775	0.74703	.	.	ENSG00000138160	ENST00000260731	D	0.85258	-1.96	5.58	5.58	0.84498	Kinesin, motor domain (3);	0.107189	0.64402	D	0.000005	T	0.80854	0.4703	L	0.31065	0.9	0.58432	D	0.999991	P	0.38788	0.647	B	0.40534	0.332	T	0.83177	-0.0091	10	0.72032	D	0.01	.	15.7561	0.78025	1.0:0.0:0.0:0.0	.	305	P52732	KIF11_HUMAN	S	305	ENSP00000260731:R305S	ENSP00000260731:R305S	R	+	3	2	KIF11	94363239	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.298000	0.51818	2.115000	0.64714	0.482000	0.46254	AGA	.	.		0.428	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
COX15	1355	hgsc.bcm.edu	37	10	101491746	101491746	+	Silent	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr10:101491746G>A	ENST00000016171.5	-	1	111	c.61C>T	c.(61-63)Ctg>Ttg	p.L21L	COX15_ENST00000370483.5_Silent_p.L21L|CUTC_ENST00000370476.5_5'Flank|CUTC_ENST00000493385.1_Intron			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	21					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		CTAGGAGCCAGGAGCGGCAGA	0.607																																					p.L21L		Atlas-SNP	.											.	COX15	25	.	0			c.C61T						.						35.0	28.0	30.0					10																	101491746		2203	4300	6503	SO:0001819	synonymous_variant	1355	exon1			GAGCCAGGAGCGG	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.61C>T	chr10.hg19:g.101491746G>A		181.0	0.0		183.0	96.0	NM_078470	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Silent	SNP	ENST00000016171.5	hg19	CCDS7482.1																																																																																			.	.		0.607	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
OTUB1	55611	hgsc.bcm.edu	37	11	63765004	63765004	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr11:63765004A>G	ENST00000538426.1	+	7	846	c.802A>G	c.(802-804)Atc>Gtc	p.I268V	OTUB1_ENST00000428192.2_Missense_Mutation_p.I268V|OTUB1_ENST00000543004.1_Missense_Mutation_p.I277V|OTUB1_ENST00000541478.1_Missense_Mutation_p.I167V|OTUB1_ENST00000422031.2_Missense_Mutation_p.I305V|OTUB1_ENST00000543988.1_Missense_Mutation_p.I238V|OTUB1_ENST00000535715.1_Intron	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	268	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						ACACTACGATATCCTCTACAA	0.597																																					p.I268V		Atlas-SNP	.											.	OTUB1	19	.	0			c.A802G						.						71.0	70.0	70.0					11																	63765004		2201	4297	6498	SO:0001583	missense	55611	exon7			TACGATATCCTCT	AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.802A>G	chr11.hg19:g.63765004A>G	ENSP00000444357:p.Ile268Val	60.0	0.0		25.0	18.0	NM_017670	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	ENST00000538426.1	hg19	CCDS8055.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.773126	0.49680	.	.	ENSG00000167770	ENST00000541478;ENST00000428192;ENST00000422031;ENST00000538426;ENST00000543004;ENST00000543988	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.17	2.72	0.32119	Ovarian tumour, otubain (1);	0.000000	0.85682	D	0.000000	T	0.41419	0.1158	M	0.62723	1.935	0.47276	D	0.999378	B;B;P;B	0.40066	0.441;0.219;0.701;0.441	B;B;B;B	0.38056	0.198;0.131;0.264;0.198	T	0.19031	-1.0318	10	0.46703	T	0.11	.	7.8337	0.29358	0.7197:0.1433:0.0:0.137	.	305;167;312;268	B4DPD5;F5H3F0;Q96FW1-2;Q96FW1	.;.;.;OTUB1_HUMAN	V	167;268;305;268;277;238	ENSP00000439142:I167V;ENSP00000402551:I268V;ENSP00000416973:I305V;ENSP00000444357:I268V;ENSP00000437453:I277V;ENSP00000441328:I238V	ENSP00000416973:I305V	I	+	1	0	OTUB1	63521580	1.000000	0.71417	0.709000	0.30452	0.983000	0.72400	8.909000	0.92647	0.331000	0.23511	0.379000	0.24179	ATC	.	.		0.597	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396277.1	NM_017670	
TAS2R13	50838	hgsc.bcm.edu	37	12	11061798	11061798	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:11061798C>A	ENST00000390677.2	-	1	363	c.100G>T	c.(100-102)Gac>Tac	p.D34Y	PRR4_ENST00000536668.1_Intron	NM_023920.2	NP_076409.1	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	34					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						CTGACCCAGTCAATGCAGTTG	0.398																																					p.D34Y		Atlas-SNP	.											.	TAS2R13	29	.	0			c.G100T						.						61.0	57.0	58.0					12																	11061798		2203	4300	6503	SO:0001583	missense	50838	exon1			CCCAGTCAATGCA	AF227137	CCDS8635.1	12p13	2012-08-22			ENSG00000212128	ENSG00000212128		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14919	protein-coding gene	gene with protein product		604792				10761934, 10766242	Standard	NM_023920		Approved	T2R13, TRB3	uc001qzg.1	Q9NYV9		ENST00000390677.2:c.100G>T	chr12.hg19:g.11061798C>A	ENSP00000375095:p.Asp34Tyr	70.0	0.0		72.0	29.0	NM_023920	Q4G0I5|Q502V8|Q645X2	Missense_Mutation	SNP	ENST00000390677.2	hg19	CCDS8635.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062554	0.36373	.	.	ENSG00000212128	ENST00000390677	T	0.01059	5.39	3.3	1.35	0.21983	.	0.984368	0.08250	U	0.974697	T	0.07188	0.0182	M	0.89785	3.06	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.22521	-1.0214	10	0.87932	D	0	.	3.9964	0.09559	0.0:0.6067:0.2516:0.1417	.	34	Q9NYV9	T2R13_HUMAN	Y	34	ENSP00000375095:D34Y	ENSP00000375095:D34Y	D	-	1	0	TAS2R13	10953065	0.000000	0.05858	0.001000	0.08648	0.925000	0.55904	0.170000	0.16663	0.653000	0.30826	0.655000	0.94253	GAC	.	.		0.398	TAS2R13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400229.1		
KIAA1551	55196	hgsc.bcm.edu	37	12	32134716	32134716	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:32134716G>A	ENST00000312561.4	+	4	1241	c.827G>A	c.(826-828)aGa>aAa	p.R276K	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	276																	ACTGACAAAAGACCTCCTCCT	0.418																																					p.R276K		Atlas-SNP	.											.	.	.	.	0			c.G827A						.						95.0	93.0	93.0					12																	32134716		2203	4300	6503	SO:0001583	missense	55196	exon4			ACAAAAGACCTCC	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.827G>A	chr12.hg19:g.32134716G>A	ENSP00000310338:p.Arg276Lys	64.0	0.0		79.0	24.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	hg19	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936031	0.73442	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.09817	3.54;2.94	5.68	4.79	0.61399	.	0.254572	0.28198	N	0.016236	T	0.18841	0.0452	L	0.34521	1.04	0.09310	N	1	D	0.61697	0.99	D	0.70935	0.971	T	0.04509	-1.0946	9	.	.	.	.	9.5846	0.39508	0.0927:0.0:0.9073:0.0	.	276	Q9HCM1	CL035_HUMAN	K	276	ENSP00000310338:R276K;ENSP00000370442:R276K	.	R	+	2	0	C12orf35	32025983	0.922000	0.31269	0.489000	0.27452	0.019000	0.09904	1.773000	0.38563	2.672000	0.90937	0.650000	0.86243	AGA	.	.		0.418	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43884211	43884211	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:43884211T>G	ENST00000389420.3	-	7	1103	c.1104A>C	c.(1102-1104)aaA>aaC	p.K368N	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.K368N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	368	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACATGTTACATTTCTCTTTAG	0.219																																					p.K368N		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.A1104C						.						18.0	20.0	19.0					12																	43884211		2138	4209	6347	SO:0001583	missense	80070	exon7			GTTACATTTCTCT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1104A>C	chr12.hg19:g.43884211T>G	ENSP00000374071:p.Lys368Asn	480.0	0.0		458.0	207.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	15.20	2.763144	0.49574	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.63417	-0.04;-0.04	5.18	2.86	0.33363	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.53938	D	0.000044	T	0.53690	0.1812	L	0.37897	1.145	0.80722	D	1	P	0.37663	0.604	P	0.46685	0.524	T	0.50775	-0.8788	10	0.41790	T	0.15	.	3.6962	0.08365	0.0:0.1495:0.2107:0.6398	.	368	P59510	ATS20_HUMAN	N	368	ENSP00000374071:K368N;ENSP00000448341:K368N	ENSP00000374068:K368N	K	-	3	2	ADAMTS20	42170478	0.991000	0.36638	1.000000	0.80357	0.531000	0.34715	0.161000	0.16481	1.047000	0.40274	-0.291000	0.09656	AAA	.	.		0.219	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
KMT2D	8085	hgsc.bcm.edu	37	12	49433090	49433090	+	Silent	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:49433090G>A	ENST00000301067.7	-	33	8280	c.8281C>T	c.(8281-8283)Ctg>Ttg	p.L2761L	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2761					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCTGGCCCCAGGATGGGGCCA	0.602																																					p.L2761L		Atlas-SNP	.											.	MLL2	1173	.	0			c.C8281T						.						33.0	39.0	37.0					12																	49433090		1858	4095	5953	SO:0001819	synonymous_variant	8085	exon33			GCCCCAGGATGGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8281C>T	chr12.hg19:g.49433090G>A		73.0	0.0		102.0	52.0	NM_003482	O14687	Silent	SNP	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.		0.602	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KRT72	140807	hgsc.bcm.edu	37	12	52979915	52979915	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:52979915A>G	ENST00000537672.2	-	9	1397	c.1387T>C	c.(1387-1389)Ttc>Ctc	p.F463L	KRT72_ENST00000354310.4_Missense_Mutation_p.F421L|KRT72_ENST00000293745.2_Missense_Mutation_p.F463L|KRT72_ENST00000398066.3_Missense_Mutation_p.F275L	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	463	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CCCATGCTGAAGCCAGCCCCT	0.592																																					p.F463L		Atlas-SNP	.											.	KRT72	70	.	0			c.T1387C						.						55.0	51.0	53.0					12																	52979915		2203	4300	6503	SO:0001583	missense	140807	exon9			TGCTGAAGCCAGC	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1387T>C	chr12.hg19:g.52979915A>G	ENSP00000441160:p.Phe463Leu	58.0	0.0		58.0	19.0	NM_001146225	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	hg19	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	A	4.366	0.067376	0.08388	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	T;T;T;T	0.81330	-1.41;-1.41;-1.48;-1.14	4.18	4.18	0.49190	.	0.000000	0.36167	N	0.002760	T	0.65144	0.2663	L	0.27053	0.805	0.34788	D	0.735388	B;B	0.29037	0.231;0.131	B;B	0.27608	0.081;0.023	T	0.65455	-0.6164	10	0.11485	T	0.65	.	9.8521	0.41064	1.0:0.0:0.0:0.0	.	421;463	B4DEI8;Q14CN4	.;K2C72_HUMAN	L	463;463;421;275	ENSP00000441160:F463L;ENSP00000293745:F463L;ENSP00000346269:F421L;ENSP00000446151:F275L	ENSP00000293745:F463L	F	-	1	0	KRT72	51266182	1.000000	0.71417	0.978000	0.43139	0.146000	0.21551	2.882000	0.48546	1.902000	0.55061	0.445000	0.29226	TTC	.	.		0.592	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
CNOT2	4848	hgsc.bcm.edu	37	12	70724084	70724084	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:70724084A>G	ENST00000418359.3	+	7	855	c.404A>G	c.(403-405)aAt>aGt	p.N135S	CNOT2_ENST00000229195.3_Missense_Mutation_p.N135S|CNOT2_ENST00000548230.1_3'UTR	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	135					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TTGCCTATGAATCCTAGGAAT	0.403																																					p.N135S		Atlas-SNP	.											.	CNOT2	53	.	0			c.A404G						.						88.0	84.0	86.0					12																	70724084		2203	4300	6503	SO:0001583	missense	4848	exon7			CTATGAATCCTAG	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.404A>G	chr12.hg19:g.70724084A>G	ENSP00000412091:p.Asn135Ser	97.0	0.0		89.0	32.0	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	hg19	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	A	10.49	1.363862	0.24684	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550641;ENST00000548159;ENST00000549750;ENST00000551043;ENST00000551873;ENST00000550194	T;T;T;T	0.44881	0.91;0.91;0.92;0.91	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	L	0.29908	0.895	0.58432	D	0.999994	B	0.11235	0.004	B	0.10450	0.005	T	0.12293	-1.0553	10	0.08381	T	0.77	-7.0579	15.9985	0.80270	1.0:0.0:0.0:0.0	.	135	Q9NZN8	CNOT2_HUMAN	S	135;135;135;115;126;135;135;50;135	ENSP00000229195:N135S;ENSP00000412091:N135S;ENSP00000449659:N126S;ENSP00000449260:N135S	ENSP00000229195:N135S	N	+	2	0	CNOT2	69010351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.145000	0.64839	2.233000	0.73108	0.455000	0.32223	AAT	.	.		0.403	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
CEP290	80184	hgsc.bcm.edu	37	12	88522769	88522769	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:88522769T>C	ENST00000552810.1	-	11	1239	c.896A>G	c.(895-897)gAt>gGt	p.D299G	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.D299G	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	299					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						AATTGGATCATCTTCTTCATT	0.284																																					p.D299G		Atlas-SNP	.											.	CEP290	195	.	0			c.A896G						.						73.0	66.0	68.0					12																	88522769		1817	4067	5884	SO:0001583	missense	80184	exon11			GGATCATCTTCTT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.896A>G	chr12.hg19:g.88522769T>C	ENSP00000448012:p.Asp299Gly	26.0	0.0		38.0	18.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	hg19	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	T	16.18	3.049036	0.55110	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.59083	0.29;0.29	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.68769	0.3037	M	0.64997	1.995	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.73380	0.98;0.943	T	0.65278	-0.6207	10	0.18276	T	0.48	.	11.8163	0.52214	0.0:0.0:0.1462:0.8538	.	299;299	Q05BJ6;O15078	.;CE290_HUMAN	G	299;299;299;201	ENSP00000448012:D299G;ENSP00000308021:D299G	ENSP00000308021:D299G	D	-	2	0	CEP290	87046900	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.715000	0.54897	1.912000	0.55364	0.397000	0.26171	GAT	.	.		0.284	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
PEBP1	5037	hgsc.bcm.edu	37	12	118577335	118577335	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr12:118577335T>A	ENST00000261313.2	+	3	677	c.325T>A	c.(325-327)Tcg>Acg	p.S109T	PEBP1_ENST00000542939.1_3'UTR	NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	109	Interaction with RAF1.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTATGTGGGCTCGGGGCCTCC	0.517																																					p.S109T	NSCLC(44;94 1357 12187 49467)	Atlas-SNP	.											.	PEBP1	13	.	0			c.T325A						.						119.0	107.0	111.0					12																	118577335		2203	4300	6503	SO:0001583	missense	5037	exon3			GTGGGCTCGGGGC	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.325T>A	chr12.hg19:g.118577335T>A	ENSP00000261313:p.Ser109Thr	82.0	0.0		69.0	29.0	NM_002567	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	hg19	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.442332	0.83993	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.42900	0.96	5.43	5.43	0.79202	.	0.053251	0.85682	D	0.000000	T	0.60209	0.2251	M	0.88377	2.95	0.58432	D	0.999992	P;P	0.37233	0.588;0.506	P;B	0.45167	0.472;0.338	T	0.67473	-0.5662	10	0.66056	D	0.02	.	15.4783	0.75504	0.0:0.0:0.0:1.0	.	109;109	B4DRT4;P30086	.;PEBP1_HUMAN	T	109	ENSP00000261313:S109T	ENSP00000261313:S109T	S	+	1	0	PEBP1	117061718	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.754000	0.68743	2.057000	0.61298	0.460000	0.39030	TCG	.	.		0.517	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401405.1	NM_002567	
PSMC6	5706	hgsc.bcm.edu	37	14	53185036	53185036	+	Silent	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr14:53185036A>G	ENST00000606149.1	+	9	697	c.681A>G	c.(679-681)ccA>ccG	p.P227P	PSMC6_ENST00000445930.2_Silent_p.P241P	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	227					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					ATCATCAACCATGCATCATTT	0.318																																					p.P241P		Atlas-SNP	.											.	PSMC6	71	.	0			c.A723G						.						94.0	99.0	97.0					14																	53185036		2203	4300	6503	SO:0001819	synonymous_variant	5706	exon9			TCAACCATGCATC		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.681A>G	chr14.hg19:g.53185036A>G		120.0	0.0		114.0	54.0	NM_002806	B2R975|P49719|Q6IBU3|Q92524	Silent	SNP	ENST00000606149.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.958	1.221936	0.22457	.	.	ENSG00000100519	ENST00000555339;ENST00000556813	.	.	.	5.03	2.66	0.31614	.	.	.	.	.	T	0.52306	0.1726	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44406	-0.9330	4	.	.	.	.	5.0424	0.14465	0.5389:0.2292:0.2319:0.0	.	.	.	.	V	188;227	.	.	M	+	1	0	PSMC6	52254786	0.464000	0.25807	1.000000	0.80357	0.990000	0.78478	-0.108000	0.10857	0.869000	0.35703	0.482000	0.46254	ATG	.	.		0.318	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1	NM_002806	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102453099	102453099	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr14:102453099A>G	ENST00000360184.4	+	8	2701	c.2537A>G	c.(2536-2538)aAg>aGg	p.K846R		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	846	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TTCCAAGAAAAGGTATGCTCT	0.478																																					p.K846R		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.A2537G						.						86.0	82.0	84.0					14																	102453099		2203	4300	6503	SO:0001630	splice_region_variant	1778	exon8			AAGAAAAGGTATG	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.2538+1A>G	chr14.hg19:g.102453099A>G		48.0	0.0		39.0	30.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	hg19	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.467198	0.43839	.	.	ENSG00000197102	ENST00000360184	T	0.29655	1.56	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	L	0.33485	1.01	0.80722	D	1	B	0.23591	0.088	B	0.21708	0.036	T	0.05801	-1.0863	10	0.15066	T	0.55	.	15.9355	0.79704	1.0:0.0:0.0:0.0	.	846	Q14204	DYHC1_HUMAN	R	846	ENSP00000348965:K846R	ENSP00000348965:K846R	K	+	2	0	DYNC1H1	101522852	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	8.885000	0.92439	2.234000	0.73211	0.533000	0.62120	AAG	.	.		0.478	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	Missense_Mutation
POLR2M	81488	hgsc.bcm.edu	37	15	58000999	58000999	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr15:58000999A>C	ENST00000299638.3	+	2	415	c.201A>C	c.(199-201)gaA>gaC	p.E67D	GCOM1_ENST00000380568.3_Intron|POLR2M_ENST00000464308.1_3'UTR|GCOM1_ENST00000380569.2_Intron|POLR2M_ENST00000380557.4_Intron|POLR2M_ENST00000380563.2_Missense_Mutation_p.E67D|GCOM1_ENST00000484300.1_Intron|GCOM1_ENST00000587652.1_Missense_Mutation_p.E464D	NM_015532.3	NP_056347.1	P0CAP2	GRL1A_HUMAN	polymerase (RNA) II (DNA directed) polypeptide M	67					maintenance of ER location (GO:0051685)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)	DNA-directed RNA polymerase activity (GO:0003899)										AATGTGAAGAAGTTAGAAGAA	0.378																																					p.E67D		Atlas-SNP	.											.	POLR2M	2	.	0			c.A201C						.						74.0	73.0	73.0					15																	58000999		2192	4292	6484	SO:0001583	missense	81488	exon2			TGAAGAAGTTAGA	AF326773	CCDS32252.1, CCDS42045.1	15q21.3	2013-01-21	2011-11-07	2011-11-07		ENSG00000255529		"""RNA polymerase subunits"""	14862	protein-coding gene	gene with protein product		606485	"""glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A"""	GRINL1A		16769904, 22850672	Standard	NM_015532		Approved	Gdown, Gdown1, GCOM1	uc002aev.1	P0CAP2	OTTHUMG00000166486	ENST00000299638.3:c.201A>C	chr15.hg19:g.58000999A>C	ENSP00000299638:p.Glu67Asp	191.0	0.0		175.0	69.0	NM_015532	Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5|Q9Y3V6	Missense_Mutation	SNP	ENST00000299638.3	hg19	CCDS32252.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.752154	0.49362	.	.	ENSG00000255529	ENST00000380563;ENST00000299638	T;T	0.37411	1.2;1.2	5.13	-2.76	0.05896	.	.	.	.	.	T	0.26882	0.0658	.	.	.	0.09310	N	0.999998	B	0.13594	0.008	B	0.17433	0.018	T	0.38520	-0.9657	8	0.87932	D	0	.	9.8146	0.40844	0.1084:0.2387:0.653:0.0	.	67	P0CAP2	GRL1A_HUMAN	D	67	ENSP00000369937:E67D;ENSP00000299638:E67D	ENSP00000299638:E67D	E	+	3	2	GRINL1A	55788291	0.007000	0.16637	0.022000	0.16811	0.815000	0.46073	-0.214000	0.09292	-0.229000	0.09854	-0.334000	0.08254	GAA	.	.		0.378	POLR2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255719.2		
MYH11	4629	hgsc.bcm.edu	37	16	15797859	15797859	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr16:15797859C>A	ENST00000300036.5	-	41	6017	c.5908G>T	c.(5908-5910)Gcc>Tcc	p.A1970S	NDE1_ENST00000396354.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.A1977S|MYH11_ENST00000573908.1_5'UTR|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000576790.2_3'UTR|MYH11_ENST00000452625.2_3'UTR	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1970	C-terminal.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TATTCACTGGCCTTGGTTCCA	0.433			T	CBFB	AML																																p.A1977S		Atlas-SNP	.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	520	.	0			c.G5929T						.						231.0	227.0	228.0					16																	15797859		2197	4300	6497	SO:0001583	missense	4629	exon42			CACTGGCCTTGGT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5908G>T	chr16.hg19:g.15797859C>A	ENSP00000300036:p.Ala1970Ser	114.0	0.0		130.0	49.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	hg19	CCDS10565.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.012|7.012	0.557056|0.557056	0.13436|0.13436	.|.	.|.	ENSG00000133392|ENSG00000133392	ENST00000300036;ENST00000396324|ENST00000396320	D;D|.	0.85258|.	-1.96;-1.96|.	5.43|5.43	3.39|3.39	0.38822|0.38822	.|.	0.298040|.	0.32343|.	N|.	0.006223|.	T|T	0.39145|0.39145	0.1067|0.1067	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	B;B|.	0.09022|.	0.002;0.002|.	B;B|.	0.13407|.	0.009;0.009|.	T|T	0.09378|0.09378	-1.0677|-1.0677	10|5	0.25751|.	T|.	0.34|.	.|.	11.7039|11.7039	0.51587|0.51587	0.3188:0.6811:0.0:0.0|0.3188:0.6811:0.0:0.0	.|.	1970;1977|.	P35749;Q3MNF1|.	MYH11_HUMAN;.|.	S|S	1970;1977|1989	ENSP00000300036:A1970S;ENSP00000379616:A1977S|.	ENSP00000300036:A1970S|.	A|R	-|-	1|3	0|2	MYH11|MYH11	15705360|15705360	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.955000|0.955000	0.61496|0.61496	1.431000|1.431000	0.34925|0.34925	0.595000|0.595000	0.29777|0.29777	0.561000|0.561000	0.74099|0.74099	GCC|AGG	.	.		0.433	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
ZNF785	146540	hgsc.bcm.edu	37	16	30594587	30594587	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr16:30594587G>A	ENST00000395216.2	-	3	671	c.512C>T	c.(511-513)cCc>cTc	p.P171L	AC002310.7_ENST00000492040.1_RNA|ZNF785_ENST00000470110.1_Missense_Mutation_p.P156L|RP11-146F11.5_ENST00000563540.1_RNA|AC002310.7_ENST00000486926.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						GCAAGAGTGGGGCAGTCTTCG	0.657																																					p.P171L		Atlas-SNP	.											.	ZNF785	30	.	0			c.C512T						.						75.0	65.0	68.0					16																	30594587		2197	4300	6497	SO:0001583	missense	146540	exon3			GAGTGGGGCAGTC	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.512C>T	chr16.hg19:g.30594587G>A	ENSP00000378642:p.Pro171Leu	84.0	0.0		76.0	32.0	NM_152458	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000395216.2	hg19	CCDS10685.1	.	.	.	.	.	.	.	.	.	.	g	17.85	3.491175	0.64074	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.32515	1.45;1.45	4.34	3.38	0.38709	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35941	0.0949	N	0.14661	0.345	0.09310	N	1	B;D;P	0.89917	0.446;1.0;0.581	B;D;B	0.80764	0.043;0.994;0.094	T	0.15665	-1.0429	9	0.56958	D	0.05	.	10.3082	0.43693	0.0975:0.0:0.9025:0.0	.	136;171;156	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	L	156;136;171	ENSP00000420340:P156L;ENSP00000378642:P171L	ENSP00000378642:P171L	P	-	2	0	ZNF785	30502088	0.819000	0.29175	0.009000	0.14445	0.257000	0.26127	1.291000	0.33330	1.072000	0.40860	0.644000	0.83932	CCC	.	.		0.657	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458	
COG8	84342	hgsc.bcm.edu	37	16	69364961	69364961	+	Silent	SNP	T	T	C	rs189199610	byFrequency	TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr16:69364961T>C	ENST00000306875.4	-	5	1734	c.1620A>G	c.(1618-1620)ctA>ctG	p.L540L	PDF_ENST00000288022.1_5'Flank|RP11-343C2.12_ENST00000562949.1_Intron|COG8_ENST00000564419.1_5'Flank	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	540					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TCACATGCCCTAGGTTACCGT	0.512																																					p.L540L		Atlas-SNP	.											.	COG8	32	.	0			c.A1620G						.						55.0	52.0	53.0					16																	69364961		2198	4300	6498	SO:0001819	synonymous_variant	84342	exon5			ATGCCCTAGGTTA	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1620A>G	chr16.hg19:g.69364961T>C		109.0	0.0		71.0	32.0	NM_032382	Q0VAK2|Q8WVV6|Q9H6F8	Silent	SNP	ENST00000306875.4	hg19	CCDS10876.1																																																																																			.	T|0.997;G|0.003		0.512	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
ADAD2	161931	hgsc.bcm.edu	37	16	84227641	84227641	+	Intron	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr16:84227641G>A	ENST00000315906.5	+	2	470				RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G150R|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2						RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGCCCCTGGAGGAGAGGAATT	0.463																																					p.G150R		Atlas-SNP	.											.	ADAD2	46	.	0			c.G448A						.						75.0	80.0	78.0					16																	84227641		2200	4300	6500	SO:0001627	intron_variant	161931	exon2			CCTGGAGGAGAGG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.419-407G>A	chr16.hg19:g.84227641G>A		164.0	0.0		167.0	82.0	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	hg19	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	G	7.666	0.685905	0.14973	.	.	ENSG00000140955	ENST00000268624	T	0.21543	2.0	1.85	0.725	0.18242	.	1.517390	0.05097	N	0.486342	T	0.09335	0.0230	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32107	-0.9919	10	0.12430	T	0.62	.	3.3213	0.07052	0.3532:0.0:0.6468:0.0	.	150	Q8NCV1-2	.	R	150	ENSP00000268624:G150R	ENSP00000268624:G150R	G	+	1	0	ADAD2	82785142	0.009000	0.17119	0.000000	0.03702	0.036000	0.12997	2.685000	0.46959	0.230000	0.21059	0.313000	0.20887	GGA	.	.		0.463	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ATP2C2	9914	hgsc.bcm.edu	37	16	84402321	84402321	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr16:84402321G>A	ENST00000262429.4	+	1	188		c.e1+1		ATP2C2_ENST00000416219.2_Splice_Site	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GGAAGCCTTGGTGAGTCCCCG	0.706																																					.		Atlas-SNP	.											.	ATP2C2	75	.	0			c.99+1G>A						.						11.0	16.0	15.0					16																	84402321		1906	4066	5972	SO:0001630	splice_region_variant	9914	exon1			GCCTTGGTGAGTC	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.99+1G>A	chr16.hg19:g.84402321G>A		260.0	0.0		256.0	115.0	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Splice_Site	SNP	ENST00000262429.4	hg19	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438501	0.25900	.	.	ENSG00000064270	ENST00000416219;ENST00000262429	.	.	.	4.38	3.43	0.39272	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1587	0.31185	0.1097:0.0:0.8903:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP2C2	82959822	1.000000	0.71417	0.995000	0.50966	0.176000	0.22953	2.638000	0.46562	1.067000	0.40740	0.514000	0.50259	.	.	.		0.706	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	Intron
CCDC144A	9720	hgsc.bcm.edu	37	17	16676815	16676815	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:16676815T>C	ENST00000360524.8	+	18	4332	c.4256T>C	c.(4255-4257)cTa>cCa	p.L1419P	CCDC144A_ENST00000443444.2_Missense_Mutation_p.L1419P|RP11-219A15.1_ENST00000448331.3_Silent_p.A1382A|CCDC144A_ENST00000399273.1_Silent_p.A1382A	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1419																	TTTCAGCTGCTACTAAATATG	0.328																																					p.L1419P		Atlas-SNP	.											.	CCDC144A	53	.	0			c.T4256C						.						5.0	5.0	5.0					17																	16676815		1331	3138	4469	SO:0001583	missense	9720	exon18			AGCTGCTACTAAA	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.4256T>C	chr17.hg19:g.16676815T>C	ENSP00000353717:p.Leu1419Pro	263.0	0.0		134.0	101.0	NM_014695	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	hg19	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	8.585	0.883176	0.17467	.	.	ENSG00000170160	ENST00000443444;ENST00000360524	T;T	0.03212	4.01;4.01	2.29	1.11	0.20524	.	.	.	.	.	T	0.04907	0.0132	N	0.08118	0	0.51767	D	0.999934	D	0.71674	0.998	D	0.72982	0.979	T	0.54207	-0.8328	9	0.87932	D	0	.	4.3407	0.11108	0.2995:0.0:0.0:0.7005	.	1419	A2RUR9	C144A_HUMAN	P	1419	ENSP00000439262:L1419P;ENSP00000353717:L1419P	ENSP00000353717:L1419P	L	+	2	0	CCDC144A	16617540	0.999000	0.42202	0.561000	0.28357	0.067000	0.16453	1.034000	0.30204	0.105000	0.17753	0.164000	0.16699	CTA	.	.		0.328	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
KCNJ12	3768	hgsc.bcm.edu	37	17	21319861	21319861	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:21319861G>A	ENST00000583088.1	+	3	2102	c.1207G>A	c.(1207-1209)Ggc>Agc	p.G403S	KCNJ12_ENST00000331718.5_Missense_Mutation_p.G403S	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	403					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	AAGCCGGGACGGCCTCAGCCC	0.667										Prostate(3;0.18)																											p.G403S		Atlas-SNP	.											.	.	.	.	0			c.G1207A						.																																			SO:0001583	missense	100134444	exon3			CGGGACGGCCTCA	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1207G>A	chr17.hg19:g.21319861G>A	ENSP00000463778:p.Gly403Ser	43.0	0.0		44.0	7.0	NM_001194958	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	hg19	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	4.044	0.005744	0.07866	.	.	ENSG00000184185	ENST00000331718	D	0.86956	-2.19	5.46	-0.0112	0.13993	.	1.494790	0.03838	N	0.270119	T	0.70876	0.3274	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.61128	-0.7125	10	0.06365	T	0.9	.	6.155	0.20332	0.318:0.1188:0.5632:0.0	.	403	Q14500	IRK12_HUMAN	S	403	ENSP00000328150:G403S	ENSP00000328150:G403S	G	+	1	0	KCNJ12	21260454	0.955000	0.32602	0.000000	0.03702	0.444000	0.32077	2.092000	0.41700	-0.186000	0.10533	-0.165000	0.13383	GGC	.	.		0.667	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
TMEM132E	124842	hgsc.bcm.edu	37	17	32955721	32955721	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:32955721C>A	ENST00000321639.5	+	4	1196	c.868C>A	c.(868-870)Ccc>Acc	p.P290T		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	290						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		CACACCCCTGCCCCCCAGGTG	0.622																																					p.P290T		Atlas-SNP	.											.	TMEM132E	122	.	0			c.C868A						.						37.0	30.0	32.0					17																	32955721		2203	4300	6503	SO:0001583	missense	124842	exon4			CCCCTGCCCCCCA	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.868C>A	chr17.hg19:g.32955721C>A	ENSP00000316532:p.Pro290Thr	65.0	0.0		57.0	23.0	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	hg19	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	c	0.012	-1.685598	0.00745	.	.	ENSG00000181291	ENST00000321639	T	0.14640	2.49	4.46	2.43	0.29744	.	0.781520	0.12298	N	0.481373	T	0.05364	0.0142	N	0.04959	-0.14	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33033	-0.9884	10	0.15952	T	0.53	-25.6004	4.2395	0.10642	0.1503:0.5927:0.1663:0.0907	.	290	Q6IEE7	T132E_HUMAN	T	290	ENSP00000316532:P290T	ENSP00000316532:P290T	P	+	1	0	TMEM132E	29979834	0.000000	0.05858	0.972000	0.41901	0.032000	0.12392	0.864000	0.27926	0.577000	0.29470	-2.552000	0.00177	CCC	.	.		0.622	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
KRT9	3857	hgsc.bcm.edu	37	17	39727697	39727697	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:39727697T>A	ENST00000246662.4	-	1	613	c.548A>T	c.(547-549)aAt>aTt	p.N183I	KRT9_ENST00000588431.1_5'UTR	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	183	Coil 1A.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				CTGGATCTTATTCTCCAGGTC	0.478																																					p.N183I		Atlas-SNP	.											.	KRT9	78	.	0			c.A548T						.						141.0	142.0	142.0					17																	39727697		2203	4300	6503	SO:0001583	missense	3857	exon1			ATCTTATTCTCCA		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.548A>T	chr17.hg19:g.39727697T>A	ENSP00000246662:p.Asn183Ile	78.0	0.0		149.0	42.0	NM_000226	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	hg19	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	T	10.15	1.271537	0.23221	.	.	ENSG00000171403	ENST00000246662	D	0.87887	-2.31	4.64	-8.63	0.00878	Filament (1);	.	.	.	.	T	0.67702	0.2921	N	0.11698	0.16	0.09310	N	0.999999	B	0.13594	0.008	B	0.14023	0.01	T	0.54084	-0.8346	9	0.33141	T	0.24	.	4.0704	0.09879	0.0926:0.2:0.1837:0.5237	.	183	P35527	K1C9_HUMAN	I	183	ENSP00000246662:N183I	ENSP00000246662:N183I	N	-	2	0	KRT9	36981223	0.000000	0.05858	0.069000	0.20011	0.175000	0.22909	-6.907000	0.00050	-1.579000	0.01646	-0.472000	0.04984	AAT	.	.		0.478	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
ABCA9	10350	hgsc.bcm.edu	37	17	67013796	67013796	+	Splice_Site	SNP	C	C	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:67013796C>G	ENST00000340001.4	-	21	3113		c.e21+1		ABCA9_ENST00000370732.2_Splice_Site|ABCA9-AS1_ENST00000458677.1_RNA|ABCA9_ENST00000453985.2_Splice_Site	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9						transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GTCCAGCATACCTTTTCATCA	0.418																																					.		Atlas-SNP	.											.	ABCA9	192	.	0			c.2901+1G>C						.						308.0	289.0	296.0					17																	67013796		2203	4300	6503	SO:0001630	splice_region_variant	10350	exon22			AGCATACCTTTTC	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2901+1G>C	chr17.hg19:g.67013796C>G		107.0	0.0		128.0	17.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Splice_Site	SNP	ENST00000340001.4	hg19	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	9.937	1.216409	0.22373	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2392	0.73455	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA9	64525391	0.998000	0.40836	0.901000	0.35422	0.167000	0.22549	4.106000	0.57804	2.372000	0.80975	0.591000	0.81541	.	.	.		0.418	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	Intron
SDK2	54549	hgsc.bcm.edu	37	17	71412072	71412072	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:71412072A>G	ENST00000392650.3	-	17	2246	c.2246T>C	c.(2245-2247)gTg>gCg	p.V749A	SDK2_ENST00000388726.3_Missense_Mutation_p.V749A	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	749	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CAGGTTGTTCACATCAGCATC	0.567																																					p.V749A		Atlas-SNP	.											.	SDK2	219	.	0			c.T2246C						.						99.0	74.0	82.0					17																	71412072		2203	4300	6503	SO:0001583	missense	54549	exon17			TTGTTCACATCAG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2246T>C	chr17.hg19:g.71412072A>G	ENSP00000376421:p.Val749Ala	71.0	0.0		100.0	19.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	hg19	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.953382	0.53293	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.55234	0.53;0.53	5.95	5.95	0.96441	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.125964	0.53938	D	0.000054	T	0.32852	0.0843	N	0.04880	-0.145	0.44142	D	0.996933	B;B	0.14805	0.011;0.007	B;B	0.25506	0.061;0.043	T	0.23476	-1.0187	10	0.09084	T	0.74	.	16.4159	0.83738	1.0:0.0:0.0:0.0	.	749;749	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	A	373;749;749;749	ENSP00000376421:V749A;ENSP00000373378:V749A	ENSP00000324967:V749A	V	-	2	0	SDK2	68923667	1.000000	0.71417	0.970000	0.41538	0.882000	0.50991	4.931000	0.63469	2.279000	0.76181	0.533000	0.62120	GTG	.	.		0.567	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
FASN	2194	hgsc.bcm.edu	37	17	80041199	80041199	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr17:80041199T>G	ENST00000306749.2	-	32	5662	c.5444A>C	c.(5443-5445)cAg>cCg	p.Q1815P	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1815	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GATGCCGGCCTGCACAAGCGC	0.622																																					p.Q1815P	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.A5444C						.						69.0	67.0	68.0					17																	80041199		2198	4298	6496	SO:0001583	missense	2194	exon32			CCGGCCTGCACAA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5444A>C	chr17.hg19:g.80041199T>G	ENSP00000304592:p.Gln1815Pro	72.0	0.0		161.0	45.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	T	5.675	0.309160	0.10733	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.26810	1.71	4.25	-3.67	0.04476	Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.649919	0.15441	N	0.262195	T	0.21962	0.0529	L	0.46157	1.445	0.20196	N	0.999926	P	0.35433	0.501	B	0.41764	0.366	T	0.19128	-1.0315	10	0.32370	T	0.25	-11.3827	8.3006	0.32012	0.0:0.4211:0.1605:0.4184	.	1815	P49327	FAS_HUMAN	P	1815;780	ENSP00000304592:Q1815P	ENSP00000304592:Q1815P	Q	-	2	0	FASN	77634488	0.042000	0.20092	0.004000	0.12327	0.007000	0.05969	-0.171000	0.09883	-1.157000	0.02815	-0.441000	0.05720	CAG	.	.		0.622	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
THOC1	9984	hgsc.bcm.edu	37	18	224989	224989	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr18:224989T>C	ENST00000261600.6	-	15	1150	c.1143A>G	c.(1141-1143)atA>atG	p.I381M		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	381					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CAGTGTTTAATATATGCTGGG	0.343																																					p.I381M		Atlas-SNP	.											.	THOC1	43	.	0			c.A1143G						.						85.0	74.0	77.0					18																	224989		1814	4064	5878	SO:0001583	missense	9984	exon15			GTTTAATATATGC	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.1143A>G	chr18.hg19:g.224989T>C	ENSP00000261600:p.Ile381Met	129.0	0.0		63.0	50.0	NM_005131	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	hg19	CCDS45820.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.098265	0.37048	.	.	ENSG00000079134	ENST00000261600	.	.	.	6.16	3.63	0.41609	.	0.000000	0.85682	D	0.000000	T	0.51958	0.1705	L	0.42581	1.335	0.58432	D	0.999991	P	0.48589	0.912	P	0.50791	0.65	T	0.46871	-0.9160	9	0.33940	T	0.23	-20.4748	11.2776	0.49176	0.2435:0.0:0.0:0.7565	.	381	Q96FV9	THOC1_HUMAN	M	381	.	ENSP00000261600:I381M	I	-	3	3	THOC1	214989	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.195000	0.42677	1.124000	0.41980	0.528000	0.53228	ATA	.	.		0.343	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
CELF5	60680	hgsc.bcm.edu	37	19	3281279	3281279	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:3281279A>G	ENST00000292672.2	+	6	723	c.686A>G	c.(685-687)cAg>cGg	p.Q229R	CELF5_ENST00000541430.2_Missense_Mutation_p.Q229R	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	229					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						ATGGTGGGCCAGCTGGGCATC	0.677																																					p.Q229R		Atlas-SNP	.											.	CELF5	32	.	0			c.A686G						.						100.0	87.0	91.0					19																	3281279		2203	4300	6503	SO:0001583	missense	60680	exon6			TGGGCCAGCTGGG	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.686A>G	chr19.hg19:g.3281279A>G	ENSP00000292672:p.Gln229Arg	30.0	0.0		15.0	12.0	NM_021938	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	hg19	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.952051	0.53293	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.34072	2.14;1.57;1.38	3.73	3.73	0.42828	.	0.275088	0.36034	N	0.002838	T	0.45316	0.1336	L	0.42245	1.32	0.47994	D	0.999567	B;D;B	0.54772	0.229;0.968;0.029	B;P;B	0.59221	0.104;0.854;0.035	T	0.41610	-0.9499	10	0.56958	D	0.05	-3.898	11.5678	0.50815	1.0:0.0:0.0:0.0	.	115;229;229	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	R	229;229;115	ENSP00000292672:Q229R;ENSP00000443498:Q229R;ENSP00000335182:Q115R	ENSP00000292672:Q229R	Q	+	2	0	CELF5	3232279	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.202000	0.95026	1.479000	0.48272	0.379000	0.24179	CAG	.	.		0.677	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
C3	718	hgsc.bcm.edu	37	19	6677908	6677908	+	Silent	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:6677908A>G	ENST00000245907.6	-	41	5069	c.4977T>C	c.(4975-4977)ttT>ttC	p.F1659F	C3_ENST00000599668.1_5'UTR	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1659	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGGGGCACCCAAAGACAACCA	0.552																																					p.F1659F		Atlas-SNP	.											.	C3	192	.	0			c.T4977C						.						99.0	81.0	87.0					19																	6677908		2203	4300	6503	SO:0001819	synonymous_variant	718	exon41			GCACCCAAAGACA	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4977T>C	chr19.hg19:g.6677908A>G		53.0	0.0		39.0	30.0	NM_000064	A7E236	Silent	SNP	ENST00000245907.6	hg19	CCDS32883.1																																																																																			.	.		0.552	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
MUC16	94025	hgsc.bcm.edu	37	19	9091765	9091765	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:9091765A>T	ENST00000397910.4	-	1	253	c.50T>A	c.(49-51)tTg>tAg	p.L17*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	17	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCCTGTCATCAAGGAGCGGGT	0.532																																					p.L17X		Atlas-SNP	.											.	MUC16	4315	.	0			c.T50A						.						78.0	76.0	77.0					19																	9091765		2010	4165	6175	SO:0001587	stop_gained	94025	exon1			GTCATCAAGGAGC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.50T>A	chr19.hg19:g.9091765A>T	ENSP00000381008:p.Leu17*	133.0	0.0		89.0	69.0	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	19.18	3.777936	0.70107	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.35	-2.7	0.06004	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.91	0.29785	0.2987:0.7013:0.0:0.0	.	.	.	.	X	17	.	ENSP00000381008:L17X	L	-	2	0	MUC16	8952765	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.053000	0.01400	-1.258000	0.02471	-0.940000	0.02684	TTG	.	.		0.532	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PALM3	342979	hgsc.bcm.edu	37	19	14165531	14165531	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:14165531G>A	ENST00000340790.4	-	6	907	c.908C>T	c.(907-909)tCg>tTg	p.S303L		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	303	Glu-rich.				negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						GAGCCTAGGCGAGCTAGTCTG	0.637																																					p.S303L		Atlas-SNP	.											.	PALM3	26	.	0			c.C908T						.						67.0	68.0	67.0					19																	14165531		692	1591	2283	SO:0001583	missense	342979	exon6			CTAGGCGAGCTAG		CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.908C>T	chr19.hg19:g.14165531G>A	ENSP00000344996:p.Ser303Leu	38.0	0.0		46.0	14.0	NM_001145028		Missense_Mutation	SNP	ENST00000340790.4	hg19	CCDS46001.1	.	.	.	.	.	.	.	.	.	.	g	8.940	0.965513	0.18583	.	.	ENSG00000187867	ENST00000340790	T	0.36520	1.25	3.31	-1.84	0.07809	.	1.374020	0.04838	N	0.439938	T	0.21962	0.0529	N	0.20986	0.625	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.23726	-1.0180	10	0.36615	T	0.2	-0.3041	4.1259	0.10126	0.3275:0.0:0.507:0.1655	.	303	A6NDB9	PALM3_HUMAN	L	303	ENSP00000344996:S303L	ENSP00000344996:S303L	S	-	2	0	PALM3	14026531	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.560000	0.23500	0.156000	0.19299	-1.430000	0.01095	TCG	.	.		0.637	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458540.1	NM_001145028	
SLC35E1	79939	hgsc.bcm.edu	37	19	16683112	16683112	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:16683112C>T	ENST00000595753.1	-	1	81	c.64G>A	c.(64-66)Ggt>Agt	p.G22S	SLC35E1_ENST00000431408.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_Intron	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	22					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						CGCGCCCCACCACTGCTGCTC	0.786																																					p.G22S		Atlas-SNP	.											.	SLC35E1	48	.	0			c.G64A						.						4.0	7.0	6.0					19																	16683112		611	1438	2049	SO:0001583	missense	79939	exon1			CCCCACCACTGCT	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.64G>A	chr19.hg19:g.16683112C>T	ENSP00000470652:p.Gly22Ser	34.0	0.0		43.0	24.0	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	hg19	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	c	17.96	3.516317	0.64634	.	.	ENSG00000127526	ENST00000409648;ENST00000436553	.	.	.	3.0	-0.904	0.10530	.	.	.	.	.	T	0.12944	0.0314	N	0.08118	0	0.09310	N	0.999994	B	0.22746	0.074	B	0.15870	0.014	T	0.30592	-0.9973	8	0.02654	T	1	.	5.78	0.18301	0.2689:0.6144:0.0:0.1167	.	22	Q96K37	S35E1_HUMAN	S	22;2	.	ENSP00000387152:G22S	G	-	1	0	SLC35E1	16544112	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.180000	0.09754	-0.766000	0.04639	-1.829000	0.00594	GGT	.	.		0.786	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
JAK3	3718	hgsc.bcm.edu	37	19	17945987	17945987	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:17945987C>T	ENST00000527670.1	-	14	1981	c.1952G>A	c.(1951-1953)cGg>cAg	p.R651Q	JAK3_ENST00000458235.1_Missense_Mutation_p.R651Q|JAK3_ENST00000534444.1_Missense_Mutation_p.R651Q			P52333	JAK3_HUMAN	Janus kinase 3	651	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GAGCACCTTCCGGGCAGAGAC	0.602		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.R651Q		Atlas-SNP	.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3	341	.	0			c.G1952A						.						33.0	36.0	35.0					19																	17945987		2203	4300	6503	SO:0001583	missense	3718	exon15			ACCTTCCGGGCAG	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1952G>A	chr19.hg19:g.17945987C>T	ENSP00000432511:p.Arg651Gln	68.0	0.0		88.0	29.0	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	hg19	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488093	0.64074	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.87334	-2.24;-2.24;-2.24	5.1	4.0	0.46444	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.064498	0.64402	D	0.000017	T	0.81297	0.4793	L	0.52266	1.64	0.36834	D	0.887027	P;P	0.49783	0.928;0.792	B;B	0.42462	0.388;0.182	D	0.83950	0.0316	10	0.87932	D	0	-35.1193	4.6177	0.12435	0.0:0.7275:0.0:0.2725	.	651;651	P52333-2;P52333	.;JAK3_HUMAN	Q	651	ENSP00000391676:R651Q;ENSP00000432511:R651Q;ENSP00000436421:R651Q	ENSP00000391676:R651Q	R	-	2	0	JAK3	17806987	1.000000	0.71417	0.998000	0.56505	0.259000	0.26198	5.758000	0.68776	2.366000	0.80165	0.555000	0.69702	CGG	.	.		0.602	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
WDR88	126248	hgsc.bcm.edu	37	19	33655144	33655144	+	Missense_Mutation	SNP	C	C	A	rs1981827	byFrequency	TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:33655144C>A	ENST00000355868.3	+	9	1198	c.1122C>A	c.(1120-1122)aaC>aaA	p.N374K	WDR88_ENST00000361680.2_Missense_Mutation_p.N374K	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	374										breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					TTAGCAACAACAAGAAATGGA	0.383																																					p.N374K		Atlas-SNP	.											.	WDR88	50	.	0			c.C1122A						.						158.0	147.0	151.0					19																	33655144		2203	4300	6503	SO:0001583	missense	126248	exon9			CAACAACAAGAAA	BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.1122C>A	chr19.hg19:g.33655144C>A	ENSP00000348129:p.Asn374Lys	134.0	0.0		142.0	65.0	NM_173479	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	hg19	CCDS12429.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457137	0.63401	.	.	ENSG00000166359	ENST00000355868;ENST00000361680	T;T	0.42900	0.96;0.96	5.18	4.14	0.48551	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.290359	0.36002	N	0.002843	T	0.40862	0.1134	L	0.40543	1.245	0.36102	P	0.155821	P	0.47484	0.896	P	0.46419	0.516	T	0.58657	-0.7598	9	0.72032	D	0.01	.	12.6303	0.56653	0.0:0.9187:0.0:0.0813	.	374	Q6ZMY6	WDR88_HUMAN	K	374	ENSP00000348129:N374K;ENSP00000355148:N374K	ENSP00000348129:N374K	N	+	3	2	WDR88	38346984	1.000000	0.71417	0.892000	0.35008	0.626000	0.37791	2.959000	0.49153	1.179000	0.42884	0.561000	0.74099	AAC	.	C|0.874;T|0.126		0.383	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479	
MEGF8	1954	hgsc.bcm.edu	37	19	42853808	42853808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:42853808A>G	ENST00000251268.6	+	14	2456	c.2456A>G	c.(2455-2457)gAg>gGg	p.E819G	MEGF8_ENST00000334370.4_Missense_Mutation_p.E752G	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	819					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GGGCACAGCGAGCTAACTCTG	0.642																																					p.E819G		Atlas-SNP	.											.	MEGF8	358	.	0			c.A2456G						.						67.0	67.0	67.0					19																	42853808		2203	4300	6503	SO:0001583	missense	1954	exon14			ACAGCGAGCTAAC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2456A>G	chr19.hg19:g.42853808A>G	ENSP00000251268:p.Glu819Gly	60.0	0.0		57.0	23.0	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	A	17.45	3.393795	0.62066	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.23348	1.91;1.94	3.97	3.97	0.46021	.	0.176592	0.34986	N	0.003539	T	0.32315	0.0825	N	0.19112	0.55	0.80722	D	1	B;D	0.76494	0.016;0.999	B;D	0.75484	0.009;0.986	T	0.07177	-1.0786	10	0.45353	T	0.12	.	10.8281	0.46645	1.0:0.0:0.0:0.0	.	819;752	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	G	752;819	ENSP00000334219:E752G;ENSP00000251268:E819G	ENSP00000251268:E819G	E	+	2	0	MEGF8	47545648	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.943000	0.75934	1.674000	0.50907	0.402000	0.26972	GAG	.	.		0.642	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
PRKD2	25865	hgsc.bcm.edu	37	19	47214210	47214210	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:47214210G>T	ENST00000291281.4	-	3	690	c.465C>A	c.(463-465)tgC>tgA	p.C155*	PRKD2_ENST00000433867.1_Nonsense_Mutation_p.C155*|MIR320E_ENST00000390179.3_RNA|PRKD2_ENST00000595515.1_Nonsense_Mutation_p.C155*|PRKD2_ENST00000601806.1_5'UTR|PRKD2_ENST00000600194.1_5'UTR			Q9BZL6	KPCD2_HUMAN	protein kinase D2	155					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GCATCTCCCCGCAGTGATCAC	0.672																																					p.C155X		Atlas-SNP	.											PRKD2,NS,carcinoma,0,1	PRKD2	94	.	0			c.C465A						.						28.0	23.0	25.0					19																	47214210		2189	4288	6477	SO:0001587	stop_gained	25865	exon3			CTCCCCGCAGTGA	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.465C>A	chr19.hg19:g.47214210G>T	ENSP00000291281:p.Cys155*	54.0	0.0		74.0	4.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Nonsense_Mutation	SNP	ENST00000291281.4	hg19	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	G	42	9.304725	0.99130	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	.	.	.	5.61	2.2	0.27929	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.6988	10.9093	0.47099	0.2174:0.0:0.7826:0.0	.	.	.	.	X	155	.	ENSP00000291281:C155X	C	-	3	2	PRKD2	51906050	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	0.259000	0.18405	0.707000	0.31934	0.591000	0.81541	TGC	.	.		0.672	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
NOSIP	51070	hgsc.bcm.edu	37	19	50060189	50060189	+	Silent	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:50060189G>A	ENST00000596358.1	-	6	538	c.480C>T	c.(478-480)ccC>ccT	p.P160P	NOSIP_ENST00000391853.3_Silent_p.P160P|NOSIP_ENST00000339093.3_Silent_p.P163P	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	160					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		TCCAGAAGCTGGGCAGCACTT	0.667																																					p.P160P		Atlas-SNP	.											.	NOSIP	28	.	0			c.C480T						.						40.0	38.0	39.0					19																	50060189		2203	4298	6501	SO:0001819	synonymous_variant	51070	exon7			GAAGCTGGGCAGC	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.480C>T	chr19.hg19:g.50060189G>A		92.0	0.0		105.0	39.0	NM_015953	Q96FD2	Silent	SNP	ENST00000596358.1	hg19	CCDS12772.1																																																																																			.	.		0.667	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1		
ZNF415	55786	hgsc.bcm.edu	37	19	53612357	53612357	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:53612357C>A	ENST00000500065.4	-	4	1274	c.941G>T	c.(940-942)tGc>tTc	p.C314F	ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.C314F|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000601493.1_Missense_Mutation_p.C84F|ZNF415_ENST00000455735.2_Missense_Mutation_p.C362F|ZNF415_ENST00000421033.1_Missense_Mutation_p.C326F|ZNF415_ENST00000448501.1_Missense_Mutation_p.C362F|ZNF415_ENST00000440291.1_Missense_Mutation_p.C301F|ZNF415_ENST00000594011.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TAGTGCAAGGCATGAATTTCG	0.428																																					p.C314F		Atlas-SNP	.											.	ZNF415	68	.	0			c.G941T						.						95.0	87.0	90.0					19																	53612357		2203	4300	6503	SO:0001583	missense	55786	exon4			GCAAGGCATGAAT	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.941G>T	chr19.hg19:g.53612357C>A	ENSP00000439435:p.Cys314Phe	42.0	0.0		38.0	15.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	hg19	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	C	4.771	0.143398	0.09134	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49	2.78	-5.55	0.02536	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07007	0.0178	N	0.17345	0.48	0.09310	N	1	B;B;B;P;B;B	0.41910	0.073;0.083;0.084;0.764;0.073;0.246	B;B;B;B;B;B	0.38500	0.004;0.015;0.005;0.275;0.004;0.049	T	0.14448	-1.0472	9	0.51188	T	0.08	.	7.2988	0.26408	0.0:0.193:0.2283:0.5787	.	314;362;362;314;301;326	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	F	314;314;362;326;362;301	ENSP00000243643:C314F;ENSP00000439435:C314F;ENSP00000396492:C362F;ENSP00000395055:C326F;ENSP00000388787:C362F;ENSP00000414601:C301F	ENSP00000243643:C314F	C	-	2	0	ZNF415	58304169	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.477000	0.00985	-2.564000	0.00472	-0.479000	0.04858	TGC	.	.		0.428	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
ZNF304	57343	hgsc.bcm.edu	37	19	57868571	57868571	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr19:57868571G>T	ENST00000282286.5	+	3	1507	c.1334G>T	c.(1333-1335)aGa>aTa	p.R445I	ZNF304_ENST00000391705.3_Missense_Mutation_p.R445I|ZNF304_ENST00000443917.2_Missense_Mutation_p.R492I|ZNF304_ENST00000598744.1_Missense_Mutation_p.R403I			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	445				R -> S (in Ref. 1; CAC06610). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACAGGAGCAAGATCCTACGTG	0.468																																					p.R445I		Atlas-SNP	.											.	ZNF304	74	.	0			c.G1334T						.						69.0	68.0	68.0					19																	57868571		2203	4300	6503	SO:0001583	missense	57343	exon3			GAGCAAGATCCTA	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.1334G>T	chr19.hg19:g.57868571G>T	ENSP00000282286:p.Arg445Ile	143.0	0.0		166.0	68.0	NM_020657		Missense_Mutation	SNP	ENST00000282286.5	hg19	CCDS12950.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529477	0.44969	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.20332	2.08;2.08;2.08	3.67	0.343	0.16001	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42245	0.1194	M	0.88775	2.98	0.35693	D	0.815048	D;P	0.53151	0.958;0.952	P;P	0.59546	0.859;0.606	T	0.53136	-0.8481	9	0.87932	D	0	.	6.6031	0.22710	0.5349:0.0:0.4651:0.0	.	445;492	Q9HCX3;E7EQD3	ZN304_HUMAN;.	I	445;445;492	ENSP00000282286:R445I;ENSP00000375586:R445I;ENSP00000401642:R492I	ENSP00000282286:R445I	R	+	2	0	ZNF304	62560383	0.289000	0.24334	0.020000	0.16555	0.747000	0.42532	0.038000	0.13862	0.170000	0.19704	0.650000	0.86243	AGA	.	.		0.468	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1		
FOXA2	3170	hgsc.bcm.edu	37	20	22562785	22562785	+	Silent	SNP	C	C	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr20:22562785C>A	ENST00000377115.4	-	3	1258	c.1077G>T	c.(1075-1077)ccG>ccT	p.P359P	FOXA2_ENST00000419308.2_Silent_p.P365P	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	359					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					GGGCCTCAGGCGGCAGGCCCG	0.721																																					p.P365P		Atlas-SNP	.											.	FOXA2	48	.	0			c.G1095T						.						44.0	35.0	38.0					20																	22562785		2174	4264	6438	SO:0001819	synonymous_variant	3170	exon2			CTCAGGCGGCAGG	AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.1077G>T	chr20.hg19:g.22562785C>A		71.0	0.0		72.0	25.0	NM_021784	Q8WUW4|Q96DF7	Silent	SNP	ENST00000377115.4	hg19	CCDS13147.1																																																																																			.	.		0.721	FOXA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078289.1		
MYH7B	57644	hgsc.bcm.edu	37	20	33585321	33585321	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr20:33585321G>T	ENST00000262873.7	+	30	3843	c.3751G>T	c.(3751-3753)Gag>Tag	p.E1251*		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1209						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGGCGCGGCGGAGCTGGGGGA	0.726																																					p.E1251X		Atlas-SNP	.											.	MYH7B	145	.	0			c.G3751T						.						26.0	28.0	27.0					20																	33585321		2196	4295	6491	SO:0001587	stop_gained	57644	exon32			GCGGCGGAGCTGG	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3751G>T	chr20.hg19:g.33585321G>T	ENSP00000262873:p.Glu1251*	45.0	0.0		40.0	17.0	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Nonsense_Mutation	SNP	ENST00000262873.7	hg19	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	G	42	9.366419	0.99150	.	.	ENSG00000078814	ENST00000262873	.	.	.	4.73	4.73	0.59995	.	0.000000	0.38381	N	0.001715	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9076	0.88923	0.0:0.0:1.0:0.0	.	.	.	.	X	1251	.	ENSP00000262873:E1251X	E	+	1	0	MYH7B	33048982	1.000000	0.71417	0.953000	0.39169	0.684000	0.39900	7.826000	0.86716	2.456000	0.83038	0.563000	0.77884	GAG	.	.		0.726	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
CTNNBL1	56259	hgsc.bcm.edu	37	20	36374896	36374896	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr20:36374896A>G	ENST00000361383.6	+	4	470	c.353A>G	c.(352-354)aAt>aGt	p.N118S	CTNNBL1_ENST00000373473.1_5'UTR|CTNNBL1_ENST00000405275.2_Missense_Mutation_p.N91S	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	118					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CTGGACCTAAATGACATCATT	0.502																																					p.N118S	Ovarian(184;582 2038 3273 4106 42608)	Atlas-SNP	.											.	CTNNBL1	78	.	0			c.A353G						.						147.0	134.0	139.0					20																	36374896		2203	4300	6503	SO:0001583	missense	56259	exon4			ACCTAAATGACAT	AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.353A>G	chr20.hg19:g.36374896A>G	ENSP00000355050:p.Asn118Ser	49.0	0.0		49.0	23.0	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	ENST00000361383.6	hg19	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.103912	0.76983	.	.	ENSG00000132792	ENST00000361383;ENST00000447935;ENST00000405275	T;T	0.44083	0.93;0.94	5.15	5.15	0.70609	Domain of unknown function DUF1716, eukaryotic (1);	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	M	0.69823	2.125	0.80722	D	1	P;B	0.52316	0.952;0.256	P;B	0.58620	0.842;0.312	T	0.59451	-0.7452	10	0.42905	T	0.14	-20.9336	14.3052	0.66380	1.0:0.0:0.0:0.0	.	118;91	Q8WYA6;A2A2P1	CTBL1_HUMAN;.	S	118;91;91	ENSP00000355050:N118S;ENSP00000384355:N91S	ENSP00000355050:N118S	N	+	2	0	CTNNBL1	35808310	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.081000	0.94049	2.165000	0.68154	0.482000	0.46254	AAT	.	.		0.502	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
ZNF335	63925	hgsc.bcm.edu	37	20	44592541	44592541	+	Silent	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr20:44592541T>A	ENST00000322927.2	-	8	1291	c.1191A>T	c.(1189-1191)ccA>ccT	p.P397P	ZNF335_ENST00000494955.1_5'Flank|ZNF335_ENST00000426788.1_Silent_p.P242P	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	397					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CCAGGTGTCCTGGGCCTGAGG	0.642																																					p.P397P		Atlas-SNP	.											.	ZNF335	115	.	0			c.A1191T						.						52.0	48.0	49.0					20																	44592541		2203	4300	6503	SO:0001819	synonymous_variant	63925	exon8			GTGTCCTGGGCCT	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1191A>T	chr20.hg19:g.44592541T>A		67.0	0.0		100.0	56.0	NM_022095	B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	hg19	CCDS13389.1																																																																																			.	.		0.642	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
SYCP2	10388	hgsc.bcm.edu	37	20	58489232	58489232	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr20:58489232G>A	ENST00000357552.3	-	11	934	c.709C>T	c.(709-711)Cat>Tat	p.H237Y	SYCP2_ENST00000371001.2_Missense_Mutation_p.H237Y			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	237					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AACCACTGATGTGCCAGTTCT	0.308																																					p.H237Y		Atlas-SNP	.											.	SYCP2	204	.	0			c.C709T						.						89.0	86.0	87.0					20																	58489232		2202	4295	6497	SO:0001583	missense	10388	exon10			ACTGATGTGCCAG	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.709C>T	chr20.hg19:g.58489232G>A	ENSP00000350162:p.His237Tyr	145.0	0.0		185.0	55.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	G	0.039	-1.293461	0.01375	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.04551	3.6;3.6;3.6	5.1	1.26	0.21427	.	0.360095	0.27420	N	0.019455	T	0.02193	0.0068	N	0.17082	0.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.48031	-0.9070	10	0.02654	T	1	-0.019	5.5285	0.16970	0.4451:0.0:0.079:0.4759	.	237;237	A2A341;Q9BX26	.;SYCP2_HUMAN	Y	237	ENSP00000360040:H237Y;ENSP00000350162:H237Y;ENSP00000402456:H237Y	ENSP00000350162:H237Y	H	-	1	0	SYCP2	57922627	0.001000	0.12720	0.906000	0.35671	0.805000	0.45488	0.023000	0.13533	0.343000	0.23821	-0.302000	0.09304	CAT	.	.		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
IGSF5	150084	hgsc.bcm.edu	37	21	41163986	41163986	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr21:41163986T>A	ENST00000380588.4	+	7	1111	c.1008T>A	c.(1006-1008)aaT>aaA	p.N336K		NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	336					single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				AAAGTGGAAATGAAAACTCCG	0.398																																					p.N336K		Atlas-SNP	.											.	IGSF5	62	.	0			c.T1008A						.						71.0	69.0	69.0					21																	41163986		2203	4300	6503	SO:0001583	missense	150084	exon7			TGGAAATGAAAAC		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.1008T>A	chr21.hg19:g.41163986T>A	ENSP00000369962:p.Asn336Lys	431.0	0.0		221.0	163.0	NM_001080444		Missense_Mutation	SNP	ENST00000380588.4	hg19	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	T	9.811	1.183176	0.21870	.	.	ENSG00000183067	ENST00000380588	T	0.04275	3.66	4.8	-2.44	0.06502	.	0.673858	0.15515	N	0.258333	T	0.01800	0.0057	N	0.17082	0.46	0.09310	N	1	B	0.22080	0.064	B	0.20184	0.028	T	0.44590	-0.9318	10	0.02654	T	1	-3.6287	1.1814	0.01846	0.1423:0.1871:0.3434:0.3272	.	336	Q9NSI5	IGSF5_HUMAN	K	336	ENSP00000369962:N336K	ENSP00000369962:N336K	N	+	3	2	IGSF5	40085856	0.046000	0.20272	0.080000	0.20451	0.457000	0.32468	-0.713000	0.05007	-0.169000	0.10834	-0.290000	0.09829	AAT	.	.		0.398	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1		
LZTR1	8216	hgsc.bcm.edu	37	22	21348001	21348001	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr22:21348001G>A	ENST00000215739.8	+	12	1670	c.1311G>A	c.(1309-1311)tgG>tgA	p.W437*	LZTR1_ENST00000389355.3_Nonsense_Mutation_p.W418*|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	437					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GGCGGCTGTGGGAGAGCCGCC	0.627																																					p.W437X		Atlas-SNP	.											.	LZTR1	99	.	0			c.G1311A						.						48.0	44.0	45.0					22																	21348001		2200	4300	6500	SO:0001587	stop_gained	8216	exon12			GCTGTGGGAGAGC	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.1311G>A	chr22.hg19:g.21348001G>A	ENSP00000215739:p.Trp437*	61.0	0.0		42.0	4.0	NM_006767	Q14776|Q20WK0	Nonsense_Mutation	SNP	ENST00000215739.8	hg19	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	G	42	9.285862	0.99125	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	.	.	.	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-25.1965	13.0129	0.58741	0.0:0.0:1.0:0.0	.	.	.	.	X	396;437;418	.	ENSP00000215739:W437X	W	+	3	0	LZTR1	19678001	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.330000	0.79181	2.432000	0.82394	0.563000	0.77884	TGG	.	.		0.627	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	
ARMCX2	9823	hgsc.bcm.edu	37	X	100911129	100911129	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chrX:100911129G>T	ENST00000328766.5	-	5	1899	c.1446C>A	c.(1444-1446)aaC>aaA	p.N482K	ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000356824.4_Missense_Mutation_p.N482K|ARMCX2_ENST00000330154.2_Missense_Mutation_p.N482K	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	482						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						GAACTGCTGAGTTCAGGTTAG	0.388																																					p.N482K		Atlas-SNP	.											.	ARMCX2	75	.	0			c.C1446A						.						127.0	126.0	126.0					X																	100911129		2203	4300	6503	SO:0001583	missense	9823	exon5			TGCTGAGTTCAGG	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1446C>A	chrX.hg19:g.100911129G>T	ENSP00000331662:p.Asn482Lys	50.0	0.0		61.0	53.0	NM_014782	O60267|Q5H9D9	Missense_Mutation	SNP	ENST00000328766.5	hg19	CCDS14490.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303840	0.40795	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.47177	0.85;0.85;0.85	4.09	3.23	0.37069	Armadillo-like helical (1);Armadillo-type fold (1);	0.092515	0.64402	D	0.000001	T	0.60805	0.2297	M	0.66297	2.02	0.42916	D	0.994272	D	0.89917	1.0	D	0.80764	0.994	T	0.61352	-0.7080	10	0.59425	D	0.04	-9.4184	6.7153	0.23300	0.1294:0.0:0.8706:0.0	.	482	Q7L311	ARMX2_HUMAN	K	482	ENSP00000331662:N482K;ENSP00000328631:N482K;ENSP00000349281:N482K	ENSP00000331662:N482K	N	-	3	2	ARMCX2	100797785	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.972000	0.49256	1.073000	0.40885	0.422000	0.28245	AAC	.	.		0.388	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782	
CT55	54967	hgsc.bcm.edu	37	X	134305029	134305029	+	Missense_Mutation	SNP	C	C	A	rs367724422		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chrX:134305029C>A	ENST00000276241.6	-	1	293	c.67G>T	c.(67-69)Ggc>Tgc	p.G23C	CXorf48_ENST00000344129.2_Missense_Mutation_p.G23C	NM_001031705.2	NP_001026875.1	Q8WUE5	CT55_HUMAN		23										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	5	Acute lymphoblastic leukemia(192;0.000127)					TGCTGTGGGCCCTGTCGCTCT	0.637																																					p.G23C		Atlas-SNP	.											.	CXorf48	17	.	0			c.G67T						.						108.0	92.0	97.0					X																	134305029		2203	4300	6503	SO:0001583	missense	54967	exon1			GTGGGCCCTGTCG																												ENST00000276241.6:c.67G>T	chrX.hg19:g.134305029C>A	ENSP00000276241:p.Gly23Cys	87.0	0.0		96.0	85.0	NM_017863	Q9NWY8	Missense_Mutation	SNP	ENST00000276241.6	hg19	CCDS35400.1	.	.	.	.	.	.	.	.	.	.	C	9.809	1.182544	0.21870	.	.	ENSG00000169551	ENST00000276241;ENST00000344129	T;T	0.31769	1.48;1.48	1.53	-3.05	0.05396	.	.	.	.	.	T	0.20700	0.0498	L	0.42245	1.32	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.25187	-1.0139	9	0.66056	D	0.02	8.8294	3.2749	0.06894	0.4058:0.259:0.3352:0.0	.	23	Q8WUE5	CX048_HUMAN	C	23	ENSP00000276241:G23C;ENSP00000343893:G23C	ENSP00000276241:G23C	G	-	1	0	CXorf48	134132695	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.227000	0.01210	-1.184000	0.02720	-0.456000	0.05471	GGC	.	.		0.637	CXorf48-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058404.1		
MT-CYB	4519	hgsc.bcm.edu	37	M	15063	15063	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chrM:15063C>T	ENST00000361789.2	+	1	317	c.317C>T	c.(316-318)tCa>tTa	p.S106L	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	106					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATATTACGGATCATTTCTCTA	0.468																																					p.S106L		Atlas-SNP	.											.	.	.	.	0			c.C317T						.																																			SO:0001583	missense	0	exon1			ACGGATCATTTCT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.317C>T	chrM.hg19:g.15063C>T	ENSP00000354554:p.Ser106Leu	20.0	0.0		53.0	14.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.468	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
SLC4A2	6522	hgsc.bcm.edu	37	7	150761611	150761633	+	Splice_Site	DEL	TCCTCCCTGCAGACCACCGCCAG	TCCTCCCTGCAGACCACCGCCAG	-	rs143210272|rs387907523|rs1131280		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	TCCTCCCTGCAGACCACCGCCAG	TCCTCCCTGCAGACCACCGCCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr7:150761611_150761633delTCCTCCCTGCAGACCACCGCCAG	ENST00000485713.1	+	4	1257_1278	c.217_238delTCCTCCCTGCAGACCACCGCCAG	c.(217-240)tcctccctgcagaccaccgccaga>ga	p.SSLQTTAR73fs	SLC4A2_ENST00000310317.5_Intron|SLC4A2_ENST00000461735.1_Splice_Site_p.SSLQTTAR59fs|SLC4A2_ENST00000413384.2_Splice_Site_p.SSLQTTAR73fs|SLC4A2_ENST00000392826.2_Splice_Site_p.SSLQTTAR64fs	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	73	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)	p.Y73*(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCTCCCTGCAGACCACCGCCAGTCCTCCCACCACATCCATCA	0.686																																					p.73_76del		Atlas-INDEL	.											.	SLC4A2	98	.	1	Substitution - Nonsense(1)	lung(1)	c.218_227del						.																																			SO:0001630	splice_region_variant	6522	exon4			.		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.218-1TCCTCCCTGCAGACCACCGCCAG>-	chr7.hg19:g.150761611_150761633delTCCTCCCTGCAGACCACCGCCAG		88.0	0.0		91.0	24.0	NM_001199692	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Frame_Shift_Del	DEL	ENST00000485713.1	hg19	CCDS5917.1																																																																																			.	.		0.686	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	Frame_Shift_Del
USP34	9736	hgsc.bcm.edu	37	2	61538926	61538926	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr2:61538926delG	ENST00000398571.2	-	26	3738	c.3662delC	c.(3661-3663)cctfs	p.P1221fs		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1221					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TACCTTGTCAGGAAGTCCAGC	0.383																																					p.P1221fs		Atlas-INDEL	.											.	USP34	334	.	0			c.3663delT						.						84.0	79.0	81.0					2																	61538926		1891	4129	6020	SO:0001589	frameshift_variant	9736	exon26			.	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.3662delC	chr2.hg19:g.61538926delG	ENSP00000381577:p.Pro1221fs	57.0	0.0		56.0	25.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Frame_Shift_Del	DEL	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.		0.383	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CRMP1	1400	hgsc.bcm.edu	37	4	5827327	5827327	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:5827327delT	ENST00000397890.2	-	13	1735	c.1521delA	c.(1519-1521)ccafs	p.P507fs	EVC_ENST00000382674.2_Intron|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Frame_Shift_Del_p.P621fs|CRMP1_ENST00000512574.1_Frame_Shift_Del_p.P505fs	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	507					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TGGGTGTAGCTGGTACCTCGT	0.517																																					p.A622fs		Atlas-INDEL	.											.	CRMP1	118	.	0			c.1864delG						.						219.0	201.0	207.0					4																	5827327		2203	4300	6503	SO:0001589	frameshift_variant	1400	exon13			.	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1521delA	chr4.hg19:g.5827327delT	ENSP00000380987:p.Pro507fs	175.0	0.0		170.0	67.0	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Frame_Shift_Del	DEL	ENST00000397890.2	hg19	CCDS43207.1																																																																																			.	.		0.517	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
ALB	213	hgsc.bcm.edu	37	4	74276072	74276073	+	Frame_Shift_Del	DEL	AG	AG	-	rs3210163		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr4:74276072_74276073delAG	ENST00000503124.1	+	4	416_417	c.209_210delAG	c.(208-210)cagfs	p.Q70fs	ALB_ENST00000509063.1_Frame_Shift_Del_p.Q220fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Frame_Shift_Del_p.Q105fs|ALB_ENST00000295897.4_Frame_Shift_Del_p.Q220fs|ALB_ENST00000415165.2_Intron			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCTGCCAAACAGAGACTCAAGT	0.366																																					p.220_220del		Atlas-INDEL	.											.	ALB	132	.	0			c.658_659del						.																																			SO:0001589	frameshift_variant	213	exon6			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.209_210delAG	chr4.hg19:g.74276074_74276075delAG	ENSP00000421027:p.Gln70fs	344.0	0.0		330.0	132.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.366	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
NDUFS6	4726	hgsc.bcm.edu	37	5	1802445	1802445	+	Frame_Shift_Del	DEL	A	A	-	rs199652659		TCGA-DD-AAD6-01A-11D-A40R-10	TCGA-DD-AAD6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e38cc549-ebc1-45a9-82a3-3f17720f4c67	d61125a0-8951-47b0-a531-d4685f12039c	g.chr5:1802445delA	ENST00000274137.5	+	2	161	c.143delA	c.(142-144)gatfs	p.D48fs	MRPL36_ENST00000505059.2_5'Flank|MRPL36_ENST00000505818.1_5'Flank|MRPL36_ENST00000508987.1_5'Flank|NDUFS6_ENST00000469176.1_Frame_Shift_Del_p.D48fs|MRPL36_ENST00000382647.7_5'Flank	NM_004553.4	NP_004544.1	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)	48					cardiovascular system development (GO:0072358)|cellular metabolic process (GO:0044237)|fatty acid metabolic process (GO:0006631)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrion morphogenesis (GO:0070584)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|muscle contraction (GO:0006936)|reproductive system development (GO:0061458)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	7						GTTTATGATGATAAAGACTAC	0.338																																					p.D48fs		Atlas-INDEL	.											.	NDUFS6	11	.	0			c.142delG						.						100.0	103.0	102.0					5																	1802445		2203	4300	6503	SO:0001589	frameshift_variant	4726	exon2			.	BC038664	CCDS3866.1	5p15.33	2011-07-04	2002-08-29		ENSG00000145494	ENSG00000145494	1.6.99.3, 1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7713	protein-coding gene	gene with protein product	"""complex I 13kDa subunit A"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial"""	603848	"""NADH dehydrogenase (ubiquinone) Fe-S protein 6 (13kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004553		Approved	CI-13kA	uc003jcy.3	O75380	OTTHUMG00000090372	ENST00000274137.5:c.143delA	chr5.hg19:g.1802445delA	ENSP00000274137:p.Asp48fs	111.0	0.0		132.0	56.0	NM_004553		Frame_Shift_Del	DEL	ENST00000274137.5	hg19	CCDS3866.1																																																																																			.	.		0.338	NDUFS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206744.2	NM_004553	
