#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CD	5293	hgsc.bcm.edu	37	1	9775778	9775778	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:9775778C>A	ENST00000377346.4	+	4	516	c.321C>A	c.(319-321)gaC>gaA	p.D107E	PIK3CD_ENST00000361110.2_Missense_Mutation_p.D107E|PIK3CD_ENST00000543390.1_5'Flank|PIK3CD_ENST00000536656.1_Missense_Mutation_p.D107E	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	107					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GTGAGGGCGACCGCGTGAAGA	0.667																																					p.D107E		Atlas-SNP	.											.	PIK3CD	86	.	0			c.C321A						.						68.0	68.0	68.0					1																	9775778		2203	4300	6503	SO:0001583	missense	5293	exon4			GGGCGACCGCGTG		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.321C>A	chr1.hg19:g.9775778C>A	ENSP00000366563:p.Asp107Glu	136.0	0.0		203.0	89.0	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	hg19	CCDS104.1	.	.	.	.	.	.	.	.	.	.	C	36	5.705716	0.96812	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.45276	0.9;0.9;0.9	5.95	5.95	0.96441	Phosphatidylinositol 3-kinase, p85-binding (2);	0.043393	0.85682	D	0.000000	T	0.53302	0.1788	L	0.44542	1.39	0.80722	D	1	B;P;P	0.39480	0.096;0.675;0.526	B;P;P	0.52189	0.201;0.472;0.692	T	0.47235	-0.9133	10	0.54805	T	0.06	-37.2471	18.1519	0.89677	0.0:1.0:0.0:0.0	.	107;107;107	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	E	107	ENSP00000446444:D107E;ENSP00000366563:D107E;ENSP00000354410:D107E	ENSP00000353766:D107E	D	+	3	2	PIK3CD	9698365	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.431000	0.66507	2.826000	0.97356	0.563000	0.77884	GAC	.	.		0.667	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
EPB41	2035	hgsc.bcm.edu	37	1	29391656	29391656	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:29391656C>A	ENST00000343067.4	+	16	2297	c.2170C>A	c.(2170-2172)Ccc>Acc	p.P724T	EPB41_ENST00000373798.1_Missense_Mutation_p.P724T|EPB41_ENST00000373797.1_Missense_Mutation_p.P710T|EPB41_ENST00000373800.3_Missense_Mutation_p.P482T|EPB41_ENST00000347529.3_Missense_Mutation_p.P635T|EPB41_ENST00000398863.2_Missense_Mutation_p.P670T|EPB41_ENST00000356093.2_Missense_Mutation_p.P691T|EPB41_ENST00000349460.4_Missense_Mutation_p.P501T	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	724	C-terminal (CTD).				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		TGGGCAAATCCCCACAGGAGA	0.418																																					p.P724T		Atlas-SNP	.											.	EPB41	118	.	0			c.C2170A						.						86.0	78.0	80.0					1																	29391656		2203	4300	6503	SO:0001583	missense	2035	exon16			CAAATCCCCACAG	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.2170C>A	chr1.hg19:g.29391656C>A	ENSP00000345259:p.Pro724Thr	115.0	0.0		171.0	66.0	NM_001166005	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	hg19	CCDS53288.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753390	0.49362	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000349460;ENST00000373800;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D;D;D	0.84660	-1.87;-1.85;-1.58;-1.84;-1.82;-1.58;-1.87;-1.88	5.99	5.99	0.97316	.	0.341500	0.31246	N	0.007996	D	0.91119	0.7204	L	0.53249	1.67	0.44711	D	0.997701	B;P;P;P;P;P;P;D;B	0.89917	0.035;0.775;0.57;0.837;0.837;0.749;0.837;1.0;0.151	B;P;B;P;P;B;P;D;B	0.85130	0.013;0.665;0.334;0.535;0.637;0.334;0.535;0.997;0.037	D	0.90307	0.4334	10	0.52906	T	0.07	.	19.4659	0.94939	0.0:1.0:0.0:0.0	.	564;670;724;691;710;687;635;482;501	E9PEX0;E9PEW9;P11171;P11171-2;P11171-7;Q59F12;P11171-5;P11171-4;P11171-3	.;.;41_HUMAN;.;.;.;.;.;.	T	687;724;691;670;564;710;501;482;635;724;710	ENSP00000345259:P724T;ENSP00000348397:P691T;ENSP00000381839:P670T;ENSP00000317597:P501T;ENSP00000362906:P482T;ENSP00000290100:P635T;ENSP00000362904:P724T;ENSP00000362903:P710T	ENSP00000345259:P724T	P	+	1	0	EPB41	29264243	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	4.277000	0.58939	2.840000	0.97914	0.655000	0.94253	CCC	.	.		0.418	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	NM_203342	
CSMD2	114784	hgsc.bcm.edu	37	1	34204803	34204803	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:34204803G>T	ENST00000373381.4	-	15	2482	c.2306C>A	c.(2305-2307)aCc>aAc	p.T769N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	729	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCAGGTGATGGTCTCTGAGCC	0.597																																					p.T729N		Atlas-SNP	.											.	CSMD2	946	.	0			c.C2186A						.						64.0	59.0	61.0					1																	34204803		2203	4300	6503	SO:0001583	missense	114784	exon15			GTGATGGTCTCTG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2306C>A	chr1.hg19:g.34204803G>T	ENSP00000362479:p.Thr769Asn	83.0	0.0		95.0	35.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	hg19		.	.	.	.	.	.	.	.	.	.	G	24.5	4.543313	0.86022	.	.	ENSG00000121904	ENST00000373381	T	0.66815	-0.23	6.17	6.17	0.99709	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.77143	0.4087	L	0.56199	1.76	0.80722	D	1	P;P	0.47604	0.898;0.764	P;P	0.61070	0.881;0.883	T	0.68217	-0.5467	10	0.19590	T	0.45	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	729;769	Q7Z408;E7EUA6	CSMD2_HUMAN;.	N	769	ENSP00000362479:T769N	ENSP00000241312:T729N	T	-	2	0	CSMD2	33977390	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	6.590000	0.74085	2.941000	0.99782	0.655000	0.94253	ACC	.	.		0.597	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CYP4A22	284541	hgsc.bcm.edu	37	1	47606518	47606518	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:47606518T>G	ENST00000371891.3	+	2	293	c.262T>G	c.(262-264)Tat>Gat	p.Y88D	CYP4A22_ENST00000371890.3_Missense_Mutation_p.Y88D|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000294337.3_Missense_Mutation_p.Y88D|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	88						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGCCTGTCCTTATTGGATATG	0.498																																					p.Y88D	Pancreas(88;1240 1470 2099 14214 37557)	Atlas-SNP	.											.	CYP4A22	60	.	0			c.T262G						.						183.0	159.0	167.0					1																	47606518		2203	4300	6503	SO:0001583	missense	284541	exon2			TGTCCTTATTGGA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.262T>G	chr1.hg19:g.47606518T>G	ENSP00000360958:p.Tyr88Asp	70.0	0.0		138.0	49.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	hg19	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	t	1.347	-0.592506	0.03799	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.68624	-0.3;-0.34;-0.34	1.36	-0.637	0.11504	.	0.825859	0.10596	N	0.656257	T	0.52500	0.1738	L	0.39245	1.2	0.09310	N	1	B;B	0.13145	0.007;0.005	B;B	0.24848	0.007;0.056	T	0.46596	-0.9180	10	0.51188	T	0.08	.	3.4037	0.07333	0.0:0.2973:0.2179:0.4847	.	88;88	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	D	88	ENSP00000360957:Y88D;ENSP00000360958:Y88D;ENSP00000294337:Y88D	ENSP00000294337:Y88D	Y	+	1	0	CYP4A22	47379105	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.227000	0.09126	-0.220000	0.09988	-1.527000	0.00925	TAT	.	.		0.498	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
DOCK7	85440	hgsc.bcm.edu	37	1	62953084	62953084	+	Splice_Site	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:62953084C>A	ENST00000340370.5	-	42	5418		c.e42-1		DOCK7_ENST00000251157.5_Intron	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AGCCAGTACTCTGTATAATAA	0.338																																					.		Atlas-SNP	.											DOCK7,NS,carcinoma,0,1	DOCK7	184	.	1	Unknown(1)	endometrium(1)	c.5401-1G>T						.						64.0	71.0	69.0					1																	62953084		2203	4299	6502	SO:0001630	splice_region_variant	85440	exon43			AGTACTCTGTATA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5401-1G>T	chr1.hg19:g.62953084C>A		190.0	0.0		274.0	15.0	NM_033407	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Splice_Site	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462961	0.84425	.	.	ENSG00000116641	ENST00000340370;ENST00000454575;ENST00000395441	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5753	0.95439	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK7	62725672	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.770000	0.85390	2.633000	0.89246	0.591000	0.81541	.	.	.		0.338	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	Intron
ANGPTL3	27329	hgsc.bcm.edu	37	1	63070335	63070335	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:63070335A>C	ENST00000371129.3	+	7	1310	c.1230A>C	c.(1228-1230)gaA>gaC	p.E410D	DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	410	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						AGTGTGGAGAAAACAACCTAA	0.393																																					p.T410T		Atlas-SNP	.											.	ANGPTL3	42	.	0			c.C1230C						.						98.0	98.0	98.0					1																	63070335		2203	4300	6503	SO:0001583	missense	27329	exon7			TGGAGAAAACAAC	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1230A>C	chr1.hg19:g.63070335A>C	ENSP00000360170:p.Glu410Asp	369.0	1.0		443.0	165.0	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Silent	SNP	ENST00000371129.3	hg19	CCDS622.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.424607	0.25639	.	.	ENSG00000132855	ENST00000371129	T	0.76968	-1.06	5.4	5.4	0.78164	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.361732	0.34652	N	0.003793	T	0.43100	0.1232	N	0.11818	0.18	0.30301	N	0.789483	B	0.15719	0.014	B	0.16722	0.016	T	0.12553	-1.0543	10	0.12766	T	0.61	.	15.7054	0.77577	1.0:0.0:0.0:0.0	.	410	Q9Y5C1	ANGL3_HUMAN	D	410	ENSP00000360170:E410D	ENSP00000360170:E410D	E	+	3	2	ANGPTL3	62842923	1.000000	0.71417	0.666000	0.29783	0.940000	0.58332	3.344000	0.52174	2.164000	0.68074	0.477000	0.44152	GAA	.	.		0.393	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
ANGPTL3	27329	hgsc.bcm.edu	37	1	63070357	63070357	+	Missense_Mutation	SNP	A	A	G	rs4145257		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:63070357A>G	ENST00000371129.3	+	7	1332	c.1252A>G	c.(1252-1254)Aac>Gac	p.N418D	DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	418	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.		N -> Y (in dbSNP:rs4145257).		acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						TGGTAAATATAACAAACCAAG	0.373																																					p.E418E		Atlas-SNP	.											.	ANGPTL3	42	.	0			c.G1252G						.						99.0	99.0	99.0					1																	63070357		2203	4300	6503	SO:0001583	missense	27329	exon7			AAATATAACAAAC	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1252A>G	chr1.hg19:g.63070357A>G	ENSP00000360170:p.Asn418Asp	371.0	0.0		451.0	159.0	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Silent	SNP	ENST00000371129.3	hg19	CCDS622.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.868252	0.32977	.	.	ENSG00000132855	ENST00000371129	T	0.76578	-1.03	5.4	2.71	0.32032	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.874603	0.10458	N	0.672346	T	0.51584	0.1683	L	0.41573	1.285	0.09310	N	1	B	0.25007	0.116	B	0.28011	0.085	T	0.52852	-0.8520	10	0.72032	D	0.01	.	5.8007	0.18412	0.6999:0.1696:0.1305:0.0	.	418	Q9Y5C1	ANGL3_HUMAN	D	418	ENSP00000360170:N418D	ENSP00000360170:N418D	N	+	1	0	ANGPTL3	62842945	0.011000	0.17503	0.979000	0.43373	0.987000	0.75469	0.500000	0.22562	0.945000	0.37605	0.477000	0.44152	AAC	.	A|0.998;T|0.002		0.373	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
ANGPTL3	27329	hgsc.bcm.edu	37	1	63070362	63070362	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:63070362A>G	ENST00000371129.3	+	7	1337	c.1257A>G	c.(1255-1257)aaA>aaG	p.K419K	DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	419	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						AATATAACAAACCAAGAGCAA	0.378																																					p.E419E		Atlas-SNP	.											.	ANGPTL3	42	.	0			c.G1257G						.						98.0	98.0	98.0					1																	63070362		2203	4300	6503	SO:0001819	synonymous_variant	27329	exon7			TAACAAACCAAGA	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1257A>G	chr1.hg19:g.63070362A>G		369.0	1.0		455.0	164.0	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Silent	SNP	ENST00000371129.3	hg19	CCDS622.1																																																																																			.	.		0.378	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
ANGPTL3	27329	hgsc.bcm.edu	37	1	63070371	63070371	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:63070371A>G	ENST00000371129.3	+	7	1346	c.1266A>G	c.(1264-1266)gcA>gcG	p.A422A	DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	422	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						AACCAAGAGCAAAATCTAAGC	0.373																																					p.I422M		Atlas-SNP	.											.	ANGPTL3	42	.	0			c.T1266G						.						95.0	96.0	96.0					1																	63070371		2203	4300	6503	SO:0001819	synonymous_variant	27329	exon7			AAGAGCAAAATCT	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1266A>G	chr1.hg19:g.63070371A>G		369.0	0.0		460.0	173.0	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Missense_Mutation	SNP	ENST00000371129.3	hg19	CCDS622.1																																																																																			.	.		0.373	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
MIER1	57708	hgsc.bcm.edu	37	1	67436507	67436507	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:67436507T>A	ENST00000355356.3	+	8	779	c.630T>A	c.(628-630)gaT>gaA	p.D210E	MIER1_ENST00000357692.2_Missense_Mutation_p.D227E|MIER1_ENST00000401042.3_Missense_Mutation_p.D210E|MIER1_ENST00000355977.6_Missense_Mutation_p.D147E|MIER1_ENST00000401041.1_Missense_Mutation_p.D263E|MIER1_ENST00000371016.1_Missense_Mutation_p.D227E|MIER1_ENST00000371018.3_Missense_Mutation_p.D227E|MIER1_ENST00000371014.1_Missense_Mutation_p.D263E	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator	210	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						AAAATGATGATCAGCTCCTGT	0.308																																					p.D263E		Atlas-SNP	.											.	MIER1	86	.	0			c.T789A						.						74.0	70.0	71.0					1																	67436507		1821	4080	5901	SO:0001583	missense	57708	exon9			TGATGATCAGCTC		CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.630T>A	chr1.hg19:g.67436507T>A	ENSP00000347514:p.Asp210Glu	203.0	0.0		245.0	102.0	NM_001077700	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Missense_Mutation	SNP	ENST00000355356.3	hg19	CCDS41348.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.238259	0.79800	.	.	ENSG00000198160	ENST00000371017;ENST00000371018;ENST00000355977;ENST00000357692;ENST00000401041;ENST00000371016;ENST00000371014;ENST00000401042;ENST00000355356	T;T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37	5.38	2.8	0.32819	ELM2 domain (2);	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	M	0.84511	2.7	0.58432	D	0.999993	D;D;D;D;D;D;D;D;D	0.89917	0.987;1.0;1.0;0.99;0.995;1.0;1.0;0.962;0.986	D;D;D;D;D;D;D;D;D	0.87578	0.966;0.998;0.996;0.986;0.982;0.998;0.996;0.953;0.971	T	0.47661	-0.9100	10	0.20519	T	0.43	-49.7154	4.7714	0.13157	0.0:0.4339:0.0:0.5661	.	227;227;210;210;147;234;227;263;263	Q5TAD2;Q32NC4;Q8N108-3;Q8N108-6;Q08AE0;Q8N108;Q8N108-10;Q5TAD5;Q5TAD4	.;.;.;.;.;MIER1_HUMAN;.;.;.	E	231;227;147;227;263;227;263;210;210	ENSP00000360057:D227E;ENSP00000348253:D147E;ENSP00000350321:D227E;ENSP00000383820:D263E;ENSP00000360055:D227E;ENSP00000360053:D263E;ENSP00000383821:D210E;ENSP00000347514:D210E	ENSP00000347514:D210E	D	+	3	2	MIER1	67209095	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.947000	0.49058	1.005000	0.39183	0.454000	0.30748	GAT	.	.		0.308	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025491.2	NM_020948	
FLG	2312	hgsc.bcm.edu	37	1	152280666	152280667	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:152280666_152280667CC>AA	ENST00000368799.1	-	3	6730_6731	c.6695_6696GG>TT	c.(6694-6696)gGG>gTT	p.G2232V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2232	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCCTGGGCCCTGATGATTG	0.584									Ichthyosis																												p.G2232G|p.G2232V		Atlas-SNP	.											.	FLG	900	.	0			c.G6696T|c.G6695T						.																																			SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCTGGGCCCTGAT|CTGGGCCCTGATG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6695_6696delinsAA	chr1.hg19:g.152280666_152280667delinsAA	ENSP00000357789:p.Gly2232Val	115.0|117.0	0.0		150.0	49.0|48.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent|Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1																																																																																			.	.		0.584	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
NUP210L	91181	hgsc.bcm.edu	37	1	154033101	154033101	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:154033101A>G	ENST00000368559.3	-	20	2836	c.2765T>C	c.(2764-2766)gTg>gCg	p.V922A	NUP210L_ENST00000271854.3_Missense_Mutation_p.V922A	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	922					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AGATCCTTCCACAAGGCTAAA	0.378																																					p.V922A		Atlas-SNP	.											.	NUP210L	181	.	0			c.T2765C						.						102.0	93.0	96.0					1																	154033101		1866	4098	5964	SO:0001583	missense	91181	exon20			CCTTCCACAAGGC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2765T>C	chr1.hg19:g.154033101A>G	ENSP00000357547:p.Val922Ala	75.0	0.0		109.0	37.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	hg19	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.423837	0.25639	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.06068	3.61;3.35	5.14	5.14	0.70334	.	0.000000	0.53938	D	0.000048	T	0.03263	0.0095	L	0.51422	1.61	0.36542	D	0.871331	P;P	0.48089	0.905;0.905	P;P	0.46026	0.501;0.501	T	0.20472	-1.0274	10	0.06494	T	0.89	-15.9844	12.5793	0.56381	1.0:0.0:0.0:0.0	.	922;922	E7EP56;Q5VU65	.;P210L_HUMAN	A	922	ENSP00000357547:V922A;ENSP00000271854:V922A	ENSP00000271854:V922A	V	-	2	0	NUP210L	152299725	0.983000	0.35010	1.000000	0.80357	0.987000	0.75469	1.689000	0.37700	2.161000	0.67846	0.533000	0.62120	GTG	.	.		0.378	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
KCNN3	3782	hgsc.bcm.edu	37	1	154842234	154842235	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:154842234_154842235CT>AA	ENST00000271915.4	-	1	521_522	c.206_207AG>TT	c.(205-207)cAG>cTT	p.Q69L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	69	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgctgctgctgaag	0.698																																					p.Q69H|p.Q69L		Atlas-SNP	.											.	KCNN3	141	.	0			c.G207T|c.A206T						.																																			SO:0001583	missense	3782	exon1			CTGCTGCTGCTGC|TGCTGCTGCTGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.206_207delinsAA	chr1.hg19:g.154842234_154842235delinsAA	ENSP00000271915:p.Gln69Leu	56.0|58.0	0.0		77.0|76.0	5.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
OR10Z1	128368	hgsc.bcm.edu	37	1	158576492	158576492	+	Silent	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:158576492G>T	ENST00000361284.1	+	1	264	c.264G>T	c.(262-264)ggG>ggT	p.G88G		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TGGCTGGGGGGGACCAGGCTA	0.547																																					p.G88G		Atlas-SNP	.											.	OR10Z1	99	.	0			c.G264T						.						182.0	191.0	188.0					1																	158576492		2203	4300	6503	SO:0001819	synonymous_variant	128368	exon1			TGGGGGGGACCAG	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.264G>T	chr1.hg19:g.158576492G>T		61.0	0.0		83.0	33.0	NM_001004478	Q5VYL0|Q6IFR7	Silent	SNP	ENST00000361284.1	hg19	CCDS30901.1																																																																																			.	.		0.547	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478	
FMO3	2328	hgsc.bcm.edu	37	1	171083272	171083272	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:171083272T>C	ENST00000367755.4	+	7	1064	c.953T>C	c.(952-954)aTa>aCa	p.I318T	FMO3_ENST00000538429.1_Missense_Mutation_p.I255T|FMO3_ENST00000542847.1_Missense_Mutation_p.I298T|FMO3_ENST00000392085.2_Missense_Mutation_p.I318T	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	318					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GATGGGACCATATTTGAGGGC	0.443																																					p.I318T		Atlas-SNP	.											.	FMO3	73	.	0			c.T953C						.						156.0	141.0	146.0					1																	171083272		2203	4300	6503	SO:0001583	missense	2328	exon7			GGACCATATTTGA	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.953T>C	chr1.hg19:g.171083272T>C	ENSP00000356729:p.Ile318Thr	57.0	0.0		90.0	33.0	NM_006894	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	hg19	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	T	0.171	-1.071672	0.01918	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	4.73	-0.888	0.10583	.	0.560313	0.19733	N	0.107301	T	0.06096	0.0158	N	0.03238	-0.38	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.34354	-0.9832	10	0.13108	T	0.6	0.0183	2.2265	0.03985	0.1023:0.2147:0.1902:0.4927	.	255;298;318	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	T	318;318;298;255	ENSP00000356729:I318T;ENSP00000375935:I318T;ENSP00000444073:I298T;ENSP00000439500:I255T	ENSP00000356729:I318T	I	+	2	0	FMO3	169349896	0.000000	0.05858	0.043000	0.18650	0.029000	0.11900	-0.375000	0.07475	-0.318000	0.08665	-1.162000	0.01777	ATA	.	.		0.443	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
FMO3	2328	hgsc.bcm.edu	37	1	171083276	171083276	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:171083276T>G	ENST00000367755.4	+	7	1068	c.957T>G	c.(955-957)ttT>ttG	p.F319L	FMO3_ENST00000538429.1_Missense_Mutation_p.F256L|FMO3_ENST00000542847.1_Missense_Mutation_p.F299L|FMO3_ENST00000392085.2_Missense_Mutation_p.F319L	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	319					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GGACCATATTTGAGGGCATTG	0.433																																					p.F319L		Atlas-SNP	.											.	FMO3	73	.	0			c.T957G						.						155.0	141.0	146.0					1																	171083276		2203	4300	6503	SO:0001583	missense	2328	exon7			CATATTTGAGGGC	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.957T>G	chr1.hg19:g.171083276T>G	ENSP00000356729:p.Phe319Leu	56.0	0.0		89.0	32.0	NM_006894	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	hg19	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	T	11.67	1.706657	0.30232	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	4.73	3.51	0.40186	.	0.407958	0.27379	N	0.019629	T	0.14700	0.0355	L	0.31294	0.92	0.31710	N	0.639691	P;P;B	0.42692	0.787;0.613;0.142	B;B;B	0.39258	0.295;0.185;0.216	T	0.05801	-1.0863	10	0.08381	T	0.77	-9.3707	4.9997	0.14259	0.3344:0.0:0.1406:0.525	.	256;299;319	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	L	319;319;299;256	ENSP00000356729:F319L;ENSP00000375935:F319L;ENSP00000444073:F299L;ENSP00000439500:F256L	ENSP00000356729:F319L	F	+	3	2	FMO3	169349900	0.999000	0.42202	0.998000	0.56505	0.255000	0.26057	0.509000	0.22707	1.871000	0.54225	0.528000	0.53228	TTT	.	.		0.433	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
MYOG	4656	hgsc.bcm.edu	37	1	203055032	203055032	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:203055032C>A	ENST00000241651.4	-	1	132	c.58G>T	c.(58-60)Gaa>Taa	p.E20*		NM_002479.5	NP_002470.2	P15173	MYOG_HUMAN	myogenin (myogenic factor 4)	20					cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lithium ion (GO:0071285)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|negative regulation of cell proliferation (GO:0008285)|ossification (GO:0001503)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of muscle atrophy (GO:0014737)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myoblast fusion (GO:1901739)|regulation of satellite cell proliferation (GO:0014842)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|striated muscle atrophy (GO:0014891)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|urinary_tract(1)	12						AGGTAGTTTTCCCCATCATAG	0.617																																					p.E20X		Atlas-SNP	.											.	MYOG	28	.	0			c.G58T						.						50.0	44.0	46.0					1																	203055032		2203	4300	6503	SO:0001587	stop_gained	4656	exon1			AGTTTTCCCCATC	BC053899	CCDS1433.1	1q31-q41	2013-05-21			ENSG00000122180	ENSG00000122180		"""Basic helix-loop-helix proteins"""	7612	protein-coding gene	gene with protein product		159980		MYF4		10329008	Standard	NM_002479		Approved	bHLHc3	uc001gzd.4	P15173	OTTHUMG00000042127	ENST00000241651.4:c.58G>T	chr1.hg19:g.203055032C>A	ENSP00000241651:p.Glu20*	104.0	0.0		161.0	61.0	NM_002479	Q53XW6	Nonsense_Mutation	SNP	ENST00000241651.4	hg19	CCDS1433.1	.	.	.	.	.	.	.	.	.	.	c	37	6.134173	0.97315	.	.	ENSG00000122180	ENST00000241651	.	.	.	5.68	4.74	0.60224	.	0.397439	0.30820	N	0.008815	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	15.7728	0.78184	0.1373:0.8627:0.0:0.0	.	.	.	.	X	20	.	ENSP00000241651:E20X	E	-	1	0	MYOG	201321655	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	7.230000	0.78097	1.338000	0.45544	0.558000	0.71614	GAA	.	.		0.617	MYOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100279.1	NM_002479	
MARC1	64757	hgsc.bcm.edu	37	1	220970004	220970004	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:220970004G>A	ENST00000366910.5	+	3	655	c.469G>A	c.(469-471)Gag>Aag	p.E157K	MARC1_ENST00000496110.1_3'UTR	NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	157					detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										CCTGGAGATAGAGGGCAGGGA	0.572																																					p.E157K		Atlas-SNP	.											.	.	.	.	0			c.G469A						.						61.0	56.0	58.0					1																	220970004		2203	4300	6503	SO:0001583	missense	64757	exon3			GAGATAGAGGGCA	AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.469G>A	chr1.hg19:g.220970004G>A	ENSP00000355877:p.Glu157Lys	86.0	0.0		126.0	45.0	NM_022746	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Missense_Mutation	SNP	ENST00000366910.5	hg19	CCDS1526.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.060|7.060	0.566198|0.566198	0.13560|0.13560	.|.	.|.	ENSG00000186205|ENSG00000186205	ENST00000366910|ENST00000407981	T|.	0.29655|.	1.56|.	4.71|4.71	2.81|2.81	0.32909|0.32909	MOSC, N-terminal beta barrel (1);Pyruvate kinase-like, insert domain (1);|.	0.207351|.	0.32120|.	N|.	0.006554|.	T|T	0.37785|0.37785	0.1016|0.1016	L|L	0.39397|0.39397	1.21|1.21	0.23186|0.23186	N|N	0.998152|0.998152	B;B|.	0.13145|.	0.007;0.003|.	B;B|.	0.15870|.	0.013;0.014|.	T|T	0.20940|0.20940	-1.0260|-1.0260	10|5	0.16420|.	T|.	0.52|.	-2.5841|-2.5841	9.7471|9.7471	0.40453|0.40453	0.0851:0.5169:0.398:0.0|0.0851:0.5169:0.398:0.0	.|.	157;157|.	Q5VT66-2;Q5VT66|.	.;MOSC1_HUMAN|.	K|K	157|65	ENSP00000355877:E157K|.	ENSP00000355877:E157K|.	E|R	+|+	1|2	0|0	MOSC1|MOSC1	219036627|219036627	0.267000|0.267000	0.24122|0.24122	0.360000|0.360000	0.25837|0.25837	0.359000|0.359000	0.29487|0.29487	0.716000|0.716000	0.25836|0.25836	0.365000|0.365000	0.24400|0.24400	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.	.		0.572	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090904.1	NM_022746	
OBSCN	84033	hgsc.bcm.edu	37	1	228556439	228556439	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:228556439T>C	ENST00000422127.1	+	89	19828	c.19784T>C	c.(19783-19785)aTg>aCg	p.M6595T	OBSCN_ENST00000570156.2_Missense_Mutation_p.M7552T|OBSCN_ENST00000366707.4_Missense_Mutation_p.M4229T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6595	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AACATCCTGATGGTGCATCCT	0.597																																					p.M7552T		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T22655C						.						173.0	182.0	179.0					1																	228556439		2011	4177	6188	SO:0001583	missense	84033	exon100			TCCTGATGGTGCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.19784T>C	chr1.hg19:g.228556439T>C	ENSP00000409493:p.Met6595Thr	68.0	0.0		99.0	37.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.832315	0.50845	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.65178	-0.14;-0.14	4.37	4.37	0.52481	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.898935	0.09381	N	0.809962	T	0.74313	0.3700	L	0.46819	1.47	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.69045	-0.5249	10	0.52906	T	0.07	.	14.0056	0.64461	0.0:0.0:0.0:1.0	.	6595	Q5VST9	OBSCN_HUMAN	T	6595;4229	ENSP00000409493:M6595T;ENSP00000355668:M4229T	ENSP00000355668:M4229T	M	+	2	0	OBSCN	226623062	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.748000	0.85085	1.957000	0.56846	0.379000	0.24179	ATG	.	.		0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2L2	26246	hgsc.bcm.edu	37	1	248202072	248202072	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr1:248202072G>A	ENST00000366479.2	+	1	599	c.503G>A	c.(502-504)tGc>tAc	p.C168Y	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ATCCCATATTGCAAGTCCAGA	0.423																																					p.C168Y		Atlas-SNP	.											.	OR2L2	115	.	0			c.G503A						.						196.0	180.0	186.0					1																	248202072		2203	4300	6503	SO:0001583	missense	26246	exon1			CATATTGCAAGTC	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.503G>A	chr1.hg19:g.248202072G>A	ENSP00000355435:p.Cys168Tyr	58.0	0.0		68.0	27.0	NM_001004686	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	hg19	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	13.21	2.170073	0.38315	.	.	ENSG00000203663	ENST00000366479	T	0.00224	8.51	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35970	U	0.002877	T	0.00468	0.0015	H	0.94847	3.59	0.09310	N	1	P	0.45011	0.848	P	0.50825	0.651	T	0.16867	-1.0388	10	0.72032	D	0.01	.	7.6763	0.28488	0.0:0.0:0.6672:0.3328	.	168	Q8NH16	OR2L2_HUMAN	Y	168	ENSP00000355435:C168Y	ENSP00000355435:C168Y	C	+	2	0	OR2L2	246268695	0.945000	0.32115	0.006000	0.13384	0.419000	0.31324	3.116000	0.50399	0.897000	0.36392	0.194000	0.17425	TGC	.	.		0.423	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
CTNNA2	1496	hgsc.bcm.edu	37	2	80101354	80101354	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:80101354A>T	ENST00000402739.4	+	5	743	c.738A>T	c.(736-738)caA>caT	p.Q246H	CTNNA2_ENST00000540488.1_Missense_Mutation_p.Q246H|CTNNA2_ENST00000361291.4_Missense_Mutation_p.Q280H|CTNNA2_ENST00000466387.1_Missense_Mutation_p.Q246H|CTNNA2_ENST00000541047.1_Missense_Mutation_p.Q246H|CTNNA2_ENST00000496558.1_Missense_Mutation_p.Q246H	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	246					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TGTTCAAACAAGTCCAGGAGG	0.587																																					p.Q246H		Atlas-SNP	.											.	CTNNA2	462	.	0			c.A738T						.						49.0	53.0	52.0					2																	80101354		2069	4219	6288	SO:0001583	missense	1496	exon6			CAAACAAGTCCAG		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.738A>T	chr2.hg19:g.80101354A>T	ENSP00000384638:p.Gln246His	82.0	0.0		99.0	11.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	hg19		.	.	.	.	.	.	.	.	.	.	A	23.9	4.469827	0.84533	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	5.93	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.83012	2.62	0.58432	D	0.999999	D;D;D	0.71674	0.992;0.998;0.995	D;D;D	0.71656	0.974;0.955;0.92	T	0.69079	-0.5240	10	0.66056	D	0.02	.	11.4576	0.50191	0.9303:0.0:0.0697:0.0	.	246;246;246	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	H	246;246;280;246;246;246	ENSP00000418191:Q246H;ENSP00000419295:Q246H;ENSP00000355398:Q280H;ENSP00000384638:Q246H;ENSP00000444675:Q246H;ENSP00000441705:Q246H	ENSP00000355398:Q280H	Q	+	3	2	CTNNA2	79954862	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.307000	0.65762	2.261000	0.74972	0.528000	0.53228	CAA	.	.		0.587	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
LRRTM1	347730	hgsc.bcm.edu	37	2	80529914	80529914	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:80529914C>A	ENST00000295057.3	-	2	1687	c.1031G>T	c.(1030-1032)aGc>aTc	p.S344I	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.S344I|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	344	LRRCT.				exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GTACTCCGGGCTGGCGCACTG	0.682										HNSCC(69;0.2)																											p.S344I		Atlas-SNP	.											.	LRRTM1	251	.	0			c.G1031T						.						24.0	22.0	23.0					2																	80529914		2203	4300	6503	SO:0001583	missense	347730	exon2			TCCGGGCTGGCGC	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1031G>T	chr2.hg19:g.80529914C>A	ENSP00000295057:p.Ser344Ile	128.0	0.0		133.0	38.0	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	hg19	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694137	0.48202	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.49139	0.79;0.79	5.32	5.32	0.75619	.	0.160698	0.53938	U	0.000045	T	0.48732	0.1516	M	0.78456	2.415	0.43608	D	0.995974	P	0.40398	0.716	B	0.36766	0.232	T	0.53809	-0.8386	9	.	.	.	.	13.6483	0.62294	0.0:0.7165:0.2835:0.0	.	344	Q86UE6	LRRT1_HUMAN	I	344	ENSP00000295057:S344I;ENSP00000386646:S344I	.	S	-	2	0	LRRTM1	80383425	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.170000	0.58229	2.452000	0.82932	0.655000	0.94253	AGC	.	.		0.682	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
DNAH6	1768	hgsc.bcm.edu	37	2	84880999	84880999	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:84880999G>A	ENST00000237449.6	+	33	5642		c.e33+1		DNAH6_ENST00000398278.2_Splice_Site|DNAH6_ENST00000389394.3_Splice_Site			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GCTTTTTGAGGTAAGTGTACA	0.353																																					.		Atlas-SNP	.											.	DNAH6	194	.	0			c.5634+1G>A						.						82.0	66.0	71.0					2																	84880999		692	1591	2283	SO:0001630	splice_region_variant	1768	exon34			TTTGAGGTAAGTG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5634+1G>A	chr2.hg19:g.84880999G>A		54.0	0.0		57.0	23.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Splice_Site	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087207	0.55968	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5984	0.88018	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH6	84734510	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	6.746000	0.74866	2.451000	0.82905	0.544000	0.68410	.	.	.		0.353	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	Intron
CNTNAP5	129684	hgsc.bcm.edu	37	2	125530441	125530441	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:125530441C>T	ENST00000431078.1	+	17	2960	c.2596C>T	c.(2596-2598)Cct>Tct	p.P866S		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	866	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGTCCAGTCTCCTTCTCTTCT	0.527																																					p.P866S		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.C2596T						.						183.0	172.0	176.0					2																	125530441		1946	4142	6088	SO:0001583	missense	129684	exon17			CAGTCTCCTTCTC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2596C>T	chr2.hg19:g.125530441C>T	ENSP00000399013:p.Pro866Ser	92.0	0.0		119.0	15.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	c	11.76	1.735408	0.30774	.	.	ENSG00000155052	ENST00000431078	T	0.79033	-1.23	5.63	4.76	0.60689	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.47093	D	0.000248	T	0.68044	0.2958	L	0.45581	1.43	0.09310	N	0.999998	B	0.23891	0.093	B	0.21708	0.036	T	0.53718	-0.8399	10	0.20046	T	0.44	.	9.3463	0.38111	0.0:0.78:0.1441:0.0759	.	866	Q8WYK1	CNTP5_HUMAN	S	866	ENSP00000399013:P866S	ENSP00000399013:P866S	P	+	1	0	CNTNAP5	125246911	0.021000	0.18746	0.989000	0.46669	0.799000	0.45148	1.123000	0.31308	1.397000	0.46682	0.645000	0.84053	CCT	.	.		0.527	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
AMER3	205147	hgsc.bcm.edu	37	2	131520209	131520209	+	Silent	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:131520209G>A	ENST00000423981.1	+	2	674	c.564G>A	c.(562-564)ggG>ggA	p.G188G	AMER3_ENST00000321420.4_Silent_p.G188G	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	188					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.G188G(1)									CCTCCCCAGGGGACCCGTCAG	0.667																																					p.G188G		Atlas-SNP	.											FAM123C,NS,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	lung(1)	c.G564A						.						32.0	38.0	36.0					2																	131520209		2200	4291	6491	SO:0001819	synonymous_variant	205147	exon2			CCCAGGGGACCCG	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.564G>A	chr2.hg19:g.131520209G>A		55.0	0.0		58.0	21.0	NM_152698	B7ZLH6	Silent	SNP	ENST00000423981.1	hg19	CCDS2164.1																																																																																			.	.		0.667	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
MAP3K19	80122	hgsc.bcm.edu	37	2	135743849	135743849	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:135743849T>C	ENST00000375845.3	-	7	2623	c.2593A>G	c.(2593-2595)Aac>Gac	p.N865D	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.N882D|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.N752D|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	865							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										ACATACTTGTTAGAATTCTTC	0.408																																					p.N865D		Atlas-SNP	.											.	.	.	.	0			c.A2593G						.						115.0	115.0	115.0					2																	135743849		2203	4300	6503	SO:0001583	missense	80122	exon7			ACTTGTTAGAATT	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2593A>G	chr2.hg19:g.135743849T>C	ENSP00000365005:p.Asn865Asp	71.0	0.0		95.0	23.0	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	hg19	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	T	1.870	-0.460465	0.04508	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915;ENST00000437365	T;T;T;T	0.72167	-0.5;-0.49;1.85;-0.63	4.86	-3.94	0.04130	.	0.869319	0.09891	N	0.742345	T	0.54447	0.1859	L	0.42245	1.32	0.09310	N	0.999999	P;B;B	0.41265	0.744;0.013;0.001	B;B;B	0.41510	0.359;0.006;0.002	T	0.48490	-0.9031	10	0.14252	T	0.57	.	4.5589	0.12151	0.4585:0.2825:0.0:0.2591	.	752;882;865	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	D	865;752;882;255	ENSP00000365005:N865D;ENSP00000351140:N752D;ENSP00000376647:N882D;ENSP00000392827:N255D	ENSP00000351140:N752D	N	-	1	0	YSK4	135460319	0.001000	0.12720	0.001000	0.08648	0.067000	0.16453	0.550000	0.23345	-0.946000	0.03677	-0.714000	0.03626	AAC	.	.		0.408	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
XIRP2	129446	hgsc.bcm.edu	37	2	168107365	168107365	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:168107365C>T	ENST00000409195.1	+	9	9552	c.9463C>T	c.(9463-9465)Cca>Tca	p.P3155S	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.P2933S|XIRP2_ENST00000295237.9_Missense_Mutation_p.P3155S|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2980					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAACCCCCACCAAGAAGGCC	0.453																																					p.P3155S		Atlas-SNP	.											XIRP2,NS,carcinoma,0,1	XIRP2	914	.	0			c.C9463T						.						80.0	77.0	78.0					2																	168107365		1881	4101	5982	SO:0001583	missense	129446	exon9			CCCCCACCAAGAA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9463C>T	chr2.hg19:g.168107365C>T	ENSP00000386840:p.Pro3155Ser	113.0	0.0		96.0	43.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	3.547	-0.092441	0.07053	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.03889	3.79;3.79;3.77	5.35	2.45	0.29901	.	0.311996	0.33553	N	0.004787	T	0.05914	0.0154	M	0.69823	2.125	0.53688	D	0.999977	B;P;P	0.35628	0.379;0.513;0.513	B;B;B	0.29598	0.048;0.104;0.104	T	0.29088	-1.0023	10	0.42905	T	0.14	-4.7767	7.6257	0.28210	0.1332:0.7185:0.0:0.1483	.	2980;2980;2933	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	S	3155;3155;2933;569	ENSP00000386840:P3155S;ENSP00000295237:P3155S;ENSP00000387255:P2933S	ENSP00000295237:P3155S	P	+	1	0	XIRP2	167815611	0.015000	0.18098	0.249000	0.24280	0.127000	0.20565	2.028000	0.41088	0.776000	0.33473	0.557000	0.71058	CCA	.	.		0.453	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TTN	7273	hgsc.bcm.edu	37	2	179434324	179434324	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:179434324A>T	ENST00000591111.1	-	276	71836	c.71612T>A	c.(71611-71613)cTt>cAt	p.L23871H	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L16639H|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L16572H|TTN_ENST00000589042.1_Missense_Mutation_p.L25512H|TTN_ENST00000342992.6_Missense_Mutation_p.L22944H|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.L16447H|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23871	Ig-like 120.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTAGGTCAAGATCAATGTC	0.393																																					p.L25512H		Atlas-SNP	.											.	TTN	18412	.	0			c.T76535A						.						77.0	66.0	69.0					2																	179434324		1855	4101	5956	SO:0001583	missense	7273	exon326			AGGTCAAGATCAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.71612T>A	chr2.hg19:g.179434324A>T	ENSP00000465570:p.Leu23871His	141.0	0.0		157.0	88.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.44	3.391287	0.62066	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.69040	-0.37;-0.31;-0.32;-0.33	5.7	5.7	0.88788	Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.86301	0.5900	M	0.93720	3.45	0.52501	D	0.999955	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76071	0.95;0.987;0.987;0.972	D	0.89956	0.4083	9	0.87932	D	0	.	15.9541	0.79871	1.0:0.0:0.0:0.0	.	16447;16572;16639;23871	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	22944;16447;16639;16572;16445	ENSP00000343764:L22944H;ENSP00000434586:L16447H;ENSP00000340554:L16639H;ENSP00000352154:L16572H	ENSP00000340554:L16639H	L	-	2	0	TTN	179142570	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.339000	0.96797	2.163000	0.67991	0.533000	0.62120	CTT	.	.		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
IDH1	3417	hgsc.bcm.edu	37	2	209110051	209110051	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:209110051T>G	ENST00000415913.1	-	5	893	c.512A>C	c.(511-513)aAc>aCc	p.N171T	IDH1_ENST00000345146.2_Missense_Mutation_p.N171T|IDH1_ENST00000446179.1_Missense_Mutation_p.N171T	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	171					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ACCTTCAAAGTTATGTACCAG	0.353			Mis		gliobastoma																																p.N171T	Pancreas(158;264 1958 3300 35450 36047)	Atlas-SNP	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	.	IDH1	6310	.	0			c.A512C						.						148.0	131.0	137.0					2																	209110051		2203	4300	6503	SO:0001583	missense	3417	exon5			TCAAAGTTATGTA		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.512A>C	chr2.hg19:g.209110051T>G	ENSP00000390265:p.Asn171Thr	83.0	0.0		113.0	28.0	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	hg19	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	T	16.37	3.105296	0.56291	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	T;T;T	0.68025	-0.3;-0.3;-0.3	5.66	4.49	0.54785	Isopropylmalate dehydrogenase-like domain (2);	0.272219	0.47455	D	0.000235	T	0.55386	0.1917	L	0.33339	1.005	0.43234	D	0.995131	B	0.17852	0.024	B	0.21360	0.034	T	0.55648	-0.8108	10	0.51188	T	0.08	-1.8721	11.8784	0.52560	0.0:0.0695:0.0:0.9305	.	171	O75874	IDHC_HUMAN	T	171	ENSP00000260985:N171T;ENSP00000410513:N171T;ENSP00000390265:N171T	ENSP00000260985:N171T	N	-	2	0	IDH1	208818296	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.511000	0.60462	2.153000	0.67306	0.459000	0.35465	AAC	.	.		0.353	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
ANKZF1	55139	hgsc.bcm.edu	37	2	220096992	220096992	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:220096992A>G	ENST00000323348.5	+	4	446	c.272A>G	c.(271-273)tAt>tGt	p.Y91C	ATG9A_ENST00000396761.2_5'Flank|ANKZF1_ENST00000409849.1_Intron|ATG9A_ENST00000409618.1_5'Flank|ANKZF1_ENST00000410034.3_Missense_Mutation_p.Y91C|ATG9A_ENST00000361242.4_5'Flank|ATG9A_ENST00000409422.1_5'Flank|ATG9A_ENST00000488833.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	91						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGAACATTATAAGCTTGAC	0.468																																					p.Y91C		Atlas-SNP	.											.	ANKZF1	45	.	0			c.A272G						.						125.0	118.0	120.0					2																	220096992		1909	4130	6039	SO:0001583	missense	55139	exon4			AACATTATAAGCT	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.272A>G	chr2.hg19:g.220096992A>G	ENSP00000321617:p.Tyr91Cys	112.0	0.0		112.0	61.0	NM_001042410	Q9NVZ4	Missense_Mutation	SNP	ENST00000323348.5	hg19	CCDS42821.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942092	0.73557	.	.	ENSG00000163516	ENST00000323348;ENST00000453432;ENST00000410034;ENST00000447157	T;T;T	0.50548	0.74;0.74;0.74	5.16	5.16	0.70880	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.67832	0.2935	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.72027	-0.4414	10	0.87932	D	0	-10.8476	15.1597	0.72775	1.0:0.0:0.0:0.0	.	35;91	B4DZT1;Q9H8Y5	.;ANKZ1_HUMAN	C	91;26;91;91	ENSP00000321617:Y91C;ENSP00000386337:Y91C;ENSP00000399667:Y91C	ENSP00000321617:Y91C	Y	+	2	0	ANKZF1	219805236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.363000	0.90103	2.162000	0.67917	0.533000	0.62120	TAT	.	.		0.468	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
STK11IP	114790	hgsc.bcm.edu	37	2	220471465	220471465	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:220471465G>A	ENST00000456909.1	+	12	1109	c.1019G>A	c.(1018-1020)gGc>gAc	p.G340D	STK11IP_ENST00000295641.10_Missense_Mutation_p.G351D			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	351					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCCCATGGGCCCACCTTTG	0.637																																					p.G351D		Atlas-SNP	.											.	STK11IP	152	.	0			c.G1052A						.						72.0	77.0	75.0					2																	220471465		2044	4183	6227	SO:0001583	missense	114790	exon12			CCATGGGCCCACC	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1019G>A	chr2.hg19:g.220471465G>A	ENSP00000389383:p.Gly340Asp	47.0	0.0		45.0	15.0	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	hg19		.	.	.	.	.	.	.	.	.	.	G	9.927	1.213718	0.22289	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.04551	3.6;3.6	4.76	0.922	0.19408	.	1.014060	0.07880	N	0.969419	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B;B;B	0.32160	0.358;0.358;0.157	B;B;B	0.38616	0.071;0.277;0.069	T	0.50346	-0.8839	10	0.17832	T	0.49	-0.4725	4.567	0.12191	0.0:0.5482:0.1701:0.2817	.	319;351;351	B4DUE4;Q8N1F8-2;Q8N1F8	.;.;S11IP_HUMAN	D	340;319;351	ENSP00000389383:G340D;ENSP00000295641:G351D	ENSP00000295641:G351D	G	+	2	0	STK11IP	220179709	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	0.333000	0.19768	-0.014000	0.14175	-0.311000	0.09066	GGC	.	.		0.637	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
TCAIM	285343	hgsc.bcm.edu	37	3	44434442	44434442	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:44434442C>G	ENST00000342649.4	+	6	1095	c.668C>G	c.(667-669)tCt>tGt	p.S223C	TCAIM_ENST00000417237.1_Missense_Mutation_p.S223C	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	223						mitochondrion (GO:0005739)											GATGAACTGTCTCATCAATTG	0.333																																					p.S223C		Atlas-SNP	.											.	.	.	.	0			c.C668G						.						100.0	102.0	102.0					3																	44434442		2203	4296	6499	SO:0001583	missense	285343	exon6			AACTGTCTCATCA		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.668C>G	chr3.hg19:g.44434442C>G	ENSP00000341539:p.Ser223Cys	302.0	0.0		381.0	126.0	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	hg19	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978802	0.34942	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.40476	1.03;1.03	5.57	4.7	0.59300	.	0.296354	0.40064	N	0.001182	T	0.27063	0.0663	L	0.31926	0.97	0.33298	D	0.564447	B	0.14438	0.01	B	0.13407	0.009	T	0.28427	-1.0044	10	0.05436	T	0.98	.	10.5708	0.45198	0.0:0.7947:0.1335:0.0718	.	223	Q8N3R3	CC023_HUMAN	C	223	ENSP00000402581:S223C;ENSP00000341539:S223C	ENSP00000341539:S223C	S	+	2	0	C3orf23	44409446	0.895000	0.30542	0.621000	0.29145	0.993000	0.82548	1.494000	0.35616	1.359000	0.45940	0.591000	0.81541	TCT	.	.		0.333	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
PLXNB1	5364	hgsc.bcm.edu	37	3	48463572	48463572	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:48463572A>T	ENST00000358536.4	-	6	1731	c.1462T>A	c.(1462-1464)Tgt>Agt	p.C488S	PLXNB1_ENST00000296440.6_Missense_Mutation_p.C488S|PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Missense_Mutation_p.C488S|PLXNB1_ENST00000456774.1_Missense_Mutation_p.C488S	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	488					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CAAGATGCACAGTCCAGGTGC	0.582																																					p.C488S		Atlas-SNP	.											.	PLXNB1	150	.	0			c.T1462A						.						77.0	69.0	72.0					3																	48463572		2203	4300	6503	SO:0001583	missense	5364	exon6			ATGCACAGTCCAG	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1462T>A	chr3.hg19:g.48463572A>T	ENSP00000351338:p.Cys488Ser	60.0	0.0		92.0	34.0	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	hg19	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.912312	0.92178	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.82921	0.5142	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.986	D	0.88147	0.2848	10	0.87932	D	0	.	14.9872	0.71356	1.0:0.0:0.0:0.0	.	488;488	O43157;O43157-2	PLXB1_HUMAN;.	S	488	ENSP00000296440:C488S;ENSP00000351242:C488S;ENSP00000351338:C488S;ENSP00000414199:C488S	ENSP00000296440:C488S	C	-	1	0	PLXNB1	48438576	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	9.071000	0.93980	2.140000	0.66376	0.528000	0.53228	TGT	.	.		0.582	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
GPR156	165829	hgsc.bcm.edu	37	3	119911830	119911830	+	Nonsense_Mutation	SNP	G	G	A	rs138857726		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:119911830G>A	ENST00000464295.1	-	5	875	c.430C>T	c.(430-432)Cga>Tga	p.R144*	GPR156_ENST00000315843.3_Nonsense_Mutation_p.R144*|GPR156_ENST00000461057.1_Nonsense_Mutation_p.R144*			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TTGTAGAGTCGCCAGCTCTTT	0.517																																					p.R144X		Atlas-SNP	.											.	GPR156	85	.	0			c.C430T						.	G	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	92.0	95.0	94.0		430,430	1.3	1.0	3	dbSNP_134	94	0,8600		0,0,4300	no	stop-gained,stop-gained	GPR156	NM_001168271.1,NM_153002.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	144/811,144/815	119911830	1,13005	2203	4300	6503	SO:0001587	stop_gained	165829	exon4			AGAGTCGCCAGCT	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.430C>T	chr3.hg19:g.119911830G>A	ENSP00000417261:p.Arg144*	50.0	0.0		79.0	10.0	NM_001168271	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Nonsense_Mutation	SNP	ENST00000464295.1	hg19	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	G	37	6.416960	0.97550	2.27E-4	0.0	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	.	.	.	5.78	1.31	0.21738	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1317	14.2401	0.65952	0.0:0.0:0.2604:0.7396	.	.	.	.	X	144	.	.	R	-	1	2	GPR156	121394520	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.720000	0.25896	0.313000	0.23062	-0.311000	0.09066	CGA	.	G|1.000;A|0.000		0.517	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
POLQ	10721	hgsc.bcm.edu	37	3	121168168	121168168	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:121168168A>T	ENST00000264233.5	-	26	7386	c.7258T>A	c.(7258-7260)Tac>Aac	p.Y2420N		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2420					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTACCTGTGTATCTGGATTTG	0.308								DNA polymerases (catalytic subunits)																													p.Y2420N	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.T7258A						.						174.0	174.0	174.0					3																	121168168		2203	4300	6503	SO:0001583	missense	10721	exon26			CTGTGTATCTGGA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7258T>A	chr3.hg19:g.121168168A>T	ENSP00000264233:p.Tyr2420Asn	116.0	0.0		159.0	72.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.441768	0.83993	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.97279	-4.32	5.41	5.41	0.78517	DNA-directed DNA polymerase, family A, palm domain (2);	0.124466	0.56097	D	0.000027	D	0.98950	0.9643	H	0.96175	3.78	0.46131	D	0.99888	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99537	1.0962	10	0.87932	D	0	.	15.0946	0.72223	1.0:0.0:0.0:0.0	.	2420;1592	O75417;O75417-2	DPOLQ_HUMAN;.	N	2043;2420;2556	ENSP00000264233:Y2420N	ENSP00000264233:Y2420N	Y	-	1	0	POLQ	122650858	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.739000	0.74827	2.041000	0.60428	0.533000	0.62120	TAC	.	.		0.308	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
KPNA1	3836	hgsc.bcm.edu	37	3	122160952	122160952	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:122160952T>C	ENST00000344337.6	-	10	1105	c.929A>G	c.(928-930)tAt>tGt	p.Y310C	KPNA1_ENST00000466923.1_5'UTR|RP11-299J3.8_ENST00000609469.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	310	Binding to RAG1.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		AACCACTTTATAATCATTATG	0.338																																					p.Y310C	Melanoma(12;340 801 11196 19797)	Atlas-SNP	.											.	KPNA1	42	.	0			c.A929G						.						141.0	145.0	143.0					3																	122160952		2203	4300	6503	SO:0001583	missense	3836	exon10			ACTTTATAATCAT	S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.929A>G	chr3.hg19:g.122160952T>C	ENSP00000343701:p.Tyr310Cys	315.0	0.0		424.0	170.0	NM_002264	D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	ENST00000344337.6	hg19	CCDS3013.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555508	0.65425	.	.	ENSG00000114030	ENST00000344337;ENST00000465882	T;T	0.68624	-0.34;-0.34	5.17	5.17	0.71159	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	L	0.40543	1.245	0.80722	D	1	D	0.62365	0.991	P	0.54401	0.751	T	0.68387	-0.5422	10	0.39692	T	0.17	-13.2149	14.3589	0.66757	0.0:0.0:0.0:1.0	.	310	P52294	IMA1_HUMAN	C	310	ENSP00000343701:Y310C;ENSP00000419890:Y310C	ENSP00000343701:Y310C	Y	-	2	0	KPNA1	123643642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.952000	0.70282	2.175000	0.68902	0.533000	0.62120	TAT	.	.		0.338	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355740.1	NM_002264	
PARP14	54625	hgsc.bcm.edu	37	3	122447347	122447347	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:122447347A>G	ENST00000474629.2	+	17	5575	c.5309A>G	c.(5308-5310)tAt>tGt	p.Y1770C		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1770	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		ACTGACCTGTATGACACTGTC	0.373																																					p.Y1770C		Atlas-SNP	.											.	PARP14	242	.	0			c.A5309G						.						166.0	160.0	162.0					3																	122447347		1922	4143	6065	SO:0001583	missense	54625	exon17			ACCTGTATGACAC	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.5309A>G	chr3.hg19:g.122447347A>G	ENSP00000418194:p.Tyr1770Cys	76.0	0.0		137.0	59.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	hg19	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.475023	0.43942	.	.	ENSG00000173193	ENST00000474629;ENST00000398162;ENST00000398157	T	0.15834	2.39	6.01	0.433	0.16534	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.321156	0.26499	N	0.024038	T	0.45458	0.1343	M	0.91090	3.175	0.49582	D	0.999808	D	0.89917	1.0	D	0.76575	0.988	T	0.53222	-0.8469	10	0.72032	D	0.01	.	11.2668	0.49114	0.5404:0.0:0.0:0.4596	.	1770	Q460N5	PAR14_HUMAN	C	1770;1689;766	ENSP00000418194:Y1770C	ENSP00000381224:Y766C	Y	+	2	0	PARP14	123930037	0.868000	0.29978	0.886000	0.34754	0.452000	0.32318	1.916000	0.39986	0.119000	0.18210	-1.407000	0.01130	TAT	.	.		0.373	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
SEMA5B	54437	hgsc.bcm.edu	37	3	122658315	122658315	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:122658315T>C	ENST00000357599.3	-	5	817	c.431A>G	c.(430-432)aAc>aGc	p.N144S	SEMA5B_ENST00000451055.2_Missense_Mutation_p.N198S|SEMA5B_ENST00000195173.4_Missense_Mutation_p.N144S	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	144	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GAAGAGGTAGTTCCTGTGAAA	0.537																																					p.N198S		Atlas-SNP	.											.	SEMA5B	303	.	0			c.A593G						.						167.0	132.0	144.0					3																	122658315		2203	4300	6503	SO:0001583	missense	54437	exon5			AGGTAGTTCCTGT	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.431A>G	chr3.hg19:g.122658315T>C	ENSP00000350215:p.Asn144Ser	73.0	0.0		89.0	31.0	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	hg19	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104670	0.77096	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.54	4.39	0.52855	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.056401	0.64402	N	0.000002	T	0.42877	0.1222	M	0.85859	2.78	0.44380	D	0.997282	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.80764	0.978;0.994;0.994	T	0.41270	-0.9518	10	0.72032	D	0.01	.	9.4034	0.38447	0.0:0.083:0.0:0.917	.	86;144;144	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	S	144;144;86;198;144	ENSP00000350215:N144S;ENSP00000195173:N144S;ENSP00000389588:N198S;ENSP00000377208:N144S	ENSP00000195173:N144S	N	-	2	0	SEMA5B	124141005	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.674000	0.68117	1.126000	0.42016	0.528000	0.53228	AAC	.	.		0.537	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ATP11B	23200	hgsc.bcm.edu	37	3	182554178	182554178	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:182554178T>A	ENST00000323116.5	+	6	732	c.472T>A	c.(472-474)Ttg>Atg	p.L158M	ATP11B_ENST00000482794.1_3'UTR|ATP11B_ENST00000493826.1_Missense_Mutation_p.L158M	NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	158					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TCCTGCAGACTTGGTGCTTCT	0.398																																					p.L158M		Atlas-SNP	.											.	ATP11B	115	.	0			c.T472A						.						171.0	166.0	168.0					3																	182554178		2203	4300	6503	SO:0001583	missense	23200	exon6			GCAGACTTGGTGC	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.472T>A	chr3.hg19:g.182554178T>A	ENSP00000321195:p.Leu158Met	89.0	0.0		113.0	39.0	NM_014616	Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	hg19	CCDS33896.1	.	.	.	.	.	.	.	.	.	.	T	18.65	3.669596	0.67814	.	.	ENSG00000058063	ENST00000323116;ENST00000493826	D;D	0.91068	-2.78;-2.78	5.13	2.76	0.32466	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.64402	D	0.000001	D	0.92612	0.7653	M	0.65320	2	0.52501	D	0.999957	D;D	0.65815	0.995;0.987	D;D	0.72075	0.971;0.976	D	0.90048	0.4147	10	0.51188	T	0.08	.	7.0662	0.25154	0.0:0.4084:0.0:0.5916	.	158;158	Q9Y2G3;B4DKX1	AT11B_HUMAN;.	M	158	ENSP00000321195:L158M;ENSP00000419032:L158M	ENSP00000321195:L158M	L	+	1	2	ATP11B	184036872	0.963000	0.33076	0.909000	0.35828	0.994000	0.84299	0.572000	0.23684	0.374000	0.24650	0.482000	0.46254	TTG	.	.		0.398	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616	
VWA5B2	90113	hgsc.bcm.edu	37	3	183955168	183955168	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr3:183955168G>A	ENST00000426955.2	+	11	1788	c.1688G>A	c.(1687-1689)aGg>aAg	p.R563K	VWA5B2_ENST00000273794.5_Missense_Mutation_p.R344K|EIF2B5_ENST00000444495.1_Intron	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	574										breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						TCACTCTTCAGGGTGGATGGC	0.657																																					p.R563K		Atlas-SNP	.											.	VWA5B2	47	.	0			c.G1688A						.						33.0	33.0	33.0					3																	183955168		692	1591	2283	SO:0001583	missense	90113	exon11			TCTTCAGGGTGGA		CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.1688G>A	chr3.hg19:g.183955168G>A	ENSP00000398688:p.Arg563Lys	41.0	0.0		71.0	37.0	NM_138345	B9EGN7	Missense_Mutation	SNP	ENST00000426955.2	hg19	CCDS54686.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086115	0.36855	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.16457	3.02;2.34	5.2	4.33	0.51752	.	0.106711	0.41294	D	0.000917	T	0.07458	0.0188	N	0.08118	0	0.30142	N	0.803852	B;B;B	0.09022	0.002;0.0;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.25984	-1.0116	10	0.09590	T	0.72	-5.9887	9.3294	0.38012	0.1652:0.0:0.8348:0.0	.	344;563;574	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	K	563;344	ENSP00000398688:R563K;ENSP00000273794:R344K	ENSP00000273794:R344K	R	+	2	0	VWA5B2	185437862	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.748000	0.26305	1.342000	0.45619	0.561000	0.74099	AGG	.	.		0.657	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346004.2	XM_291077	
ZNF141	7700	hgsc.bcm.edu	37	4	366828	366828	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr4:366828G>A	ENST00000240499.7	+	4	751	c.602G>A	c.(601-603)tGt>tAt	p.C201Y	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	201					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						CCCTACACTTGTGAAGAATGT	0.358																																					p.C201Y		Atlas-SNP	.											.	ZNF141	48	.	0			c.G602A						.						60.0	66.0	64.0					4																	366828		2202	4298	6500	SO:0001583	missense	7700	exon4			ACACTTGTGAAGA	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.602G>A	chr4.hg19:g.366828G>A	ENSP00000240499:p.Cys201Tyr	76.0	0.0		126.0	56.0	NM_003441	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	hg19	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735305	0.48939	.	.	ENSG00000131127	ENST00000240499	D	0.85088	-1.94	1.23	1.23	0.21249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92034	0.7476	H	0.94222	3.51	0.21604	N	0.999622	D	0.59357	0.985	P	0.58721	0.844	T	0.83007	-0.0174	8	.	.	.	.	7.8726	0.29576	0.0:0.0:1.0:0.0	.	201	Q15928	ZN141_HUMAN	Y	201	ENSP00000240499:C201Y	.	C	+	2	0	ZNF141	356828	0.911000	0.30947	0.051000	0.19133	0.297000	0.27493	1.708000	0.37899	0.585000	0.29608	0.305000	0.20034	TGT	.	.		0.358	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
SLIT2	9353	hgsc.bcm.edu	37	4	20618809	20618810	+	Nonsense_Mutation	DNP	GC	GC	AA			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr4:20618809_20618810GC>AA	ENST00000504154.1	+	35	4376_4377	c.4124_4125GC>AA	c.(4123-4125)tGC>tAA	p.C1375*	SLIT2_ENST00000503837.1_Nonsense_Mutation_p.C1371*|SLIT2_ENST00000503823.1_Nonsense_Mutation_p.C1367*|SLIT2_ENST00000273739.5_Nonsense_Mutation_p.C1388*	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1375					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AATGACCCTTGCCTTGGAAATA	0.569																																					p.C1375Y|p.C1375X		Atlas-SNP	.											.	SLIT2	290	.	0			c.G4124A|c.C4125A						.																																			SO:0001587	stop_gained	9353	exon35			ACCCTTGCCTTGG|CCCTTGCCTTGGA	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	Exception_encountered	chr4.hg19:g.20618809_20618810delinsAA	ENSP00000422591:p.Cys1375*	97.0|99.0	0.0		152.0|155.0	63.0|65.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000504154.1	hg19	CCDS3426.1																																																																																			.	.		0.569	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
BMP3	651	hgsc.bcm.edu	37	4	81952752	81952752	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr4:81952752C>T	ENST00000282701.2	+	1	634	c.314C>T	c.(313-315)gCa>gTa	p.A105V		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	105					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						GCGGCAGCAGCAGGTGAGTGC	0.716																																					p.A105V		Atlas-SNP	.											.	BMP3	59	.	0			c.C314T						.						8.0	8.0	8.0					4																	81952752		2180	4248	6428	SO:0001583	missense	651	exon1			CAGCAGCAGGTGA	M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.314C>T	chr4.hg19:g.81952752C>T	ENSP00000282701:p.Ala105Val	58.0	0.0		36.0	21.0	NM_001201	Q4VAS5	Missense_Mutation	SNP	ENST00000282701.2	hg19	CCDS3588.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037948	0.54896	.	.	ENSG00000152785	ENST00000282701	T	0.65364	-0.15	5.04	5.04	0.67666	Transforming growth factor-beta, N-terminal (1);	0.543205	0.21343	N	0.076095	T	0.67144	0.2862	M	0.62723	1.935	0.39984	D	0.974959	P	0.38048	0.616	P	0.45377	0.478	T	0.65882	-0.6060	10	0.30854	T	0.27	.	16.3482	0.83171	0.0:1.0:0.0:0.0	.	105	P12645	BMP3_HUMAN	V	105	ENSP00000282701:A105V	ENSP00000282701:A105V	A	+	2	0	BMP3	82171776	1.000000	0.71417	0.985000	0.45067	0.115000	0.19883	3.850000	0.55918	2.630000	0.89119	0.655000	0.94253	GCA	.	.		0.716	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1		
DNAH5	1767	hgsc.bcm.edu	37	5	13829748	13829748	+	Silent	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:13829748G>A	ENST00000265104.4	-	38	6419	c.6315C>T	c.(6313-6315)gcC>gcT	p.A2105A		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2105	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCACCATCATGGCCACTGAGC	0.458									Kartagener syndrome																												p.A2105A		Atlas-SNP	.											.	DNAH5	868	.	0			c.C6315T						.						129.0	115.0	119.0					5																	13829748		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon38	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CATCATGGCCACT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6315C>T	chr5.hg19:g.13829748G>A		80.0	0.0		122.0	63.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	hg19	CCDS3882.1																																																																																			.	.		0.458	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PDZD2	23037	hgsc.bcm.edu	37	5	31799600	31799600	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:31799600C>G	ENST00000438447.1	+	2	633	c.245C>G	c.(244-246)aCt>aGt	p.T82S	PDZD2_ENST00000282493.3_Missense_Mutation_p.T82S			O15018	PDZD2_HUMAN	PDZ domain containing 2	82					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GACACAGAGACTGTGGGCCTG	0.557																																					p.T82S		Atlas-SNP	.											.	PDZD2	306	.	0			c.C245G						.						112.0	115.0	114.0					5																	31799600		2203	4300	6503	SO:0001583	missense	23037	exon1			CAGAGACTGTGGG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.245C>G	chr5.hg19:g.31799600C>G	ENSP00000402033:p.Thr82Ser	104.0	0.0		150.0	62.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	hg19	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574398	0.65878	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.65364	-0.15;-0.15	5.67	5.67	0.87782	PDZ/DHR/GLGF (2);	0.000000	0.46145	D	0.000316	T	0.60157	0.2247	N	0.19112	0.55	0.26511	N	0.974593	D	0.67145	0.996	P	0.62740	0.906	T	0.52975	-0.8503	10	0.21014	T	0.42	.	10.6552	0.45671	0.0:0.9134:0.0:0.0866	.	82	O15018	PDZD2_HUMAN	S	82	ENSP00000402033:T82S;ENSP00000282493:T82S	ENSP00000282493:T82S	T	+	2	0	PDZD2	31835357	0.984000	0.35163	0.995000	0.50966	0.995000	0.86356	2.957000	0.49137	2.661000	0.90470	0.655000	0.94253	ACT	.	.		0.557	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
PCDHA9	9752	hgsc.bcm.edu	37	5	140229700	140229700	+	Silent	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:140229700G>A	ENST00000532602.1	+	1	2653	c.1620G>A	c.(1618-1620)gcG>gcA	p.A540A	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.A540A|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	540	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A540A(2)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCGACGCGGGCGTGCCGC	0.672																																					p.A540A	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											PCDHA9_ENST00000532602,NS,carcinoma,0,2	PCDHA9	373	.	2	Substitution - coding silent(2)	lung(2)	c.G1620A						.						60.0	68.0	65.0					5																	140229700		2195	4267	6462	SO:0001819	synonymous_variant	9752	exon1			CGACGCGGGCGTG	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1620G>A	chr5.hg19:g.140229700G>A		63.0	0.0		87.0	31.0	NM_031857	O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	hg19	CCDS54920.1																																																																																			.	.		0.672	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
FAT2	2196	hgsc.bcm.edu	37	5	150923055	150923055	+	Silent	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:150923055G>T	ENST00000261800.5	-	9	7645	c.7633C>A	c.(7633-7635)Cgg>Agg	p.R2545R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2545	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAATTTTCCCGATCCAGTTTC	0.448																																					p.R2545R		Atlas-SNP	.											.	FAT2	465	.	0			c.C7633A						.						151.0	154.0	153.0					5																	150923055		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon9			TTTCCCGATCCAG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.7633C>A	chr5.hg19:g.150923055G>T		63.0	0.0		77.0	24.0	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	hg19	CCDS4317.1																																																																																			.	.		0.448	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
PWWP2A	114825	hgsc.bcm.edu	37	5	159519506	159519506	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:159519506C>A	ENST00000307063.7	-	2	2185	c.2151G>T	c.(2149-2151)caG>caT	p.Q717H	PWWP2A_ENST00000523662.1_Intron|PWWP2A_ENST00000456329.3_Intron	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	717										kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAAAGCGTGACTGGAAGTTTT	0.498																																					p.Q717H		Atlas-SNP	.											.	PWWP2A	64	.	0			c.G2151T						.						48.0	44.0	45.0					5																	159519506		692	1591	2283	SO:0001583	missense	114825	exon2			GCGTGACTGGAAG		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.2151G>T	chr5.hg19:g.159519506C>A	ENSP00000305151:p.Gln717His	67.0	0.0		97.0	4.0	NM_001130864	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	ENST00000307063.7	hg19	CCDS47332.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471796	0.43942	.	.	ENSG00000170234	ENST00000307063	T	0.71341	-0.56	5.49	2.62	0.31277	PWWP (1);	.	.	.	.	T	0.60457	0.2270	L	0.41824	1.3	0.48511	D	0.999662	B	0.26512	0.151	B	0.30105	0.111	T	0.61865	-0.6975	9	0.62326	D	0.03	.	8.3741	0.32432	0.0:0.7283:0.1286:0.1432	.	717	Q96N64	PWP2A_HUMAN	H	717	ENSP00000305151:Q717H	ENSP00000305151:Q717H	Q	-	3	2	PWWP2A	159452084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.266000	0.51569	1.322000	0.45245	0.557000	0.71058	CAG	.	.		0.498	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1		
C5orf45	51149	hgsc.bcm.edu	37	5	179264710	179264710	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:179264710T>G	ENST00000292586.6	-	7	803	c.713A>C	c.(712-714)aAa>aCa	p.K238T	C5orf45_ENST00000403396.2_Intron|C5orf45_ENST00000523267.1_5'UTR|C5orf45_ENST00000518235.1_Intron|C5orf45_ENST00000521333.1_3'UTR|SQSTM1_ENST00000389805.4_3'UTR|C5orf45_ENST00000523084.1_Missense_Mutation_p.K104T|C5orf45_ENST00000376931.2_Missense_Mutation_p.K183T|C5orf45_ENST00000518219.1_3'UTR|SQSTM1_ENST00000376929.3_3'UTR|C5orf45_ENST00000520698.1_Intron	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45	238										breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						ATGTGAACTTTTTCTAGGTGG	0.592																																					p.K238T		Atlas-SNP	.											.	C5orf45	23	.	0			c.A713C						.						80.0	84.0	83.0					5																	179264710		2203	4300	6503	SO:0001583	missense	51149	exon7			GAACTTTTTCTAG		CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.713A>C	chr5.hg19:g.179264710T>G	ENSP00000292586:p.Lys238Thr	87.0	0.0		90.0	35.0	NM_016175	B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Missense_Mutation	SNP	ENST00000292586.6	hg19	CCDS34319.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.524962	0.27299	.	.	ENSG00000161010	ENST00000376931;ENST00000523084;ENST00000292586	T;T;T	0.07567	3.18;3.18;3.18	4.36	0.44	0.16572	.	0.623191	0.14607	N	0.309276	T	0.03739	0.0106	N	0.08118	0	0.09310	N	0.999999	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.002	T	0.37709	-0.9694	10	0.66056	D	0.02	-4.5449	3.8939	0.09131	0.0:0.2065:0.1853:0.6083	.	183;238	E9PAK6;Q6NTE8	.;CE045_HUMAN	T	183;104;238	ENSP00000366130:K183T;ENSP00000429107:K104T;ENSP00000292586:K238T	ENSP00000292586:K238T	K	-	2	0	C5orf45	179197316	0.000000	0.05858	0.002000	0.10522	0.048000	0.14542	0.555000	0.23422	-0.013000	0.14199	0.402000	0.26972	AAA	.	.		0.592	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373760.2	NM_016175	
OR2B3	442184	hgsc.bcm.edu	37	6	29054417	29054417	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr6:29054417A>G	ENST00000377173.2	-	1	673	c.609T>C	c.(607-609)agT>agC	p.S203S		NM_001005226.2	NP_001005226.1	O76000	OR2B3_HUMAN	olfactory receptor, family 2, subfamily B, member 3	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|lung(17)|prostate(1)|skin(2)	24						GAATTAGTACACTAAAGAAGA	0.438																																					p.S203S		Atlas-SNP	.											.	OR2B3	44	.	0			c.T609C						.						78.0	73.0	74.0					6																	29054417		2203	4300	6503	SO:0001819	synonymous_variant	442184	exon1			TAGTACACTAAAG		CCDS34358.1	6p22.2-p21.31	2012-08-09	2008-10-22	2008-10-22	ENSG00000204703	ENSG00000204703		"""GPCR / Class A : Olfactory receptors"""	8238	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 3 pseudogene"""	OR2B3P			Standard	NM_001005226		Approved	OR6-4	uc003nlx.3	O76000	OTTHUMG00000031226	ENST00000377173.2:c.609T>C	chr6.hg19:g.29054417A>G		104.0	0.0		149.0	72.0	NM_001005226	B0UYQ1|Q5ST41|Q96R13	Silent	SNP	ENST00000377173.2	hg19	CCDS34358.1																																																																																			.	.		0.438	OR2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076469.2		
COL11A2	1302	hgsc.bcm.edu	37	6	33157128	33157128	+	Silent	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr6:33157128C>T	ENST00000374708.4	-	2	459	c.201G>A	c.(199-201)caG>caA	p.Q67Q	COL11A2_ENST00000395197.1_Silent_p.Q67Q|COL11A2_ENST00000357486.1_Silent_p.Q67Q|COL11A2_ENST00000361917.1_Silent_p.Q67Q|COL11A2_ENST00000395194.1_Silent_p.Q67Q|COL11A2_ENST00000374712.1_Silent_p.Q67Q|COL11A2_ENST00000374714.1_Silent_p.Q67Q|COL11A2_ENST00000374713.1_Silent_p.Q67Q|COL11A2_ENST00000341947.2_Silent_p.Q67Q	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	67	Laminin G-like.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GTGCACTGAGCTGGGCAGGTC	0.632																																					p.Q67Q	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.G201A						.						72.0	60.0	64.0					6																	33157128		1511	2709	4220	SO:0001819	synonymous_variant	1302	exon2			ACTGAGCTGGGCA	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.201G>A	chr6.hg19:g.33157128C>T		74.0	0.0		110.0	5.0	NM_080681	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	hg19	CCDS43452.1																																																																																			.	.		0.632	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
MUT	4594	hgsc.bcm.edu	37	6	49416564	49416564	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr6:49416564T>C	ENST00000274813.3	-	7	1536	c.1409A>G	c.(1408-1410)gAa>gGa	p.E470G		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	470					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCAGCACATTCTTCAATTCG	0.333																																					p.E470G		Atlas-SNP	.											.	MUT	70	.	0			c.A1409G						.						140.0	138.0	138.0					6																	49416564		2203	4300	6503	SO:0001583	missense	4594	exon7			GCACATTCTTCAA		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1409A>G	chr6.hg19:g.49416564T>C	ENSP00000274813:p.Glu470Gly	126.0	0.0		184.0	81.0	NM_000255	A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	hg19	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.926264	0.92319	.	.	ENSG00000146085	ENST00000274813	D	0.98762	-5.12	5.95	5.95	0.96441	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.99205	0.9724	M	0.92880	3.355	0.80722	D	1	D	0.53619	0.961	P	0.61397	0.888	D	0.99063	1.0831	10	0.87932	D	0	-6.0076	15.5927	0.76550	0.0:0.0:0.0:1.0	.	470	P22033	MUTA_HUMAN	G	470	ENSP00000274813:E470G	ENSP00000274813:E470G	E	-	2	0	MUT	49524523	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.276000	0.75962	0.528000	0.53228	GAA	.	.		0.333	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		
MUT	4594	hgsc.bcm.edu	37	6	49416604	49416604	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr6:49416604T>A	ENST00000274813.3	-	7	1496	c.1369A>T	c.(1369-1371)Aaa>Taa	p.K457*		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	457					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCTACAGCTTTGGCCATTCCA	0.318																																					p.K457X		Atlas-SNP	.											.	MUT	70	.	0			c.A1369T						.						136.0	136.0	136.0					6																	49416604		2203	4300	6503	SO:0001587	stop_gained	4594	exon7			CAGCTTTGGCCAT		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1369A>T	chr6.hg19:g.49416604T>A	ENSP00000274813:p.Lys457*	107.0	0.0		173.0	76.0	NM_000255	A8K953|Q5SYZ3|Q96B11|Q9UD64	Nonsense_Mutation	SNP	ENST00000274813.3	hg19	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	T	39	7.502300	0.98322	.	.	ENSG00000146085	ENST00000274813	.	.	.	5.75	5.75	0.90469	.	0.153804	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5132	11.2628	0.49093	0.0:0.0:0.1527:0.8473	.	.	.	.	X	457	.	ENSP00000274813:K457X	K	-	1	0	MUT	49524563	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.705000	0.54823	2.192000	0.70111	0.528000	0.53228	AAA	.	.		0.318	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		
KHDRBS2	202559	hgsc.bcm.edu	37	6	62442656	62442656	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr6:62442656C>T	ENST00000281156.4	-	7	1102	c.824G>A	c.(823-825)gGc>gAc	p.G275D		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		ACCCCCGTAGCCATCATCATA	0.378																																					p.G275D		Atlas-SNP	.											.	KHDRBS2	103	.	0			c.G824A						.						152.0	143.0	146.0					6																	62442656		2203	4300	6503	SO:0001583	missense	202559	exon7			CCGTAGCCATCAT	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.824G>A	chr6.hg19:g.62442656C>T	ENSP00000281156:p.Gly275Asp	91.0	0.0		132.0	31.0	NM_152688	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	hg19	CCDS4963.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965183	0.74131	.	.	ENSG00000112232	ENST00000281156	T	0.47869	0.83	5.93	5.93	0.95920	.	0.237178	0.44285	D	0.000461	T	0.53254	0.1785	L	0.41236	1.265	0.48040	D	0.999577	D	0.76494	0.999	D	0.68353	0.957	T	0.52638	-0.8549	10	0.59425	D	0.04	0.6457	17.3163	0.87225	0.0:1.0:0.0:0.0	.	275	Q5VWX1	KHDR2_HUMAN	D	275	ENSP00000281156:G275D	ENSP00000281156:G275D	G	-	2	0	KHDRBS2	62500615	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	4.607000	0.61133	2.827000	0.97445	0.644000	0.83932	GGC	.	.		0.378	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688	
MAP3K4	4216	hgsc.bcm.edu	37	6	161455352	161455352	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr6:161455352T>A	ENST00000392142.4	+	2	362	c.214T>A	c.(214-216)Tcc>Acc	p.S72T	MAP3K4_ENST00000348824.7_Missense_Mutation_p.S72T|MAP3K4_ENST00000366919.2_Missense_Mutation_p.S72T|MAP3K4_ENST00000366920.2_Missense_Mutation_p.S72T	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	72					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGAAGACTTCTCCGATGAAAC	0.453																																					p.S72T		Atlas-SNP	.											.	MAP3K4	364	.	0			c.T214A						.						87.0	83.0	84.0					6																	161455352		2203	4300	6503	SO:0001583	missense	4216	exon2			GACTTCTCCGATG	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.214T>A	chr6.hg19:g.161455352T>A	ENSP00000375986:p.Ser72Thr	103.0	0.0		79.0	21.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.556742	0.45487	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824;ENST00000544209	T;T;T;T	0.72615	-0.67;-0.65;-0.64;-0.67	5.49	1.6	0.23607	.	0.380161	0.24820	N	0.035334	T	0.39279	0.1072	L	0.51422	1.61	0.24656	N	0.993493	P;B	0.35272	0.493;0.361	B;B	0.36134	0.218;0.108	T	0.28364	-1.0046	10	0.21014	T	0.42	-3.2875	7.0369	0.24998	0.0:0.1328:0.1251:0.742	.	72;72	Q9Y6R4-2;Q9Y6R4	.;M3K4_HUMAN	T	72;72;72;72;72;51	ENSP00000355886:S72T;ENSP00000375986:S72T;ENSP00000355887:S72T;ENSP00000297332:S72T	ENSP00000297332:S72T	S	+	1	0	MAP3K4	161375342	0.998000	0.40836	0.818000	0.32626	0.660000	0.38997	1.417000	0.34770	0.100000	0.17581	0.456000	0.33151	TCC	.	.		0.453	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
ABCB5	340273	hgsc.bcm.edu	37	7	20698136	20698136	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr7:20698136A>G	ENST00000404938.2	+	14	2196	c.1544A>G	c.(1543-1545)aAt>aGt	p.N515S	ABCB5_ENST00000258738.6_Missense_Mutation_p.N70S|ABCB5_ENST00000406935.1_Missense_Mutation_p.N70S|ABCB5_ENST00000443026.2_Missense_Mutation_p.N70S	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	515	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TAGAAATTTAATACATTGGTA	0.393																																					p.N515S		Atlas-SNP	.											.	ABCB5	357	.	0			c.A1544G						.						69.0	67.0	68.0					7																	20698136		2203	4300	6503	SO:0001583	missense	340273	exon14			AATTTAATACATT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1544A>G	chr7.hg19:g.20698136A>G	ENSP00000384881:p.Asn515Ser	39.0	0.0		46.0	25.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	hg19	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518164	0.44763	.	.	ENSG00000004846	ENST00000404938;ENST00000443026;ENST00000406935;ENST00000258738	D;D;D;D	0.90444	-1.92;-2.67;-2.67;-1.92	5.86	3.5	0.40072	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.169418	0.38959	N	0.001509	D	0.87676	0.6237	N	0.20766	0.605	0.32743	N	0.507456	B;B;B;B	0.27316	0.002;0.175;0.001;0.001	B;P;B;B	0.45037	0.004;0.467;0.006;0.002	D	0.88281	0.2936	10	0.59425	D	0.04	.	9.4926	0.38969	0.8573:0.0:0.1427:0.0	.	70;515;70;70	B5MD19;A7BKA4;Q2M3G0;Q2M3G0-2	.;.;ABCB5_HUMAN;.	S	515;70;70;70	ENSP00000384881:N515S;ENSP00000406730:N70S;ENSP00000383899:N70S;ENSP00000258738:N70S	ENSP00000258738:N70S	N	+	2	0	ABCB5	20664661	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	5.144000	0.64832	1.149000	0.42402	0.528000	0.53228	AAT	.	.		0.393	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
HOXA7	3204	hgsc.bcm.edu	37	7	27195946	27195946	+	Silent	SNP	G	G	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr7:27195946G>C	ENST00000242159.3	-	1	352	c.219C>G	c.(217-219)ggC>ggG	p.G73G	HOXA7_ENST00000523796.2_5'Flank|HOXA-AS3_ENST00000518947.2_RNA|RP1-170O19.21_ENST00000602610.1_lincRNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7	73					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						AGGCGTCGGCGCCCAGGCCGT	0.672																																					p.G73G		Atlas-SNP	.											.	HOXA7	34	.	0			c.C219G						.						25.0	34.0	31.0					7																	27195946		2203	4296	6499	SO:0001819	synonymous_variant	3204	exon1			GTCGGCGCCCAGG		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217	ENST00000242159.3:c.219C>G	chr7.hg19:g.27195946G>C		195.0	0.0		227.0	67.0	NM_006896	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	Silent	SNP	ENST00000242159.3	hg19	CCDS5408.1																																																																																			.	.		0.672	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358695.1		
SEMA3A	10371	hgsc.bcm.edu	37	7	83640603	83640604	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr7:83640603_83640604CC>AA	ENST00000265362.4	-	8	1134_1135	c.820_821GG>TT	c.(820-822)GGa>TTa	p.G274L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.G274L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	274	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TCTGTGCCCTCCAAAGTCATTC	0.376																																					p.G274V|p.G274X		Atlas-SNP	.											SEMA3A,right_upper_lobe,carcinoma,0,1|.	SEMA3A	121	.	0			c.G821T|c.G820T						.																																			SO:0001583	missense	10371	exon8			TGCCCTCCAAAGT|GCCCTCCAAAGTC	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.820_821delinsAA	chr7.hg19:g.83640603_83640604delinsAA	ENSP00000265362:p.Gly274Leu	84.0|83.0	0.0		115.0	52.0	NM_006080		Missense_Mutation|Nonsense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1																																																																																			.	.		0.376	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
ORC5	5001	hgsc.bcm.edu	37	7	103808951	103808952	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr7:103808951_103808952TC>CA	ENST00000297431.4	-	9	988_989	c.846_847GA>TG	c.(844-849)caGAaa>caTGaa	p.282_283QK>HE	ORC5_ENST00000545943.1_Missense_Mutation_p.150_151QK>HE|ORC5_ENST00000447452.2_Missense_Mutation_p.282_283QK>HE	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	282					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						GTGTCATCTTTCTGTAGCTTTT	0.342																																					p.K283E|p.Q282H		Atlas-SNP	.											.	ORC5	48	.	0			c.A847G|c.G846T						.																																			SO:0001583	missense	5001	exon9			CATCTTTCTGTAG|ATCTTTCTGTAGC		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.846_847delinsCA	chr7.hg19:g.103808951_103808952delinsCA	ENSP00000297431:p.Q282_K283delinsHE	27.0|28.0	0.0		79.0|75.0	45.0|44.0	NM_002553	A4D0P8|O60590|O95268	Missense_Mutation	SNP	ENST00000297431.4	hg19	CCDS5734.1																																																																																			.	.		0.342	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553	
PPP1R3A	5506	hgsc.bcm.edu	37	7	113518118	113518118	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr7:113518118G>T	ENST00000284601.3	-	4	3097	c.3029C>A	c.(3028-3030)cCa>cAa	p.P1010Q		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1010					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TAAAATCATTGGCCCTAGAGA	0.383																																					p.P1010Q		Atlas-SNP	.											.	PPP1R3A	317	.	0			c.C3029A						.						130.0	129.0	129.0					7																	113518118		2203	4298	6501	SO:0001583	missense	5506	exon4			ATCATTGGCCCTA	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3029C>A	chr7.hg19:g.113518118G>T	ENSP00000284601:p.Pro1010Gln	51.0	0.0		126.0	78.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	hg19	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162074	0.38217	.	.	ENSG00000154415	ENST00000284601	T	0.60171	0.21	5.71	5.71	0.89125	.	0.192043	0.37178	N	0.002211	T	0.77143	0.4087	M	0.72894	2.215	0.41562	D	0.98863	D	0.89917	1.0	D	0.91635	0.999	T	0.78760	-0.2078	10	0.87932	D	0	-6.8891	19.8454	0.96706	0.0:0.0:1.0:0.0	.	1010	Q16821	PPR3A_HUMAN	Q	1010	ENSP00000284601:P1010Q	ENSP00000284601:P1010Q	P	-	2	0	PPP1R3A	113305354	1.000000	0.71417	0.157000	0.22605	0.242000	0.25591	6.468000	0.73551	2.680000	0.91292	0.650000	0.86243	CCA	.	.		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
ESYT2	57488	hgsc.bcm.edu	37	7	158586392	158586392	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr7:158586392A>G	ENST00000251527.5	-	4	742	c.677T>C	c.(676-678)gTa>gCa	p.V226A	ESYT2_ENST00000497111.1_5'UTR	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	254	Glycerophospholipid-binding barrel-like domain.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TTCAGTGTATACCTTAACACC	0.313																																					p.V226A		Atlas-SNP	.											.	ESYT2	70	.	0			c.T677C						.						103.0	90.0	95.0					7																	158586392		2203	4300	6503	SO:0001583	missense	57488	exon4			GTGTATACCTTAA	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.677T>C	chr7.hg19:g.158586392A>G	ENSP00000251527:p.Val226Ala	31.0	0.0		61.0	33.0	NM_020728	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	hg19	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	A	10.46	1.356051	0.24598	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000429474	T;T	0.20463	2.07;2.07	4.97	3.81	0.43845	.	0.120339	0.56097	D	0.000032	T	0.32406	0.0828	L	0.46157	1.445	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.70016	0.967;0.967	T	0.05716	-1.0868	10	0.15066	T	0.55	-23.4484	9.8762	0.41205	0.9194:0.0:0.0806:0.0	.	254;226	A0FGR8-6;A0FGR8-2	.;.	A	226;254;196;50	ENSP00000251527:V226A;ENSP00000275418:V196A	ENSP00000251527:V226A	V	-	2	0	ESYT2	158279153	1.000000	0.71417	0.811000	0.32455	0.966000	0.64601	5.679000	0.68160	0.744000	0.32741	0.460000	0.39030	GTA	.	.		0.313	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
MBOAT4	619373	hgsc.bcm.edu	37	8	29989500	29989500	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr8:29989500G>T	ENST00000320542.3	-	3	1351	c.1267C>A	c.(1267-1269)Ctg>Atg	p.L423M	LEPROTL1_ENST00000523116.1_Intron|LEPROTL1_ENST00000442880.2_Intron	NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4	423					cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)			endometrium(1)	1						AGCAAAAGCAGAATACAGTAC	0.448																																					p.L423M		Atlas-SNP	.											.	MBOAT4	31	.	0			c.C1267A						.						110.0	90.0	96.0					8																	29989500		692	1591	2283	SO:0001583	missense	619373	exon3			AAAGCAGAATACA	AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.1267C>A	chr8.hg19:g.29989500G>T	ENSP00000314196:p.Leu423Met	161.0	0.0		209.0	76.0	NM_001100916	B1Q003	Missense_Mutation	SNP	ENST00000320542.3	hg19	CCDS47835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.76|13.76	2.334679|2.334679	0.41297|0.41297	.|.	.|.	ENSG00000177669|ENSG00000104660	ENST00000320542|ENST00000520682	T|.	0.26660|.	1.72|.	5.11|5.11	1.31|1.31	0.21738|0.21738	.|.	0.391117|.	0.17548|.	N|.	0.170266|.	T|T	0.38585|0.38585	0.1046|0.1046	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D|.	0.58620|.	0.983|.	P|.	0.52267|.	0.694|.	T|T	0.09796|0.09796	-1.0658|-1.0658	9|5	.|.	.|.	.|.	.|.	3.755|3.755	0.08582|0.08582	0.6443:0.0:0.1969:0.1588|0.6443:0.0:0.1969:0.1588	.|.	423|.	Q96T53|.	MBOA4_HUMAN|.	M|H	423|96	ENSP00000314196:L423M|.	.|.	L|Q	-|+	1|3	2|2	MBOAT4|LEPROTL1	30109042|30109042	0.107000|0.107000	0.21998|0.21998	0.971000|0.971000	0.41717|0.41717	0.370000|0.370000	0.29829|0.29829	0.588000|0.588000	0.23924|0.23924	0.443000|0.443000	0.26582|0.26582	0.557000|0.557000	0.71058|0.71058	CTG|CAG	.	.		0.448	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375795.1		
FGFR1	2260	hgsc.bcm.edu	37	8	38273520	38273520	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr8:38273520C>A	ENST00000447712.2	-	13	2663	c.1722G>T	c.(1720-1722)caG>caT	p.Q574H	FGFR1_ENST00000397108.4_Missense_Mutation_p.Q572H|FGFR1_ENST00000397103.1_Missense_Mutation_p.Q485H|FGFR1_ENST00000532791.1_Missense_Mutation_p.Q572H|FGFR1_ENST00000425967.3_Missense_Mutation_p.Q605H|FGFR1_ENST00000326324.6_Missense_Mutation_p.Q483H|FGFR1_ENST00000335922.5_Missense_Mutation_p.Q564H|FGFR1_ENST00000397091.5_Missense_Mutation_p.Q572H|FGFR1_ENST00000356207.5_Missense_Mutation_p.Q485H|FGFR1_ENST00000341462.5_Missense_Mutation_p.Q574H|FGFR1_ENST00000397113.2_Missense_Mutation_p.Q572H	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	574	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCCTCCGGGCCTGCAGGTACT	0.637		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														p.Q605H	Melanoma(146;1153 1840 21453 21841 43625)	Atlas-SNP	.		Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	.	FGFR1	284	.	0			c.G1815T						.						35.0	41.0	39.0					8																	38273520		2041	4217	6258	SO:0001583	missense	2260	exon14			CCGGGCCTGCAGG	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.1722G>T	chr8.hg19:g.38273520C>A	ENSP00000400162:p.Gln574His	37.0	0.0		47.0	15.0	NM_001174067	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	ENST00000447712.2	hg19	CCDS6107.2	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765607	0.69878	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000335922;ENST00000326324;ENST00000397103;ENST00000397108	D;D;D;D;D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	5.4	5.4	0.78164	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.054186	0.85682	D	0.000000	T	0.74635	0.3742	N	0.05534	-0.03	0.53688	D	0.99997	P;P;P;P;P	0.44659	0.84;0.84;0.787;0.747;0.747	P;P;P;P;P	0.50049	0.598;0.598;0.629;0.496;0.496	T	0.78160	-0.2312	10	0.87932	D	0	.	10.1119	0.42568	0.0:0.8508:0.0:0.1492	.	483;483;574;564;572	P11362-14;P11362-4;P11362;P11362-20;P11362-2	.;.;FGFR1_HUMAN;.;.	H	572;605;574;574;574;572;572;485;564;483;485;572	ENSP00000380280:Q572H;ENSP00000393312:Q605H;ENSP00000400162:Q574H;ENSP00000340636:Q574H;ENSP00000432972:Q572H;ENSP00000380302:Q572H;ENSP00000348537:Q485H;ENSP00000337247:Q564H;ENSP00000327229:Q483H;ENSP00000380292:Q485H;ENSP00000380297:Q572H	ENSP00000311337:Q574H	Q	-	3	2	FGFR1	38392677	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.455000	0.21843	2.688000	0.91661	0.655000	0.94253	CAG	.	.		0.637	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SAMD12	401474	hgsc.bcm.edu	37	8	119391802	119391802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr8:119391802G>A	ENST00000314727.4	-	4	596	c.460C>T	c.(460-462)Caa>Taa	p.Q154*	SAMD12_ENST00000409003.4_Nonsense_Mutation_p.Q154*|SAMD12_ENST00000527515.1_5'UTR|AC023590.1_ENST00000430457.1_Intron	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	154										endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			AGGGTACCTTGTGTGAGTAAC	0.483																																					p.Q154X		Atlas-SNP	.											.	SAMD12	24	.	0			c.C460T						.						159.0	142.0	148.0					8																	119391802		2203	4300	6503	SO:0001587	stop_gained	401474	exon4			TACCTTGTGTGAG	AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.460C>T	chr8.hg19:g.119391802G>A	ENSP00000314173:p.Gln154*	80.0	0.0		145.0	20.0	NM_207506	Q0P502	Nonsense_Mutation	SNP	ENST00000314727.4	hg19	CCDS6325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.839213|5.839213	0.97009|0.97009	.|.	.|.	ENSG00000177570|ENSG00000177570	ENST00000409003;ENST00000524796;ENST00000314727;ENST00000526328|ENST00000453675	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.77638	.|0.4160	.|.	.|.	.|.	0.52099|0.52099	D|D	0.999941|0.999941	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73658	.|-0.3913	.|4	.|.	.|.	.|.	-16.377|-16.377	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	154;146;154;154|140	.|.	.|.	Q|T	-|-	1|2	0|0	SAMD12|SAMD12	119460983|119460983	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.787000|0.787000	0.44495|0.44495	9.476000|9.476000	0.97823|0.97823	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CAA|ACA	.	.		0.483	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506	
ADCY8	114	hgsc.bcm.edu	37	8	131896827	131896827	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr8:131896827A>G	ENST00000286355.5	-	8	4184	c.2092T>C	c.(2092-2094)Tcc>Ccc	p.S698P	ADCY8_ENST00000377928.3_Missense_Mutation_p.S698P	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	698					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TCCAGGCTGGAGTCTTTAAAC	0.463										HNSCC(32;0.087)																											p.S698P		Atlas-SNP	.											.	ADCY8	291	.	0			c.T2092C						.						114.0	113.0	114.0					8																	131896827		2203	4300	6503	SO:0001583	missense	114	exon8			GGCTGGAGTCTTT	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2092T>C	chr8.hg19:g.131896827A>G	ENSP00000286355:p.Ser698Pro	46.0	0.0		54.0	17.0	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	hg19	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	A	3.937	-0.014994	0.07681	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.76186	-1.0;-1.0	5.98	5.98	0.97165	.	0.102243	0.64402	D	0.000001	T	0.54175	0.1842	N	0.01242	-0.935	0.40433	D	0.97996	D;B	0.53619	0.961;0.005	P;B	0.48030	0.564;0.006	T	0.64491	-0.6395	10	0.23302	T	0.38	.	15.7096	0.77615	1.0:0.0:0.0:0.0	.	698;698	E7EVL1;P40145	.;ADCY8_HUMAN	P	698	ENSP00000286355:S698P;ENSP00000367161:S698P	ENSP00000286355:S698P	S	-	1	0	ADCY8	131966009	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.325000	0.65869	2.307000	0.77673	0.529000	0.55759	TCC	.	.		0.463	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
SCRIB	23513	hgsc.bcm.edu	37	8	144875222	144875222	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr8:144875222G>A	ENST00000320476.3	-	29	3947	c.3941C>T	c.(3940-3942)cCc>cTc	p.P1314L	SCRIB_ENST00000356994.2_Missense_Mutation_p.P1314L|SCRIB_ENST00000546337.1_5'UTR|SCRIB_ENST00000377533.3_Missense_Mutation_p.P1233L|RP11-429J17.8_ENST00000527139.1_RNA|RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000534089.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1314	Pro-rich.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CACATTGGCGGGCAGCTCATC	0.692																																					p.P1314L	Pancreas(51;966 1133 10533 14576 29674)	Atlas-SNP	.											.	SCRIB	192	.	0			c.C3941T						.						13.0	13.0	13.0					8																	144875222		2091	4133	6224	SO:0001583	missense	23513	exon29			TTGGCGGGCAGCT	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.3941C>T	chr8.hg19:g.144875222G>A	ENSP00000322938:p.Pro1314Leu	70.0	0.0		92.0	33.0	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	hg19	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717052	0.48622	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533;ENST00000377539	T;T;T	0.41065	1.22;1.16;1.01	3.81	2.83	0.33086	.	.	.	.	.	T	0.60599	0.2281	M	0.72894	2.215	0.46028	D	0.998823	D;D;D	0.89917	1.0;0.996;1.0	D;P;D	0.91635	0.997;0.898;0.999	T	0.65142	-0.6240	9	0.72032	D	0.01	.	11.6576	0.51328	0.0:0.181:0.819:0.0	.	1314;1314;1233	Q14160;Q14160-3;Q14160-2	SCRIB_HUMAN;.;.	L	1314;1314;1233;683	ENSP00000349486:P1314L;ENSP00000322938:P1314L;ENSP00000366756:P1233L	ENSP00000322938:P1314L	P	-	2	0	SCRIB	144947210	1.000000	0.71417	0.845000	0.33349	0.215000	0.24574	4.603000	0.61105	1.862000	0.54008	0.305000	0.20034	CCC	.	.		0.692	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SMARCA2	6595	hgsc.bcm.edu	37	9	2123796	2123796	+	Silent	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr9:2123796G>A	ENST00000382203.1	+	27	4049	c.3840G>A	c.(3838-3840)ctG>ctA	p.L1280L	SMARCA2_ENST00000382194.1_Silent_p.L1280L|SMARCA2_ENST00000357248.2_Silent_p.L1280L|SMARCA2_ENST00000349721.2_Silent_p.L1280L			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1280					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AGGATGAGCTGCCCTCCTGGA	0.562																																					p.L1280L		Atlas-SNP	.											.	SMARCA2	313	.	0			c.G3840A						.						46.0	47.0	46.0					9																	2123796		2203	4300	6503	SO:0001819	synonymous_variant	6595	exon27			TGAGCTGCCCTCC	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3840G>A	chr9.hg19:g.2123796G>A		87.0	0.0		112.0	8.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.		0.562	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
NPR2	4882	hgsc.bcm.edu	37	9	35811575	35811575	+	IGR	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr9:35811575G>A	ENST00000342694.2	+	0	3686				AL133410.1_ENST00000582432.1_RNA|HINT2_ENST00000474908.1_5'Flank|SPAG8_ENST00000340291.2_Silent_p.G156G|SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000484764.1_Silent_p.G154G|TMEM8B_ENST00000377996.1_5'Flank|SPAG8_ENST00000396638.2_Silent_p.G156G	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	cagagccagagccatggccag	0.602																																					p.G156G		Atlas-SNP	.											.	SPAG8	67	.	0			c.C468T						.						52.0	41.0	45.0					9																	35811575		2203	4300	6503	SO:0001628	intergenic_variant	26206	exon2			GCCAGAGCCATGG	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		chr9.hg19:g.35811575G>A		63.0	0.0		65.0	28.0	NM_001039592	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Silent	SNP	ENST00000342694.2	hg19	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	5.563	0.288698	0.10513	.	.	ENSG00000137098	ENST00000497810	.	.	.	4.52	3.52	0.40303	.	.	.	.	.	T	0.35770	0.0943	.	.	.	0.20638	N	0.999877	.	.	.	.	.	.	T	0.13602	-1.0503	4	.	.	.	-2.241	9.0247	0.36222	0.0:0.0:0.7803:0.2197	.	.	.	.	V	154	.	.	A	-	2	0	SPAG8	35801575	0.000000	0.05858	0.013000	0.15412	0.084000	0.17831	-1.130000	0.03241	2.474000	0.83562	0.655000	0.94253	GCT	.	.		0.602	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
TRIM32	22954	hgsc.bcm.edu	37	9	119461915	119461915	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr9:119461915G>T	ENST00000450136.1	+	2	2055	c.1894G>T	c.(1894-1896)Gtc>Ttc	p.V632F	ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000373996.3_Intron|ASTN2_ENST00000361477.3_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.V632F|ASTN2_ENST00000361209.2_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	632					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						GCAGCTGCTGGTCTTGGACTG	0.488																																					p.V632F	Esophageal Squamous(92;212 1916 19711 26951)	Atlas-SNP	.											.	TRIM32	67	.	0			c.G1894T						.						93.0	93.0	93.0					9																	119461915		2203	4300	6503	SO:0001583	missense	22954	exon2			CTGCTGGTCTTGG	U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.1894G>T	chr9.hg19:g.119461915G>T	ENSP00000408292:p.Val632Phe	72.0	0.0		98.0	46.0	NM_012210	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	hg19	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894783	0.72639	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	D;D	0.87729	-2.29;-2.29	5.69	5.69	0.88448	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000003	D	0.94182	0.8133	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93724	0.7035	9	.	.	.	-22.3703	19.8228	0.96604	0.0:0.0:1.0:0.0	.	632	Q13049	TRI32_HUMAN	F	632	ENSP00000408292:V632F;ENSP00000363095:V632F	.	V	+	1	0	TRIM32	118501736	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.434000	0.97515	2.668000	0.90789	0.650000	0.86243	GTC	.	.		0.488	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210	
WDFY4	57705	hgsc.bcm.edu	37	10	49917835	49917835	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr10:49917835A>C	ENST00000325239.5	+	1	85	c.58A>C	c.(58-60)Aat>Cat	p.N20H	WDFY4_ENST00000360890.2_Missense_Mutation_p.N20H|WDFY4_ENST00000413659.2_Missense_Mutation_p.N20H	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	20						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGGTTCCAAAAATGAAGGGCA	0.502																																					p.N20H		Atlas-SNP	.											.	WDFY4	205	.	0			c.A58C						.						61.0	63.0	62.0					10																	49917835		692	1591	2283	SO:0001583	missense	57705	exon2			TCCAAAAATGAAG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.58A>C	chr10.hg19:g.49917835A>C	ENSP00000320563:p.Asn20His	75.0	0.0		74.0	36.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	hg19	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.862561	0.51482	.	.	ENSG00000128815	ENST00000360890;ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T;T	0.56776	0.86;0.44;1.45	5.73	0.698	0.18087	.	.	.	.	.	T	0.46795	0.1411	M	0.65975	2.015	0.09310	N	1	P;B	0.38642	0.641;0.002	B;B	0.38500	0.275;0.003	T	0.40961	-0.9535	9	0.56958	D	0.05	.	4.3091	0.10962	0.5744:0.1656:0.2599:0.0	.	20;20	Q6ZS81;Q6ZS81-2	WDFY4_HUMAN;.	H	20;29;20;20;20	ENSP00000354141:N20H;ENSP00000320563:N20H;ENSP00000403789:N20H	ENSP00000320563:N20H	N	+	1	0	WDFY4	49587841	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.318000	0.19504	0.085000	0.17107	0.477000	0.44152	AAT	.	.		0.502	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
LBX1	10660	hgsc.bcm.edu	37	10	102988325	102988325	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr10:102988325G>A	ENST00000370193.2	-	1	1226	c.248C>T	c.(247-249)tCg>tTg	p.S83L	LBX1-AS1_ENST00000546988.1_RNA|LBX1-AS1_ENST00000547077.1_RNA	NM_006562.4	NP_006553.2	P52954	LBX1_HUMAN	ladybird homeobox 1	83					anatomical structure morphogenesis (GO:0009653)|heart looping (GO:0001947)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neuron fate determination (GO:0048664)|regulation of transcription from RNA polymerase II promoter involved in spinal cord association neuron specification (GO:0021920)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(4)|ovary(1)	7		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)		GCACAGCGGCGAGGTCTGCGA	0.716																																					p.S83L		Atlas-SNP	.											.	LBX1	18	.	0			c.C248T						.						8.0	8.0	8.0					10																	102988325		2092	4108	6200	SO:0001583	missense	10660	exon1			AGCGGCGAGGTCT	X90828	CCDS31270.1	10q24.32	2011-06-20	2007-02-15		ENSG00000138136	ENSG00000138136		"""Homeoboxes / ANTP class : NKL subclass"""	16960	protein-coding gene	gene with protein product		604255	"""ladybird homeobox homolog 1 (Drosophila)"""			8645601	Standard	XM_005269443		Approved	LBX1H, HPX6	uc001ksx.3	P52954	OTTHUMG00000018927	ENST00000370193.2:c.248C>T	chr10.hg19:g.102988325G>A	ENSP00000359212:p.Ser83Leu	41.0	0.0		36.0	27.0	NM_006562	B9EGA2|Q05BB2	Missense_Mutation	SNP	ENST00000370193.2	hg19	CCDS31270.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862142	0.91511	.	.	ENSG00000138136	ENST00000370193	D	0.94046	-3.34	4.21	4.21	0.49690	.	0.000000	0.85682	D	0.000000	D	0.96244	0.8775	M	0.80746	2.51	0.58432	D	0.999999	D	0.89917	1.0	D	0.72075	0.976	D	0.96199	0.9144	10	0.52906	T	0.07	.	14.1022	0.65065	0.0:0.0:1.0:0.0	.	83	P52954	LBX1_HUMAN	L	83	ENSP00000359212:S83L	ENSP00000359212:S83L	S	-	2	0	LBX1	102978315	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.823000	0.92018	2.203000	0.70933	0.561000	0.74099	TCG	.	.		0.716	LBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049928.3	NM_006562	
PPRC1	23082	hgsc.bcm.edu	37	10	103898443	103898443	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr10:103898443A>G	ENST00000278070.2	+	3	449	c.410A>G	c.(409-411)aAt>aGt	p.N137S	PPRC1_ENST00000413464.2_Missense_Mutation_p.N137S|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		ATCTTGGACAATGCAGATTCT	0.532																																					p.N137S		Atlas-SNP	.											.	PPRC1	151	.	0			c.A410G						.						121.0	108.0	112.0					10																	103898443		2203	4300	6503	SO:0001583	missense	23082	exon3			TGGACAATGCAGA	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.410A>G	chr10.hg19:g.103898443A>G	ENSP00000278070:p.Asn137Ser	60.0	0.0		53.0	33.0	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	hg19	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.528710	0.44969	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.26660	1.72;1.72	4.97	4.97	0.65823	.	0.200781	0.37136	N	0.002234	T	0.20495	0.0493	L	0.32530	0.975	0.43745	D	0.996241	P;P	0.43750	0.816;0.816	B;B	0.43225	0.412;0.412	T	0.01930	-1.1245	10	0.35671	T	0.21	.	8.1841	0.31328	0.8716:0.0:0.1284:0.0	.	137;137	E7EVG6;Q5VV67	.;PPRC1_HUMAN	S	137	ENSP00000278070:N137S;ENSP00000399743:N137S	ENSP00000278070:N137S	N	+	2	0	PPRC1	103888433	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.874000	0.75546	2.024000	0.59613	0.379000	0.24179	AAT	.	.		0.532	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
CCDC186	55088	hgsc.bcm.edu	37	10	115922915	115922915	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr10:115922915A>G	ENST00000369287.3	-	2	379	c.113T>C	c.(112-114)tTa>tCa	p.L38S	C10orf118_ENST00000369286.1_Missense_Mutation_p.L38S|C10orf118_ENST00000369285.3_Missense_Mutation_p.L38S	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		38										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		CTCATTTTCTAATTTGCTGCT	0.343																																					p.L38S		Atlas-SNP	.											.	C10orf118	70	.	0			c.T113C						.						124.0	122.0	123.0					10																	115922915		2203	4300	6503	SO:0001583	missense	55088	exon2			TTTTCTAATTTGC																												ENST00000369287.3:c.113T>C	chr10.hg19:g.115922915A>G	ENSP00000358293:p.Leu38Ser	56.0	0.0		70.0	45.0	NM_018017	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Missense_Mutation	SNP	ENST00000369287.3	hg19	CCDS7587.1	.	.	.	.	.	.	.	.	.	.	A	13.59	2.281855	0.40394	.	.	ENSG00000165813	ENST00000369287;ENST00000430353;ENST00000369286;ENST00000369285	T;T;T	0.47528	1.37;0.84;0.84	5.65	4.51	0.55191	.	0.676274	0.13875	N	0.356763	T	0.49762	0.1576	L	0.50333	1.59	0.80722	D	1	P	0.45827	0.867	P	0.48030	0.564	T	0.42916	-0.9423	10	0.56958	D	0.05	.	10.1473	0.42771	0.9246:0.0:0.0754:0.0	.	38	Q7Z3E2	CJ118_HUMAN	S	38;144;38;38	ENSP00000358293:L38S;ENSP00000358292:L38S;ENSP00000358291:L38S	ENSP00000358291:L38S	L	-	2	0	C10orf118	115912905	0.977000	0.34250	0.982000	0.44146	0.680000	0.39746	3.166000	0.50785	0.983000	0.38602	0.529000	0.55759	TTA	.	.		0.343	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		
CTC-497E21.3	0	hgsc.bcm.edu	37	11	13032049	13032049	+	lincRNA	SNP	C	C	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:13032049C>G	ENST00000533002.1	-	0	0																											gcggcgCCCCCTCTAGCCGGC	0.716																																					p.P309R		Atlas-SNP	.											.	.	.	.	0			c.C926G						.																																					644943	exon1			CGCCCCCTCTAGC																													chr11.hg19:g.13032049C>G		80.0	0.0		102.0	18.0	NM_001080521		Missense_Mutation	SNP	ENST00000533002.1	hg19																																																																																				.	.		0.716	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
KIAA1549L	25758	hgsc.bcm.edu	37	11	33689596	33689596	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:33689596G>T	ENST00000321505.4	+	20	5626	c.5446G>T	c.(5446-5448)Gct>Tct	p.A1816S	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.A1822S|RP4-541C22.5_ENST00000534431.1_RNA			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1816						integral component of membrane (GO:0016021)											CCCGTCTGACGCTCCCCTGAC	0.637																																					p.A1816S		Atlas-SNP	.											.	.	.	.	0			c.G5446T						.						54.0	62.0	59.0					11																	33689596		2025	4182	6207	SO:0001583	missense	25758	exon20			TCTGACGCTCCCC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.5446G>T	chr11.hg19:g.33689596G>T	ENSP00000315295:p.Ala1816Ser	72.0	0.0		93.0	50.0	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	hg19	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419030	0.25552	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000536568	.	.	.	5.67	-4.08	0.03963	.	0.487586	0.17947	N	0.156629	T	0.15219	0.0367	N	0.08118	0	0.09310	N	0.999998	B	0.31893	0.345	B	0.26517	0.07	T	0.11421	-1.0588	9	0.24483	T	0.36	-0.0232	14.4568	0.67420	0.5444:0.0:0.4556:0.0	.	1822	E9PAT2	.	S	1816;1822;1655	.	ENSP00000315295:A1816S	A	+	1	0	C11orf41	33646172	0.052000	0.20516	0.039000	0.18376	0.149000	0.21700	0.072000	0.14617	-0.596000	0.05821	-0.258000	0.10820	GCT	.	.		0.637	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
ZNF408	79797	hgsc.bcm.edu	37	11	46726573	46726573	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:46726573G>T	ENST00000311764.2	+	5	1553	c.1323G>T	c.(1321-1323)caG>caT	p.Q441H		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTTGTGACCAGTGTGGCAAGG	0.652																																					p.Q441H	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	Atlas-SNP	.											.	ZNF408	70	.	0			c.G1323T						.						51.0	48.0	49.0					11																	46726573		2201	4299	6500	SO:0001583	missense	79797	exon5			TGACCAGTGTGGC	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1323G>T	chr11.hg19:g.46726573G>T	ENSP00000309606:p.Gln441His	66.0	0.0		87.0	29.0	NM_024741		Missense_Mutation	SNP	ENST00000311764.2	hg19	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210545	0.58343	.	.	ENSG00000175213	ENST00000311764	T	0.17054	2.3	5.68	3.8	0.43715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42682	D	0.000672	T	0.13841	0.0335	N	0.25992	0.78	0.32639	N	0.520927	P;P	0.48503	0.911;0.911	P;P	0.45753	0.492;0.492	T	0.12837	-1.0532	10	0.62326	D	0.03	-31.9179	7.299	0.26409	0.1355:0.2493:0.6152:0.0	.	433;441	B4DXY4;Q9H9D4	.;ZN408_HUMAN	H	441	ENSP00000309606:Q441H	ENSP00000309606:Q441H	Q	+	3	2	ZNF408	46683149	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.593000	0.23999	0.847000	0.35167	0.563000	0.77884	CAG	.	.		0.652	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
C11orf24	53838	hgsc.bcm.edu	37	11	68029831	68029832	+	Missense_Mutation	DNP	GC	GC	AA	rs567702264		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:68029831_68029832GC>AA	ENST00000304271.6	-	4	1033_1034	c.631_632GC>TT	c.(631-633)GCc>TTc	p.A211F	C11orf24_ENST00000530166.1_5'Flank|C11orf24_ENST00000533310.1_Intron	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	211						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						AGCACGTGTGGCCAATGTGGCC	0.604																																					p.A211V|p.A211S	NSCLC(21;855 905 4198 36694)	Atlas-SNP	.											.	C11orf24	35	.	0			c.C632T|c.G631T						.																																			SO:0001583	missense	53838	exon4			CGTGTGGCCAATG|GTGTGGCCAATGT	AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.631_632delinsAA	chr11.hg19:g.68029831_68029832delinsAA	ENSP00000307264:p.Ala211Phe	123.0|124.0	0.0		128.0|127.0	40.0	NM_022338	Q9H2K4	Missense_Mutation	SNP	ENST00000304271.6	hg19	CCDS8180.1																																																																																			.	.		0.604	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338	
DHCR7	1717	hgsc.bcm.edu	37	11	71146549	71146549	+	Missense_Mutation	SNP	T	T	C	rs375187933		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:71146549T>C	ENST00000355527.3	-	9	1576	c.1300A>G	c.(1300-1302)Atc>Gtc	p.I434V	DHCR7_ENST00000407721.2_Missense_Mutation_p.I434V	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	434					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						GCCATGTAGATGATGTAGAAG	0.687									Smith-Lemli-Opitz syndrome																												p.I434V		Atlas-SNP	.											.	DHCR7	98	.	0			c.A1300G						.	T	VAL/ILE,VAL/ILE	1,4397	2.1+/-5.4	0,1,2198	29.0	33.0	31.0		1300,1300	-3.5	1.0	11		31	0,8586		0,0,4293	no	missense,missense	DHCR7	NM_001163817.1,NM_001360.2	29,29	0,1,6491	CC,CT,TT		0.0,0.0227,0.0077	benign,benign	434/476,434/476	71146549	1,12983	2199	4293	6492	SO:0001583	missense	1717	exon9	Familial Cancer Database	SLOS type I & II	TGTAGATGATGTA	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.1300A>G	chr11.hg19:g.71146549T>C	ENSP00000347717:p.Ile434Val	49.0	0.0		86.0	20.0	NM_001163817	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	ENST00000355527.3	hg19	CCDS8200.1	.	.	.	.	.	.	.	.	.	.	T	9.029	0.986802	0.18889	2.27E-4	0.0	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000533800	D;D;D	0.97850	-4.57;-4.57;-4.57	5.12	-3.46	0.04767	.	0.329841	0.33005	N	0.005387	D	0.89897	0.6848	N	0.11284	0.12	0.33808	D	0.62748	B	0.09022	0.002	B	0.12837	0.008	T	0.80710	-0.1261	10	0.05833	T	0.94	-26.0222	11.5442	0.50683	0.0:0.4786:0.0:0.5214	.	434	Q9UBM7	DHCR7_HUMAN	V	434;434;184	ENSP00000384739:I434V;ENSP00000347717:I434V;ENSP00000435011:I184V	ENSP00000347717:I434V	I	-	1	0	DHCR7	70824197	0.031000	0.19500	0.977000	0.42913	0.937000	0.57800	-0.262000	0.08682	-0.609000	0.05724	-0.411000	0.06167	ATC	.	.		0.687	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1	NM_001360	
SLCO2B1	11309	hgsc.bcm.edu	37	11	74915600	74915600	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:74915600A>G	ENST00000289575.5	+	14	2500	c.2105A>G	c.(2104-2106)aAg>aGg	p.K702R	SLCO2B1_ENST00000532236.1_Missense_Mutation_p.K586R|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.K475R|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.K680R|SLCO2B1_ENST00000341411.4_Missense_Mutation_p.K475R|SLCO2B1_ENST00000525650.1_Missense_Mutation_p.K558R	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	702					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	GGGCCAGGGAAGAAGCCAGAG	0.582																																					p.K702R		Atlas-SNP	.											.	SLCO2B1	84	.	0			c.A2105G						.						69.0	60.0	63.0					11																	74915600		2200	4293	6493	SO:0001583	missense	11309	exon14			CAGGGAAGAAGCC	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.2105A>G	chr11.hg19:g.74915600A>G	ENSP00000289575:p.Lys702Arg	57.0	0.0		83.0	16.0	NM_007256	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	hg19	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.378745	0.42207	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000525650;ENST00000454962;ENST00000428359	T;T;T;T;T;T	0.41758	1.16;1.16;1.29;0.99;1.16;1.16	5.51	3.2	0.36748	.	2.321250	0.01909	N	0.039702	T	0.25680	0.0625	N	0.08118	0	0.20873	N	0.999835	B;B;B	0.23540	0.009;0.087;0.009	B;B;B	0.22601	0.008;0.04;0.008	T	0.23762	-1.0179	10	0.18710	T	0.47	.	6.8978	0.24265	0.8166:0.0:0.1834:0.0	.	558;475;702	E9PPU8;O94956-2;O94956	.;.;SO2B1_HUMAN	R	702;475;586;558;475;680	ENSP00000289575:K702R;ENSP00000341286:K475R;ENSP00000434112:K586R;ENSP00000436324:K558R;ENSP00000389653:K475R;ENSP00000388912:K680R	ENSP00000289575:K702R	K	+	2	0	SLCO2B1	74593248	0.992000	0.36948	0.777000	0.31699	0.141000	0.21300	1.804000	0.38873	0.399000	0.25367	0.460000	0.39030	AAG	.	.		0.582	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
CNTN5	53942	hgsc.bcm.edu	37	11	99942502	99942502	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:99942502G>T	ENST00000524871.1	+	12	1655	c.1365G>T	c.(1363-1365)atG>atT	p.M455I	CNTN5_ENST00000418526.2_Missense_Mutation_p.M381I|CNTN5_ENST00000527185.1_Missense_Mutation_p.M455I|CNTN5_ENST00000528682.1_Missense_Mutation_p.M455I|CNTN5_ENST00000279463.3_Missense_Mutation_p.M455I	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	455	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ATGCTGGAATGTATCAGTGTT	0.338																																					p.M455I		Atlas-SNP	.											.	CNTN5	324	.	0			c.G1365T						.						115.0	110.0	112.0					11																	99942502		1884	4147	6031	SO:0001583	missense	53942	exon11			TGGAATGTATCAG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1365G>T	chr11.hg19:g.99942502G>T	ENSP00000435637:p.Met455Ile	94.0	0.0		128.0	56.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659147	0.88154	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71978	0.3404	L	0.37507	1.11	0.80722	D	1	D;D;D	0.69078	0.985;0.99;0.997	P;P;D	0.70487	0.905;0.886;0.969	T	0.72740	-0.4202	10	0.52906	T	0.07	.	18.3469	0.90325	0.0:0.0:1.0:0.0	.	455;381;455	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	I	455;455;455;381;455	ENSP00000433575:M455I;ENSP00000436185:M455I;ENSP00000435637:M455I;ENSP00000393229:M381I;ENSP00000279463:M455I	ENSP00000279463:M455I	M	+	3	0	CNTN5	99447712	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.573000	0.86826	0.655000	0.94253	ATG	.	.		0.338	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
COPS7A	50813	hgsc.bcm.edu	37	12	6837158	6837158	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:6837158G>T	ENST00000543155.1	+	3	711	c.229G>T	c.(229-231)Gac>Tac	p.D77Y	COPS7A_ENST00000538410.1_Missense_Mutation_p.D77Y|COPS7A_ENST00000542150.1_Intron|COPS7A_ENST00000229251.3_Missense_Mutation_p.D77Y|COPS7A_ENST00000539735.1_Missense_Mutation_p.D77Y|COPS7A_ENST00000534877.1_Missense_Mutation_p.D77Y|COPS7A_ENST00000534947.1_Missense_Mutation_p.D77Y	NM_001164094.1	NP_001157566.1	Q9UBW8	CSN7A_HUMAN	COP9 signalosome subunit 7A	77	PCI.				cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	10						GACATACGCTGACTACTTAGG	0.512																																					p.D77Y		Atlas-SNP	.											.	COPS7A	26	.	0			c.G229T						.						141.0	117.0	126.0					12																	6837158		2203	4300	6503	SO:0001583	missense	50813	exon3			TACGCTGACTACT	AF193844	CCDS8558.1	12p13.31	2013-03-14	2013-03-14		ENSG00000111652	ENSG00000111652			16758	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7A"", ""COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)"""				Standard	NM_001164093		Approved	CSN7A	uc001qqh.3	Q9UBW8	OTTHUMG00000169182	ENST00000543155.1:c.229G>T	chr12.hg19:g.6837158G>T	ENSP00000438115:p.Asp77Tyr	44.0	0.0		59.0	28.0	NM_001164094	A8K9A6|Q9NVX3|Q9UJW4	Missense_Mutation	SNP	ENST00000543155.1	hg19	CCDS8558.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928297	0.92389	.	.	ENSG00000111652	ENST00000543155;ENST00000442593;ENST00000229251;ENST00000539735;ENST00000538410;ENST00000544725;ENST00000534947;ENST00000541866;ENST00000534877;ENST00000538753	T;T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51	5.88	5.88	0.94601	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.993;0.994	T	0.73241	-0.4045	10	0.87932	D	0	-11.7169	19.8373	0.96661	0.0:0.0:1.0:0.0	.	77;77	F5H248;Q9UBW8	.;CSN7A_HUMAN	Y	77	ENSP00000438115:D77Y;ENSP00000229251:D77Y;ENSP00000441852:D77Y;ENSP00000439547:D77Y;ENSP00000446039:D77Y;ENSP00000442613:D77Y;ENSP00000438363:D77Y;ENSP00000440683:D77Y	ENSP00000229251:D77Y	D	+	1	0	COPS7A	6707419	1.000000	0.71417	0.992000	0.48379	0.930000	0.56654	8.717000	0.91425	2.782000	0.95742	0.655000	0.94253	GAC	.	.		0.512	COPS7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402740.1		
METTL20	254013	hgsc.bcm.edu	37	12	31815050	31815050	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:31815050A>T	ENST00000357721.3	+	2	378	c.163A>T	c.(163-165)Act>Tct	p.T55S	METTL20_ENST00000412352.2_Missense_Mutation_p.T55S|METTL20_ENST00000395763.3_Missense_Mutation_p.T55S|METTL20_ENST00000538463.1_Missense_Mutation_p.T55S|METTL20_ENST00000538391.1_Missense_Mutation_p.T55S	NM_001135863.1	NP_001129335.1	Q8IXQ9	MET20_HUMAN	methyltransferase like 20	55						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			lung(2)|stomach(1)	3						GGAGGAGAACACTGAAGTCAC	0.552																																					p.T55S		Atlas-SNP	.											.	METTL20	23	.	0			c.A163T						.						99.0	97.0	97.0					12																	31815050		2203	4300	6503	SO:0001583	missense	254013	exon2			GAGAACACTGAAG	BC039535	CCDS8724.1	12p11.21	2011-03-03	2011-03-03	2011-03-03	ENSG00000139160	ENSG00000139160			28739	protein-coding gene	gene with protein product		615256	"""chromosome 12 open reading frame 72"""	C12orf72			Standard	NM_173802		Approved	DKFZp451L235, MGC50559	uc001rkm.3	Q8IXQ9		ENST00000357721.3:c.163A>T	chr12.hg19:g.31815050A>T	ENSP00000350353:p.Thr55Ser	102.0	0.0		120.0	52.0	NM_173802	D3DUW3	Missense_Mutation	SNP	ENST00000357721.3	hg19	CCDS8724.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.188525	0.78789	.	.	ENSG00000139160	ENST00000412352;ENST00000395763;ENST00000538463;ENST00000357721;ENST00000539633;ENST00000538391	.	.	.	4.5	2.12	0.27331	.	0.054522	0.64402	D	0.000001	T	0.75369	0.3840	M	0.85777	2.775	0.51012	D	0.999904	D	0.69078	0.997	D	0.67548	0.952	T	0.72782	-0.4189	9	0.56958	D	0.05	-14.2507	6.589	0.22636	0.6853:0.1611:0.0:0.1536	.	55	Q8IXQ9	MET20_HUMAN	S	55	.	ENSP00000350353:T55S	T	+	1	0	METTL20	31706317	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	6.281000	0.72632	0.257000	0.21650	0.459000	0.35465	ACT	.	.		0.552	METTL20-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402196.1	NM_173802	
KRT5	3852	hgsc.bcm.edu	37	12	52911408	52911408	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:52911408C>A	ENST00000252242.4	-	5	1448	c.1058G>T	c.(1057-1059)aGc>aTc	p.S353I		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	353	Coil 2.|Rod.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTCTGTCCGGCTGCGGTTGGC	0.562																																					p.S353I		Atlas-SNP	.											.	KRT5	88	.	0			c.G1058T						.						145.0	137.0	140.0					12																	52911408		2203	4300	6503	SO:0001583	missense	3852	exon5			GTCCGGCTGCGGT		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1058G>T	chr12.hg19:g.52911408C>A	ENSP00000252242:p.Ser353Ile	39.0	0.0		54.0	11.0	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	hg19	CCDS8830.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.725329|4.725329	0.89298|0.89298	.|.	.|.	ENSG00000186081|ENSG00000186081	ENST00000548409;ENST00000551188|ENST00000252242;ENST00000456000	.|T	.|0.80214	.|-1.35	6.03|6.03	6.03|6.03	0.97812|0.97812	.|Filament (1);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.94341|0.94341	0.8181|0.8181	H|H	0.98068|0.98068	4.14|4.14	0.52099|0.52099	D|D	0.999949|0.999949	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	D|D	0.95548|0.95548	0.8618|0.8618	5|10	.|0.87932	.|D	.|0	.|.	20.5666|20.5666	0.99351|0.99351	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|353	.|P13647	.|K2C5_HUMAN	H|I	60;167|353;318	.|ENSP00000252242:S353I	.|ENSP00000252242:S353I	Q|S	-|-	3|2	2|0	KRT5|KRT5	51197675|51197675	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.810000|0.810000	0.45777|0.45777	3.969000|3.969000	0.56816|0.56816	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	CAG|AGC	.	.		0.562	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
CTDSP2	10106	hgsc.bcm.edu	37	12	58217408	58217408	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:58217408G>T	ENST00000398073.2	-	8	1096	c.793C>A	c.(793-795)Ctt>Att	p.L265I	CTDSP2_ENST00000547701.1_Missense_Mutation_p.L113I|CTDSP2_ENST00000548823.1_Missense_Mutation_p.L92I|MIR26A2_ENST00000385054.1_RNA	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	265					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					AGCTGCCCAAGGCTGGTGTAG	0.587																																					p.L265I		Atlas-SNP	.											.	CTDSP2	25	.	0			c.C793A						.						31.0	37.0	35.0					12																	58217408		2134	4257	6391	SO:0001583	missense	10106	exon8			GCCCAAGGCTGGT	AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.793C>A	chr12.hg19:g.58217408G>T	ENSP00000381148:p.Leu265Ile	36.0	0.0		56.0	7.0	NM_005730	A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Missense_Mutation	SNP	ENST00000398073.2	hg19	CCDS41801.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516799	0.85495	.	.	ENSG00000175215	ENST00000398073;ENST00000548823;ENST00000549039;ENST00000547701	T;T	0.48201	1.22;0.82	5.26	5.26	0.73747	HAD-like domain (2);	0.059088	0.64402	D	0.000002	T	0.61924	0.2386	L	0.47716	1.5	0.58432	D	0.999999	B;P;P	0.48834	0.184;0.83;0.916	B;P;P	0.62184	0.376;0.646;0.899	T	0.62714	-0.6796	10	0.72032	D	0.01	-17.0957	17.7708	0.88491	0.0:0.0:1.0:0.0	.	139;92;265	B4DH48;F8W1I1;O14595	.;.;CTDS2_HUMAN	I	265;92;119;113	ENSP00000381148:L265I;ENSP00000448386:L119I	ENSP00000381148:L265I	L	-	1	0	CTDSP2	56503675	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.531000	0.73820	2.729000	0.93468	0.563000	0.77884	CTT	.	.		0.587	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409353.1	NM_005730	
KERA	11081	hgsc.bcm.edu	37	12	91450006	91450006	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:91450006A>G	ENST00000266719.3	-	2	300	c.53T>C	c.(52-54)gTg>gCg	p.V18A		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	18					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						TCTAGACCACACAGTGTCTGT	0.418																																					p.V18A		Atlas-SNP	.											.	KERA	62	.	0			c.T53C						.						85.0	67.0	73.0					12																	91450006		2202	4300	6502	SO:0001583	missense	11081	exon2			GACCACACAGTGT	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.53T>C	chr12.hg19:g.91450006A>G	ENSP00000266719:p.Val18Ala	59.0	0.0		82.0	5.0	NM_007035		Missense_Mutation	SNP	ENST00000266719.3	hg19	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	A	5.651	0.304812	0.10678	.	.	ENSG00000139330	ENST00000266719	T	0.55760	0.5	5.96	2.34	0.29019	.	0.517808	0.21546	N	0.072808	T	0.32071	0.0817	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18555	-1.0333	10	0.07644	T	0.81	-10.2314	10.317	0.43743	0.748:0.0:0.252:0.0	.	18	O60938	KERA_HUMAN	A	18	ENSP00000266719:V18A	ENSP00000266719:V18A	V	-	2	0	KERA	89974137	0.051000	0.20477	0.018000	0.16275	0.436000	0.31835	1.368000	0.34216	0.525000	0.28522	0.528000	0.53228	GTG	.	.		0.418	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035	
PRDM4	11108	hgsc.bcm.edu	37	12	108128174	108128174	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:108128174A>G	ENST00000228437.5	-	12	2678	c.2219T>C	c.(2218-2220)cTa>cCa	p.L740P	RP11-864J10.4_ENST00000546714.1_RNA|RP11-864J10.4_ENST00000546829.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	740					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						GTATTTGGTTAGATAAGCCTT	0.438																																					p.L740P		Atlas-SNP	.											.	PRDM4	64	.	0			c.T2219C						.						210.0	209.0	210.0					12																	108128174		2203	4300	6503	SO:0001583	missense	11108	exon12			TTGGTTAGATAAG	AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.2219T>C	chr12.hg19:g.108128174A>G	ENSP00000228437:p.Leu740Pro	147.0	0.0		171.0	75.0	NM_012406	Q9UFA6	Missense_Mutation	SNP	ENST00000228437.5	hg19	CCDS9115.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.714394	0.89112	.	.	ENSG00000110851	ENST00000228437	T	0.09163	3.01	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	N	0.25201	0.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.02553	-1.1142	10	0.41790	T	0.15	-0.3342	16.5602	0.84551	1.0:0.0:0.0:0.0	.	740	Q9UKN5	PRDM4_HUMAN	P	740	ENSP00000228437:L740P	ENSP00000228437:L740P	L	-	2	0	PRDM4	106652304	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.095000	0.94175	2.313000	0.78055	0.454000	0.30748	CTA	.	.		0.438	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1	NM_012406	
CCDC63	160762	hgsc.bcm.edu	37	12	111345151	111345151	+	Missense_Mutation	SNP	C	C	A	rs371014584		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:111345151C>A	ENST00000308208.5	+	12	1805	c.1563C>A	c.(1561-1563)gaC>gaA	p.D521E	CCDC63_ENST00000545036.1_Missense_Mutation_p.D481E|CCDC63_ENST00000552694.1_Missense_Mutation_p.D442E	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	521										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						AGCCCCTGGACCACAGCAGCC	0.562																																					p.D521E		Atlas-SNP	.											.	CCDC63	89	.	0			c.C1563A						.						48.0	44.0	45.0					12																	111345151		2203	4300	6503	SO:0001583	missense	160762	exon12			CCTGGACCACAGC	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1563C>A	chr12.hg19:g.111345151C>A	ENSP00000312399:p.Asp521Glu	40.0	0.0		49.0	21.0	NM_152591	B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	hg19	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	C	6.864	0.528684	0.13127	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.32753	1.44;1.44;1.44	4.01	2.12	0.27331	.	0.449706	0.24296	N	0.039770	T	0.30386	0.0763	M	0.76574	2.34	0.25134	N	0.990546	B	0.16603	0.018	B	0.19946	0.027	T	0.26849	-1.0091	10	0.48119	T	0.1	.	6.167	0.20396	0.0:0.7095:0.1847:0.1058	.	521	Q8NA47	CCD63_HUMAN	E	481;521;442	ENSP00000445881:D481E;ENSP00000312399:D521E;ENSP00000450217:D442E	ENSP00000312399:D521E	D	+	3	2	CCDC63	109829534	1.000000	0.71417	0.999000	0.59377	0.124000	0.20399	0.960000	0.29253	0.421000	0.25980	-0.415000	0.06103	GAC	.	.		0.562	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
MICU2	221154	hgsc.bcm.edu	37	13	22069447	22069447	+	Silent	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:22069447C>T	ENST00000382374.4	-	11	1118	c.1053G>A	c.(1051-1053)aaG>aaA	p.K351K	MICU2_ENST00000479790.1_5'UTR	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	351					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TCACAGCTCTCTTAAACTCCG	0.308																																					p.K351K		Atlas-SNP	.											.	EFHA1	33	.	0			c.G1053A						.						87.0	74.0	79.0					13																	22069447		2202	4300	6502	SO:0001819	synonymous_variant	221154	exon11			AGCTCTCTTAAAC	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.1053G>A	chr13.hg19:g.22069447C>T		89.0	0.0		90.0	24.0	NM_152726	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	hg19	CCDS9297.1																																																																																			.	.		0.308	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
FLT1	2321	hgsc.bcm.edu	37	13	28963914	28963914	+	Intron	SNP	T	T	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:28963914T>G	ENST00000282397.4	-	13	2221				FLT1_ENST00000541932.1_Intron	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1						blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAAAACAGCCTTTTTGTTGCA	0.388																																					p.K663T		Atlas-SNP	.											.	FLT1	393	.	0			c.A1988C						.						119.0	112.0	114.0					13																	28963914		2203	4300	6503	SO:0001627	intron_variant	2321	exon13			ACAGCCTTTTTGT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1969+18A>C	chr13.hg19:g.28963914T>G		45.0	0.0		48.0	33.0	NM_001159920	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	hg19	CCDS9330.1																																																																																			.	.		0.388	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
UBL3	5412	hgsc.bcm.edu	37	13	30341820	30341820	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:30341820G>A	ENST00000380680.4	-	4	1381	c.236C>T	c.(235-237)cCt>cTt	p.P79L		NM_007106.3	NP_009037.1	O95164	UBL3_HUMAN	ubiquitin-like 3	79	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				large_intestine(3)|lung(1)	4		Lung SC(185;0.0281)		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)		TTTGCCAAAAGGAAGTTTTAA	0.353																																					p.P79L		Atlas-SNP	.											.,1	UBL3	13	.	0			c.C236T						.						133.0	114.0	120.0					13																	30341820		2203	4300	6503	SO:0001583	missense	5412	exon4			CCAAAAGGAAGTT	AF044221	CCDS9334.1	13q12-q13	2008-07-18			ENSG00000122042	ENSG00000122042			12504	protein-coding gene	gene with protein product		604711		PNSC1		10375635	Standard	NM_007106		Approved	HCG-1, DKFZP434K151, FLJ32018	uc001usp.3	O95164	OTTHUMG00000016661	ENST00000380680.4:c.236C>T	chr13.hg19:g.30341820G>A	ENSP00000370055:p.Pro79Leu	84.0	0.0		70.0	4.0	NM_007106	B2R4J1|Q5RL72|Q5VZS0|Q6FIG8|Q96SG7	Missense_Mutation	SNP	ENST00000380680.4	hg19	CCDS9334.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873674	0.91664	.	.	ENSG00000122042	ENST00000380680	.	.	.	5.74	4.9	0.64082	Ubiquitin supergroup (1);	0.047648	0.85682	N	0.000000	T	0.77025	0.4070	M	0.84511	2.7	0.80722	D	1	D	0.64830	0.994	P	0.57152	0.814	T	0.81335	-0.0979	9	0.62326	D	0.03	-15.6777	14.055	0.64761	0.0724:0.0:0.9276:0.0	.	79	O95164	UBL3_HUMAN	L	79	.	ENSP00000370055:P79L	P	-	2	0	UBL3	29239820	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.040000	0.93783	1.557000	0.49525	0.563000	0.77884	CCT	.	.		0.353	UBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044342.1	NM_007106	
CCNA1	8900	hgsc.bcm.edu	37	13	37007255	37007255	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:37007255C>G	ENST00000255465.4	+	2	458	c.194C>G	c.(193-195)gCt>gGt	p.A65G	CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000418263.1_Missense_Mutation_p.A64G|CCNA1_ENST00000449823.1_Missense_Mutation_p.A21G|CCNA1_ENST00000440264.1_Missense_Mutation_p.A21G			P78396	CCNA1_HUMAN	cyclin A1	65					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		GGTCCCGATGCTTGTCAGATA	0.607																																					p.A65G		Atlas-SNP	.											.	CCNA1	91	.	0			c.C194G						.						92.0	89.0	90.0					13																	37007255		2203	4300	6503	SO:0001583	missense	8900	exon2			CCGATGCTTGTCA	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.194C>G	chr13.hg19:g.37007255C>G	ENSP00000255465:p.Ala65Gly	78.0	0.0		43.0	31.0	NM_003914	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	hg19	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488805	0.44249	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.16073	2.42;2.42;2.37;2.37	4.63	1.35	0.21983	.	1.361570	0.04561	N	0.391654	T	0.13586	0.0329	L	0.36672	1.1	0.25042	N	0.991199	B;B	0.27559	0.001;0.181	B;B	0.26969	0.003;0.075	T	0.32295	-0.9912	10	0.22706	T	0.39	.	5.1207	0.14858	0.0:0.5876:0.1704:0.2419	.	64;65	P78396-2;P78396	.;CCNA1_HUMAN	G	21;21;64;65	ENSP00000400666:A21G;ENSP00000409873:A21G;ENSP00000396479:A64G;ENSP00000255465:A65G	ENSP00000255465:A65G	A	+	2	0	CCNA1	35905255	0.534000	0.26362	0.873000	0.34254	0.925000	0.55904	-0.161000	0.10026	0.477000	0.27464	-0.263000	0.10527	GCT	.	.		0.607	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	NM_003914	
CSNK1A1L	122011	hgsc.bcm.edu	37	13	37679379	37679379	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:37679379G>T	ENST00000379800.3	-	1	424	c.15C>A	c.(13-15)agC>agA	p.S5R		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	5			S -> G (in dbSNP:rs56224973). {ECO:0000269|PubMed:17344846}.		cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S5S(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		CTTTGGAGCCGCTGTTGTTTG	0.607																																					p.S5R		Atlas-SNP	.											CSNK1A1L,colon,carcinoma,0,2	CSNK1A1L	69	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C15A						.						76.0	73.0	74.0					13																	37679379		2203	4300	6503	SO:0001583	missense	122011	exon1			GGAGCCGCTGTTG	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.15C>A	chr13.hg19:g.37679379G>T	ENSP00000369126:p.Ser5Arg	80.0	0.0		64.0	43.0	NM_145203	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	hg19	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	G	7.439	0.640261	0.14386	.	.	ENSG00000180138	ENST00000379800	T	0.51071	0.72	0.778	-0.148	0.13424	.	0.088116	0.85682	D	0.000000	T	0.27663	0.0680	N	0.19112	0.55	0.27953	N	0.93707	P	0.38677	0.642	B	0.39935	0.314	T	0.13202	-1.0518	10	0.42905	T	0.14	.	4.9918	0.14218	0.248:0.0:0.752:0.0	.	5	Q8N752	KC1AL_HUMAN	R	5	ENSP00000369126:S5R	ENSP00000369126:S5R	S	-	3	2	CSNK1A1L	36577379	1.000000	0.71417	0.009000	0.14445	0.009000	0.06853	0.727000	0.25999	-0.112000	0.11979	-0.258000	0.10820	AGC	.	.		0.607	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
EDNRB	1910	hgsc.bcm.edu	37	13	78475302	78475302	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:78475302T>C	ENST00000334286.5	-	4	1078	c.842A>G	c.(841-843)tAt>tGt	p.Y281C	EDNRB_ENST00000446573.1_Missense_Mutation_p.Y281C|EDNRB_ENST00000377211.4_Missense_Mutation_p.Y371C	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	281					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CAAGCAGAAATAGAAACTGAA	0.338																																					p.Y371C		Atlas-SNP	.											.	EDNRB	172	.	0			c.A1112G						.						74.0	77.0	76.0					13																	78475302		2203	4299	6502	SO:0001583	missense	1910	exon5			CAGAAATAGAAAC	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.842A>G	chr13.hg19:g.78475302T>C	ENSP00000335311:p.Tyr281Cys	54.0	0.0		97.0	43.0	NM_001201397	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	hg19	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.401948	0.83120	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.71817	-0.6;-0.6;-0.6	5.69	5.69	0.88448	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85318	0.5669	M	0.83852	2.665	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.97;0.999	D	0.87582	0.2485	10	0.87932	D	0	-3.7268	15.9518	0.79846	0.0:0.0:0.0:1.0	.	281;371;281	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	C	371;281;281	ENSP00000366416:Y371C;ENSP00000403401:Y281C;ENSP00000335311:Y281C	ENSP00000335311:Y281C	Y	-	2	0	EDNRB	77373303	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.180000	0.69256	0.533000	0.62120	TAT	.	.		0.338	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
MYH7	4625	hgsc.bcm.edu	37	14	23895186	23895186	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr14:23895186C>A	ENST00000355349.3	-	19	2311	c.2149G>T	c.(2149-2151)Gac>Tac	p.D717Y		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	717	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGCCGGAAGTCCCCGTAGAGG	0.607																																					p.D717Y		Atlas-SNP	.											.	MYH7	349	.	0			c.G2149T						.						59.0	59.0	59.0					14																	23895186		2203	4300	6503	SO:0001583	missense	4625	exon19			GGAAGTCCCCGTA	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2149G>T	chr14.hg19:g.23895186C>A	ENSP00000347507:p.Asp717Tyr	66.0	0.0		89.0	32.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761038	0.89932	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.95622	-3.76	5.03	5.03	0.67393	Myosin head, motor domain (2);	.	.	.	.	D	0.98592	0.9529	H	0.98178	4.165	0.80722	D	1	P	0.46395	0.877	P	0.60173	0.87	D	0.99593	1.0976	9	0.87932	D	0	.	18.5432	0.91037	0.0:1.0:0.0:0.0	.	717	P12883	MYH7_HUMAN	Y	717	ENSP00000347507:D717Y	ENSP00000347507:D717Y	D	-	1	0	MYH7	22965026	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.399000	0.79935	2.612000	0.88384	0.655000	0.94253	GAC	.	.		0.607	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68256275	68256275	+	Silent	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr14:68256275C>T	ENST00000347230.4	-	16	2934	c.2796G>A	c.(2794-2796)ctG>ctA	p.L932L	ZFYVE26_ENST00000555452.1_Silent_p.L932L	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	932					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGGTGTTGAGCAGCTTGTCAG	0.502																																					p.L932L		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.G2796A						.						120.0	124.0	123.0					14																	68256275		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon16			GTTGAGCAGCTTG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2796G>A	chr14.hg19:g.68256275C>T		51.0	0.0		48.0	36.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	hg19	CCDS9788.1																																																																																			.	.		0.502	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZFP36L1	677	hgsc.bcm.edu	37	14	69256756	69256756	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr14:69256756G>A	ENST00000439696.2	-	2	812	c.511C>T	c.(511-513)Ccc>Tcc	p.P171S	ZFP36L1_ENST00000336440.3_Missense_Mutation_p.P171S|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	171					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGCAGCGGGGCCCGTAGGGG	0.672											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P240S		Atlas-SNP	.											.	ZFP36L1	47	.	0			c.C718T						.						34.0	41.0	39.0					14																	69256756		2203	4298	6501	SO:0001583	missense	677	exon3			AGCGGGGCCCGTA	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.511C>T	chr14.hg19:g.69256756G>A	ENSP00000388402:p.Pro171Ser	60.0	0.0	1113	35.0	23.0	NM_001244701	Q13851	Missense_Mutation	SNP	ENST00000439696.2	hg19	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166230	0.57476	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246;ENST00000557086;ENST00000557022	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	4.5	2.53	0.30540	Zinc finger, CCCH-type (3);	0.137414	0.48286	D	0.000193	T	0.44371	0.1290	N	0.16567	0.415	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.36625	-0.9740	10	0.42905	T	0.14	0.7599	11.067	0.47980	0.0:0.1389:0.7169:0.1442	.	171	Q07352	TISB_HUMAN	S	171;171;154;177;149	ENSP00000388402:P171S;ENSP00000337386:P171S;ENSP00000450784:P177S;ENSP00000450600:P149S	ENSP00000337386:P171S	P	-	1	0	ZFP36L1	68326509	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.735000	0.84939	1.086000	0.41228	0.585000	0.79938	CCC	.	.		0.672	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1		
FURIN	5045	hgsc.bcm.edu	37	15	91424928	91424928	+	Silent	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr15:91424928C>T	ENST00000268171.3	+	16	2484	c.2205C>T	c.(2203-2205)gtC>gtT	p.V735V	FES_ENST00000414248.2_5'Flank|FES_ENST00000328850.3_5'Flank|FES_ENST00000394302.1_5'Flank	NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	735					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TCTTCCTGGTCCTGCAGCTGC	0.642																																					p.V735V		Atlas-SNP	.											.	FURIN	85	.	0			c.C2205T						.						142.0	126.0	131.0					15																	91424928		2198	4298	6496	SO:0001819	synonymous_variant	5045	exon16			CCTGGTCCTGCAG	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.2205C>T	chr15.hg19:g.91424928C>T		110.0	0.0		139.0	61.0	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Silent	SNP	ENST00000268171.3	hg19	CCDS10364.1																																																																																			.	.		0.642	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29889696	29889696	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr16:29889696C>A	ENST00000308713.5	-	10	2151	c.1624G>T	c.(1624-1626)Gac>Tac	p.D542Y	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.D472Y|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.D428Y|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.D498Y	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	542	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGGGCCAGTCGGGAGAGAGG	0.597																																					p.D542Y		Atlas-SNP	.											.	SEZ6L2	137	.	0			c.G1624T						.						84.0	72.0	76.0					16																	29889696		2197	4300	6497	SO:0001583	missense	26470	exon10			GCCAGTCGGGAGA	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1624G>T	chr16.hg19:g.29889696C>A	ENSP00000312550:p.Asp542Tyr	37.0	0.0		58.0	49.0	NM_001243332	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	hg19	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547122	0.86022	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.42	5.42	0.78866	CUB (5);	0.000000	0.64402	D	0.000019	T	0.53045	0.1772	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.987;1.0;1.0;1.0;1.0;1.0	T	0.53837	-0.8382	10	0.87932	D	0	.	17.99	0.89165	0.0:1.0:0.0:0.0	.	498;542;428;472;542;472	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	Y	472;542;428;498	ENSP00000310206:D472Y;ENSP00000312550:D542Y;ENSP00000319215:D428Y;ENSP00000439412:D498Y	ENSP00000312550:D542Y	D	-	1	0	SEZ6L2	29797197	0.998000	0.40836	0.945000	0.38365	0.970000	0.65996	3.758000	0.55220	2.547000	0.85894	0.655000	0.94253	GAC	.	.		0.597	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
SRCAP	10847	hgsc.bcm.edu	37	16	30735749	30735749	+	Silent	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr16:30735749T>C	ENST00000262518.4	+	25	5389	c.5004T>C	c.(5002-5004)gtT>gtC	p.V1668V	SRCAP_ENST00000344771.4_Silent_p.V1510V|SRCAP_ENST00000395059.2_Silent_p.V1606V	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1668	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CAGCCCCGGTTCCGTCACCTC	0.572																																					p.V1668V		Atlas-SNP	.											.	SRCAP	298	.	0			c.T5004C						.						144.0	150.0	148.0					16																	30735749		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon25			CCCGGTTCCGTCA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5004T>C	chr16.hg19:g.30735749T>C		97.0	0.0		74.0	57.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.		0.572	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SETD1A	9739	hgsc.bcm.edu	37	16	30990708	30990708	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr16:30990708C>T	ENST00000262519.8	+	14	4287	c.3601C>T	c.(3601-3603)Cgg>Tgg	p.R1201W		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1201					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CAAGGCTCCCCGGGGCGTGGA	0.711																																					p.R1201W		Atlas-SNP	.											.	SETD1A	143	.	0			c.C3601T						.						12.0	14.0	14.0					16																	30990708		2173	4261	6434	SO:0001583	missense	9739	exon14			GCTCCCCGGGGCG	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3601C>T	chr16.hg19:g.30990708C>T	ENSP00000262519:p.Arg1201Trp	103.0	0.0		115.0	86.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	hg19	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.283251	0.23392	.	.	ENSG00000099381	ENST00000262519	D	0.94723	-3.5	5.03	5.03	0.67393	.	0.258265	0.32068	N	0.006625	D	0.93025	0.7780	L	0.27053	0.805	0.39959	D	0.974631	D	0.76494	0.999	P	0.56474	0.799	D	0.93675	0.6993	10	0.72032	D	0.01	.	11.0517	0.47894	0.1854:0.8146:0.0:0.0	.	1201	O15047	SET1A_HUMAN	W	1201	ENSP00000262519:R1201W	ENSP00000262519:R1201W	R	+	1	2	SETD1A	30898209	0.652000	0.27349	0.991000	0.47740	0.357000	0.29423	0.629000	0.24538	2.328000	0.79073	0.557000	0.71058	CGG	.	.		0.711	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
PHKB	5257	hgsc.bcm.edu	37	16	47497889	47497889	+	Intron	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr16:47497889G>A	ENST00000323584.5	+	1	100				PHKB_ENST00000455779.1_Missense_Mutation_p.A14T|PHKB_ENST00000567402.1_Intron|PHKB_ENST00000299167.8_Intron|ITFG1_ENST00000320640.6_5'Flank|ITFG1_ENST00000544001.2_5'Flank|PHKB_ENST00000566044.1_Missense_Mutation_p.A14T	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.A14T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TCCGTCTTCCGCTTTCTTAAG	0.398																																					p.A14T		Atlas-SNP	.											PHKB_ENST00000299167,NS,carcinoma,0,1	PHKB	298	.	1	Substitution - Missense(1)	endometrium(1)	c.G40A						.						137.0	130.0	132.0					16																	47497889		1855	4092	5947	SO:0001627	intron_variant	5257	exon2			TCTTCCGCTTTCT		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.76+2552G>A	chr16.hg19:g.47497889G>A		73.0	0.0		78.0	23.0	NM_001031835	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	hg19	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	1.407	-0.576672	0.03854	.	.	ENSG00000102893	ENST00000299167;ENST00000455779	D	0.90788	-2.73	5.65	1.33	0.21861	.	.	.	.	.	T	0.76751	0.4031	N	0.08118	0	0.18873	N	0.999982	B;B	0.10296	0.002;0.003	B;B	0.06405	0.0;0.002	T	0.59994	-0.7349	9	0.13108	T	0.6	.	7.4646	0.27314	0.2533:0.0:0.6364:0.1103	.	14;14	B4DQ16;Q93100-4	.;.	T	14	ENSP00000414345:A14T	ENSP00000299167:A14T	A	+	1	0	PHKB	46055390	0.888000	0.30383	0.144000	0.22314	0.050000	0.14768	1.209000	0.32357	0.074000	0.16767	-1.128000	0.01989	GCT	.	.		0.398	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
USP10	9100	hgsc.bcm.edu	37	16	84779047	84779047	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr16:84779047A>G	ENST00000219473.7	+	4	1073	c.960A>G	c.(958-960)gcA>gcG	p.A320A	USP10_ENST00000570191.1_Silent_p.A324A	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	320					autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						CCGAGAGTGCATCACCTCCTG	0.572																																					p.A324A		Atlas-SNP	.											.	USP10	51	.	0			c.A972G						.						40.0	41.0	41.0					16																	84779047		1977	4161	6138	SO:0001819	synonymous_variant	9100	exon5			GAGTGCATCACCT	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.960A>G	chr16.hg19:g.84779047A>G		100.0	0.0		63.0	46.0	NM_001272075	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Silent	SNP	ENST00000219473.7	hg19	CCDS45537.1																																																																																			.	.		0.572	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
TP53	7157	hgsc.bcm.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.Y205C|TP53_ENST00000413465.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000455263.2_Missense_Mutation_p.Y205C|TP53_ENST00000420246.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y205C	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,temporoparietal,glioma,0,24	TP53	33396	.	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)	c.A614G						.						136.0	121.0	126.0					17																	7578235		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TCCAAATACTCCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	chr17.hg19:g.7578235T>C	ENSP00000269305:p.Tyr205Cys	139.0	0.0		101.0	70.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT	.	.		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH9	1770	hgsc.bcm.edu	37	17	11593003	11593003	+	Silent	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr17:11593003C>T	ENST00000262442.4	+	20	3932	c.3864C>T	c.(3862-3864)gaC>gaT	p.D1288D	DNAH9_ENST00000454412.2_Silent_p.D1288D	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1288	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ATGTCCCTGACTATAAGCAGC	0.527																																					p.D1288D		Atlas-SNP	.											.	DNAH9	695	.	0			c.C3864T						.						113.0	105.0	107.0					17																	11593003		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon20			CCCTGACTATAAG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3864C>T	chr17.hg19:g.11593003C>T		91.0	0.0		66.0	56.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	hg19	CCDS11160.1																																																																																			.	.		0.527	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
GRN	2896	hgsc.bcm.edu	37	17	42427830	42427830	+	Silent	SNP	G	G	A	rs373703310		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr17:42427830G>A	ENST00000053867.3	+	6	545	c.483G>A	c.(481-483)agG>agA	p.R161R	GRN_ENST00000589265.1_Intron	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	161					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GTGAAGACAGGGTGCACTGCT	0.632											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R161R		Atlas-SNP	.											.	GRN	51	.	0			c.G483A						.	G		0,4406		0,0,2203	119.0	114.0	116.0		483	0.0	1.0	17		116	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GRN	NM_002087.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		161/594	42427830	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2896	exon6			AGACAGGGTGCAC	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.483G>A	chr17.hg19:g.42427830G>A		50.0	0.0	908	52.0	16.0	NM_002087	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Silent	SNP	ENST00000053867.3	hg19	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	G	7.956	0.745896	0.15710	0.0	1.16E-4	ENSG00000030582	ENST00000393566	.	.	.	4.43	0.0146	0.14101	.	.	.	.	.	T	0.23766	0.0575	.	.	.	0.20074	N	0.999937	.	.	.	.	.	.	T	0.24799	-1.0150	5	0.30854	T	0.27	-15.0016	3.7331	0.08500	0.3986:0.0:0.4352:0.1662	.	.	.	.	E	68	.	ENSP00000377196:G68E	G	+	2	0	GRN	39783356	0.000000	0.05858	0.997000	0.53966	0.760000	0.43138	-0.716000	0.04991	0.127000	0.18452	0.462000	0.41574	GGG	.	.		0.632	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087	
SMCHD1	23347	hgsc.bcm.edu	37	18	2763754	2763754	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr18:2763754A>G	ENST00000320876.6	+	37	5024	c.4686A>G	c.(4684-4686)gaA>gaG	p.E1562E	SMCHD1_ENST00000261598.8_Silent_p.E1562E|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1562					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GAACACTTGAATTCCCCTTCG	0.343																																					p.E1562E		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A4686G						.						108.0	103.0	105.0					18																	2763754		1821	4076	5897	SO:0001819	synonymous_variant	23347	exon37			ACTTGAATTCCCC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4686A>G	chr18.hg19:g.2763754A>G		128.0	0.0		148.0	58.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	ENST00000320876.6	hg19	CCDS45822.1																																																																																			.	.		0.343	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
TCEB3B	51224	hgsc.bcm.edu	37	18	44560876	44560876	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr18:44560876A>G	ENST00000332567.4	-	1	1112	c.760T>C	c.(760-762)Tgc>Cgc	p.C254R	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	254			C -> F (in dbSNP:rs2010834). {ECO:0000269|PubMed:10692460}.		regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CAGGCCCCGCATGATTTCTCC	0.582																																					p.C254R		Atlas-SNP	.											.	TCEB3B	141	.	0			c.T760C						.						48.0	51.0	50.0					18																	44560876		2203	4300	6503	SO:0001583	missense	51224	exon1			CCCCGCATGATTT	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.760T>C	chr18.hg19:g.44560876A>G	ENSP00000331302:p.Cys254Arg	56.0	0.0		66.0	26.0	NM_016427	Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	hg19	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	A	0.189	-1.055028	0.01965	.	.	ENSG00000206181	ENST00000332567	T	0.06068	3.35	1.52	-1.6	0.08426	.	2.949720	0.01911	U	0.039898	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.21753	0.06	B	0.15870	0.014	T	0.34329	-0.9833	10	0.12103	T	0.63	.	2.4514	0.04519	0.3098:0.2945:0.3958:0.0	.	254	Q8IYF1	ELOA2_HUMAN	R	254	ENSP00000331302:C254R	ENSP00000331302:C254R	C	-	1	0	TCEB3B	42814874	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.375000	0.20518	-0.434000	0.07275	0.379000	0.24179	TGC	.	.		0.582	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
GPR108	56927	hgsc.bcm.edu	37	19	6730371	6730371	+	Silent	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:6730371T>C	ENST00000264080.7	-	18	1610	c.1584A>G	c.(1582-1584)gaA>gaG	p.E528E	GPR108_ENST00000598626.1_5'UTR|GPR108_ENST00000430424.4_Silent_p.E286E	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	528						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						TGGAGAGGCCTTCCCGGAACC	0.602																																					p.E528E		Atlas-SNP	.											.	GPR108	35	.	0			c.A1584G						.						151.0	162.0	158.0					19																	6730371		2030	4195	6225	SO:0001819	synonymous_variant	56927	exon18			GAGGCCTTCCCGG		CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.1584A>G	chr19.hg19:g.6730371T>C		96.0	0.0		121.0	42.0	NM_001080452	B9EJD7	Silent	SNP	ENST00000264080.7	hg19	CCDS42479.1																																																																																			.	.		0.602	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407508.2		
SIN3B	23309	hgsc.bcm.edu	37	19	16988394	16988394	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:16988394G>C	ENST00000248054.5	+	17	2919	c.2898G>C	c.(2896-2898)gaG>gaC	p.E966D	SIN3B_ENST00000594235.1_3'UTR|SIN3B_ENST00000379803.1_Missense_Mutation_p.E998D|SIN3B_ENST00000595541.1_Missense_Mutation_p.E556D					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TGGGGACCGAGGGCGCGTCCA	0.617																																					p.E998D		Atlas-SNP	.											.	SIN3B	90	.	0			c.G2994C						.						83.0	65.0	71.0					19																	16988394		2201	4300	6501	SO:0001583	missense	23309	exon18			GACCGAGGGCGCG	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.2898G>C	chr19.hg19:g.16988394G>C	ENSP00000248054:p.Glu966Asp	43.0	0.0		48.0	18.0	NM_015260		Missense_Mutation	SNP	ENST00000248054.5	hg19		.	.	.	.	.	.	.	.	.	.	G	1.423	-0.572400	0.03882	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.46819	0.86;0.86	4.55	3.51	0.40186	.	0.000000	0.85682	D	0.000000	T	0.20700	0.0498	N	0.11427	0.14	0.44619	D	0.997595	B;B;B	0.15141	0.012;0.001;0.004	B;B;B	0.12837	0.007;0.008;0.005	T	0.11767	-1.0574	10	0.11794	T	0.64	-39.5633	3.3092	0.07011	0.1841:0.0:0.5823:0.2337	.	556;966;998	B7Z392;O75182-2;O75182	.;.;SIN3B_HUMAN	D	998;966	ENSP00000369131:E998D;ENSP00000248054:E966D	ENSP00000248054:E966D	E	+	3	2	SIN3B	16849394	1.000000	0.71417	0.973000	0.42090	0.194000	0.23727	2.755000	0.47540	2.082000	0.62665	0.555000	0.69702	GAG	.	.		0.617	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
ANKLE1	126549	hgsc.bcm.edu	37	19	17396553	17396553	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:17396553G>T	ENST00000394458.3	+	8	1876	c.1600G>T	c.(1600-1602)Gtg>Ttg	p.V534L	ANKLE1_ENST00000404085.1_Missense_Mutation_p.V530L|ANKLE1_ENST00000594072.1_Missense_Mutation_p.V497L|ANKLE1_ENST00000433424.2_3'UTR|ANKLE1_ENST00000598347.1_Intron	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	534	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						TTGCGGTGTTGTGTCCCTACA	0.592																																					p.V534L		Atlas-SNP	.											.	ANKLE1	27	.	0			c.G1600T						.						141.0	113.0	122.0					19																	17396553		2203	4300	6503	SO:0001583	missense	126549	exon8			GGTGTTGTGTCCC	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1600G>T	chr19.hg19:g.17396553G>T	ENSP00000377971:p.Val534Leu	69.0	0.0		81.0	28.0	NM_152363	A8VU82|Q8N8J8	Missense_Mutation	SNP	ENST00000394458.3	hg19	CCDS12354.2	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076689	0.36662	.	.	ENSG00000160117	ENST00000404261;ENST00000404085;ENST00000394458	T;T	0.73152	-0.72;-0.5	5.19	0.584	0.17422	.	0.359954	0.24904	N	0.034675	T	0.66509	0.2796	L	0.58428	1.81	0.80722	D	1	P;P;P	0.52170	0.951;0.802;0.802	P;B;B	0.46796	0.527;0.236;0.236	T	0.64188	-0.6466	10	0.66056	D	0.02	-21.2453	7.7732	0.29021	0.4474:0.0:0.5526:0.0	.	494;534;497	Q8NAG6-1;Q8NAG6;A0JLW0	.;ANKL1_HUMAN;.	L	534;530;497	ENSP00000384008:V530L;ENSP00000377971:V497L	ENSP00000377971:V497L	V	+	1	0	ANKLE1	17257553	0.027000	0.19231	0.048000	0.18961	0.237000	0.25408	0.243000	0.18106	-0.035000	0.13691	-0.339000	0.08088	GTG	.	.		0.592	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
FXYD1	5348	hgsc.bcm.edu	37	19	35632088	35632088	+	Silent	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:35632088C>T	ENST00000588081.1	+	3	205	c.147C>T	c.(145-147)atC>atT	p.I49I	FXYD1_ENST00000588715.1_Silent_p.I49I|FXYD7_ENST00000588265.1_5'Flank|FXYD7_ENST00000270310.2_5'Flank|CTD-2527I21.4_ENST00000592174.1_RNA|LGI4_ENST00000493050.1_Intron|FXYD1_ENST00000589209.1_Silent_p.I49I|FXYD1_ENST00000351325.4_Silent_p.I49I|FXYD1_ENST00000588607.1_Silent_p.I49I|FXYD7_ENST00000586063.1_5'Flank|FXYD1_ENST00000455515.2_Silent_p.I49I			O00168	PLM_HUMAN	FXYD domain containing ion transport regulator 1	49					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|positive regulation of sodium ion export from cell (GO:1903278)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of heart contraction (GO:0008016)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)	chloride channel activity (GO:0005254)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)			lung(3)	3	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;2.32e-21)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;2.43e-18)|LUSC - Lung squamous cell carcinoma(66;0.0849)			TCCTCTTCATCCTGGGCATCC	0.662																																					p.I49I		Atlas-SNP	.											.	FXYD1	6	.	0			c.C147T						.						100.0	74.0	83.0					19																	35632088		2203	4300	6503	SO:0001819	synonymous_variant	5348	exon4			CTTCATCCTGGGC		CCDS12445.1	19q13.1	2008-08-01	2008-08-01			ENSG00000266964			4025	protein-coding gene	gene with protein product		602359	"""phospholemman"""	PLM		9169143	Standard	NM_005031		Approved		uc002nyc.3	O00168		ENST00000588081.1:c.147C>T	chr19.hg19:g.35632088C>T		30.0	0.0		37.0	10.0	NM_005031	A8K196	Silent	SNP	ENST00000588081.1	hg19	CCDS12445.1																																																																																			.	.		0.662	FXYD1-007	KNOWN	alternative_3_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460761.1	NM_021902	
LRFN1	57622	hgsc.bcm.edu	37	19	39798880	39798880	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:39798880A>T	ENST00000248668.4	-	2	1708	c.1709T>A	c.(1708-1710)gTc>gAc	p.V570D		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	570						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GGAGCCCTTGACGCGGCGGCT	0.687																																					p.V570D		Atlas-SNP	.											.	LRFN1	59	.	0			c.T1709A						.						18.0	24.0	22.0					19																	39798880		2131	4243	6374	SO:0001583	missense	57622	exon2			CCCTTGACGCGGC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1709T>A	chr19.hg19:g.39798880A>T	ENSP00000248668:p.Val570Asp	96.0	0.0		123.0	53.0	NM_020862	Q8TBS9	Missense_Mutation	SNP	ENST00000248668.4	hg19	CCDS46071.1	.	.	.	.	.	.	.	.	.	.	A	3.009	-0.204323	0.06180	.	.	ENSG00000128011	ENST00000248668	T	0.61627	0.09	4.17	-3.59	0.04583	.	1.375180	0.05524	N	0.562529	T	0.29028	0.0721	N	0.08118	0	0.20196	N	0.999928	P	0.47841	0.901	B	0.42188	0.379	T	0.13899	-1.0492	10	0.15066	T	0.55	.	1.5832	0.02638	0.2134:0.2824:0.349:0.1552	.	570	Q9P244	LRFN1_HUMAN	D	570	ENSP00000248668:V570D	ENSP00000248668:V570D	V	-	2	0	LRFN1	44490720	0.115000	0.22152	0.073000	0.20177	0.073000	0.16967	0.347000	0.20014	-0.496000	0.06650	-0.464000	0.05259	GTC	.	.		0.687	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862	
SPTBN4	57731	hgsc.bcm.edu	37	19	41026029	41026029	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:41026029C>T	ENST00000352632.3	+	16	3711	c.3625C>T	c.(3625-3627)Cgc>Tgc	p.R1209C	SPTBN4_ENST00000598249.1_Missense_Mutation_p.R1209C|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R1209C|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R1209C|SPTBN4_ENST00000344104.3_Missense_Mutation_p.R1209C			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1209					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGGGATCTACGCCAGGCGCT	0.647																																					p.R1209C		Atlas-SNP	.											.	SPTBN4	213	.	0			c.C3625T						.						11.0	13.0	12.0					19																	41026029		2147	4201	6348	SO:0001583	missense	57731	exon16			GATCTACGCCAGG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3625C>T	chr19.hg19:g.41026029C>T	ENSP00000263373:p.Arg1209Cys	36.0	0.0		38.0	14.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910051	0.52439	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.76448	-1.02;1.26;1.26	3.89	2.61	0.31194	.	0.228526	0.30185	N	0.010215	T	0.73674	0.3617	L	0.52573	1.65	0.80722	D	1	D;B	0.76494	0.999;0.009	P;B	0.51657	0.676;0.001	T	0.70525	-0.4848	10	0.54805	T	0.06	.	2.9946	0.05994	0.3706:0.4418:0.0:0.1876	.	1209;1209	Q9H254;Q71S06	SPTN4_HUMAN;.	C	1209	ENSP00000263373:R1209C;ENSP00000340345:R1209C;ENSP00000340741:R1209C	ENSP00000340345:R1209C	R	+	1	0	SPTBN4	45717869	0.000000	0.05858	0.589000	0.28718	0.727000	0.41649	-0.582000	0.05814	0.487000	0.27698	0.462000	0.41574	CGC	.	.		0.647	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
CEACAM3	1084	hgsc.bcm.edu	37	19	42314898	42314898	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:42314898C>G	ENST00000357396.3	+	6	897	c.656C>G	c.(655-657)cCc>cGc	p.P219R	CEACAM3_ENST00000344550.4_Silent_p.P201P|CEACAM3_ENST00000221999.4_Silent_p.P201P	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	219						integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						GCCCAGGCCCCCCTACCCAAC	0.612																																					p.P219R		Atlas-SNP	.											.	CEACAM3	37	.	0			c.C656G						.						83.0	75.0	78.0					19																	42314898		2203	4300	6503	SO:0001583	missense	1084	exon6			AGGCCCCCCTACC	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.656C>G	chr19.hg19:g.42314898C>G	ENSP00000349971:p.Pro219Arg	88.0	0.0		101.0	47.0	NM_001815	G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	hg19	CCDS12586.2	.	.	.	.	.	.	.	.	.	.	C	11.40	1.628579	0.28978	.	.	ENSG00000170956	ENST00000357396	T	0.02890	4.12	2.0	0.934	0.19477	.	.	.	.	.	T	0.02380	0.0073	L	0.38175	1.15	0.09310	N	1	B	0.28636	0.218	B	0.16722	0.016	T	0.45600	-0.9250	9	0.32370	T	0.25	.	5.8099	0.18460	0.3151:0.6849:0.0:0.0	.	219	P40198	CEAM3_HUMAN	R	219	ENSP00000349971:P219R	ENSP00000349971:P219R	P	+	2	0	CEACAM3	47006738	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.274000	0.08537	0.414000	0.25790	-0.507000	0.04495	CCC	.	.		0.612	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2	NM_001815	
SULT2A1	6822	hgsc.bcm.edu	37	19	48389503	48389503	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:48389503A>G	ENST00000222002.3	-	1	151	c.12T>C	c.(10-12)gaT>gaC	p.D4D		NM_003167.3	NP_003158.2	Q06520	ST2A1_HUMAN	sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1	4					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|bile acid catabolic process (GO:0030573)|cellular lipid metabolic process (GO:0044255)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	bile-salt sulfotransferase activity (GO:0047704)|sulfotransferase activity (GO:0008146)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)	Abiraterone(DB05812)|Acetaminophen(DB00316)	ACCATAAGAAATCGTCCGACA	0.463																																					p.D4D		Atlas-SNP	.											.	SULT2A1	49	.	0			c.T12C						.						199.0	163.0	175.0					19																	48389503		2203	4300	6503	SO:0001819	synonymous_variant	6822	exon1			TAAGAAATCGTCC	X70222	CCDS12707.1	19q13.3	2014-05-21			ENSG00000105398	ENSG00000105398	2.8.2.2	"""Sulfotransferases, cytosolic"""	11458	protein-coding gene	gene with protein product		125263		STD		1588921, 7736787	Standard	NM_003167		Approved	DHEA-ST	uc002phr.2	Q06520	OTTHUMG00000162469	ENST00000222002.3:c.12T>C	chr19.hg19:g.48389503A>G		98.0	0.0		117.0	60.0	NM_003167		Silent	SNP	ENST00000222002.3	hg19	CCDS12707.1																																																																																			.	.		0.463	SULT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369044.1	NM_003167	
NLRP7	199713	hgsc.bcm.edu	37	19	55451284	55451284	+	Silent	SNP	C	C	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:55451284C>A	ENST00000590030.1	-	3	943	c.903G>T	c.(901-903)acG>acT	p.T301T	NLRP7_ENST00000340844.2_Silent_p.T301T|NLRP7_ENST00000588756.1_Silent_p.T301T|NLRP7_ENST00000448121.2_Silent_p.T301T|NLRP7_ENST00000446217.1_Silent_p.T329T|NLRP7_ENST00000328092.5_Silent_p.T301T|NLRP7_ENST00000592784.1_Silent_p.T301T			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	301	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CCCTGGGCCGCGTGGTGACCA	0.627																																					p.T301T		Atlas-SNP	.											NLRP7_ENST00000328092,caecum,carcinoma,0,2	NLRP7	411	.	0			c.G903T						.						43.0	42.0	42.0					19																	55451284		2203	4300	6503	SO:0001819	synonymous_variant	199713	exon4			GGGCCGCGTGGTG	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.903G>T	chr19.hg19:g.55451284C>A		68.0	0.0		89.0	5.0	NM_001127255	E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	hg19	CCDS33109.1																																																																																			.	.		0.627	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
ZNF551	90233	hgsc.bcm.edu	37	19	58199257	58199257	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:58199257A>G	ENST00000282296.5	+	3	1799	c.1614A>G	c.(1612-1614)aaA>aaG	p.K538K	ZNF551_ENST00000356715.4_Silent_p.K522K|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AATGTGGCAAATCTTTTAGAC	0.448																																					p.K538K		Atlas-SNP	.											.	ZNF551	65	.	0			c.A1614G						.						85.0	80.0	82.0					19																	58199257		2203	4300	6503	SO:0001819	synonymous_variant	90233	exon3			TGGCAAATCTTTT	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1614A>G	chr19.hg19:g.58199257A>G		83.0	0.0		88.0	35.0	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Silent	SNP	ENST00000282296.5	hg19	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	A	7.864	0.726680	0.15439	.	.	ENSG00000228006	ENST00000541705	.	.	.	2.49	-0.904	0.10530	.	0.000000	0.46758	U	0.000269	T	0.11537	0.0281	.	.	.	0.19575	N	0.999967	.	.	.	.	.	.	T	0.34725	-0.9817	6	0.02654	T	1	.	7.1774	0.25753	0.6297:0.0:0.3703:0.0	.	.	.	.	L	50	.	ENSP00000437781:F50L	F	-	1	0	AC004017.1	62891069	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	-0.198000	0.09505	-0.134000	0.11516	0.459000	0.35465	TTT	.	.		0.448	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
CST11	140880	hgsc.bcm.edu	37	20	23433401	23433401	+	Silent	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr20:23433401T>C	ENST00000377009.3	-	1	81	c.48A>G	c.(46-48)ctA>ctG	p.L16L	CST11_ENST00000377007.3_Silent_p.L16L	NM_130794.1	NP_570612.1	Q9H112	CST11_HUMAN	cystatin 11	16					defense response to bacterium (GO:0042742)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(2)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	14	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TCAGAGTCAATAGAATGGCCA	0.517																																					p.L16L		Atlas-SNP	.											.	CST11	27	.	0			c.A48G						.						78.0	68.0	71.0					20																	23433401		2203	4300	6503	SO:0001819	synonymous_variant	140880	exon1			AGTCAATAGAATG	AL096677	CCDS13154.1, CCDS13155.1	20p11.21	2012-08-14			ENSG00000125831	ENSG00000125831			15959	protein-coding gene	gene with protein product		609731		CST8L		20565543	Standard	NM_080830		Approved	dJ322G13.6, CTES2	uc002wtf.1	Q9H112	OTTHUMG00000032060	ENST00000377009.3:c.48A>G	chr20.hg19:g.23433401T>C		94.0	0.0		121.0	55.0	NM_130794	Q0VAF2|Q0VAF3|Q8WXU5|Q8WXU6|Q9H113	Silent	SNP	ENST00000377009.3	hg19	CCDS13155.1																																																																																			.	.		0.517	CST11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078314.1	NM_130794	
TLDC2	140711	hgsc.bcm.edu	37	20	35507490	35507490	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr20:35507490T>A	ENST00000217320.3	+	3	280	c.236T>A	c.(235-237)cTg>cAg	p.L79Q	TLDC2_ENST00000602922.1_Missense_Mutation_p.L79Q	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	79	TLD.																CCCTGGAGTCTGGTCTTCTGC	0.632																																					p.L79Q		Atlas-SNP	.											.	C20orf118	21	.	0			c.T236A						.						116.0	90.0	99.0					20																	35507490		2203	4300	6503	SO:0001583	missense	140711	exon3			GGAGTCTGGTCTT	AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.236T>A	chr20.hg19:g.35507490T>A	ENSP00000217320:p.Leu79Gln	60.0	0.0		84.0	29.0	NM_080628	B3KVU8	Missense_Mutation	SNP	ENST00000217320.3	hg19	CCDS33465.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.071083	0.55646	.	.	ENSG00000101342	ENST00000217320	T	0.54071	0.59	5.09	4.0	0.46444	TLDc (2);	0.000000	0.85682	D	0.000000	T	0.76528	0.4000	H	0.94306	3.52	0.46011	D	0.998815	D	0.89917	1.0	D	0.85130	0.997	T	0.78463	-0.2194	10	0.87932	D	0	-32.8788	7.4279	0.27109	0.0:0.0961:0.0:0.9039	.	79	A0PJX2	CT118_HUMAN	Q	79	ENSP00000217320:L79Q	ENSP00000217320:L79Q	L	+	2	0	C20orf118	34940904	1.000000	0.71417	0.933000	0.37362	0.491000	0.33493	5.934000	0.70138	0.980000	0.38523	-0.250000	0.11733	CTG	.	.		0.632	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079060.2	NM_080628	
SEMG2	6407	hgsc.bcm.edu	37	20	43850459	43850459	+	Silent	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr20:43850459T>C	ENST00000372769.3	+	2	276	c.186T>C	c.(184-186)agT>agC	p.S62S		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	62					sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CCAAAGGCAGTTTTTCTATTC	0.398																																					p.S62S		Atlas-SNP	.											.	SEMG2	92	.	0			c.T186C						.						123.0	117.0	119.0					20																	43850459		2203	4300	6503	SO:0001819	synonymous_variant	6407	exon2			AGGCAGTTTTTCT		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.186T>C	chr20.hg19:g.43850459T>C		202.0	0.0		264.0	33.0	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Silent	SNP	ENST00000372769.3	hg19	CCDS13346.1																																																																																			.	.		0.398	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
ZNF831	128611	hgsc.bcm.edu	37	20	57767217	57767217	+	Silent	SNP	G	G	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr20:57767217G>A	ENST00000371030.2	+	1	1143	c.1143G>A	c.(1141-1143)ccG>ccA	p.P381P		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	381							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					gcccgggcccggggccagggg	0.756																																					p.P381P		Atlas-SNP	.											.	ZNF831	287	.	0			c.G1143A						.						4.0	6.0	5.0					20																	57767217		1493	3488	4981	SO:0001819	synonymous_variant	128611	exon1			GGGCCCGGGGCCA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1143G>A	chr20.hg19:g.57767217G>A		67.0	0.0		107.0	45.0	NM_178457	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	hg19	CCDS42894.1																																																																																			.	.		0.756	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
CRYBA4	1413	hgsc.bcm.edu	37	22	27021475	27021475	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr22:27021475A>C	ENST00000354760.3	+	4	224	c.189A>C	c.(187-189)caA>caC	p.Q63H	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	63	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CTGGCTTCCAAGGGCAGCAGT	0.612																																					p.Q63H		Atlas-SNP	.											.	CRYBA4	33	.	0			c.A189C						.						118.0	109.0	112.0					22																	27021475		2203	4300	6503	SO:0001583	missense	1413	exon4			CTTCCAAGGGCAG		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.189A>C	chr22.hg19:g.27021475A>C	ENSP00000346805:p.Gln63His	37.0	0.0		45.0	19.0	NM_001886	Q4VB22|Q6ICE4	Missense_Mutation	SNP	ENST00000354760.3	hg19	CCDS13841.1	.	.	.	.	.	.	.	.	.	.	A	6.390	0.440004	0.12104	.	.	ENSG00000196431	ENST00000354760	T	0.77229	-1.08	4.43	-1.83	0.07833	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.131786	0.52532	D	0.000079	T	0.71476	0.3344	M	0.71581	2.175	0.54753	D	0.999987	B	0.09022	0.002	B	0.28553	0.091	T	0.59123	-0.7513	10	0.52906	T	0.07	.	5.8464	0.18669	0.4941:0.1404:0.3655:0.0	.	63	P53673	CRBA4_HUMAN	H	63	ENSP00000346805:Q63H	ENSP00000346805:Q63H	Q	+	3	2	CRYBA4	25351475	0.968000	0.33430	0.994000	0.49952	0.106000	0.19336	0.063000	0.14410	-0.328000	0.08539	-1.202000	0.01658	CAA	.	.		0.612	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886	
CXCR3	2833	hgsc.bcm.edu	37	X	70837372	70837372	+	Intron	SNP	T	T	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chrX:70837372T>C	ENST00000373693.3	-	2	80				CXCR3_ENST00000373691.4_Missense_Mutation_p.I31V	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					TCTTTTGTGATTGAGTCTGAT	0.552																																					p.I31V		Atlas-SNP	.											.	CXCR3	57	.	0			c.A91G						.						64.0	56.0	58.0					X																	70837372		692	1591	2283	SO:0001627	intron_variant	2833	exon2			TTGTGATTGAGTC	U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.13-63A>G	chrX.hg19:g.70837372T>C		47.0	0.0		85.0	62.0	NM_001142797	B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	ENST00000373693.3	hg19	CCDS14416.1	.	.	.	.	.	.	.	.	.	.	T	0.956	-0.704724	0.03255	.	.	ENSG00000186810	ENST00000373691	T	0.70516	-0.49	3.11	-3.34	0.04943	.	9.515090	0.00659	U	0.000593	T	0.46927	0.1418	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.55360	-0.8153	9	0.02654	T	1	.	12.1564	0.54079	0.0:0.6559:0.0:0.3441	.	31	P49682-2	.	V	31	ENSP00000362795:I31V	ENSP00000362795:I31V	I	-	1	0	CXCR3	70754097	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-1.510000	0.01796	-2.111000	0.00353	ATC	.	.		0.552	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144141.1		
ZNF711	7552	hgsc.bcm.edu	37	X	84526085	84526085	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chrX:84526085G>T	ENST00000373165.3	+	9	1843	c.1537G>T	c.(1537-1539)Ggt>Tgt	p.G513C	ZNF711_ENST00000360700.4_Missense_Mutation_p.G559C|ZNF711_ENST00000542798.1_Missense_Mutation_p.G355C|ZNF711_ENST00000276123.3_Missense_Mutation_p.G513C|ZNF711_ENST00000395402.1_Missense_Mutation_p.G521C	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	513					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						GTGTGGGAAGGGTTTTCGACA	0.413																																					p.G513C		Atlas-SNP	.											.	ZNF711	198	.	0			c.G1537T						.						87.0	70.0	76.0					X																	84526085		2203	4300	6503	SO:0001583	missense	7552	exon9			GGGAAGGGTTTTC	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1537G>T	chrX.hg19:g.84526085G>T	ENSP00000362260:p.Gly513Cys	93.0	0.0		115.0	102.0	NM_021998	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	hg19	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137421	0.56936	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43919	D	0.000507	T	0.34513	0.0900	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.10917	-1.0609	10	0.87932	D	0	-9.6284	17.9439	0.89034	0.0:0.0:1.0:0.0	.	559;513	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	C	521;513;513;559;355	ENSP00000378798:G521C;ENSP00000362260:G513C;ENSP00000276123:G513C;ENSP00000353922:G559C;ENSP00000442071:G355C	ENSP00000276123:G513C	G	+	1	0	ZNF711	84412741	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.171000	0.68590	0.513000	0.50165	GGT	.	.		0.413	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998	
DOCK11	139818	hgsc.bcm.edu	37	X	117676789	117676789	+	Silent	SNP	A	A	G			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chrX:117676789A>G	ENST00000276202.7	+	2	267	c.204A>G	c.(202-204)ccA>ccG	p.P68P	DOCK11_ENST00000276204.6_Silent_p.P68P	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	68	Interaction with activated CDC42. {ECO:0000250}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTATGTTCCCAATGGAAGATA	0.393																																					p.P68P		Atlas-SNP	.											.	DOCK11	185	.	0			c.A204G						.						130.0	128.0	129.0					X																	117676789		2203	4300	6503	SO:0001819	synonymous_variant	139818	exon2			GTTCCCAATGGAA	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.204A>G	chrX.hg19:g.117676789A>G		141.0	0.0		208.0	161.0	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	ENST00000276202.7	hg19	CCDS35373.1																																																																																			.	.		0.393	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
GABRQ	55879	hgsc.bcm.edu	37	X	151818238	151818238	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chrX:151818238G>C	ENST00000370306.2	+	6	664	c.644G>C	c.(643-645)tGg>tCg	p.W215S		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	215					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATATTATTCTGGGATGACAAT	0.433																																					p.W215S		Atlas-SNP	.											.	GABRQ	131	.	0			c.G644C						.						164.0	132.0	143.0					X																	151818238		2203	4300	6503	SO:0001583	missense	55879	exon6			TATTCTGGGATGA	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.644G>C	chrX.hg19:g.151818238G>C	ENSP00000359329:p.Trp215Ser	42.0	0.0		58.0	50.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	hg19	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249999	0.59212	.	.	ENSG00000147402	ENST00000370306	T	0.80123	-1.34	5.82	5.82	0.92795	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.46758	D	0.000268	D	0.92348	0.7572	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94050	0.7317	10	0.87932	D	0	.	16.2847	0.82712	0.0:0.0:1.0:0.0	.	215	Q9UN88	GBRT_HUMAN	S	215	ENSP00000359329:W215S	ENSP00000359329:W215S	W	+	2	0	GABRQ	151568894	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	9.564000	0.98151	2.450000	0.82876	0.600000	0.82982	TGG	.	.		0.433	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
ETNK1	55500	hgsc.bcm.edu	37	12	22837867	22837901	+	Stop_Codon_Del	DEL	TGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAA	TGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAA	-	rs138041873|rs142528168|rs377113417		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	TGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAA	TGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:22837867_22837901delTGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAA	ENST00000266517.4	+	0	1427_1461					NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CTGAGGTTACTGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAATTATTCTCCA	0.315																																					p.446_453del	Esophageal Squamous(42;87 913 3224 6226 43339)	Atlas-INDEL	.											.	ETNK1	61	.	0			c.1337_1381del						.																																			SO:0001567	stop_retained_variant	55500	exon8			.	BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	Exception_encountered	chr12.hg19:g.22837867_22837901delTGCATTAAAAGTGCCTGAGTAAAGAAGAGATTTAA		88.0	0.0		79.0	14.0	NM_018638	G5E969	Frame_Shift_Del	DEL	ENST00000266517.4	hg19	CCDS8698.1																																																																																			.	.		0.315	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401926.2	NM_018638	
FAM120A	23196	hgsc.bcm.edu	37	9	96278439	96278439	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr9:96278439delC	ENST00000277165.6	+	7	1500	c.1306delC	c.(1306-1308)cccfs	p.P436fs	FAM120A_ENST00000340893.4_Frame_Shift_Del_p.P436fs|FAM120A_ENST00000375389.3_Frame_Shift_Del_p.P436fs|FAM120A_ENST00000333936.5_Frame_Shift_Del_p.P436fs	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	436						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GCGGTCCTCGCCCATCAACCC	0.597																																					p.S435fs		Atlas-INDEL	.											.	FAM120A	105	.	0			c.1305delG						.						106.0	98.0	101.0					9																	96278439		2203	4299	6502	SO:0001589	frameshift_variant	23196	exon7			.	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1306delC	chr9.hg19:g.96278439delC	ENSP00000277165:p.Pro436fs	304.0	0.0		359.0	175.0	NM_014612	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Frame_Shift_Del	DEL	ENST00000277165.6	hg19	CCDS6706.1																																																																																			.	.		0.597	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612	
NOSIP	51070	hgsc.bcm.edu	37	19	50063276	50063291	+	Frame_Shift_Del	DEL	GGGTCCCATAGCCCGA	GGGTCCCATAGCCCGA	-	rs534415595		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	GGGTCCCATAGCCCGA	GGGTCCCATAGCCCGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr19:50063276_50063291delGGGTCCCATAGCCCGA	ENST00000596358.1	-	3	134_149	c.76_91delTCGGGCTATGGGACCC	c.(76-93)tcgggctatgggacccagfs	p.SGYGTQ26fs	NOSIP_ENST00000391853.3_Frame_Shift_Del_p.SGYGTQ26fs|NOSIP_ENST00000339093.3_Frame_Shift_Del_p.SGYGTQ26fs	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	26					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		CGAATGTTCTGGGTCCCATAGCCCGAGGCCGCTGGG	0.606																																					p.26_31del		Atlas-INDEL	.											.	NOSIP	28	.	0			c.77_92del						.																																			SO:0001589	frameshift_variant	51070	exon3			.	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.76_91delTCGGGCTATGGGACCC	chr19.hg19:g.50063276_50063291delGGGTCCCATAGCCCGA	ENSP00000470034:p.Ser26fs	92.0	0.0		112.0	27.0	NM_001270960	Q96FD2	Frame_Shift_Del	DEL	ENST00000596358.1	hg19	CCDS12772.1																																																																																			.	.		0.606	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1		
ATP8A2	51761	hgsc.bcm.edu	37	13	26594099	26594100	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr13:26594099_26594100insA	ENST00000381655.2	+	37	3685_3686	c.3543_3544insA	c.(3544-3546)aaafs	p.K1182fs	ATP8A2_ENST00000255283.8_Frame_Shift_Ins_p.K1117fs	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1142					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ATGACACCACCAAAAAGAAATC	0.406																																					p.T1181fs		Atlas-INDEL	.											.	ATP8A2	181	.	0			c.3543_3544insA						.																																			SO:0001589	frameshift_variant	51761	exon37			.	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3548dupA	chr13.hg19:g.26594104_26594104dupA	ENSP00000371070:p.Lys1182fs	60.0	0.0		61.0	16.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Frame_Shift_Ins	INS	ENST00000381655.2	hg19	CCDS41873.1																																																																																			.	.		0.406	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
TAPBPL	55080	hgsc.bcm.edu	37	12	6566826	6566838	+	Frame_Shift_Del	DEL	ACTATACAGGACG	ACTATACAGGACG	-	rs368603949|rs374216855		TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	ACTATACAGGACG	ACTATACAGGACG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr12:6566826_6566838delACTATACAGGACG	ENST00000266556.7	+	4	985_997	c.820_832delACTATACAGGACG	c.(820-834)actatacaggacgagfs	p.TIQDE274fs	TAPBPL_ENST00000544021.1_Splice_Site_p.TI158fs|TAPBPL_ENST00000545700.1_3'UTR	NM_018009.4	NP_060479.3	Q9BX59	TPSNR_HUMAN	TAP binding protein-like	274	Ig-like V-type.				negative regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			endometrium(2)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	6						GCCCGGCCTCACTATACAGGACGAGGGGACCTA	0.624																																					p.273_277del		Atlas-INDEL	.											.	TAPBPL	21	.	0			c.819_831del						.																																			SO:0001589	frameshift_variant	55080	exon4			.	AK001005	CCDS8546.1	12p13.31	2013-01-11						"""Immunoglobulin superfamily / C1-set domain containing"""	30683	protein-coding gene	gene with protein product		607081				11920573	Standard	NM_018009		Approved	TAPBP-R, FLJ10143, TAPBPR	uc001qog.4	Q9BX59		ENST00000266556.7:c.820_832delACTATACAGGACG	chr12.hg19:g.6566826_6566838delACTATACAGGACG	ENSP00000266556:p.Thr274fs	106.0	0.0		111.0	35.0	NM_018009	Q9NWB8	Frame_Shift_Del	DEL	ENST00000266556.7	hg19	CCDS8546.1																																																																																			.	.		0.624	TAPBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399263.1	NM_018009	
ARHGEF12	23365	hgsc.bcm.edu	37	11	120319893	120319894	+	Frame_Shift_Ins	INS	-	-	GGAG			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr11:120319893_120319894insGGAG	ENST00000397843.2	+	21	1979_1980	c.1813_1814insGGAG	c.(1813-1815)cggfs	p.R605fs	ARHGEF12_ENST00000356641.3_Frame_Shift_Ins_p.R586fs|ARHGEF12_ENST00000532993.1_Frame_Shift_Ins_p.R502fs	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	605					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GGGACCCCCACGGAGACCAAGC	0.455			T	MLL	AML																																p.R605fs		Atlas-INDEL	.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	133	.	0			c.1813_1814insGGAG						.																																			SO:0001589	frameshift_variant	23365	exon21			.	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1814_1817dupGGAG	chr11.hg19:g.120319894_120319897dupGGAG	ENSP00000380942:p.Arg605fs	93.0	0.0		124.0	52.0	NM_015313	O15086|Q6P526	Frame_Shift_Ins	INS	ENST00000397843.2	hg19	CCDS41727.1																																																																																			.	.		0.455	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
WDR35	57539	hgsc.bcm.edu	37	2	20173444	20173447	+	Frame_Shift_Del	DEL	CATG	CATG	-	rs564598017|rs547986777	byFrequency	TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	CATG	CATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr2:20173444_20173447delCATG	ENST00000345530.3	-	8	874_877	c.759_762delCATG	c.(757-762)ggcatgfs	p.GM253fs	WDR35_ENST00000416055.2_5'UTR|WDR35_ENST00000281405.4_Frame_Shift_Del_p.GM253fs	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	253					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTACTACGTACATGCCAGTGTCAA	0.451																																					p.254_255del		Atlas-INDEL	.											.	WDR35	92	.	0			c.760_763del						.																																			SO:0001589	frameshift_variant	57539	exon8			.	AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.759_762delCATG	chr2.hg19:g.20173444_20173447delCATG	ENSP00000314444:p.Gly253fs	149.0	0.0		133.0	55.0	NM_001006657	B3KVI5|Q4ZG01|Q8NE11	Frame_Shift_Del	DEL	ENST00000345530.3	hg19	CCDS33152.1																																																																																			.	.		0.451	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
TMCO6	55374	hgsc.bcm.edu	37	5	140022524	140022525	+	Frame_Shift_Ins	INS	-	-	CACAG			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:140022524_140022525insCACAG	ENST00000394671.3	+	7	805_806	c.704_705insCACAG	c.(703-708)tccactfs	p.-236fs	NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000537378.1_5'UTR|TMCO6_ENST00000252100.6_Frame_Shift_Ins_p.-242fs	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6						protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTTGGCCTCCACTCTCCCTC	0.545																																					p.S235fs		Atlas-INDEL	.											.	TMCO6	30	.	0			c.704_705insCACAG						.																																			SO:0001589	frameshift_variant	55374	exon7			.	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	Exception_encountered	chr5.hg19:g.140022524_140022525insCACAG	ENSP00000378166:p.Thr236fs	61.0	0.0		97.0	24.0	NM_018502	Q9BUU0|Q9P198	Frame_Shift_Ins	INS	ENST00000394671.3	hg19	CCDS4233.2																																																																																			.	.		0.545	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251666.2	NM_018502	
C5orf45	51149	hgsc.bcm.edu	37	5	179264714	179264714	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADL-01A-11D-A40R-10	TCGA-DD-AADL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2a6b995-9bef-41e2-8e57-896039e6579d	12f9780c-620f-4e1c-af89-a3905b81bc11	g.chr5:179264714delT	ENST00000292586.6	-	7	799	c.709delA	c.(709-711)agafs	p.R237fs	C5orf45_ENST00000403396.2_Intron|C5orf45_ENST00000523267.1_5'UTR|C5orf45_ENST00000518235.1_Intron|C5orf45_ENST00000521333.1_3'UTR|SQSTM1_ENST00000389805.4_3'UTR|C5orf45_ENST00000523084.1_Frame_Shift_Del_p.R103fs|C5orf45_ENST00000376931.2_Frame_Shift_Del_p.R182fs|C5orf45_ENST00000518219.1_3'UTR|SQSTM1_ENST00000376929.3_3'UTR|C5orf45_ENST00000520698.1_Intron	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45	237										breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						GAACTTTTTCTAGGTGGCAGG	0.582																																					p.R237fs		Atlas-INDEL	.											.	C5orf45	23	.	0			c.710delG						.						79.0	83.0	82.0					5																	179264714		2203	4300	6503	SO:0001589	frameshift_variant	51149	exon7			.		CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.709delA	chr5.hg19:g.179264714delT	ENSP00000292586:p.Arg237fs	88.0	0.0		92.0	34.0	NM_016175	B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Frame_Shift_Del	DEL	ENST00000292586.6	hg19	CCDS34319.1																																																																																			.	.		0.582	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373760.2	NM_016175	
