#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
METTL18	92342	hgsc.bcm.edu	37	1	169761971	169761971	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr1:169761971A>C	ENST00000310392.4	-	2	1219	c.866T>G	c.(865-867)cTc>cGc	p.L289R	C1orf112_ENST00000413811.2_5'Flank|C1orf112_ENST00000286031.6_5'Flank|C1orf112_ENST00000456684.1_5'Flank|C1orf112_ENST00000498289.1_Intron|METTL18_ENST00000303469.2_Missense_Mutation_p.L289R|C1orf112_ENST00000359326.4_5'Flank	NM_033418.2	NP_219486.1	O95568	MET18_HUMAN	methyltransferase like 18	289						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			kidney(1)|large_intestine(3)|lung(4)	8						GGTGAGAATGAGATCATATTT	0.333																																					p.L289R		Atlas-SNP	.											.	METTL18	23	.	0			c.T866G						.						59.0	61.0	60.0					1																	169761971		2203	4299	6502	SO:0001583	missense	92342	exon2			AGAATGAGATCAT	AL035369	CCDS1284.1	1q24.2	2013-10-11	2011-03-02	2011-03-02	ENSG00000171806	ENSG00000171806			28793	protein-coding gene	gene with protein product	"""histidine protein methyltransferase 1"""	615255	"""chromosome 1 open reading frame 156"""	C1orf156		20864530	Standard	NM_033418		Approved	MGC9084, AsTP2, HPM1	uc001ggn.4	O95568	OTTHUMG00000035813	ENST00000310392.4:c.866T>G	chr1.hg19:g.169761971A>C	ENSP00000307975:p.Leu289Arg	222.0	0.0		352.0	102.0	NM_033418	B2R9T5	Missense_Mutation	SNP	ENST00000310392.4	hg19	CCDS1284.1	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347780	0.61183	.	.	ENSG00000171806	ENST00000310392;ENST00000303469	T;T	0.12879	2.64;2.64	6.17	6.17	0.99709	.	0.212777	0.37577	N	0.002033	T	0.27594	0.0678	M	0.84156	2.68	0.39158	D	0.962341	D	0.59767	0.986	D	0.66497	0.944	T	0.15838	-1.0423	10	0.87932	D	0	0.0217	10.029	0.42090	0.9252:0.0:0.0748:0.0	.	289	O95568	MET18_HUMAN	R	289	ENSP00000307975:L289R;ENSP00000307077:L289R	ENSP00000307077:L289R	L	-	2	0	METTL18	168028595	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.995000	0.70631	2.371000	0.80710	0.533000	0.62120	CTC	.	.		0.333	METTL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087109.1	NM_033418	
KCTD3	51133	hgsc.bcm.edu	37	1	215768702	215768702	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr1:215768702G>A	ENST00000259154.4	+	10	1116	c.822G>A	c.(820-822)gtG>gtA	p.V274V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	274					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TTTAAGGAGTGTTCAGCCTGG	0.373																																					p.V274V		Atlas-SNP	.											.	KCTD3	101	.	0			c.G822A						.						160.0	152.0	155.0					1																	215768702		2203	4300	6503	SO:0001819	synonymous_variant	51133	exon10			AGGAGTGTTCAGC	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.822G>A	chr1.hg19:g.215768702G>A		77.0	0.0		113.0	36.0	NM_016121	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Silent	SNP	ENST00000259154.4	hg19	CCDS1515.1																																																																																			.	.		0.373	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
EML4	27436	hgsc.bcm.edu	37	2	42557132	42557132	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr2:42557132G>A	ENST00000318522.5	+	23	2993	c.2731G>A	c.(2731-2733)Gaa>Aaa	p.E911K	EML4_ENST00000401738.3_Missense_Mutation_p.E922K|EML4_ENST00000402711.2_Missense_Mutation_p.E853K|EML4_ENST00000453191.2_Missense_Mutation_p.E175K	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	911					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						TGAGACAGCTGAAGAGGAAAG	0.493			T	ALK	NSCLC																																p.E911K		Atlas-SNP	.		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	.	EML4	92	.	0			c.G2731A						.						82.0	77.0	79.0					2																	42557132		2203	4300	6503	SO:0001583	missense	27436	exon23			ACAGCTGAAGAGG	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.2731G>A	chr2.hg19:g.42557132G>A	ENSP00000320663:p.Glu911Lys	101.0	0.0		102.0	46.0	NM_019063	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	ENST00000318522.5	hg19	CCDS1807.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.405084	0.62288	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738;ENST00000453191	T;T;D;T	0.97752	1.18;1.23;-4.52;0.94	5.4	4.52	0.55395	.	1.715750	0.02481	N	0.088497	D	0.94515	0.8234	L	0.27053	0.805	0.29842	N	0.829157	B;B;P;P	0.41420	0.01;0.01;0.749;0.749	B;B;B;B	0.37731	0.008;0.008;0.257;0.257	D	0.89493	0.3758	10	0.52906	T	0.07	-24.7593	4.4452	0.11593	0.2244:0.2011:0.5745:0.0	.	853;853;922;911	A6H8Y6;B5MCW9;B5MBZ0;Q9HC35	.;.;.;EMAL4_HUMAN	K	911;853;922;175	ENSP00000320663:E911K;ENSP00000385059:E853K;ENSP00000384939:E922K;ENSP00000400590:E175K	ENSP00000320663:E911K	E	+	1	0	EML4	42410636	0.965000	0.33210	0.992000	0.48379	0.996000	0.88848	2.455000	0.44988	2.519000	0.84933	0.655000	0.94253	GAA	.	.		0.493	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063	
XIRP2	129446	hgsc.bcm.edu	37	2	168105919	168105919	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr2:168105919T>A	ENST00000409195.1	+	9	8106	c.8017T>A	c.(8017-8019)Tgc>Agc	p.C2673S	XIRP2_ENST00000409273.1_Missense_Mutation_p.C2451S|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.C2673S|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2498					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CAAATCAGCTTGCGAAATTAA	0.403																																					p.C2673S		Atlas-SNP	.											.	XIRP2	914	.	0			c.T8017A						.						58.0	57.0	57.0					2																	168105919		1869	4091	5960	SO:0001583	missense	129446	exon9			TCAGCTTGCGAAA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8017T>A	chr2.hg19:g.168105919T>A	ENSP00000386840:p.Cys2673Ser	328.0	1.0		389.0	197.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	8.326	0.825298	0.16749	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02197	4.4;4.4;4.4	6.07	-0.989	0.10242	.	0.812175	0.11931	N	0.515758	T	0.02455	0.0075	L	0.57536	1.79	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.47249	-0.9132	10	0.16420	T	0.52	0.1596	5.9177	0.19063	0.1182:0.298:0.0:0.5837	.	2498;2498;2451	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	S	2673;2673;2451;87	ENSP00000386840:C2673S;ENSP00000295237:C2673S;ENSP00000387255:C2451S	ENSP00000295237:C2673S	C	+	1	0	XIRP2	167814165	0.003000	0.15002	0.062000	0.19696	0.843000	0.47879	0.247000	0.18179	-0.052000	0.13311	0.533000	0.62120	TGC	.	.		0.403	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098804	178098804	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr2:178098804C>A	ENST00000397062.3	-	2	795	c.241G>T	c.(241-243)Ggt>Tgt	p.G81C	NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65C|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65C|NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65C|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65C	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81S(2)|p.G81_F83delGEF(1)|p.G81C(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AGAAATTCACCTGTCTCTTCA	0.438			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.G81C		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,4	NFE2L2	225	.	4	Substitution - Missense(3)|Deletion - In frame(1)	lung(2)|liver(1)|endometrium(1)	c.G241T						.						143.0	142.0	142.0					2																	178098804		1901	4105	6006	SO:0001583	missense	4780	exon2			ATTCACCTGTCTC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.241G>T	chr2.hg19:g.178098804C>A	ENSP00000380252:p.Gly81Cys	70.0	0.0		85.0	39.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.3|21.3	4.125375|4.125375	0.77436|0.77436	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T|T;T;T;T;T;T	0.29142|0.53423	1.58|1.18;1.18;1.18;0.62;0.62;1.18	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75110|0.75110	0.3805|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0	T|T	0.78563|0.78563	-0.2156|-0.2156	7|10	0.31617|0.87932	T|D	0.26|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	S|C	65|65;81;65;65;65;65	ENSP00000391590:A65S|ENSP00000380253:G65C;ENSP00000380252:G81C;ENSP00000411575:G65C;ENSP00000400073:G65C;ENSP00000412191:G65C;ENSP00000410015:G65C	ENSP00000391590:A65S|ENSP00000380252:G81C	A|G	-|-	1|1	0|0	NFE2L2|NFE2L2	177807050|177807050	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.995000|0.995000	0.86356|0.86356	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	GCA|GGT	.	.		0.438	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
GULP1	51454	hgsc.bcm.edu	37	2	189434772	189434772	+	Silent	SNP	A	A	G			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr2:189434772A>G	ENST00000409580.1	+	10	1248	c.534A>G	c.(532-534)acA>acG	p.T178T	GULP1_ENST00000409843.1_Silent_p.T178T|GULP1_ENST00000409830.1_Silent_p.T178T|GULP1_ENST00000359135.3_Silent_p.T178T|GULP1_ENST00000409609.1_Silent_p.T178T|GULP1_ENST00000409805.1_Silent_p.T75T			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	178					apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			ACTTAGAAACAGAAAATATGG	0.279																																					p.T178T	Pancreas(178;563 2065 20199 42378 52815)	Atlas-SNP	.											.	GULP1	35	.	0			c.A534G						.						47.0	53.0	51.0					2																	189434772		2183	4276	6459	SO:0001819	synonymous_variant	51454	exon9			AGAAACAGAAAAT	AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.534A>G	chr2.hg19:g.189434772A>G		395.0	0.0		516.0	167.0	NM_016315	B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Silent	SNP	ENST00000409580.1	hg19	CCDS2295.1	.	.	.	.	.	.	.	.	.	.	A	7.931	0.740583	0.15642	.	.	ENSG00000144366	ENST00000451191	.	.	.	5.86	2.02	0.26589	.	.	.	.	.	T	0.45577	0.1349	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29458	-1.0011	4	.	.	.	-11.8172	3.0751	0.06243	0.535:0.2219:0.0689:0.1742	.	.	.	.	R	3	.	.	Q	+	2	0	GULP1	189143017	0.964000	0.33143	1.000000	0.80357	0.996000	0.88848	0.045000	0.14013	0.570000	0.29347	0.528000	0.53228	CAG	.	.		0.279	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335722.1	NM_016315	
SLC4A3	6508	hgsc.bcm.edu	37	2	220493162	220493162	+	Silent	SNP	A	A	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr2:220493162A>T	ENST00000358055.3	+	3	599	c.87A>T	c.(85-87)ccA>ccT	p.P29P	SLC4A3_ENST00000273063.6_Silent_p.P29P|SLC4A3_ENST00000373760.2_Silent_p.P29P|SLC4A3_ENST00000317151.3_Silent_p.P29P|AC009955.8_ENST00000455896.1_RNA|SLC4A3_ENST00000373762.3_Silent_p.P29P			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	29					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCTAAGTCCAGACGTGGAGG	0.652																																					p.P29P		Atlas-SNP	.											.	SLC4A3	144	.	0			c.A87T						.						44.0	48.0	47.0					2																	220493162		2203	4300	6503	SO:0001819	synonymous_variant	6508	exon3			AAGTCCAGACGTG		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.87A>T	chr2.hg19:g.220493162A>T		198.0	0.0		222.0	94.0	NM_005070	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	hg19	CCDS2445.1																																																																																			.	.		0.652	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
LARS2	23395	hgsc.bcm.edu	37	3	45557708	45557708	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:45557708A>G	ENST00000415258.1	+	16	2125	c.1984A>G	c.(1984-1986)Att>Gtt	p.I662V	LARS2_ENST00000467936.1_3'UTR|LARS2_ENST00000265537.3_Missense_Mutation_p.I662V|LARS2_ENST00000414984.1_Missense_Mutation_p.I619V			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	662					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	GATCGACACGATTCGGCTCTA	0.483																																					p.I662V		Atlas-SNP	.											.	LARS2	48	.	0			c.A1984G						.						252.0	201.0	218.0					3																	45557708		2203	4300	6503	SO:0001583	missense	23395	exon17			GACACGATTCGGC	AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.1984A>G	chr3.hg19:g.45557708A>G	ENSP00000408576:p.Ile662Val	166.0	0.0		183.0	64.0	NM_015340		Missense_Mutation	SNP	ENST00000415258.1	hg19	CCDS2728.1	.	.	.	.	.	.	.	.	.	.	A	4.520	0.096474	0.08681	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	T;T;T	0.35973	1.28;1.28;1.28	5.43	-1.8	0.07907	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.667620	0.15704	N	0.248787	T	0.10165	0.0249	N	0.02169	-0.655	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37103	-0.9720	10	0.02654	T	1	-6.2613	9.181	0.37141	0.4702:0.1042:0.4256:0.0	.	619;662	E9PHM2;Q15031	.;SYLM_HUMAN	V	662;662;619	ENSP00000265537:I662V;ENSP00000408576:I662V;ENSP00000412893:I619V	ENSP00000265537:I662V	I	+	1	0	LARS2	45532712	0.000000	0.05858	0.002000	0.10522	0.831000	0.47069	-0.094000	0.11094	-0.183000	0.10585	0.455000	0.32223	ATT	.	.		0.483	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345001.1	NM_015340	
CACNA2D2	9254	hgsc.bcm.edu	37	3	50403525	50403525	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:50403525G>A	ENST00000479441.1	-	33	2799	c.2800C>T	c.(2800-2802)Cgc>Tgc	p.R934C	CACNA2D2_ENST00000360963.3_Missense_Mutation_p.R858C|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.R928C|XXcos-LUCA11.4_ENST00000606665.1_RNA|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.R927C|XXcos-LUCA11.4_ENST00000606259.1_RNA|XXcos-LUCA11.4_ENST00000607121.1_RNA|XXcos-LUCA11.5_ENST00000606589.1_Intron|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.R935C|XXcos-LUCA11.4_ENST00000607583.1_RNA|XXcos-LUCA11.4_ENST00000607088.1_RNA|XXcos-LUCA11.4_ENST00000607362.1_RNA|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.R927C|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.R934C|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.R927C			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	934					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GACTCCTTGCGGGTGTAGAAG	0.577																																					p.R934C		Atlas-SNP	.											.	CACNA2D2	82	.	0			c.C2800T						.						108.0	102.0	104.0					3																	50403525		2203	4300	6503	SO:0001583	missense	9254	exon33			CCTTGCGGGTGTA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.2800C>T	chr3.hg19:g.50403525G>A	ENSP00000418081:p.Arg934Cys	90.0	0.0		76.0	29.0	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	hg19	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109775	0.56398	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	4.97	4.08	0.47627	.	0.261790	0.32473	N	0.006041	T	0.81706	0.4879	M	0.66939	2.045	0.46609	D	0.999125	D;D	0.76494	0.998;0.999	P;P	0.61275	0.676;0.886	T	0.82550	-0.0401	10	0.62326	D	0.03	-14.0228	11.6586	0.51332	0.0:0.0:0.6809:0.3191	.	934;927	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	C	935;928;927;858;934;927;927;934	ENSP00000407393:R935C;ENSP00000404631:R928C;ENSP00000266039:R927C;ENSP00000354228:R858C;ENSP00000390526:R934C;ENSP00000378519:R927C;ENSP00000390329:R927C;ENSP00000418081:R934C	ENSP00000266039:R927C	R	-	1	0	CACNA2D2	50378529	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.002000	0.40835	1.059000	0.40554	0.561000	0.74099	CGC	.	.		0.577	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
DOCK3	1795	hgsc.bcm.edu	37	3	51418626	51418626	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:51418626G>A	ENST00000266037.9	+	53	5752	c.5729G>A	c.(5728-5730)cGc>cAc	p.R1910H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1910					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GCCCCACCTCGCACTGACACC	0.607																																					p.R1910H		Atlas-SNP	.											.	DOCK3	397	.	0			c.G5729A						.						58.0	71.0	67.0					3																	51418626		2187	4278	6465	SO:0001583	missense	1795	exon53			CACCTCGCACTGA	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5729G>A	chr3.hg19:g.51418626G>A	ENSP00000266037:p.Arg1910His	75.0	0.0		100.0	44.0	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	hg19	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341197	0.81911	.	.	ENSG00000088538	ENST00000266037	T	0.05081	3.5	6.17	6.17	0.99709	.	0.151595	0.49916	D	0.000132	T	0.19087	0.0458	L	0.51422	1.61	0.54753	D	0.999981	D	0.71674	0.998	D	0.72075	0.976	T	0.00020	-1.2351	10	0.45353	T	0.12	.	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	1910	Q8IZD9	DOCK3_HUMAN	H	1910	ENSP00000266037:R1910H	ENSP00000266037:R1910H	R	+	2	0	DOCK3	51393666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.272000	0.78516	2.941000	0.99782	0.655000	0.94253	CGC	.	.		0.607	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
FAM208A	23272	hgsc.bcm.edu	37	3	56674029	56674029	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:56674029G>T	ENST00000493960.2	-	16	2759	c.2749C>A	c.(2749-2751)Ctg>Atg	p.L917M	FAM208A_ENST00000431842.2_Missense_Mutation_p.L521M|FAM208A_ENST00000355628.5_Missense_Mutation_p.L917M	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	917							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						ATTGGAATCAGTTTCCAATGT	0.363																																					p.L917M		Atlas-SNP	.											.	FAM208A	113	.	0			c.C2749A						.						91.0	86.0	88.0					3																	56674029		2202	4300	6502	SO:0001583	missense	23272	exon16			GAATCAGTTTCCA	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.2749C>A	chr3.hg19:g.56674029G>T	ENSP00000417509:p.Leu917Met	104.0	0.0		147.0	27.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	hg19	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300856	0.60195	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.29917	1.55;1.74;2.63	5.48	3.23	0.37069	.	0.000000	0.52532	D	0.000075	T	0.47135	0.1429	L	0.54323	1.7	0.36001	D	0.837403	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.988;0.999	T	0.57763	-0.7755	10	0.87932	D	0	-5.4998	10.0388	0.42144	0.1923:0.0:0.8077:0.0	.	917;917;521	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	M	521;917;917	ENSP00000399410:L521M;ENSP00000417509:L917M;ENSP00000347845:L917M	ENSP00000347845:L917M	L	-	1	2	C3orf63	56649069	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	2.360000	0.44151	1.074000	0.40909	0.650000	0.86243	CTG	.	.		0.363	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
RYBP	23429	hgsc.bcm.edu	37	3	72427650	72427650	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:72427650T>A	ENST00000477973.2	-	4	837	c.838A>T	c.(838-840)Agg>Tgg	p.R280W		NM_012234.5	NP_036366.3	Q8N488	RYBP_HUMAN	RING1 and YY1 binding protein	0					apoptotic process (GO:0006915)|histone H2A monoubiquitination (GO:0035518)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			prostate(1)|upper_aerodigestive_tract(1)	2		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)		GTTCTGACCCTGCACTGGAGG	0.547																																					p.A181A		Atlas-SNP	.											.	RYBP	13	.	0			c.A543T						.						102.0	104.0	103.0					3																	72427650		2160	4253	6413	SO:0001583	missense	23429	exon4			TGACCCTGCACTG	AF179286		3p14.2	2008-07-18			ENSG00000163602	ENSG00000163602			10480	protein-coding gene	gene with protein product	"""YY1 and E4TF1 associated factor 1"", ""ring1 interactor RYBP"", ""apoptin-associating protein 1"", ""death effector domain-associated factor"""	607535				10369680	Standard	NM_012234		Approved	YEAF1, AAP1, DEDAF	uc003dpe.3	Q8N488	OTTHUMG00000159190	ENST00000477973.2:c.838A>T	chr3.hg19:g.72427650T>A	ENSP00000419494:p.Arg280Trp	130.0	0.0		133.0	52.0	NM_012234	Q9P2W5|Q9UMW4	Silent	SNP	ENST00000477973.2	hg19		.	.	.	.	.	.	.	.	.	.	T	7.034	0.561234	0.13498	.	.	ENSG00000163602	ENST00000477973	.	.	.	5.86	3.23	0.37069	.	.	.	.	.	T	0.50377	0.1612	.	.	.	.	.	.	.	.	.	.	.	.	T	0.57516	-0.7798	3	.	.	.	-14.0658	8.8939	0.35451	0.0:0.2184:0.0:0.7816	.	.	.	.	W	280	.	.	R	-	1	2	RYBP	72510340	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	1.214000	0.32419	0.466000	0.27193	-0.297000	0.09499	AGG	.	.		0.547	RYBP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353762.3	NM_012234	
NLGN1	22871	hgsc.bcm.edu	37	3	173996998	173996998	+	Missense_Mutation	SNP	G	G	A	rs371578371		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:173996998G>A	ENST00000457714.1	+	6	1636	c.1207G>A	c.(1207-1209)Gat>Aat	p.D403N	NLGN1_ENST00000361589.4_Missense_Mutation_p.D403N|NLGN1_ENST00000401917.3_Missense_Mutation_p.D443N|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Missense_Mutation_p.D403N	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	420					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AGTAGATAGCGATGATGGTAT	0.338																																					p.D403N		Atlas-SNP	.											.	NLGN1	209	.	0			c.G1207A						.	G	ASN/ASP	0,4406		0,0,2203	122.0	130.0	127.0		1207	5.6	1.0	3		127	1,8599		0,1,4299	no	missense	NLGN1	NM_014932.2	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	403/824	173996998	1,13005	2203	4300	6503	SO:0001583	missense	22871	exon6			GATAGCGATGATG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1207G>A	chr3.hg19:g.173996998G>A	ENSP00000392500:p.Asp403Asn	157.0	0.0		159.0	66.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	hg19	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325969	0.60743	0.0	1.16E-4	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.62	5.62	0.85841	.	0.106713	0.64402	D	0.000006	T	0.49729	0.1574	N	0.16166	0.38	0.58432	D	0.999996	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.40869	-0.9540	10	0.49607	T	0.09	.	19.6753	0.95930	0.0:0.0:1.0:0.0	.	443;403	D2X2H5;Q8N2Q7-2	.;.	N	403;403;403;443	ENSP00000392500:D403N;ENSP00000354541:D403N;ENSP00000441108:D403N;ENSP00000385750:D443N	ENSP00000354541:D403N	D	+	1	0	NLGN1	175479692	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.648000	0.89879	0.563000	0.77884	GAT	.	.		0.338	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
MUC4	4585	hgsc.bcm.edu	37	3	195512150	195512150	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:195512150C>A	ENST00000463781.3	-	2	6760	c.6301G>T	c.(6301-6303)Gac>Tac	p.D2101Y	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2101Y	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGCGTCGGTGACAAGA	0.572																																					p.D2101Y		Atlas-SNP	.											.	MUC4	1505	.	0			c.G6301T						.						50.0	42.0	45.0					3																	195512150		690	1589	2279	SO:0001583	missense	4585	exon2			AAGCGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6301G>T	chr3.hg19:g.195512150C>A	ENSP00000417498:p.Asp2101Tyr	294.0	0.0		403.0	59.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	2.677	-0.276311	0.05679	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38240	1.27;1.15	.	.	.	.	.	.	.	.	T	0.14787	0.0357	N	0.19112	0.55	0.09310	N	1	P	0.35944	0.529	B	0.19666	0.026	T	0.13522	-1.0506	7	.	.	.	.	2.6646	0.05037	0.0:0.5037:0.0:0.4962	.	2101	E7ESK3	.	Y	2101	ENSP00000417498:D2101Y;ENSP00000420243:D2101Y	.	D	-	1	0	MUC4	196996545	0.000000	0.05858	0.017000	0.16124	0.081000	0.17604	-0.112000	0.10791	0.064000	0.16427	0.064000	0.15345	GAC	.	.		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CRMP1	1400	hgsc.bcm.edu	37	4	5841321	5841322	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr4:5841321_5841322GC>TT	ENST00000397890.2	-	9	1109_1110	c.895_896GC>AA	c.(895-897)GCg>AAg	p.A299K	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Missense_Mutation_p.A297K|CRMP1_ENST00000324989.7_Missense_Mutation_p.A413K	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	299					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CACGAACGCCGCAGCCTTGGCC	0.629																																					p.A413E|p.A413T		Atlas-SNP	.											.	CRMP1	118	.	0			c.C1238A|c.G1237A						.																																			SO:0001583	missense	1400	exon9			AACGCCGCAGCCT|ACGCCGCAGCCTT	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.895_896delinsTT	chr4.hg19:g.5841321_5841322delinsTT	ENSP00000380987:p.Ala299Lys	62.0|63.0	0.0		75.0|76.0	31.0|30.0	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	hg19	CCDS43207.1																																																																																			.	.		0.629	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
NWD2	57495	hgsc.bcm.edu	37	4	37246800	37246800	+	Silent	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr4:37246800C>T	ENST00000309447.5	+	1	959	c.111C>T	c.(109-111)gcC>gcT	p.A37A		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		37										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TCGTGCCCGCCGGCCGCAGCG	0.711																																					p.A37A		Atlas-SNP	.											.	KIAA1239	79	.	0			c.C111T						.						3.0	5.0	4.0					4																	37246800		623	1518	2141	SO:0001819	synonymous_variant	57495	exon1			GCCCGCCGGCCGC																												ENST00000309447.5:c.111C>T	chr4.hg19:g.37246800C>T		70.0	0.0		81.0	4.0	NM_001144990	A8MRU1	Silent	SNP	ENST00000309447.5	hg19	CCDS47040.1																																																																																			.	.		0.711	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
PCDHGA4	56111	hgsc.bcm.edu	37	5	140735877	140735877	+	Silent	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr5:140735877C>T	ENST00000571252.1	+	1	1110	c.1110C>T	c.(1108-1110)aaC>aaT	p.N370N	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACTTTTCAACGTGCATGACA	0.433																																					p.N370N		Atlas-SNP	.											.	PCDHGA4	150	.	0			c.C1110T						.						30.0	29.0	30.0					5																	140735877		1956	4091	6047	SO:0001819	synonymous_variant	56111	exon1			TTTCAACGTGCAT	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1110C>T	chr5.hg19:g.140735877C>T		84.0	0.0		112.0	46.0	NM_018917	Q9Y5D3	Silent	SNP	ENST00000571252.1	hg19	CCDS58979.1																																																																																			.	.		0.433	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
ERVFRD-1	405754	hgsc.bcm.edu	37	6	11104810	11104810	+	Missense_Mutation	SNP	C	C	T	rs558720062		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:11104810C>T	ENST00000472091.1	-	2	1109	c.734G>A	c.(733-735)gGa>gAa	p.G245E	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Missense_Mutation_p.G245E	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	245					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						ctggttagctcccttggtttt	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		18505	0.001		0.0	False		,,,				2504	0.0				p.G245E		Atlas-SNP	.											.	ERVFRD-1	41	.	0			c.G734A						.						27.0	27.0	27.0					6																	11104810		2203	4299	6502	SO:0001583	missense	405754	exon2			TTAGCTCCCTTGG	AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.734G>A	chr6.hg19:g.11104810C>T	ENSP00000420174:p.Gly245Glu	60.0	0.0		61.0	26.0	NM_207582		Missense_Mutation	SNP	ENST00000472091.1	hg19	CCDS4519.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692817	0.48202	.	.	ENSG00000244476	ENST00000472091;ENST00000542862	T;T	0.16897	2.31;2.31	0.225	0.225	0.15325	.	422.947000	0.00797	U	0.001381	T	0.13243	0.0321	N	0.22421	0.69	0.26156	N	0.980072	D	0.76494	0.999	D	0.75484	0.986	T	0.27739	-1.0065	9	0.56958	D	0.05	.	.	.	.	.	245	P60508	EFRD1_HUMAN	E	245	ENSP00000420174:G245E;ENSP00000444461:G245E	ENSP00000420174:G245E	G	-	2	0	ERVFRD-1	11212796	0.983000	0.35010	0.929000	0.37066	0.930000	0.56654	0.305000	0.19254	0.300000	0.22699	0.305000	0.20034	GGA	.	.		0.448	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353776.1	NM_207582	
OR5V1	81696	hgsc.bcm.edu	37	6	29323627	29323627	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:29323627C>A	ENST00000377154.1	-	4	645	c.346G>T	c.(346-348)Gca>Tca	p.A116S	OR5V1_ENST00000543825.1_Missense_Mutation_p.A116S			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	116				A -> T (in Ref. 1; CAD31042). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GCCATTGCTGCCAGTAGGAGA	0.408																																					p.A116S	Ovarian(32;43 883 21137 32120 42650)	Atlas-SNP	.											.	OR5V1	63	.	0			c.G346T						.						66.0	67.0	67.0					6																	29323627		2203	4299	6502	SO:0001583	missense	81696	exon1			TTGCTGCCAGTAG		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.346G>T	chr6.hg19:g.29323627C>A	ENSP00000366359:p.Ala116Ser	117.0	0.0		125.0	48.0	NM_030876	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	ENST00000377154.1	hg19	CCDS4657.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808297	0.31961	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.01998	4.51;4.51	4.37	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32719	N	0.005724	T	0.01627	0.0052	L	0.56199	1.76	0.22656	N	0.998885	P	0.47762	0.9	B	0.43331	0.416	T	0.42258	-0.9462	10	0.54805	T	0.06	-34.1359	12.0146	0.53307	0.0:0.9118:0.0:0.0882	.	116	Q9UGF6	OR5V1_HUMAN	S	116	ENSP00000366359:A116S;ENSP00000443309:A116S	ENSP00000366356:A116S	A	-	1	0	OR5V1	29431606	0.000000	0.05858	0.972000	0.41901	0.576000	0.36127	0.249000	0.18216	2.422000	0.82143	0.543000	0.68304	GCA	.	.		0.408	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
PI16	221476	hgsc.bcm.edu	37	6	36930828	36930828	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:36930828C>A	ENST00000373674.3	+	5	1038	c.710C>A	c.(709-711)gCa>gAa	p.A237E	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	237					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCTTCCCTAGCAACGGGGATT	0.552																																					p.A237E		Atlas-SNP	.											PI16,NS,neuroblastoma,0,1	PI16	50	.	0			c.C710A						.						103.0	96.0	99.0					6																	36930828		2203	4300	6503	SO:0001583	missense	221476	exon6			CCCTAGCAACGGG		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.710C>A	chr6.hg19:g.36930828C>A	ENSP00000362778:p.Ala237Glu	137.0	0.0		153.0	74.0	NM_001199159	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	hg19	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539744	0.45176	.	.	ENSG00000164530	ENST00000373674;ENST00000539035	T	0.07567	3.18	4.47	1.71	0.24356	.	0.568577	0.16057	N	0.231657	T	0.07052	0.0179	L	0.51422	1.61	0.80722	D	1	D	0.58268	0.982	P	0.55824	0.785	T	0.27434	-1.0074	10	0.49607	T	0.09	.	6.1845	0.20490	0.0:0.6649:0.1561:0.1789	.	237	Q6UXB8	PI16_HUMAN	E	237;89	ENSP00000362778:A237E	ENSP00000362778:A237E	A	+	2	0	PI16	37038806	0.953000	0.32496	0.859000	0.33776	0.945000	0.59286	0.596000	0.24044	0.383000	0.24910	0.591000	0.81541	GCA	.	.		0.552	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1	NM_153370	
KCNK17	89822	hgsc.bcm.edu	37	6	39271861	39271861	+	Nonsense_Mutation	SNP	G	G	T	rs140102103		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:39271861G>T	ENST00000373231.4	-	4	792	c.560C>A	c.(559-561)tCg>tAg	p.S187*	KCNK17_ENST00000453413.2_Nonsense_Mutation_p.S187*	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	187					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						CAGGAGGCCCGAGAGGAGGGC	0.652																																					p.S187X		Atlas-SNP	.											.	KCNK17	61	.	0			c.C560A						.						49.0	53.0	52.0					6																	39271861		2203	4300	6503	SO:0001587	stop_gained	89822	exon4			AGGCCCGAGAGGA	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.560C>A	chr6.hg19:g.39271861G>T	ENSP00000362328:p.Ser187*	68.0	0.0		87.0	4.0	NM_001135111	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Nonsense_Mutation	SNP	ENST00000373231.4	hg19	CCDS4842.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.882316	0.51908	.	.	ENSG00000124780	ENST00000373231;ENST00000453413	.	.	.	4.21	4.21	0.49690	.	0.281130	0.22934	N	0.053875	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	9.3161	0.37934	0.1012:0.0:0.8988:0.0	.	.	.	.	X	187	.	ENSP00000362328:S187X	S	-	2	0	KCNK17	39379839	0.016000	0.18221	0.263000	0.24496	0.006000	0.05464	1.932000	0.40143	2.166000	0.68216	0.561000	0.74099	TCG	.	G|1.000;A|0.000		0.652	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PRICKLE4	29964	hgsc.bcm.edu	37	6	41751951	41751951	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:41751951A>T	ENST00000394260.1	+	1	95	c.95A>T	c.(94-96)cAg>cTg	p.Q32L	PRICKLE4_ENST00000394259.1_Missense_Mutation_p.Q32L|PRICKLE4_ENST00000458694.1_Missense_Mutation_p.Q72L|PRICKLE4_ENST00000394263.1_Missense_Mutation_p.Q72L|PRICKLE4_ENST00000359201.5_Missense_Mutation_p.Q72L			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)	32	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACCCTCCTGCAGCAACTCCCT	0.557																																					p.Q72L		Atlas-SNP	.											.	PRICKLE4	29	.	0			c.A215T						.						153.0	117.0	130.0					6																	41751951		2203	4300	6503	SO:0001583	missense	29964	exon4			TCCTGCAGCAACT	AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.95A>T	chr6.hg19:g.41751951A>T	ENSP00000377803:p.Gln32Leu	87.0	0.0		104.0	47.0	NM_013397	A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	Missense_Mutation	SNP	ENST00000394260.1	hg19		.	.	.	.	.	.	.	.	.	.	A	18.73	3.687081	0.68157	.	.	ENSG00000124593	ENST00000458694;ENST00000359201;ENST00000394263;ENST00000394259;ENST00000394260	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	4.7	2.26	0.28386	.	0.473404	0.17933	N	0.157081	T	0.70928	0.3280	L	0.45285	1.41	0.34640	D	0.720587	P	0.49559	0.925	P	0.49752	0.621	T	0.63721	-0.6573	10	0.22706	T	0.39	-6.4371	6.2312	0.20736	0.7968:0.0:0.2032:0.0	.	72	Q2TBC4-3	.	L	72;72;72;32;32	ENSP00000404911:Q72L;ENSP00000352128:Q72L;ENSP00000377806:Q72L;ENSP00000377802:Q32L;ENSP00000377803:Q32L	ENSP00000335185:Q72L	Q	+	2	0	PRICKLE4	41859929	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	2.619000	0.46401	0.304000	0.22809	0.459000	0.35465	CAG	.	.		0.557	PRICKLE4-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000303948.1	NM_013397	
ABCB4	5244	hgsc.bcm.edu	37	7	87074258	87074258	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr7:87074258C>T	ENST00000265723.4	-	10	1150	c.1039G>A	c.(1039-1041)Gtt>Att	p.V347I	ABCB4_ENST00000358400.3_Missense_Mutation_p.V347I|ABCB4_ENST00000359206.3_Missense_Mutation_p.V347I|ABCB4_ENST00000545634.1_Missense_Mutation_p.V347I|ABCB4_ENST00000453593.1_Missense_Mutation_p.V347I	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	347	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	GCCTGGCCAACACTGAAAGCT	0.333																																					p.V347I		Atlas-SNP	.											.	ABCB4	177	.	0			c.G1039A						.						65.0	62.0	63.0					7																	87074258		2203	4300	6503	SO:0001583	missense	5244	exon10			GGCCAACACTGAA	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1039G>A	chr7.hg19:g.87074258C>T	ENSP00000265723:p.Val347Ile	1716.0	1.0		1941.0	856.0	NM_018850	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	hg19	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	c	2.233	-0.375585	0.05034	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75	5.01	0.0543	0.14310	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.355033	0.28544	N	0.014963	T	0.68265	0.2982	N	0.01424	-0.875	0.24914	N	0.99202	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12837	0.002;0.005;0.008	T	0.60234	-0.7303	10	0.07325	T	0.83	-3.6652	7.1166	0.25421	0.0:0.4995:0.1082:0.3922	.	347;347;347	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	I	347	ENSP00000352135:V347I;ENSP00000351172:V347I;ENSP00000265723:V347I;ENSP00000392983:V347I;ENSP00000437465:V347I	ENSP00000265723:V347I	V	-	1	0	ABCB4	86912194	0.000000	0.05858	0.828000	0.32881	0.989000	0.77384	-0.531000	0.06171	-0.310000	0.08766	0.460000	0.39030	GTT	.	.		0.333	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
SAMD9	54809	hgsc.bcm.edu	37	7	92731597	92731597	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr7:92731597C>A	ENST00000379958.2	-	3	4083	c.3814G>T	c.(3814-3816)Gat>Tat	p.D1272Y		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1272						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			AAGTATTCATCAAAAAAATCA	0.313																																					p.D1272Y		Atlas-SNP	.											.	SAMD9	239	.	0			c.G3814T						.						43.0	49.0	47.0					7																	92731597		2180	4286	6466	SO:0001583	missense	54809	exon2			ATTCATCAAAAAA	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3814G>T	chr7.hg19:g.92731597C>A	ENSP00000369292:p.Asp1272Tyr	219.0	0.0		189.0	72.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	hg19	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452743	0.43531	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.24908	1.83;2.6	4.62	2.72	0.32119	.	0.387379	0.22527	U	0.058886	T	0.20047	0.0482	L	0.40543	1.245	0.27838	N	0.941209	B	0.30914	0.3	B	0.31442	0.13	T	0.14699	-1.0463	10	0.59425	D	0.04	.	9.2369	0.37473	0.1413:0.6007:0.258:0.0	.	1272	Q5K651	SAMD9_HUMAN	Y	1272	ENSP00000369292:D1272Y;ENSP00000414529:D1272Y	ENSP00000369292:D1272Y	D	-	1	0	SAMD9	92569533	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	1.665000	0.37449	2.377000	0.81083	0.536000	0.68110	GAT	.	.		0.313	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
CNTNAP2	26047	hgsc.bcm.edu	37	7	146829391	146829391	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr7:146829391G>A	ENST00000361727.3	+	8	1654	c.1138G>A	c.(1138-1140)Gct>Act	p.A380T		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	380					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTTTTTCAACGCTACAAGTTA	0.463										HNSCC(39;0.1)																											p.A380T		Atlas-SNP	.											CNTNAP2,NS,carcinoma,0,1	CNTNAP2	392	.	0			c.G1138A						.						126.0	121.0	122.0					7																	146829391		2203	4300	6503	SO:0001583	missense	26047	exon8			TTCAACGCTACAA	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1138G>A	chr7.hg19:g.146829391G>A	ENSP00000354778:p.Ala380Thr	79.0	0.0		109.0	38.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	hg19	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894940	0.72639	.	.	ENSG00000174469	ENST00000361727	T	0.79247	-1.25	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.088434	0.42420	D	0.000703	T	0.66208	0.2766	N	0.24115	0.695	0.80722	D	1	B	0.25809	0.135	B	0.23574	0.047	T	0.61564	-0.7037	10	0.13470	T	0.59	.	18.3986	0.90507	0.0:0.0:1.0:0.0	.	380	Q9UHC6	CNTP2_HUMAN	T	380	ENSP00000354778:A380T	ENSP00000354778:A380T	A	+	1	0	CNTNAP2	146460324	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.191000	0.65110	2.686000	0.91538	0.591000	0.81541	GCT	.	.		0.463	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
LZTS1	11178	hgsc.bcm.edu	37	8	20112506	20112506	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr8:20112506C>T	ENST00000381569.1	-	2	544	c.187G>A	c.(187-189)Gaa>Aaa	p.E63K	LZTS1_ENST00000522290.1_Missense_Mutation_p.E63K|LZTS1_ENST00000265801.6_Missense_Mutation_p.E63K			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	63					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		AAGAAGTCTTCGCTCTTGCCC	0.592																																					p.E63K		Atlas-SNP	.											LZTS1,NS,carcinoma,0,1	LZTS1	72	.	0			c.G187A						.						99.0	91.0	94.0					8																	20112506		2203	4300	6503	SO:0001583	missense	11178	exon1			AGTCTTCGCTCTT	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.187G>A	chr8.hg19:g.20112506C>T	ENSP00000370981:p.Glu63Lys	117.0	0.0		92.0	42.0	NM_021020	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	hg19	CCDS6015.1	.	.	.	.	.	.	.	.	.	.	C	33	5.245606	0.95272	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.24538	2.17;2.17;1.85	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.34395	0.0896	N	0.22421	0.69	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.65684	0.937;0.912	T	0.02533	-1.1145	10	0.09843	T	0.71	-21.7579	19.022	0.92919	0.0:1.0:0.0:0.0	.	63;63	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	K	63	ENSP00000370981:E63K;ENSP00000265801:E63K;ENSP00000429263:E63K	ENSP00000265801:E63K	E	-	1	0	LZTS1	20156786	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.354000	0.79424	2.835000	0.97688	0.650000	0.86243	GAA	.	.		0.592	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
SLC24A2	25769	hgsc.bcm.edu	37	9	19786033	19786033	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr9:19786033C>T	ENST00000341998.2	-	1	893	c.832G>A	c.(832-834)Gtt>Att	p.V278I	SLC24A2_ENST00000286344.3_Missense_Mutation_p.V278I	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	278					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TTCATGAAAACCACATAGCAA	0.398																																					p.V278I		Atlas-SNP	.											SLC24A2,NS,carcinoma,0,1	SLC24A2	93	.	0			c.G832A						.						139.0	132.0	135.0					9																	19786033		2203	4300	6503	SO:0001583	missense	25769	exon1			TGAAAACCACATA	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.832G>A	chr9.hg19:g.19786033C>T	ENSP00000344801:p.Val278Ile	93.0	0.0		125.0	49.0	NM_001193288	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	hg19	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	C	2.242	-0.373600	0.05034	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.67523	-0.27;-0.27	5.91	-4.95	0.03048	Sodium/calcium exchanger membrane region (1);	0.598474	0.18681	N	0.134164	T	0.40862	0.1134	N	0.10645	0.015	0.30190	N	0.799618	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.15752	-1.0426	9	.	.	.	.	17.2888	0.87150	0.0:0.119:0.0:0.881	.	278;278	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	I	278	ENSP00000344801:V278I;ENSP00000286344:V278I	.	V	-	1	0	SLC24A2	19776033	0.998000	0.40836	0.924000	0.36721	0.991000	0.79684	0.463000	0.21972	-0.834000	0.04239	-0.150000	0.13652	GTT	.	.		0.398	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
ACO1	48	hgsc.bcm.edu	37	9	32430520	32430520	+	Silent	SNP	A	A	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr9:32430520A>T	ENST00000309951.6	+	14	1812	c.1674A>T	c.(1672-1674)atA>atT	p.I558I	ACO1_ENST00000541043.1_Silent_p.I459I|ACO1_ENST00000379923.1_Silent_p.I558I	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	558					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		CCTTAGTAATAGCATATGCAA	0.428																																					p.I558I		Atlas-SNP	.											.	ACO1	149	.	0			c.A1674T						.						124.0	122.0	123.0					9																	32430520		2203	4300	6503	SO:0001819	synonymous_variant	48	exon14			AGTAATAGCATAT	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1674A>T	chr9.hg19:g.32430520A>T		143.0	0.0		175.0	81.0	NM_002197	D3DRK7|Q14652|Q5VZA7	Silent	SNP	ENST00000309951.6	hg19	CCDS6525.1																																																																																			.	.		0.428	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
AGTPBP1	23287	hgsc.bcm.edu	37	9	88272416	88272416	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr9:88272416G>A	ENST00000357081.3	-	10	987	c.843C>T	c.(841-843)aaC>aaT	p.N281N	AGTPBP1_ENST00000376081.4_Intron|AGTPBP1_ENST00000376080.1_3'UTR|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376109.3_Silent_p.N333N|AGTPBP1_ENST00000432218.1_Silent_p.N119N|AGTPBP1_ENST00000376083.3_Silent_p.N281N			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	281					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CCAACTTGATGTTTGTAACAC	0.328																																					p.N281N		Atlas-SNP	.											.	AGTPBP1	128	.	0			c.C843T						.						108.0	97.0	101.0					9																	88272416		2202	4300	6502	SO:0001819	synonymous_variant	23287	exon10			CTTGATGTTTGTA	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.843C>T	chr9.hg19:g.88272416G>A		98.0	0.0		108.0	58.0	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	ENST00000357081.3	hg19																																																																																				.	.		0.328	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
FIBCD1	84929	hgsc.bcm.edu	37	9	133799154	133799154	+	Missense_Mutation	SNP	G	G	T	rs369690143		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr9:133799154G>T	ENST00000372338.4	-	4	1068	c.826C>A	c.(826-828)Cgc>Agc	p.R276S	FIBCD1_ENST00000372337.2_Missense_Mutation_p.R118S|FIBCD1_ENST00000448616.1_Missense_Mutation_p.R276S|FIBCD1_ENST00000253018.4_Missense_Mutation_p.R118S	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	276	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		CCGTCCGTGCGCATGTCACAG	0.667																																					p.R276S		Atlas-SNP	.											.	FIBCD1	34	.	0			c.C826A						.						60.0	53.0	55.0					9																	133799154		2202	4300	6502	SO:0001583	missense	84929	exon5			CCGTGCGCATGTC	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.826C>A	chr9.hg19:g.133799154G>T	ENSP00000361413:p.Arg276Ser	118.0	0.0		127.0	43.0	NM_001145106	A3KFK0|Q6UXK6|Q96SJ7	Missense_Mutation	SNP	ENST00000372338.4	hg19	CCDS6937.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.621|7.621	0.676885|0.676885	0.14841|0.14841	.|.	.|.	ENSG00000130720|ENSG00000130720	ENST00000444139|ENST00000448616;ENST00000372338;ENST00000372337;ENST00000253018;ENST00000451466	.|T;T;T;T;T	.|0.80824	.|-1.42;-1.42;-1.42;-0.99;-1.42	5.67|5.67	4.7|4.7	0.59300|0.59300	.|Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	.|0.448728	.|0.26359	.|N	.|0.024836	.|T	.|0.50360	.|0.1611	N|N	0.00996|0.00996	-1.065|-1.065	0.37914|0.37914	D|D	0.931464|0.931464	.|B	.|0.02656	.|0.0	.|B	.|0.08055	.|0.003	.|T	.|0.48433	.|-0.9036	.|10	.|0.24483	.|T	.|0.36	.|.	6.9889|6.9889	0.24743|0.24743	0.0:0.1191:0.4386:0.4422|0.0:0.1191:0.4386:0.4422	.|.	.|276	.|Q8N539	.|FBCD1_HUMAN	X|S	229|276;276;118;118;276	.|ENSP00000414501:R276S;ENSP00000361413:R276S;ENSP00000361412:R118S;ENSP00000253018:R118S;ENSP00000393894:R276S	.|ENSP00000253018:R118S	C|R	-|-	3|1	2|0	FIBCD1|FIBCD1	132788975|132788975	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.630000|0.630000	0.37929|0.37929	3.975000|3.975000	0.56859|0.56859	1.316000|1.316000	0.45131|0.45131	0.563000|0.563000	0.77884|0.77884	TGC|CGC	.	.		0.667	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843	
FAM163B	642968	hgsc.bcm.edu	37	9	136444248	136444248	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr9:136444248G>A	ENST00000496132.1	-	3	641	c.397C>T	c.(397-399)Ctg>Ttg	p.L133L	FAM163B_ENST00000356873.3_Silent_p.L133L			P0C2L3	F163B_HUMAN	family with sequence similarity 163, member B	133						integral component of membrane (GO:0016021)				large_intestine(1)	1						CCCGGGGGCAGCTCCACGTCC	0.701																																					p.L133L		Atlas-SNP	.											.	FAM163B	7	.	0			c.C397T						.						8.0	11.0	10.0					9																	136444248		2107	4177	6284	SO:0001819	synonymous_variant	642968	exon2			GGGGCAGCTCCAC	BX629352	CCDS35171.1	9q34.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000196990	ENSG00000196990			33277	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 166"""	C9orf166			Standard	NM_001080515		Approved		uc011mdm.2	P0C2L3	OTTHUMG00000159557	ENST00000496132.1:c.397C>T	chr9.hg19:g.136444248G>A		84.0	0.0		124.0	47.0	NM_001080515	B2RUZ5	Silent	SNP	ENST00000496132.1	hg19	CCDS35171.1																																																																																			.	.		0.701	FAM163B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356190.1	NM_001080515	
PHPT1	29085	hgsc.bcm.edu	37	9	139744507	139744507	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr9:139744507G>T	ENST00000247665.10	+	2	540	c.203G>T	c.(202-204)gGc>gTc	p.G68V	MAMDC4_ENST00000317446.2_5'Flank|PHPT1_ENST00000371661.1_Missense_Mutation_p.G68V|MAMDC4_ENST00000445819.1_5'Flank|PHPT1_ENST00000545326.1_Missense_Mutation_p.G68V|PHPT1_ENST00000492540.1_3'UTR	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1	68					negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CAGAAGCAAGGCTGCGACTGT	0.652																																					p.G68V		Atlas-SNP	.											.	PHPT1	14	.	0			c.G203T						.						107.0	103.0	104.0					9																	139744507		2203	4300	6503	SO:0001583	missense	29085	exon2			AGCAAGGCTGCGA	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950	ENST00000247665.10:c.203G>T	chr9.hg19:g.139744507G>T	ENSP00000247665:p.Gly68Val	80.0	0.0		92.0	33.0	NM_001135861	B1AMX0|B1AMX1|Q9H0Y3	Missense_Mutation	SNP	ENST00000247665.10	hg19	CCDS7009.1	.	.	.	.	.	.	.	.	.	.	.	18.52	3.641495	0.67244	.	.	ENSG00000054148	ENST00000371661;ENST00000545326;ENST00000247665	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	D	0.84406	0.5465	M	0.93898	3.47	0.80722	D	1	D;D	0.71674	0.986;0.998	P;D	0.71870	0.905;0.975	D	0.87665	0.2537	8	0.66056	D	0.02	0.1892	11.6657	0.51372	0.0:0.0:0.8226:0.1773	.	68;68	Q9NRX4-2;Q9NRX4	.;PHP14_HUMAN	V	68	.	ENSP00000247665:G68V	G	+	2	0	PHPT1	138864328	0.974000	0.33945	0.080000	0.20451	0.932000	0.56968	3.050000	0.49877	2.102000	0.63906	0.462000	0.41574	GGC	.	.		0.652	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055150.1	NM_014172	
DDB1	1642	hgsc.bcm.edu	37	11	61090560	61090560	+	Missense_Mutation	SNP	T	T	C	rs367862166		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr11:61090560T>C	ENST00000301764.7	-	8	1325	c.928A>G	c.(928-930)Att>Gtt	p.I310V	DDB1_ENST00000450997.2_Intron|DDB1_ENST00000545930.1_5'UTR	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	310	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						CACTCAGCAATAGAGGTCTGG	0.478								Nucleotide excision repair (NER)																													p.I310V		Atlas-SNP	.											.	DDB1	100	.	0			c.A928G						.	T	VAL/ILE	0,4406		0,0,2203	92.0	77.0	82.0		928	5.7	1.0	11		82	1,8597	1.2+/-3.3	0,1,4298	no	missense	DDB1	NM_001923.3	29	0,1,6501	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	310/1141	61090560	1,13003	2203	4299	6502	SO:0001583	missense	1642	exon8			CAGCAATAGAGGT	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.928A>G	chr11.hg19:g.61090560T>C	ENSP00000301764:p.Ile310Val	140.0	0.0		133.0	57.0	NM_001923	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	hg19	CCDS31576.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.005356	0.74932	0.0	1.16E-4	ENSG00000167986	ENST00000301764;ENST00000539739;ENST00000535174;ENST00000541513	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.66	5.66	0.87406	.	0.098252	0.64402	D	0.000001	T	0.55273	0.1910	M	0.84156	2.68	0.80722	D	1	B;B;P	0.42375	0.346;0.237;0.778	B;B;P	0.51266	0.181;0.156;0.664	T	0.59295	-0.7481	10	0.02654	T	1	-16.3986	15.9004	0.79369	0.0:0.0:0.0:1.0	.	310;310;310	F5GY55;B7Z2A1;Q16531	.;.;DDB1_HUMAN	V	310;29;93;125	ENSP00000301764:I310V;ENSP00000445563:I29V;ENSP00000446044:I93V;ENSP00000442660:I125V	ENSP00000301764:I310V	I	-	1	0	DDB1	60847136	1.000000	0.71417	0.971000	0.41717	0.974000	0.67602	7.843000	0.86859	2.167000	0.68274	0.533000	0.62120	ATT	.	.		0.478	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73021870	73021870	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr11:73021870G>A	ENST00000263674.3	+	1	2537	c.2187G>A	c.(2185-2187)gaG>gaA	p.E729E	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	729					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						AGGCAGGGGAGGCCTACAGGT	0.637																																					p.E729E		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.G2187A						.						39.0	42.0	41.0					11																	73021870		2200	4293	6493	SO:0001819	synonymous_variant	9828	exon1			AGGGGAGGCCTAC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.2187G>A	chr11.hg19:g.73021870G>A		30.0	0.0		33.0	10.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	hg19	CCDS8221.1																																																																																			.	.		0.637	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
EP400	57634	hgsc.bcm.edu	37	12	132547105	132547105	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr12:132547105G>A	ENST00000333577.4	+	48	8410	c.8301G>A	c.(8299-8301)caG>caA	p.Q2767Q	EP400_ENST00000389561.2_Silent_p.Q2731Q|EP400_ENST00000330386.6_Silent_p.Q2650Q|EP400_ENST00000332482.4_Silent_p.Q2694Q|EP400_ENST00000389562.2_Silent_p.Q2730Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2767	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcagcagcagc	0.587																																					p.Q2731Q		Atlas-SNP	.											.	EP400	370	.	0			c.G8193A						.						22.0	27.0	25.0					12																	132547105		2072	4019	6091	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8301G>A	chr12.hg19:g.132547105G>A		55.0	0.0		111.0	22.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	hg19																																																																																				.	.		0.587	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EP400	57634	hgsc.bcm.edu	37	12	132547108	132547108	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr12:132547108G>A	ENST00000333577.4	+	48	8413	c.8304G>A	c.(8302-8304)caG>caA	p.Q2768Q	EP400_ENST00000389561.2_Silent_p.Q2732Q|EP400_ENST00000330386.6_Silent_p.Q2651Q|EP400_ENST00000332482.4_Silent_p.Q2695Q|EP400_ENST00000389562.2_Silent_p.Q2731Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2768	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcagcagcagc	0.587																																					p.Q2732Q		Atlas-SNP	.											.	EP400	370	.	0			c.G8196A						.						22.0	26.0	25.0					12																	132547108		2047	3981	6028	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8304G>A	chr12.hg19:g.132547108G>A		59.0	0.0		113.0	27.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	hg19																																																																																				.	.		0.587	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
TGDS	23483	hgsc.bcm.edu	37	13	95248352	95248352	+	Silent	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr13:95248352G>A	ENST00000261296.5	-	1	159	c.39C>T	c.(37-39)ccC>ccT	p.P13P	TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	13					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CAAAGCCGCCGGGAAGACCCC	0.602																																					p.P13P		Atlas-SNP	.											.	TGDS	24	.	0			c.C39T						.						41.0	42.0	41.0					13																	95248352		2203	4300	6503	SO:0001819	synonymous_variant	23483	exon1			GCCGCCGGGAAGA	AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.39C>T	chr13.hg19:g.95248352G>A		167.0	0.0		179.0	78.0	NM_014305	Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Silent	SNP	ENST00000261296.5	hg19	CCDS9471.1																																																																																			.	.		0.602	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106904.2	NM_014305	
FERMT2	10979	hgsc.bcm.edu	37	14	53331148	53331148	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr14:53331148G>A	ENST00000395631.2	-	12	1789	c.1573C>T	c.(1573-1575)Cgc>Tgc	p.R525C	FERMT2_ENST00000399304.3_Missense_Mutation_p.R525C|FERMT2_ENST00000341590.3_Missense_Mutation_p.R525C|FERMT2_ENST00000557255.1_5'Flank|FERMT2_ENST00000553373.1_Missense_Mutation_p.R525C|FERMT2_ENST00000343279.4_Missense_Mutation_p.R525C			Q96AC1	FERM2_HUMAN	fermitin family member 2	525	FERM.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TTTAGATAGCGGGGAGACACC	0.348																																					p.R525C		Atlas-SNP	.											.	FERMT2	59	.	0			c.C1573T						.						124.0	120.0	121.0					14																	53331148		2203	4300	6503	SO:0001583	missense	10979	exon12			GATAGCGGGGAGA	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1573C>T	chr14.hg19:g.53331148G>A	ENSP00000378993:p.Arg525Cys	101.0	0.0		106.0	48.0	NM_001135000	B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	hg19	CCDS9713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.27|17.27	3.347306|3.347306	0.61183|0.61183	.|.	.|.	ENSG00000073712|ENSG00000073712	ENST00000553663|ENST00000395631;ENST00000341590;ENST00000554152;ENST00000343279;ENST00000553373;ENST00000399304	T|T;T;T;T;T;T	0.80033|0.80033	-1.33|-1.33;-1.33;-1.33;-1.33;-1.33;-1.33	5.86|5.86	4.97|4.97	0.65823|0.65823	.|Band 4.1 domain (1);FERM central domain (2);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84401|0.84401	0.5464|0.5464	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.46912	.|0.886;0.778;0.778	.|P;P;P	.|0.45406	.|0.462;0.479;0.479	D|D	0.87116|0.87116	0.2188|0.2188	6|10	.|0.72032	.|D	.|0.01	.|.	15.2048|15.2048	0.73169|0.73169	0.0:0.0:0.7445:0.2555|0.0:0.0:0.7445:0.2555	.|.	.|525;525;525	.|Q96AC1-2;Q96AC1;B5TJY2	.|.;FERM2_HUMAN;.	L|C	31|525;525;478;525;525;525	ENSP00000451134:P31L|ENSP00000378993:R525C;ENSP00000340391:R525C;ENSP00000450741:R478C;ENSP00000342858:R525C;ENSP00000451084:R525C;ENSP00000382243:R525C	.|ENSP00000340391:R525C	P|R	-|-	2|1	0|0	FERMT2|FERMT2	52400898|52400898	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.943000|0.943000	0.58893|0.58893	6.622000|6.622000	0.74233|0.74233	1.597000|1.597000	0.50072|0.50072	0.650000|0.650000	0.86243|0.86243	CCG|CGC	.	.		0.348	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
SNW1	22938	hgsc.bcm.edu	37	14	78187159	78187159	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr14:78187159C>G	ENST00000261531.7	-	12	1205	c.1143G>C	c.(1141-1143)caG>caC	p.Q381H	SNW1_ENST00000555761.1_Missense_Mutation_p.Q381H|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.Q219H|SLIRP_ENST00000557623.1_3'UTR	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	381					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TTTCATTTCTCTGAAGTTTCG	0.363																																					p.Q381H		Atlas-SNP	.											.	SNW1	44	.	0			c.G1143C						.						142.0	132.0	135.0					14																	78187159		2203	4300	6503	SO:0001583	missense	22938	exon12			ATTTCTCTGAAGT	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1143G>C	chr14.hg19:g.78187159C>G	ENSP00000261531:p.Gln381His	118.0	0.0		112.0	33.0	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	hg19	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229189	0.58777	.	.	ENSG00000100603	ENST00000261531;ENST00000554775;ENST00000555761	.	.	.	5.39	4.5	0.54988	.	0.119855	0.64402	D	0.000016	T	0.68476	0.3005	M	0.75264	2.295	0.54753	D	0.999988	D;D	0.61697	0.978;0.99	P;P	0.59221	0.854;0.585	T	0.69826	-0.5040	9	0.52906	T	0.07	.	8.5443	0.33413	0.0:0.7138:0.0:0.2862	.	381;381	G3V3A4;Q13573	.;SNW1_HUMAN	H	381;219;381	.	ENSP00000261531:Q381H	Q	-	3	2	SNW1	77256912	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.179000	0.50887	1.263000	0.44181	0.467000	0.42956	CAG	.	.		0.363	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
CEP128	145508	hgsc.bcm.edu	37	14	80993294	80993294	+	Silent	SNP	T	T	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr14:80993294T>C	ENST00000555265.1	-	23	3366	c.2991A>G	c.(2989-2991)ggA>ggG	p.G997G	CEP128_ENST00000553717.1_5'UTR|CEP128_ENST00000281129.3_Silent_p.G997G			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	997						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TGGAATATCTTCCATCAGTTC	0.358																																					p.G997G		Atlas-SNP	.											.	CEP128	146	.	0			c.A2991G						.						76.0	76.0	76.0					14																	80993294		2203	4300	6503	SO:0001819	synonymous_variant	145508	exon22			ATATCTTCCATCA	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2991A>G	chr14.hg19:g.80993294T>C		51.0	0.0		56.0	17.0	NM_152446	B9EK52|Q86X97|Q96ML4	Silent	SNP	ENST00000555265.1	hg19	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	T	1.090	-0.664286	0.03428	.	.	ENSG00000100629	ENST00000556061	.	.	.	5.64	-0.772	0.10998	.	.	.	.	.	T	0.50171	0.1600	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36768	-0.9734	4	.	.	.	.	5.329	0.15922	0.0:0.3623:0.2539:0.3839	.	.	.	.	E	63	.	.	K	-	1	0	CEP128	80063047	0.987000	0.35691	0.826000	0.32828	0.059000	0.15707	0.050000	0.14120	-0.194000	0.10399	-0.472000	0.04984	AAG	.	.		0.358	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
AHNAK2	113146	hgsc.bcm.edu	37	14	105407441	105407441	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr14:105407441T>C	ENST00000333244.5	-	7	14466	c.14347A>G	c.(14347-14349)Att>Gtt	p.I4783V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4783						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGAGAGAGAATAGAAGATTCA	0.502																																					p.I4783V		Atlas-SNP	.											.	AHNAK2	719	.	0			c.A14347G						.						94.0	99.0	97.0					14																	105407441		1943	4136	6079	SO:0001583	missense	113146	exon7			AGAGAATAGAAGA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14347A>G	chr14.hg19:g.105407441T>C	ENSP00000353114:p.Ile4783Val	144.0	0.0		171.0	75.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	T	2.812	-0.246726	0.05867	.	.	ENSG00000185567	ENST00000333244	T	0.00655	5.95	3.26	-5.79	0.02354	.	.	.	.	.	T	0.00440	0.0014	N	0.14661	0.345	0.09310	N	1	B	0.20988	0.05	B	0.10450	0.005	T	0.45512	-0.9256	9	0.05620	T	0.96	.	5.6943	0.17847	0.1219:0.4556:0.0:0.4225	.	4783	Q8IVF2	AHNK2_HUMAN	V	4783	ENSP00000353114:I4783V	ENSP00000353114:I4783V	I	-	1	0	AHNAK2	104478486	.	.	0.000000	0.03702	0.003000	0.03518	.	.	-1.709000	0.01399	-1.072000	0.02254	ATT	.	.		0.502	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	hgsc.bcm.edu	37	14	105408464	105408464	+	Missense_Mutation	SNP	T	T	C	rs377277155		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr14:105408464T>C	ENST00000333244.5	-	7	13443	c.13324A>G	c.(13324-13326)Agt>Ggt	p.S4442G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4442						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGCCGCGTACTGTCCAGCTTG	0.592																																					p.S4442G		Atlas-SNP	.											.	AHNAK2	719	.	0			c.A13324G						.						140.0	149.0	146.0					14																	105408464		2029	4167	6196	SO:0001583	missense	113146	exon7			GCGTACTGTCCAG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13324A>G	chr14.hg19:g.105408464T>C	ENSP00000353114:p.Ser4442Gly	103.0	0.0		111.0	48.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	0.257	-1.002408	0.02128	.	.	ENSG00000185567	ENST00000333244	T	0.00498	6.97	1.75	0.814	0.18756	.	1.211790	0.06879	N	0.802204	T	0.00178	0.0005	N	0.00554	-1.385	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29701	-1.0003	10	0.15066	T	0.55	.	4.9993	0.14257	0.0:0.4517:0.0:0.5483	.	4442	Q8IVF2	AHNK2_HUMAN	G	4442	ENSP00000353114:S4442G	ENSP00000353114:S4442G	S	-	1	0	AHNAK2	104479509	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-0.095000	0.11077	-0.494000	0.06669	-1.033000	0.02402	AGT	.	.		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ACAN	176	hgsc.bcm.edu	37	15	89401482	89401482	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr15:89401482C>T	ENST00000561243.1	+	11	5666	c.5666C>T	c.(5665-5667)tCc>tTc	p.S1889F	ACAN_ENST00000559004.1_Missense_Mutation_p.S1889F|ACAN_ENST00000439576.2_Missense_Mutation_p.S1889F|ACAN_ENST00000352105.7_Missense_Mutation_p.S1889F			P16112	PGCA_HUMAN	aggrecan	1885	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GGGTTTACATCCCAGACTCCG	0.547																																					p.S1889F		Atlas-SNP	.											.	ACAN	220	.	0			c.C5666T						.						62.0	65.0	64.0					15																	89401482		2003	4184	6187	SO:0001583	missense	176	exon12			TTACATCCCAGAC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.5666C>T	chr15.hg19:g.89401482C>T	ENSP00000453342:p.Ser1889Phe	44.0	0.0		73.0	28.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	hg19	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	9.591	1.126196	0.20959	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.07114	3.47;3.22	5.56	5.56	0.83823	.	0.558380	0.13630	N	0.373813	T	0.37571	0.1008	M	0.86740	2.835	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.23084	-1.0198	10	0.51188	T	0.08	-8.5221	18.5131	0.90925	0.0:1.0:0.0:0.0	.	1889;1889	E7ENV9;E7EX88	.;.	F	1889;1889;1775	ENSP00000387356:S1889F;ENSP00000341615:S1889F	ENSP00000268134:S1775F	S	+	2	0	ACAN	87202486	0.296000	0.24398	0.013000	0.15412	0.047000	0.14425	4.114000	0.57858	2.618000	0.88619	0.655000	0.94253	TCC	.	.		0.547	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
MTHFSD	64779	hgsc.bcm.edu	37	16	86582083	86582083	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr16:86582083C>T	ENST00000360900.6	-	4	363	c.338G>A	c.(337-339)tGt>tAt	p.C113Y	MTHFSD_ENST00000322911.6_Missense_Mutation_p.C112Y|MTHFSD_ENST00000543303.2_Missense_Mutation_p.C112Y|MTHFSD_ENST00000546093.1_De_novo_Start_OutOfFrame|MTHFSD_ENST00000381214.5_Missense_Mutation_p.C113Y|MTHFSD_ENST00000568037.1_5'UTR	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	113							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						AGAGGTGGCACATTTTCTCAA	0.458																																					p.C113Y		Atlas-SNP	.											.	MTHFSD	52	.	0			c.G338A						.						143.0	138.0	140.0					16																	86582083		1902	4106	6008	SO:0001583	missense	64779	exon4			GTGGCACATTTTC	AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.338G>A	chr16.hg19:g.86582083C>T	ENSP00000354152:p.Cys113Tyr	117.0	0.0		69.0	43.0	NM_001159377	A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Missense_Mutation	SNP	ENST00000360900.6	hg19	CCDS54047.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381718	0.82792	.	.	ENSG00000103248	ENST00000543303;ENST00000381214;ENST00000360900;ENST00000322911	T;T;T	0.38077	1.16;1.16;1.16	4.98	4.98	0.66077	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.64472	0.2601	M	0.84511	2.7	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.71241	-0.4651	10	0.87932	D	0	-2.1684	15.4266	0.75055	0.0:1.0:0.0:0.0	.	113;112;113;112	E9PAM1;B7ZLC0;Q2M296;Q2M296-2	.;.;MTHSD_HUMAN;.	Y	111;113;113;112	ENSP00000370612:C113Y;ENSP00000354152:C113Y;ENSP00000326777:C112Y	ENSP00000326777:C112Y	C	-	2	0	MTHFSD	85139584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.860000	0.75473	2.323000	0.78572	0.655000	0.94253	TGT	.	.		0.458	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432182.1	NM_022764	
PRPF8	10594	hgsc.bcm.edu	37	17	1582362	1582362	+	Silent	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr17:1582362C>A	ENST00000572621.1	-	10	1813	c.1548G>T	c.(1546-1548)ctG>ctT	p.L516L	PRPF8_ENST00000304992.6_Silent_p.L516L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	516					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGTCCAGGTGCAGGTAGTTGA	0.557																																					p.L516L		Atlas-SNP	.											.	PRPF8	169	.	0			c.G1548T						.						189.0	170.0	177.0					17																	1582362		2203	4300	6503	SO:0001819	synonymous_variant	10594	exon11			CAGGTGCAGGTAG	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1548G>T	chr17.hg19:g.1582362C>A		56.0	0.0		55.0	29.0	NM_006445	O14547|O75965	Silent	SNP	ENST00000572621.1	hg19	CCDS11010.1																																																																																			.	.		0.557	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
MYH13	8735	hgsc.bcm.edu	37	17	10210383	10210383	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr17:10210383T>C	ENST00000418404.3	-	35	5333		c.e35-2		RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Splice_Site			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle						cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCTTGTGTTCTACAAGAAGAA	0.483																																					.		Atlas-SNP	.											MYH13_ENST00000252172,NS,carcinoma,0,2	MYH13	533	.	0			c.5170-2A>G						.						58.0	59.0	59.0					17																	10210383		2114	4236	6350	SO:0001630	splice_region_variant	8735	exon37			GTGTTCTACAAGA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5170-2A>G	chr17.hg19:g.10210383T>C		58.0	0.0		43.0	17.0	NM_003802	O95252|Q9P0U8	Splice_Site	SNP	ENST00000418404.3	hg19	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.663739	0.47572	.	.	ENSG00000006788	ENST00000252172	.	.	.	4.21	4.21	0.49690	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7593	0.62956	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH13	10151108	1.000000	0.71417	0.995000	0.50966	0.445000	0.32107	7.831000	0.86748	1.895000	0.54865	0.460000	0.39030	.	.	.		0.483	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	Intron
PPAN	56342	hgsc.bcm.edu	37	19	10220893	10220893	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr19:10220893G>C	ENST00000253107.7	+	8	899	c.793G>C	c.(793-795)Gcc>Ccc	p.A265P	PPAN_ENST00000393793.1_Missense_Mutation_p.A212P|PPAN_ENST00000556468.1_Missense_Mutation_p.A265P|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.A265P|SNORD105B_ENST00000458770.1_RNA|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.A265P|P2RY11_ENST00000321826.4_5'Flank|SNORD105_ENST00000386910.1_RNA	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	265	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			CAACATGCGGGCCCAGCAGAG	0.697																																					p.A265P		Atlas-SNP	.											.	PPAN	43	.	0			c.G793C						.						20.0	25.0	23.0					19																	10220893		2203	4297	6500	SO:0001583	missense	56342	exon8			ATGCGGGCCCAGC	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.793G>C	chr19.hg19:g.10220893G>C	ENSP00000253107:p.Ala265Pro	103.0	0.0		106.0	43.0	NM_020230	C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	ENST00000253107.7	hg19	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475172	0.43942	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793;ENST00000446223	T;T;T;T;T	0.63096	1.43;-0.02;1.45;-0.02;1.45	4.82	4.82	0.62117	Brix domain (3);	.	.	.	.	T	0.68924	0.3054	L	0.35288	1.05	0.50813	D	0.999898	D;D;D	0.76494	0.999;0.996;0.998	D;D;D	0.70487	0.969;0.92;0.955	T	0.66272	-0.5965	9	0.28530	T	0.3	-31.3739	16.6942	0.85330	0.0:0.0:1.0:0.0	.	265;265;265	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	P	265;265;265;265;265;212;203	ENSP00000411918:A265P;ENSP00000377385:A265P;ENSP00000253107:A265P;ENSP00000450710:A265P;ENSP00000377382:A212P	ENSP00000253107:A265P	A	+	1	0	PPAN;PPAN-P2RY11	10081893	1.000000	0.71417	0.996000	0.52242	0.015000	0.08874	4.111000	0.57838	2.226000	0.72624	0.561000	0.74099	GCC	.	.		0.697	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230	
ZNF420	147923	hgsc.bcm.edu	37	19	37618604	37618604	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr19:37618604A>C	ENST00000337995.3	+	5	926	c.711A>C	c.(709-711)caA>caC	p.Q237H	ZNF420_ENST00000304239.7_Missense_Mutation_p.Q237H|CTC-454I21.4_ENST00000587645.1_RNA|ZNF585A_ENST00000588723.1_Intron	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTAGCTCACAACTTACCCGAC	0.358																																					p.Q237H		Atlas-SNP	.											.	ZNF420	71	.	0			c.A711C						.						58.0	62.0	61.0					19																	37618604		2203	4300	6503	SO:0001583	missense	147923	exon5			CTCACAACTTACC	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.711A>C	chr19.hg19:g.37618604A>C	ENSP00000338770:p.Gln237His	88.0	0.0		62.0	18.0	NM_144689	B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	hg19	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	A	9.405	1.079001	0.20227	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.03889	3.77;3.77	3.98	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.13352	0.335	0.09310	N	1	B	0.16166	0.016	B	0.17433	0.018	T	0.47886	-0.9082	9	0.07030	T	0.85	.	4.9572	0.14048	0.702:0.1892:0.1088:0.0	.	237	Q8TAQ5	ZN420_HUMAN	H	237	ENSP00000306102:Q237H;ENSP00000338770:Q237H	ENSP00000306102:Q237H	Q	+	3	2	ZNF420	42310444	0.000000	0.05858	0.999000	0.59377	0.984000	0.73092	-1.673000	0.01951	1.663000	0.50791	0.533000	0.62120	CAA	.	.		0.358	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689	
CYP2B6	1555	hgsc.bcm.edu	37	19	41497305	41497305	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr19:41497305C>T	ENST00000324071.4	+	1	102	c.95C>T	c.(94-96)cCa>cTa	p.P32L		NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	32					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	CGCCTCCCACCAGGGCCCCGC	0.567																																					p.P32L		Atlas-SNP	.											.	CYP2B6	79	.	0			c.C95T						.						164.0	178.0	173.0					19																	41497305		2203	4300	6503	SO:0001583	missense	1555	exon1			TCCCACCAGGGCC	AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.95C>T	chr19.hg19:g.41497305C>T	ENSP00000324648:p.Pro32Leu	84.0	0.0		88.0	37.0	NM_000767	B4DWP3|Q2V565|Q9UK46	Missense_Mutation	SNP	ENST00000324071.4	hg19	CCDS12570.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344124	0.61073	.	.	ENSG00000197408	ENST00000324071	T	0.09073	3.02	3.1	3.1	0.35709	.	0.000000	0.85682	U	0.000000	T	0.37732	0.1014	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50558	-0.8814	10	0.87932	D	0	.	9.8656	0.41140	0.0:1.0:0.0:0.0	.	32	P20813	CP2B6_HUMAN	L	32	ENSP00000324648:P32L	ENSP00000324648:P32L	P	+	2	0	CYP2B6	46189145	0.295000	0.24389	0.901000	0.35422	0.142000	0.21351	3.165000	0.50778	1.746000	0.51805	0.298000	0.19748	CCA	.	.		0.567	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463260.1	NM_000767	
ZNF331	55422	hgsc.bcm.edu	37	19	54080094	54080094	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr19:54080094C>A	ENST00000253144.9	+	7	1613	c.280C>A	c.(280-282)Cgc>Agc	p.R94S	ZNF331_ENST00000511154.1_Missense_Mutation_p.R94S|ZNF331_ENST00000449416.1_Missense_Mutation_p.R94S|ZNF331_ENST00000511593.2_Missense_Mutation_p.R94S|ZNF331_ENST00000411977.2_Missense_Mutation_p.R94S|ZNF331_ENST00000512387.1_Missense_Mutation_p.R94S|ZNF331_ENST00000513265.1_Missense_Mutation_p.R94S|ZNF331_ENST00000513999.1_Missense_Mutation_p.R94S	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	94					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		AAGACCACAGCGCTCCAGAGG	0.423			T	?	follicular thyroid adenoma																																p.R94S		Atlas-SNP	.		Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	.	ZNF331	66	.	0			c.C280A						.						83.0	85.0	84.0					19																	54080094		2203	4300	6503	SO:0001583	missense	55422	exon5			CCACAGCGCTCCA	AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.280C>A	chr19.hg19:g.54080094C>A	ENSP00000253144:p.Arg94Ser	193.0	0.0		202.0	97.0	NM_001253801	Q96GJ4	Missense_Mutation	SNP	ENST00000253144.9	hg19	CCDS33102.1	.	.	.	.	.	.	.	.	.	.	C	4.582	0.108157	0.08780	.	.	ENSG00000130844	ENST00000253144;ENST00000511593;ENST00000449416;ENST00000514374;ENST00000411977;ENST00000511154;ENST00000513999;ENST00000512387;ENST00000511567;ENST00000514022;ENST00000505949;ENST00000513265	T;T;T;T;T;T;T;T;T;T;T;T	0.08008	3.3;3.3;3.3;5.2;3.3;3.3;3.3;3.3;5.23;3.36;3.14;5.18	3.55	-0.634	0.11516	.	0.779502	0.10484	N	0.669185	T	0.03477	0.0100	N	0.17474	0.49	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.46596	-0.9180	10	0.08599	T	0.76	.	1.6109	0.02693	0.1355:0.2869:0.3966:0.181	.	94	Q9NQX6	ZN331_HUMAN	S	94	ENSP00000253144:R94S;ENSP00000427439:R94S;ENSP00000393817:R94S;ENSP00000424835:R94S;ENSP00000393336:R94S;ENSP00000421014:R94S;ENSP00000423156:R94S;ENSP00000421728:R94S;ENSP00000426127:R94S;ENSP00000422471:R94S;ENSP00000427532:R94S;ENSP00000426458:R94S	ENSP00000253144:R94S	R	+	1	0	ZNF331	58771906	0.001000	0.12720	0.001000	0.08648	0.074000	0.17049	0.994000	0.29693	0.244000	0.21351	0.467000	0.42956	CGC	.	.		0.423	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371366.1	NM_018555	
PCSK2	5126	hgsc.bcm.edu	37	20	17462588	17462588	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr20:17462588C>T	ENST00000262545.2	+	12	2105	c.1790C>T	c.(1789-1791)gCc>gTc	p.A597V	PCSK2_ENST00000377899.1_Missense_Mutation_p.A578V|PCSK2_ENST00000536609.1_Missense_Mutation_p.A562V|PCSK2_ENST00000459871.1_3'UTR	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	597					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACTCAGAGTGCCCCGTACATC	0.622																																					p.A597V		Atlas-SNP	.											.	PCSK2	112	.	0			c.C1790T						.						33.0	30.0	31.0					20																	17462588		2203	4300	6503	SO:0001583	missense	5126	exon12			AGAGTGCCCCGTA	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1790C>T	chr20.hg19:g.17462588C>T	ENSP00000262545:p.Ala597Val	101.0	0.0		98.0	29.0	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	hg19	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196933	0.79015	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.64260	-0.09;-0.09;-0.09	5.47	5.47	0.80525	Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.68063	0.2960	L	0.52573	1.65	0.80722	D	1	P;P;P	0.48230	0.907;0.82;0.515	P;P;B	0.51229	0.663;0.652;0.265	T	0.67043	-0.5770	10	0.44086	T	0.13	-35.8095	18.2492	0.89997	0.0:1.0:0.0:0.0	.	562;578;597	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	V	578;597;562	ENSP00000367131:A578V;ENSP00000262545:A597V;ENSP00000437458:A562V	ENSP00000262545:A597V	A	+	2	0	PCSK2	17410588	1.000000	0.71417	0.995000	0.50966	0.666000	0.39218	7.745000	0.85046	2.718000	0.92993	0.460000	0.39030	GCC	.	.		0.622	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
PLTP	5360	hgsc.bcm.edu	37	20	44538643	44538643	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr20:44538643C>T	ENST00000477313.1	-	3	861	c.267G>A	c.(265-267)atG>atA	p.M89I	PLTP_ENST00000372431.3_Missense_Mutation_p.M89I|PLTP_ENST00000420868.2_Intron|PLTP_ENST00000542937.1_Missense_Mutation_p.M109I|PLTP_ENST00000372420.1_Start_Codon_SNP_p.M1I|PLTP_ENST00000354050.4_Missense_Mutation_p.M89I			P55058	PLTP_HUMAN	phospholipid transfer protein	89					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				TGATTTGAAGCATCAGCTCCT	0.577																																					p.M89I		Atlas-SNP	.											.	PLTP	49	.	0			c.G267A						.						78.0	69.0	72.0					20																	44538643		2203	4300	6503	SO:0001583	missense	5360	exon4			TTGAAGCATCAGC	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.267G>A	chr20.hg19:g.44538643C>T	ENSP00000417138:p.Met89Ile	93.0	0.0		76.0	37.0	NM_182676	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	hg19	CCDS13386.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.611057	0.28712	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937	T;T;T;T;T	0.08720	3.06;3.54;3.54;3.54;3.54	4.83	0.0155	0.14104	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	1.311570	0.04496	N	0.380476	T	0.05410	0.0143	N	0.14661	0.345	0.21445	N	0.999686	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.001;0.002;0.001;0.002;0.003	T	0.40289	-0.9571	10	0.35671	T	0.21	-0.2718	5.2344	0.15439	0.1115:0.4473:0.3514:0.0899	.	1;89;89;89;109	B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;PLTP_HUMAN;.	I	1;89;89;89;109	ENSP00000361497:M1I;ENSP00000361508:M89I;ENSP00000335290:M89I;ENSP00000417138:M89I;ENSP00000440296:M109I	ENSP00000335290:M89I	M	-	3	0	PLTP	43972050	0.232000	0.23762	0.013000	0.15412	0.939000	0.58152	0.278000	0.18753	0.251000	0.21505	0.555000	0.69702	ATG	.	.		0.577	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
DSCAM	1826	hgsc.bcm.edu	37	21	41551019	41551019	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr21:41551019A>G	ENST00000400454.1	-	15	3259	c.2782T>C	c.(2782-2784)Tcc>Ccc	p.S928P		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	928	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAATCCCAGGAGTCTTTTGGG	0.413																																					p.S928P	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.T2782C						.						123.0	116.0	119.0					21																	41551019		1851	4097	5948	SO:0001583	missense	1826	exon15			CCCAGGAGTCTTT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2782T>C	chr21.hg19:g.41551019A>G	ENSP00000383303:p.Ser928Pro	95.0	0.0		126.0	47.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.525017	0.44969	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.56941	0.43;0.43	4.5	4.5	0.54988	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.061145	0.64402	D	0.000002	T	0.42154	0.1190	L	0.35793	1.09	0.44188	D	0.997005	B	0.21071	0.051	B	0.18871	0.023	T	0.26608	-1.0098	10	0.25106	T	0.35	.	13.7728	0.63036	1.0:0.0:0.0:0.0	.	928	O60469	DSCAM_HUMAN	P	928;680	ENSP00000383303:S928P;ENSP00000385342:S680P	ENSP00000383303:S928P	S	-	1	0	DSCAM	40472889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.788000	0.62439	1.792000	0.52537	0.459000	0.35465	TCC	.	.		0.413	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
ARVCF	421	hgsc.bcm.edu	37	22	19965537	19965537	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr22:19965537C>A	ENST00000263207.3	-	8	1933	c.1642G>T	c.(1642-1644)Gac>Tac	p.D548Y	ARVCF_ENST00000401994.1_Missense_Mutation_p.D485Y|ARVCF_ENST00000344269.3_Missense_Mutation_p.D485Y|ARVCF_ENST00000406522.1_Missense_Mutation_p.D485Y|ARVCF_ENST00000406259.1_Missense_Mutation_p.D548Y	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	548					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					AGGAGCGCGTCCACCAGCCCT	0.657																																					p.D548Y		Atlas-SNP	.											.	ARVCF	54	.	0			c.G1642T						.						59.0	51.0	54.0					22																	19965537		2202	4299	6501	SO:0001583	missense	421	exon8			GCGCGTCCACCAG		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1642G>T	chr22.hg19:g.19965537C>A	ENSP00000263207:p.Asp548Tyr	50.0	0.0		55.0	21.0	NM_001670	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	hg19	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700964	0.88924	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42	4.03	4.03	0.46877	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91222	0.7234	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.982	D	0.92728	0.6197	9	.	.	.	-17.5944	17.0615	0.86548	0.0:1.0:0.0:0.0	.	548;70	O00192;E7EV58	ARVC_HUMAN;.	Y	548;485;485;485;548	ENSP00000263207:D548Y;ENSP00000342042:D485Y;ENSP00000384341:D485Y;ENSP00000384732:D485Y;ENSP00000385444:D548Y	.	D	-	1	0	ARVCF	18345537	1.000000	0.71417	0.988000	0.46212	0.849000	0.48306	7.276000	0.78559	2.541000	0.85698	0.655000	0.94253	GAC	.	.		0.657	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
TIMP1	7076	hgsc.bcm.edu	37	X	47445002	47445002	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:47445002G>T	ENST00000218388.4	+	5	559	c.389G>T	c.(388-390)aGc>aTc	p.S130I	TIMP1_ENST00000456754.2_3'UTR|TIMP1_ENST00000377017.1_Missense_Mutation_p.S66I|TIMP1_ENST00000377018.2_Missense_Mutation_p.S124I|SYN1_ENST00000340666.4_Intron|MIR4769_ENST00000584126.1_RNA|SYN1_ENST00000295987.7_Intron	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1	130	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						CCCTGGAACAGCCTGAGCTTA	0.577																																					p.S130I		Atlas-SNP	.											.	TIMP1	12	.	0			c.G389T						.						44.0	36.0	39.0					X																	47445002		2203	4299	6502	SO:0001583	missense	7076	exon5			GGAACAGCCTGAG		CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.389G>T	chrX.hg19:g.47445002G>T	ENSP00000218388:p.Ser130Ile	173.0	0.0		197.0	84.0	NM_003254	Q14252|Q9UCU1	Missense_Mutation	SNP	ENST00000218388.4	hg19	CCDS14281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.55|14.55	2.569732|2.569732	0.45798|0.45798	.|.	.|.	ENSG00000102265|ENSG00000102265	ENST00000445623|ENST00000218388;ENST00000377018;ENST00000377017	.|D;D;D	.|0.94723	.|-3.5;-3.5;-3.5	5.29|5.29	3.5|3.5	0.40072|0.40072	.|Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	.|0.357239	.|0.27306	.|N	.|0.019961	D|D	0.95828|0.95828	0.8642|0.8642	M|M	0.84326|0.84326	2.69|2.69	0.26318|0.26318	N|N	0.977729|0.977729	.|D;D	.|0.63046	.|0.977;0.992	.|P;P	.|0.59424	.|0.857;0.777	D|D	0.90051|0.90051	0.4149|0.4149	5|10	.|0.49607	.|T	.|0.09	.|.	6.4938|6.4938	0.22130|0.22130	0.1008:0.1792:0.72:0.0|0.1008:0.1792:0.72:0.0	.|.	.|124;130	.|B4DJK3;P01033	.|.;TIMP1_HUMAN	S|I	88|130;124;66	.|ENSP00000218388:S130I;ENSP00000366217:S124I;ENSP00000366216:S66I	.|ENSP00000218388:S130I	A|S	+|+	1|2	0|0	TIMP1|TIMP1	47329946|47329946	0.590000|0.590000	0.26815|0.26815	0.373000|0.373000	0.26003|0.26003	0.408000|0.408000	0.30992|0.30992	1.231000|1.231000	0.32624|0.32624	0.450000|0.450000	0.26774|0.26774	0.519000|0.519000	0.50382|0.50382	GCC|AGC	.	.		0.577	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056423.1	NM_003254	
PQBP1	10084	hgsc.bcm.edu	37	X	48759212	48759212	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:48759212T>G	ENST00000376563.1	+	4	385	c.185T>G	c.(184-186)cTc>cGc	p.L62R	PQBP1_ENST00000447146.2_Missense_Mutation_p.L62R|PQBP1_ENST00000376566.4_Missense_Mutation_p.L62R|PQBP1_ENST00000218224.4_Missense_Mutation_p.L62R|PQBP1_ENST00000247140.4_Missense_Mutation_p.L62R|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000396763.1_Missense_Mutation_p.L62R	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	62	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						CACAGCGGGCTCCCTTACTAC	0.552																																					p.L62R		Atlas-SNP	.											.	PQBP1	24	.	0			c.T185G						.						77.0	65.0	69.0					X																	48759212		2203	4300	6503	SO:0001583	missense	10084	exon4			GCGGGCTCCCTTA	AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.185T>G	chrX.hg19:g.48759212T>G	ENSP00000365747:p.Leu62Arg	98.0	0.0		105.0	28.0	NM_001167989	Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	ENST00000376563.1	hg19	CCDS14309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.812|5.812	0.334103|0.334103	0.11013|0.11013	.|.	.|.	ENSG00000102103|ENSG00000102103	ENST00000376563;ENST00000376566;ENST00000447146;ENST00000247140;ENST00000218224;ENST00000396763;ENST00000443648|ENST00000456306	T;T;T;T;T;T;T|.	0.75477|.	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94|.	5.24|5.24	5.24|5.24	0.73138|0.73138	WW/Rsp5/WWP (5);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.38825|0.38825	0.1055|0.1055	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	D;D;D;D;D;B;D;D|.	0.89917|.	0.991;1.0;0.999;1.0;0.999;0.045;1.0;0.999|.	D;D;D;D;D;B;D;D|.	0.97110|.	0.991;1.0;0.962;0.996;0.997;0.041;1.0;0.998|.	T|T	0.28170|0.28170	-1.0052|-1.0052	10|5	0.21014|.	T|.	0.42|.	-21.4748|-21.4748	11.5564|11.5564	0.50750|0.50750	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	62;62;62;62;62;62;62;62|.	O60828-5;O60828-6;O60828-2;C9JQA1;O60828-7;O60828-4;O60828-3;O60828|.	.;.;.;.;.;.;.;PQBP1_HUMAN|.	R|A	62|51	ENSP00000365747:L62R;ENSP00000365750:L62R;ENSP00000391759:L62R;ENSP00000247140:L62R;ENSP00000218224:L62R;ENSP00000379985:L62R;ENSP00000414861:L62R|.	ENSP00000218224:L62R|.	L|S	+|+	2|1	0|0	PQBP1|PQBP1	48644156|48644156	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	6.723000|6.723000	0.74742|0.74742	1.928000|1.928000	0.55862|0.55862	0.486000|0.486000	0.48141|0.48141	CTC|TCC	.	.		0.552	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060777.1	NM_001032381.1	
CACNA1F	778	hgsc.bcm.edu	37	X	49072969	49072969	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:49072969G>C	ENST00000376265.2	-	27	3203	c.3142C>G	c.(3142-3144)Cca>Gca	p.P1048A	CACNA1F_ENST00000323022.5_Missense_Mutation_p.P1037A|CACNA1F_ENST00000376251.1_Missense_Mutation_p.P983A	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1048					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TCTCCATCTGGGTATACCAGG	0.572																																					p.P1048A		Atlas-SNP	.											.	CACNA1F	218	.	0			c.C3142G						.						50.0	40.0	43.0					X																	49072969		2202	4299	6501	SO:0001583	missense	778	exon27			CATCTGGGTATAC	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.3142C>G	chrX.hg19:g.49072969G>C	ENSP00000365441:p.Pro1048Ala	250.0	0.0		299.0	112.0	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	hg19	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	.	10.64	1.408420	0.25378	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96232	-3.95;-3.88;-3.88	4.76	4.76	0.60689	Ion transport (1);	0.469861	0.24400	N	0.038846	D	0.94830	0.8330	L	0.49640	1.575	0.32183	N	0.580176	B;B	0.32467	0.372;0.302	B;B	0.40864	0.121;0.342	D	0.96039	0.9023	10	0.62326	D	0.03	.	9.7757	0.40618	0.0:0.0:0.6597:0.3403	.	1037;1048	F5CIQ9;O60840	.;CAC1F_HUMAN	A	983;1037;1048	ENSP00000365427:P983A;ENSP00000321618:P1037A;ENSP00000365441:P1048A	ENSP00000321618:P1037A	P	-	1	0	CACNA1F	48959913	1.000000	0.71417	0.946000	0.38457	0.513000	0.34164	2.113000	0.41902	1.940000	0.56252	0.513000	0.50165	CCA	.	.		0.572	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
IL1RAPL2	26280	hgsc.bcm.edu	37	X	104984619	104984619	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:104984619A>T	ENST00000372582.1	+	8	1739	c.983A>T	c.(982-984)aAt>aTt	p.N328I	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.N328I	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	328	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GACCTGGCGAATTATACCTGC	0.388																																					p.N328I		Atlas-SNP	.											.	IL1RAPL2	105	.	0			c.A983T						.						71.0	65.0	67.0					X																	104984619		2203	4300	6503	SO:0001583	missense	26280	exon8			TGGCGAATTATAC	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.983A>T	chrX.hg19:g.104984619A>T	ENSP00000361663:p.Asn328Ile	347.0	0.0		440.0	189.0	NM_017416	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	hg19	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.404459	0.83230	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.03689	3.84;3.84	5.88	5.88	0.94601	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.17152	0.0412	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00166	-1.1966	10	0.54805	T	0.06	.	14.2995	0.66336	1.0:0.0:0.0:0.0	.	328	Q9NP60	IRPL2_HUMAN	I	328	ENSP00000361663:N328I;ENSP00000344976:N328I	ENSP00000344976:N328I	N	+	2	0	IL1RAPL2	104871275	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	8.324000	0.90005	1.976000	0.57569	0.486000	0.48141	AAT	.	.		0.388	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
CXorf56	63932	hgsc.bcm.edu	37	X	118699267	118699267	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:118699267C>A	ENST00000371594.4	-	1	130	c.52G>T	c.(52-54)Gag>Tag	p.E18*	CXorf56_ENST00000320339.4_5'UTR|CXorf56_ENST00000536133.1_Nonsense_Mutation_p.E18*	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	18										cervix(1)|endometrium(2)|lung(7)	10						TCATATTCCTCCCGGTCCCGA	0.572																																					p.E18X		Atlas-SNP	.											.	CXorf56	26	.	0			c.G52T						.						74.0	68.0	70.0					X																	118699267		2203	4300	6503	SO:0001587	stop_gained	63932	exon1			ATTCCTCCCGGTC	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.52G>T	chrX.hg19:g.118699267C>A	ENSP00000360652:p.Glu18*	234.0	0.0		275.0	97.0	NM_001170570	A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Nonsense_Mutation	SNP	ENST00000371594.4	hg19	CCDS14579.1	.	.	.	.	.	.	.	.	.	.	C	38	7.077629	0.98048	.	.	ENSG00000018610	ENST00000486230;ENST00000371594;ENST00000536133;ENST00000476164	.	.	.	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-25.0086	15.521	0.75866	0.0:1.0:0.0:0.0	.	.	.	.	X	18	.	ENSP00000360652:E18X	E	-	1	0	CXorf56	118583295	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.026000	0.76455	1.848000	0.53677	0.591000	0.81541	GAG	.	.		0.572	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101	
ARMCX6	54470	hgsc.bcm.edu	37	X	100870760	100870760	+	Frame_Shift_Del	DEL	A	A	-	rs111444743		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:100870760delA	ENST00000361910.4	-	3	1195	c.851delT	c.(850-852)ctcfs	p.L284fs	ARMCX6_ENST00000539247.1_Frame_Shift_Del_p.L284fs|ARMCX6_ENST00000538627.1_Frame_Shift_Del_p.L284fs|ARMCX6_ENST00000497931.1_Intron	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	284						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						TCTGATAAAGAGGGACATGAA	0.517																																					p.L284fs		Atlas-INDEL	.											.	ARMCX6	21	.	0			c.852delC						.						1.0	1.0	1.0					X																	100870760		44	103	147	SO:0001589	frameshift_variant	54470	exon3			.	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.851delT	chrX.hg19:g.100870760delA	ENSP00000354708:p.Leu284fs	125.0	0.0		158.0	25.0	NM_019007	Q9NWJ3	Frame_Shift_Del	DEL	ENST00000361910.4	hg19	CCDS14488.1																																																																																			.	.		0.517	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057562.1	NM_019007	
CD40LG	959	hgsc.bcm.edu	37	X	135741541	135741541	+	Silent	SNP	T	T	C			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chrX:135741541T>C	ENST00000370629.2	+	5	809	c.753T>C	c.(751-753)acT>acC	p.T251T	CD40LG_ENST00000370628.2_Silent_p.T230T	NM_000074.2	NP_000065.1	P29965	CD40L_HUMAN	CD40 ligand	251					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|immunoglobulin secretion (GO:0048305)|inflammatory response (GO:0006954)|isotype switching (GO:0045190)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of interleukin-12 production (GO:0032735)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CD40 receptor binding (GO:0005174)			endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|skin(1)|stomach(1)	26	Acute lymphoblastic leukemia(192;0.000127)					GCCATGGCACTGGCTTCACGT	0.507									Immune Deficiency with Hyper-IgM																												p.T251T		Atlas-SNP	.											.	CD40LG	46	.	0			c.T753C						.						125.0	106.0	113.0					X																	135741541		2203	4300	6503	SO:0001819	synonymous_variant	959	exon5	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	TGGCACTGGCTTC	X67878	CCDS14659.1	Xq26	2014-09-17	2008-08-01	2005-01-14	ENSG00000102245	ENSG00000102245		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11935	protein-coding gene	gene with protein product	"""CD40 antigen ligand"", ""tumor necrosis factor (ligand) superfamily member 5"", ""T-B cell-activating molecule"", ""TNF-related activation protein"", ""hyper-IgM syndrome"""	300386	"""tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)"""	HIGM1, IMD3, TNFSF5		1427881, 7678782	Standard	NM_000074		Approved	CD40L, TRAP, gp39, hCD40L, CD154	uc004faa.3	P29965	OTTHUMG00000022512	ENST00000370629.2:c.753T>C	chrX.hg19:g.135741541T>C		1240.0	2.0		1401.0	529.0	NM_000074		Silent	SNP	ENST00000370629.2	hg19	CCDS14659.1																																																																																			.	.		0.507	CD40LG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058501.1	NM_000074	
EHMT2	10919	hgsc.bcm.edu	37	6	31855974	31855974	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:31855974delA	ENST00000375537.4	-	13	1595	c.1589delT	c.(1588-1590)atgfs	p.M530fs	EHMT2_ENST00000375530.4_Frame_Shift_Del_p.M496fs|EHMT2_ENST00000395728.3_Frame_Shift_Del_p.M587fs|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Frame_Shift_Del_p.M553fs	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	530					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						ACAGAAGACCATCCCATTCAG	0.632																																					p.M530fs		Atlas-INDEL	.											.	EHMT2	45	.	0			c.1590delG						.						71.0	66.0	68.0					6																	31855974		1508	2708	4216	SO:0001589	frameshift_variant	10919	exon13			.	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1589delT	chr6.hg19:g.31855974delA	ENSP00000364687:p.Met530fs	110.0	0.0		133.0	66.0	NM_006709	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Frame_Shift_Del	DEL	ENST00000375537.4	hg19	CCDS4725.1																																																																																			.	.		0.632	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
DST	667	hgsc.bcm.edu	37	6	56480983	56480983	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:56480983delT	ENST00000370765.6	-	24	7389	c.7282delA	c.(7282-7284)acafs	p.T2428fs	DST_ENST00000370769.4_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000361203.3_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1728	Asp-rich.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCAAGTTCTGTAAGTGTGATG	0.438																																					p.T2428fs		Atlas-INDEL	.											.	DST	1427	.	0			c.7283delC						.						93.0	87.0	89.0					6																	56480983		2203	4300	6503	SO:0001589	frameshift_variant	667	exon24			.	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7282delA	chr6.hg19:g.56480983delT	ENSP00000359801:p.Thr2428fs	88.0	0.0		95.0	34.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Del	DEL	ENST00000370765.6	hg19	CCDS4959.1																																																																																			.	.		0.438	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
FN1	2335	hgsc.bcm.edu	37	2	216299510	216299513	+	Frame_Shift_Del	DEL	ATTT	ATTT	-			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	ATTT	ATTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr2:216299510_216299513delATTT	ENST00000359671.1	-	2	448_451	c.183_186delAAAT	c.(181-186)ataaatfs	p.IN61fs	FN1_ENST00000443816.1_Frame_Shift_Del_p.IN61fs|FN1_ENST00000426059.1_Frame_Shift_Del_p.IN61fs|FN1_ENST00000354785.4_Frame_Shift_Del_p.IN61fs|FN1_ENST00000323926.6_Frame_Shift_Del_p.IN61fs|AC012462.1_ENST00000412951.1_RNA|FN1_ENST00000432072.2_Frame_Shift_Del_p.IN61fs|FN1_ENST00000356005.4_Frame_Shift_Del_p.IN61fs|FN1_ENST00000336916.4_Frame_Shift_Del_p.IN61fs|FN1_ENST00000346544.3_Frame_Shift_Del_p.IN61fs|FN1_ENST00000357009.2_Frame_Shift_Del_p.IN61fs|FN1_ENST00000421182.1_Frame_Shift_Del_p.IN61fs|FN1_ENST00000345488.5_Frame_Shift_Del_p.IN61fs|FN1_ENST00000357867.4_Frame_Shift_Del_p.IN61fs|FN1_ENST00000446046.1_Frame_Shift_Del_p.IN61fs			P02751	FINC_HUMAN	fibronectin 1	61	Fibrin- and heparin-binding 1.|Fibronectin type-I 1. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCCACTGTTGATTTATCTGATAGT	0.402																																					p.62_63del		Atlas-INDEL	.											.	FN1	521	.	0			c.184_187del						.																																			SO:0001589	frameshift_variant	2335	exon2			.		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.183_186delAAAT	chr2.hg19:g.216299510_216299513delATTT	ENSP00000352696:p.Ile61fs	93.0	0.0		77.0	36.0	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Frame_Shift_Del	DEL	ENST00000359671.1	hg19																																																																																				.	.		0.402	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
ATP6V1D	51382	hgsc.bcm.edu	37	14	67826386	67826386	+	Frame_Shift_Del	DEL	A	A	-	rs144445579		TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr14:67826386delA	ENST00000216442.7	-	1	580	c.30delT	c.(28-30)tttfs	p.F10fs	ATP6V1D_ENST00000555474.1_Frame_Shift_Del_p.F10fs|EIF2S1_ENST00000256383.4_5'Flank|ATP6V1D_ENST00000554236.1_Frame_Shift_Del_p.F10fs|ATP6V1D_ENST00000555431.1_5'UTR	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	10					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		TTCGCGAGGGAAAGATTTCAA	0.562																																					p.P11fs		Atlas-INDEL	.											.	ATP6V1D	21	.	0			c.31delC						.						81.0	76.0	77.0					14																	67826386		2203	4300	6503	SO:0001589	frameshift_variant	51382	exon1			.	AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.30delT	chr14.hg19:g.67826386delA	ENSP00000216442:p.Phe10fs	57.0	0.0		71.0	37.0	NM_015994	B2RE33|Q9Y688	Frame_Shift_Del	DEL	ENST00000216442.7	hg19	CCDS9780.1																																																																																			.	.		0.562	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1	NM_015994	
MCM3	4172	hgsc.bcm.edu	37	6	52141926	52141940	+	In_Frame_Del	DEL	GGTGGGGATAGCTCG	GGTGGGGATAGCTCG	-	rs150139384|rs77113422	byFrequency	TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	GGTGGGGATAGCTCG	GGTGGGGATAGCTCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr6:52141926_52141940delGGTGGGGATAGCTCG	ENST00000229854.7	-	8	1166_1180	c.1090_1104delCGAGCTATCCCCACC	c.(1090-1104)cgagctatccccaccdel	p.RAIPT364del	MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000419835.2_In_Frame_Del_p.RAIPT318del|MCM3_ENST00000596288.1_In_Frame_Del_p.RAIPT409del			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	364	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					CCCGGCCAGTGGTGGGGATAGCTCGGGGTGCAGTG	0.6																																					p.409_414del		Atlas-INDEL	.											.	MCM3	63	.	0			c.1226_1240del						.																																			SO:0001651	inframe_deletion	4172	exon8			.	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1090_1104delCGAGCTATCCCCACC	chr6.hg19:g.52141926_52141940delGGTGGGGATAGCTCG	ENSP00000229854:p.Arg364_Thr368del	53.0	0.0		66.0	13.0	NM_002388	B4DWW4|Q92660|Q9BTR3|Q9NUE7	In_Frame_Del	DEL	ENST00000229854.7	hg19																																																																																				.	.		0.600	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1		
ACAD11	84129	hgsc.bcm.edu	37	3	132337613	132337613	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr3:132337613delT	ENST00000264990.6	-	11	2250	c.1279delA	c.(1279-1281)atgfs	p.M427fs	ACAD11_ENST00000355458.3_Frame_Shift_Del_p.M427fs|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000481970.2_Frame_Shift_Del_p.M427fs	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	427					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						ACTTTGGCCATTTCCTGTCAA	0.408																																					p.M427fs		Atlas-INDEL	.											.	ACAD11	78	.	0			c.1280delT						.						60.0	57.0	58.0					3																	132337613		2203	4300	6503	SO:0001589	frameshift_variant	84129	exon11			.	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.1279delA	chr3.hg19:g.132337613delT	ENSP00000264990:p.Met427fs	188.0	0.0		227.0	94.0	NM_032169	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Frame_Shift_Del	DEL	ENST00000264990.6	hg19	CCDS3074.1																																																																																			.	.		0.408	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169	
C1orf35	79169	hgsc.bcm.edu	37	1	228290360	228290395	+	Splice_Site	DEL	GTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGA	GTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGA	-	rs371615876|rs578122372	byFrequency	TCGA-DD-AADJ-01A-11D-A40R-10	TCGA-DD-AADJ-10A-01D-A40U-10	GTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGA	GTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	61b59c1e-a279-4c80-ab24-c01048f2a295	c1da5095-b907-4c39-a7b6-4c603e64b113	g.chr1:228290360_228290395delGTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGA	ENST00000272139.4	-	3	480_509	c.246_275delTCGCAGTGGCTACAAGAACGTGAAGAAGCAGCCCAC	c.(244-276)cttcgcagtggctacaagaacgtgaagaagcag>ctg	p.RSGYKNVKKQ83del	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	83							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				GCTCAGGCCCGTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGAGAGGGCCGGG	0.708																																					p.82_92del		Atlas-INDEL	.											.	C1orf35	17	.	0			c.246_276del						.																																			SO:0001630	splice_region_variant	79169	exon3			.	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.246-1TCGCAGTGGCTACAAGAACGTGAAGAAGCAGCCCAC>-	chr1.hg19:g.228290360_228290395delGTGGGCTGCTTCTTCACGTTCTTGTAGCCACTGCGA		73.0	0.0		72.0	13.0	NM_024319	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Frame_Shift_Del	DEL	ENST00000272139.4	hg19	CCDS1566.1																																																																																			.	.		0.708	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319	In_Frame_Del
