#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	hgsc.bcm.edu	37	1	12337226	12337226	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:12337226C>T	ENST00000358136.3	+	19	3711	c.3581C>T	c.(3580-3582)gCa>gTa	p.A1194V	VPS13D_ENST00000356315.4_Missense_Mutation_p.A1194V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AGAAAAATTGCAACTGCAAGT	0.423																																					p.A1194V		Atlas-SNP	.											.	VPS13D	316	.	0			c.C3581T						.						128.0	114.0	118.0					1																	12337226		2203	4300	6503	SO:0001583	missense	55187	exon19			AAATTGCAACTGC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.3581C>T	chr1.hg19:g.12337226C>T	ENSP00000350854:p.Ala1194Val	114.0	0.0		82.0	30.0	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	hg19	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.403974|4.403974	0.83230|0.83230	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000356315;ENST00000358136|ENST00000011700	T;T|.	0.54071|.	0.59;0.59|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73953|.	0.3653|.	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	P;P|.	0.40970|.	0.734;0.615|.	B;B|.	0.35470|.	0.203;0.1|.	T|.	0.69277|.	-0.5187|.	10|.	0.66056|.	D|.	0.02|.	.|.	20.2985|20.2985	0.98592|0.98592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1194;1194|.	Q5THJ4-2;Q5THJ4|.	.;VP13D_HUMAN|.	V|X	1194|17	ENSP00000348666:A1194V;ENSP00000350854:A1194V|.	ENSP00000348666:A1194V|.	A|Q	+|+	2|1	0|0	VPS13D|VPS13D	12259813|12259813	1.000000|1.000000	0.71417|0.71417	0.766000|0.766000	0.31476|0.31476	0.998000|0.998000	0.95712|0.95712	7.487000|7.487000	0.81328|0.81328	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GCA|CAA	.	.		0.423	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
USP48	84196	hgsc.bcm.edu	37	1	22048144	22048144	+	Splice_Site	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:22048144C>A	ENST00000308271.9	-	13	2410	c.1762G>T	c.(1762-1764)Ggc>Tgc	p.G588C	USP48_ENST00000374732.3_Splice_Site_p.G127C|USP48_ENST00000529637.1_Splice_Site_p.G587C|USP48_ENST00000400301.1_Splice_Site_p.G588C	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	588	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		GCAACATACCCCTTTACTGCT	0.338																																					p.G588C		Atlas-SNP	.											.	USP48	91	.	0			c.G1762T						.						68.0	69.0	69.0					1																	22048144		2202	4300	6502	SO:0001630	splice_region_variant	84196	exon13			CATACCCCTTTAC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.1763+1G>T	chr1.hg19:g.22048144C>A		152.0	0.0		133.0	65.0	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	hg19	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698811	0.48307	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T;T	0.43688	0.94;0.94;0.97;0.94	5.47	3.6	0.41247	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.249817	0.49305	D	0.000160	T	0.53045	0.1772	L	0.54323	1.7	0.53005	D	0.999964	D;D;D;D;D;D	0.89917	1.0;0.991;0.996;0.996;0.995;0.994	D;P;P;P;P;P	0.65684	0.937;0.598;0.724;0.794;0.701;0.694	T	0.54536	-0.8279	10	0.72032	D	0.01	.	8.1685	0.31241	0.0:0.7616:0.0:0.2384	.	587;588;588;588;588;127	B7ZKS7;B7ZKS3;Q86UV5-3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;.;UBP48_HUMAN;.	C	588;588;127;587	ENSP00000383157:G588C;ENSP00000309262:G588C;ENSP00000363864:G127C;ENSP00000431949:G587C	ENSP00000309262:G588C	G	-	1	0	USP48	21920731	0.986000	0.35501	1.000000	0.80357	0.925000	0.55904	1.168000	0.31859	1.330000	0.45394	0.650000	0.86243	GGC	.	.		0.338	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	Missense_Mutation
TSSK3	81629	hgsc.bcm.edu	37	1	32828424	32828424	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:32828424T>C	ENST00000373534.3	+	1	627	c.122T>C	c.(121-123)aTa>aCa	p.I41T	FAM229A_ENST00000432622.1_5'Flank|FAM229A_ENST00000415596.1_Intron	NM_052841.3	NP_443073.1	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3	41	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|large_intestine(6)|lung(5)|skin(2)|stomach(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				ATTAAAGTTATAGACAAGATG	0.507																																					p.I41T		Atlas-SNP	.											.	TSSK3	22	.	0			c.T122C						.						116.0	124.0	121.0					1																	32828424		2203	4300	6503	SO:0001583	missense	81629	exon1			AAGTTATAGACAA	AF296450	CCDS362.1	1p35-p34	2008-02-05	2005-03-10	2005-03-12	ENSG00000162526	ENSG00000162526			15473	protein-coding gene	gene with protein product		607660	"""serine/threonine kinase 22C (spermiogenesis associated)"""	STK22C		11597141	Standard	NM_052841		Approved	SPOGA3	uc001bvf.3	Q96PN8	OTTHUMG00000007585	ENST00000373534.3:c.122T>C	chr1.hg19:g.32828424T>C	ENSP00000362634:p.Ile41Thr	214.0	0.0		163.0	35.0	NM_052841	Q5TEE5	Missense_Mutation	SNP	ENST00000373534.3	hg19	CCDS362.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255596	0.59321	.	.	ENSG00000162526	ENST00000373534	T	0.28255	1.62	5.02	5.02	0.67125	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.55305	0.1912	M	0.85099	2.735	0.80722	D	1	D	0.65815	0.995	P	0.61722	0.893	T	0.63260	-0.6677	10	0.87932	D	0	.	12.4075	0.55449	0.0:0.0:0.0:1.0	.	41	Q96PN8	TSSK3_HUMAN	T	41	ENSP00000362634:I41T	ENSP00000362634:I41T	I	+	2	0	TSSK3	32601011	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.313000	0.72844	2.020000	0.59435	0.460000	0.39030	ATA	.	.		0.507	TSSK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020049.1		
KIAA1107	23285	hgsc.bcm.edu	37	1	92646304	92646304	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:92646304G>T	ENST00000370378.4	+	8	1848	c.1750G>T	c.(1750-1752)Gag>Tag	p.E584*	KIAA1107_ENST00000409154.4_Nonsense_Mutation_p.E639*	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	639										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						TCAAGAAAAAGAGAAGTTGGC	0.363																																					p.E584X		Atlas-SNP	.											.	KIAA1107	60	.	0			c.G1750T						.						68.0	60.0	63.0					1																	92646304		692	1591	2283	SO:0001587	stop_gained	23285	exon8			GAAAAAGAGAAGT	AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.1750G>T	chr1.hg19:g.92646304G>T	ENSP00000359404:p.Glu584*	341.0	0.0		256.0	54.0	NM_015237	O14767|Q8N3X7	Nonsense_Mutation	SNP	ENST00000370378.4	hg19	CCDS44172.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625613	0.46840	.	.	ENSG00000069712	ENST00000409154;ENST00000370378	.	.	.	5.47	0.111	0.14619	.	0.829930	0.10855	N	0.626756	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	8.6793	0.34198	0.1437:0.4748:0.3815:0.0	.	.	.	.	X	639;584	.	ENSP00000359404:E584X	E	+	1	0	KIAA1107	92418892	0.960000	0.32886	0.035000	0.18076	0.119000	0.20118	1.577000	0.36515	-0.225000	0.09913	0.655000	0.94253	GAG	.	.		0.363	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028375.3	XM_034086	
FCRL5	83416	hgsc.bcm.edu	37	1	157494289	157494289	+	Silent	SNP	C	C	T	rs143158449		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:157494289C>T	ENST00000361835.3	-	10	2176	c.2019G>A	c.(2017-2019)ggG>ggA	p.G673G	FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368190.3_Silent_p.G673G|FCRL5_ENST00000368191.3_Silent_p.G588G|FCRL5_ENST00000356953.4_Silent_p.G673G	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	673	Ig-like C2-type 7.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CCAGCAGGTCCCCCACCACAG	0.552																																					p.G673G		Atlas-SNP	.											.	FCRL5	177	.	0			c.G2019A						.						47.0	53.0	51.0					1																	157494289		2203	4300	6503	SO:0001819	synonymous_variant	83416	exon10			CAGGTCCCCCACC	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2019G>A	chr1.hg19:g.157494289C>T		356.0	0.0		209.0	52.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	hg19	CCDS1165.1																																																																																			.	C|1.000;A|0.000		0.552	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
ATP1A4	480	hgsc.bcm.edu	37	1	160136391	160136391	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:160136391C>T	ENST00000368081.4	+	8	1592	c.1121C>T	c.(1120-1122)aCg>aTg	p.T374M		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	374					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.T374M(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCGGTGGAGACGCTGGGCTCC	0.582																																					p.T374M		Atlas-SNP	.											ATP1A4,NS,carcinoma,0,1	ATP1A4	167	.	1	Substitution - Missense(1)	lung(1)	c.C1121T						.						126.0	104.0	112.0					1																	160136391		2203	4300	6503	SO:0001583	missense	480	exon8			TGGAGACGCTGGG	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1121C>T	chr1.hg19:g.160136391C>T	ENSP00000357060:p.Thr374Met	117.0	0.0		80.0	14.0	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	hg19	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671393	0.88348	.	.	ENSG00000132681	ENST00000368081	D	0.92397	-3.03	4.35	4.35	0.52113	ATPase, P-type, cytoplasmic domain N (1);ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.97331	0.9127	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98235	1.0485	10	0.87932	D	0	.	14.7749	0.69724	0.0:1.0:0.0:0.0	.	374	Q13733	AT1A4_HUMAN	M	374	ENSP00000357060:T374M	ENSP00000357060:T374M	T	+	2	0	ATP1A4	158403015	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.580000	0.82523	2.427000	0.82271	0.650000	0.86243	ACG	.	.		0.582	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
DENND1B	163486	hgsc.bcm.edu	37	1	197479885	197479885	+	IGR	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:197479885C>T								CRB1 (32300 upstream) : DENND1B (41499 downstream)														p.S318T(1)|p.S242T(1)									AGTAGGGTCACTCACATTGTC	0.448																																					p.S678N		Atlas-SNP	.											.	DENND1B	108	.	2	Substitution - Missense(2)	lung(2)	c.G2033A						.						112.0	103.0	106.0					1																	197479885		2203	4300	6503	SO:0001628	intergenic_variant	163486	exon23			GGGTCACTCACAT																													chr1.hg19:g.197479885C>T		189.0	0.0		149.0	51.0	NM_001195215		Missense_Mutation	SNP		hg19		.	.	.	.	.	.	.	.	.	.	C	7.124	0.578562	0.13686	.	.	ENSG00000213047	ENST00000391979;ENST00000542760;ENST00000450419	T	0.30714	1.52	5.31	0.248	0.15526	.	0.530450	0.15843	U	0.241930	T	0.19685	0.0473	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18999	-1.0319	10	0.27785	T	0.31	.	6.9673	0.24629	0.0:0.3846:0.0:0.6154	.	678	Q6P3S1-5	.	N	318;678;658	ENSP00000375839:S318N	ENSP00000375839:S318N	S	-	2	0	DENND1B	195746508	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.101000	0.10973	0.227000	0.20999	0.563000	0.77884	AGT	.	.	0	0.448								
LEFTY2	7044	hgsc.bcm.edu	37	1	226127110	226127110	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:226127110G>T	ENST00000366820.5	-	3	1036	c.688C>A	c.(688-690)Ctt>Att	p.L230I	LEFTY2_ENST00000420304.2_Missense_Mutation_p.L196I|RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'Flank	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	230					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					GGCTCCCCAAGCCCGGCTGGC	0.687																																					p.L230I	Colon(172;116 2643 9098 43333)	Atlas-SNP	.											.	LEFTY2	25	.	0			c.C688A						.						13.0	15.0	15.0					1																	226127110		2200	4291	6491	SO:0001583	missense	7044	exon3			CCCCAAGCCCGGC	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.688C>A	chr1.hg19:g.226127110G>T	ENSP00000355785:p.Leu230Ile	150.0	0.0		129.0	31.0	NM_003240	B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	ENST00000366820.5	hg19	CCDS1549.1	.	.	.	.	.	.	.	.	.	.	g	6.850	0.526147	0.13066	.	.	ENSG00000143768	ENST00000420304;ENST00000366820	T;T	0.69040	-0.11;-0.37	4.47	0.109	0.14578	.	1.201010	0.05948	N	0.638279	T	0.54224	0.1845	L	0.32530	0.975	0.09310	N	1	B;B	0.30937	0.301;0.301	B;B	0.34931	0.192;0.192	T	0.45293	-0.9271	10	0.37606	T	0.19	.	4.3752	0.11267	0.0811:0.1495:0.5199:0.2495	.	196;230	E9PDM4;O00292	.;LFTY2_HUMAN	I	196;230	ENSP00000388009:L196I;ENSP00000355785:L230I	ENSP00000355785:L230I	L	-	1	0	LEFTY2	224193733	0.014000	0.17966	0.001000	0.08648	0.003000	0.03518	1.804000	0.38873	0.053000	0.16036	-0.314000	0.08810	CTT	.	.		0.687	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240	
LYST	1130	hgsc.bcm.edu	37	1	235897870	235897870	+	Silent	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:235897870C>A	ENST00000389794.3	-	32	8622	c.8448G>T	c.(8446-8448)ctG>ctT	p.L2816L	LYST_ENST00000389793.2_Silent_p.L2816L|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2816					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.L2816L(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CATTCATAAGCAGTTCTGCTG	0.383																																					p.L2816L		Atlas-SNP	.											LYST,colon,carcinoma,-1,1	LYST	370	.	1	Substitution - coding silent(1)	ovary(1)	c.G8448T						.						237.0	205.0	216.0					1																	235897870		2203	4300	6503	SO:0001819	synonymous_variant	1130	exon32			CATAAGCAGTTCT	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8448G>T	chr1.hg19:g.235897870C>A		120.0	0.0		85.0	15.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	hg19	CCDS31062.1																																																																																			.	.		0.383	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
RYR2	6262	hgsc.bcm.edu	37	1	237889575	237889575	+	Silent	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:237889575G>A	ENST00000366574.2	+	75	11009	c.10692G>A	c.(10690-10692)aaG>aaA	p.K3564K	RYR2_ENST00000542537.1_Silent_p.K3548K|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.K3562K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3564					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTTTCAGAAGTCTAAACGTG	0.313																																					p.K3564K		Atlas-SNP	.											.	RYR2	1273	.	0			c.G10692A						.						56.0	54.0	55.0					1																	237889575		1811	4068	5879	SO:0001819	synonymous_variant	6262	exon75			TCAGAAGTCTAAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10692G>A	chr1.hg19:g.237889575G>A		358.0	0.0		252.0	32.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.		0.313	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
TRIM58	25893	hgsc.bcm.edu	37	1	248039229	248039229	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:248039229C>A	ENST00000366481.3	+	6	947	c.899C>A	c.(898-900)gCg>gAg	p.A300E	OR2W3_ENST00000537741.1_5'UTR	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	300	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCCGCCACGGCGCACCCGAGT	0.552																																					p.A300E		Atlas-SNP	.											TRIM58,NS,carcinoma,0,1	TRIM58	143	.	0			c.C899A						.						62.0	60.0	61.0					1																	248039229		2203	4300	6503	SO:0001583	missense	25893	exon6			CCACGGCGCACCC	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.899C>A	chr1.hg19:g.248039229C>A	ENSP00000355437:p.Ala300Glu	83.0	0.0		52.0	11.0	NM_015431	Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	hg19	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792603	0.50102	.	.	ENSG00000162722	ENST00000366481	T	0.39406	1.08	3.95	3.03	0.35002	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.56097	D	0.000026	T	0.73241	0.3562	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80870	-0.1189	10	0.87932	D	0	.	11.2344	0.48931	0.1846:0.8154:0.0:0.0	.	300	Q8NG06	TRI58_HUMAN	E	300	ENSP00000355437:A300E	ENSP00000355437:A300E	A	+	2	0	TRIM58	246105852	0.995000	0.38212	0.197000	0.23402	0.100000	0.18952	3.349000	0.52217	1.250000	0.43966	0.650000	0.86243	GCG	.	.		0.552	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
MYT1L	23040	hgsc.bcm.edu	37	2	1926369	1926369	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:1926369G>T	ENST00000399161.2	-	10	1919	c.1172C>A	c.(1171-1173)cCc>cAc	p.P391H	MYT1L_ENST00000428368.2_Missense_Mutation_p.P391H	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	391					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCTCGACCGGGGGCTCAACTG	0.597																																					p.P391H		Atlas-SNP	.											.	MYT1L	241	.	0			c.C1172A						.						38.0	40.0	39.0					2																	1926369		2121	4240	6361	SO:0001583	missense	23040	exon10			GACCGGGGGCTCA	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1172C>A	chr2.hg19:g.1926369G>T	ENSP00000382114:p.Pro391His	74.0	0.0		70.0	9.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	G	18.39	3.613197	0.66672	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.61392	0.12;0.11	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.69735	0.3144	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.69587	-0.5105	10	0.59425	D	0.04	-34.5834	20.4387	0.99107	0.0:0.0:1.0:0.0	.	391;391	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	H	391;339;391	ENSP00000382114:P391H;ENSP00000396103:P391H	ENSP00000295067:P339H	P	-	2	0	MYT1L	1905376	1.000000	0.71417	0.863000	0.33907	0.113000	0.19764	9.781000	0.99029	2.836000	0.97738	0.655000	0.94253	CCC	.	.		0.597	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
CENPO	79172	hgsc.bcm.edu	37	2	25038488	25038488	+	Missense_Mutation	SNP	C	C	T	rs547353937		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:25038488C>T	ENST00000380834.2	+	5	882	c.457C>T	c.(457-459)Cat>Tat	p.H153Y	CENPO_ENST00000473706.1_Missense_Mutation_p.H147Y|CENPO_ENST00000260662.1_Missense_Mutation_p.H153Y			Q9BU64	CENPO_HUMAN	centromere protein O	153					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GATACATCACCATTCAGTCCC	0.463																																					p.H153Y		Atlas-SNP	.											.	CENPO	18	.	0			c.C457T						.						176.0	168.0	171.0					2																	25038488		2203	4300	6503	SO:0001583	missense	79172	exon5			CATCACCATTCAG	AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.457C>T	chr2.hg19:g.25038488C>T	ENSP00000370214:p.His153Tyr	183.0	0.0		135.0	60.0	NM_024322	B2RDC0|D6W536|Q53T55|Q96JV3	Missense_Mutation	SNP	ENST00000380834.2	hg19	CCDS1714.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.437524	0.83885	.	.	ENSG00000138092	ENST00000380834;ENST00000473706;ENST00000260662	T;T;T	0.78003	-1.14;-1.13;-1.14	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.88941	0.6574	M	0.81802	2.56	0.52501	D	0.999959	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.89916	0.4055	10	0.87932	D	0	-16.1442	18.655	0.91450	0.0:1.0:0.0:0.0	.	147;153	Q9BU64-2;Q9BU64	.;CENPO_HUMAN	Y	153;147;153	ENSP00000370214:H153Y;ENSP00000417787:H147Y;ENSP00000260662:H153Y	ENSP00000260662:H153Y	H	+	1	0	CENPO	24891992	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.859000	0.62954	2.737000	0.93849	0.650000	0.86243	CAT	.	.		0.463	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246856.2	NM_024322	
HNRNPLL	92906	hgsc.bcm.edu	37	2	38810997	38810997	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:38810997T>C	ENST00000449105.3	-	4	957	c.618A>G	c.(616-618)atA>atG	p.I206M	HNRNPLL_ENST00000378915.3_Missense_Mutation_p.I206M|HNRNPLL_ENST00000409636.1_Missense_Mutation_p.I201M|HNRNPLL_ENST00000608859.1_Missense_Mutation_p.I206M|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.I206M|HNRNPLL_ENST00000410076.1_Missense_Mutation_p.I201M|HNRNPLL_ENST00000358367.4_Missense_Mutation_p.I206M			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	206	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CCATTGCTTGTATCCCATTTC	0.313																																					p.I206M		Atlas-SNP	.											.	HNRPLL	19	.	0			c.A618G						.						64.0	63.0	63.0					2																	38810997		2202	4294	6496	SO:0001583	missense	92906	exon4			TGCTTGTATCCCA	BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.618A>G	chr2.hg19:g.38810997T>C	ENSP00000390625:p.Ile206Met	385.0	0.0		356.0	72.0	NM_138394	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	hg19		.	.	.	.	.	.	.	.	.	.	T	19.63	3.862695	0.71949	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328;ENST00000358367;ENST00000410076;ENST00000425682	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	L	0.28115	0.83	0.47183	D	0.999347	P;P	0.40332	0.713;0.713	P;P	0.45406	0.479;0.479	T	0.59484	-0.7446	9	0.72032	D	0.01	.	15.4605	0.75353	0.0:0.0:0.0:1.0	.	201;206	C9J9G0;D6W592	.;.	M	206;201;206;206;206;201;145	.	ENSP00000351136:I206M	I	-	3	3	HNRPLL	38664501	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.928000	0.48908	2.101000	0.63845	0.460000	0.39030	ATA	.	.		0.313	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394	
TTL	150465	hgsc.bcm.edu	37	2	113278000	113278000	+	Silent	SNP	T	T	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:113278000T>A	ENST00000233336.6	+	6	1208	c.1017T>A	c.(1015-1017)gcT>gcA	p.A339A		NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	339	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)			breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		CTGCATGTGCTCAGTAAGCCT	0.512			T	ETV6	ALL																																p.A339A		Atlas-SNP	.		Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	.	TTL	27	.	0			c.T1017A						.						102.0	91.0	95.0					2																	113278000		2203	4300	6503	SO:0001819	synonymous_variant	150465	exon6			ATGTGCTCAGTAA		CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.1017T>A	chr2.hg19:g.113278000T>A		103.0	0.0		69.0	22.0	NM_153712	Q585T3|Q7Z302|Q8N426	Silent	SNP	ENST00000233336.6	hg19	CCDS2096.1																																																																																			.	.		0.512	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712	
LRP1B	53353	hgsc.bcm.edu	37	2	141072505	141072505	+	Splice_Site	SNP	T	T	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:141072505T>A	ENST00000389484.3	-	83	13775	c.12804A>T	c.(12802-12804)ctA>ctT	p.L4268L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4268	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATATTTACCTAGAACTGATG	0.353										TSP Lung(27;0.18)																											p.L4268L	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A12804T						.						106.0	103.0	104.0					2																	141072505		2203	4300	6503	SO:0001630	splice_region_variant	53353	exon83			TTTACCTAGAACT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12805+1A>T	chr2.hg19:g.141072505T>A		107.0	0.0		46.0	12.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	0.463	-0.888134	0.02511	.	.	ENSG00000168702	ENST00000437977	.	.	.	5.9	-1.52	0.08637	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.6556	0.02781	0.1312:0.2954:0.1706:0.4028	.	.	.	.	L	500	.	.	X	-	2	0	LRP1B	140788975	0.276000	0.24211	0.864000	0.33941	0.143000	0.21401	-0.357000	0.07651	-0.135000	0.11495	0.533000	0.62120	TAG	.	.		0.353	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Silent
TTLL3	26140	hgsc.bcm.edu	37	3	9876555	9876555	+	Silent	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:9876555T>C	ENST00000547186.1	+	12	2103	c.1887T>C	c.(1885-1887)gaT>gaC	p.D629D	TTLL3_ENST00000383827.1_3'UTR|TTLL3_ENST00000397241.1_3'UTR|TTLL3_ENST00000455274.1_Intron|TTLL3_ENST00000430793.1_Silent_p.D417D|TTLL3_ENST00000426895.4_Silent_p.D772D|ARPC4-TTLL3_ENST00000397256.1_3'UTR	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	629					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					CGAACCTTGATTTCAAGGTGG	0.597																																					p.D772D		Atlas-SNP	.											.	TTLL3	51	.	0			c.T2316C						.						96.0	96.0	96.0					3																	9876555		2203	4300	6503	SO:0001819	synonymous_variant	26140	exon12			CCTTGATTTCAAG		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.1887T>C	chr3.hg19:g.9876555T>C		108.0	0.0		105.0	53.0	NM_001025930	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Silent	SNP	ENST00000547186.1	hg19																																																																																				.	.		0.597	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
SLC4A7	9497	hgsc.bcm.edu	37	3	27436010	27436010	+	Splice_Site	SNP	T	T	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:27436010T>A	ENST00000295736.5	-	20	3159	c.3089A>T	c.(3088-3090)aAg>aTg	p.K1030M	SLC4A7_ENST00000446700.1_Splice_Site_p.K1022M|SLC4A7_ENST00000428386.1_Splice_Site_p.K906M|SLC4A7_ENST00000454389.1_Splice_Site_p.K1039M|SLC4A7_ENST00000437179.1_Splice_Site_p.K911M|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000435667.2_Splice_Site_p.K915M|SLC4A7_ENST00000445684.1_Splice_Site_p.K1026M|SLC4A7_ENST00000388777.4_Splice_Site_p.K580M|SLC4A7_ENST00000455077.1_Splice_Site_p.K911M|SLC4A7_ENST00000440156.1_Splice_Site_p.K1026M	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1030					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	AAATTTTACCTTTAGGACTGA	0.323																																					p.K1030M		Atlas-SNP	.											.	SLC4A7	119	.	0			c.A3089T						.						48.0	51.0	50.0					3																	27436010		2203	4300	6503	SO:0001630	splice_region_variant	9497	exon20			TTTACCTTTAGGA	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3090+1A>T	chr3.hg19:g.27436010T>A		124.0	0.0		115.0	61.0	NM_003615	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	hg19	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373635	0.82573	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42	5.77	4.62	0.57501	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89326	0.6683	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D;P;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.725;0.999;1.0;0.999	D;D;D;D;D;P;D;D;D	0.97110	0.996;0.981;0.996;1.0;0.996;0.452;0.978;0.996;0.987	D	0.89670	0.3883	10	0.66056	D	0.02	.	11.6812	0.51458	0.0:0.0691:0.0:0.9309	.	1026;911;1022;1026;1039;580;906;1030;911	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	M	581;1030;906;1039;1026;911;1022;911;1026;915;580;926	ENSP00000411031:K581M;ENSP00000295736:K1030M;ENSP00000416368:K906M;ENSP00000390394:K1039M;ENSP00000414797:K1026M;ENSP00000394252:K911M;ENSP00000406605:K1022M;ENSP00000407382:K911M;ENSP00000406804:K1026M;ENSP00000395336:K915M;ENSP00000373429:K580M;ENSP00000388703:K926M	ENSP00000295736:K1030M	K	-	2	0	SLC4A7	27411014	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	8.040000	0.89188	1.019000	0.39547	0.482000	0.46254	AAG	.	.		0.323	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	Missense_Mutation
TGM4	7047	hgsc.bcm.edu	37	3	44926965	44926965	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:44926965C>A	ENST00000296125.4	+	2	236	c.168C>A	c.(166-168)caC>caA	p.H56Q		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	56					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	AATCCTACCACCAACTGAAAC	0.572																																					p.H56Q		Atlas-SNP	.											.	TGM4	82	.	0			c.C168A						.						59.0	60.0	60.0					3																	44926965		2203	4300	6503	SO:0001583	missense	7047	exon2			CTACCACCAACTG	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.168C>A	chr3.hg19:g.44926965C>A	ENSP00000296125:p.His56Gln	163.0	0.0		139.0	71.0	NM_003241	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	hg19	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	C	8.777	0.927258	0.18056	.	.	ENSG00000163810	ENST00000296125	D	0.86164	-2.08	2.99	-1.15	0.09709	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.138996	0.28279	U	0.015922	T	0.73040	0.3536	L	0.27053	0.805	0.09310	N	1	B;B	0.15141	0.012;0.01	B;B	0.06405	0.002;0.002	T	0.60762	-0.7199	10	0.59425	D	0.04	.	3.2703	0.06879	0.0:0.3022:0.3775:0.3203	.	56;56	P49221;B4YUQ1	TGM4_HUMAN;.	Q	56	ENSP00000296125:H56Q	ENSP00000296125:H56Q	H	+	3	2	TGM4	44901969	0.001000	0.12720	0.000000	0.03702	0.068000	0.16541	-0.269000	0.08596	-0.125000	0.11703	0.467000	0.42956	CAC	.	.		0.572	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
GRAMD1C	54762	hgsc.bcm.edu	37	3	113588361	113588361	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:113588361G>T	ENST00000358160.4	+	3	674	c.182G>T	c.(181-183)aGt>aTt	p.S61I	GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000479212.1_3'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	61						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						CAGATTTCAAGTTCCACCTAT	0.303																																					p.S61I		Atlas-SNP	.											.	GRAMD1C	71	.	0			c.G182T						.						73.0	79.0	77.0					3																	113588361		2203	4294	6497	SO:0001583	missense	54762	exon3			TTTCAAGTTCCAC		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.182G>T	chr3.hg19:g.113588361G>T	ENSP00000350881:p.Ser61Ile	477.0	0.0		455.0	35.0	NM_017577	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	hg19	CCDS33826.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600393	0.46423	.	.	ENSG00000178075	ENST00000358160	T	0.36520	1.25	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000009	T	0.52821	0.1758	M	0.74467	2.265	0.80722	D	1	D	0.57257	0.979	P	0.52267	0.694	T	0.58200	-0.7678	10	0.59425	D	0.04	.	17.6656	0.88202	0.0:0.0:1.0:0.0	.	61	Q8IYS0	GRM1C_HUMAN	I	61	ENSP00000350881:S61I	ENSP00000350881:S61I	S	+	2	0	GRAMD1C	115071051	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	3.732000	0.55021	2.462000	0.83206	0.655000	0.94253	AGT	.	.		0.303	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
GATA2	2624	hgsc.bcm.edu	37	3	128204630	128204630	+	Silent	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:128204630G>A	ENST00000341105.2	-	3	1142	c.811C>T	c.(811-813)Ctg>Ttg	p.L271L	GATA2_ENST00000430265.2_Silent_p.L271L|GATA2_ENST00000487848.1_Silent_p.L271L	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	271					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GGTCCCCCCAGGAAGCCTCCG	0.652			Mis		AML(CML blast transformation)																																p.L271L		Atlas-SNP	.		Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	.	GATA2	122	.	0			c.C811T						.						35.0	40.0	38.0					3																	128204630		2202	4300	6502	SO:0001819	synonymous_variant	2624	exon3			CCCCCAGGAAGCC	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.811C>T	chr3.hg19:g.128204630G>A		71.0	0.0		42.0	16.0	NM_001145662	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Silent	SNP	ENST00000341105.2	hg19	CCDS3049.1																																																																																			.	.		0.652	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	NM_032638	
RASA2	5922	hgsc.bcm.edu	37	3	141289753	141289753	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:141289753G>A	ENST00000452898.1	+	10	898		c.e10-1		RASA2_ENST00000286364.3_Splice_Site	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						TTTTACTTTAGGTACTTGCTA	0.343																																					.		Atlas-SNP	.											.	RASA2	169	.	0			c.864-1G>A						.						41.0	42.0	42.0					3																	141289753		2203	4300	6503	SO:0001630	splice_region_variant	5922	exon10			ACTTTAGGTACTT	AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.864-1G>A	chr3.hg19:g.141289753G>A		142.0	0.0		103.0	41.0	NM_006506	A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Splice_Site	SNP	ENST00000452898.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.2	4.256904	0.80246	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2936	0.94112	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RASA2	142772443	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.312000	0.78968	2.580000	0.87095	0.650000	0.86243	.	.	.		0.343	RASA2-201	KNOWN	basic	protein_coding	protein_coding		NM_006506	Intron
PLSCR1	5359	hgsc.bcm.edu	37	3	146234891	146234891	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:146234891T>A	ENST00000342435.4	-	8	1212	c.802A>T	c.(802-804)Aga>Tga	p.R268*	PLSCR1_ENST00000484560.1_5'UTR|PLSCR1_ENST00000448787.2_Nonsense_Mutation_p.R187*|PLSCR1_ENST00000487389.1_Nonsense_Mutation_p.R261*|PLSCR1_ENST00000448205.1_5'UTR	NM_021105.2	NP_066928.1	O15162	PLS1_HUMAN	phospholipid scramblase 1	268					acute-phase response (GO:0006953)|apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|negative regulation of viral genome replication (GO:0045071)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid scrambling (GO:0017121)|platelet activation (GO:0030168)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of gene expression (GO:0010628)|positive regulation of innate immune response (GO:0045089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|regulation of mast cell activation (GO:0033003)|response to interferon-beta (GO:0035456)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|epidermal growth factor receptor binding (GO:0005154)|phospholipid scramblase activity (GO:0017128)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15						AATGCCTCTCTCAAAATTCCA	0.348																																					p.R268X		Atlas-SNP	.											.	PLSCR1	35	.	0			c.A802T						.						98.0	97.0	97.0					3																	146234891		2203	4300	6503	SO:0001587	stop_gained	5359	exon8			CCTCTCTCAAAAT	AF098642	CCDS3135.1	3q23	2004-02-27			ENSG00000188313	ENSG00000188313			9092	protein-coding gene	gene with protein product		604170				9218461	Standard	NM_021105		Approved	MMTRA1B	uc003evx.4	O15162	OTTHUMG00000159427	ENST00000342435.4:c.802A>T	chr3.hg19:g.146234891T>A	ENSP00000345494:p.Arg268*	285.0	0.0		180.0	70.0	NM_021105	B2R8H8|B4DTE8	Nonsense_Mutation	SNP	ENST00000342435.4	hg19	CCDS3135.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	33|33	5.279612|5.279612	0.95489|0.95489	.|.	.|.	ENSG00000188313|ENSG00000188313	ENST00000342435;ENST00000487389;ENST00000448787;ENST00000462666|ENST00000483300	.|.	.|.	.|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.21740|0.21740	N|N	0.999567|0.999567	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	11.9267|11.9267	0.52823|0.52823	0.0:0.0:0.145:0.855|0.0:0.0:0.145:0.855	.|.	.|.	.|.	.|.	X|C	268;261;187;244|134	.|.	ENSP00000345494:R268X|.	R|X	-|-	1|3	2|0	PLSCR1|PLSCR1	147717581|147717581	0.004000|0.004000	0.15560|0.15560	0.016000|0.016000	0.15963|0.15963	0.577000|0.577000	0.36160|0.36160	1.475000|1.475000	0.35409|0.35409	1.938000|1.938000	0.56188|0.56188	0.454000|0.454000	0.30748|0.30748	AGA|TGA	.	.		0.348	PLSCR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355257.2	NM_021105	
ZIC4	84107	hgsc.bcm.edu	37	3	147113964	147113964	+	Silent	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:147113964G>T	ENST00000383075.3	-	3	875	c.363C>A	c.(361-363)cgC>cgA	p.R121R	ZIC4_ENST00000473123.1_Silent_p.R121R|ZIC4_ENST00000484399.1_Silent_p.R121R|ZIC4_ENST00000525172.2_Silent_p.R171R|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000425731.3_Silent_p.R159R	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	121						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TGATGGGCTGGCGCATGTAGC	0.657																																					p.R171R		Atlas-SNP	.											.	ZIC4	174	.	0			c.C513A						.						34.0	39.0	37.0					3																	147113964		2200	4299	6499	SO:0001819	synonymous_variant	84107	exon3			GGGCTGGCGCATG	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.363C>A	chr3.hg19:g.147113964G>T		128.0	0.0		127.0	53.0	NM_001168378	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Silent	SNP	ENST00000383075.3	hg19	CCDS43160.1																																																																																			.	.		0.657	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
NCAPG	64151	hgsc.bcm.edu	37	4	17829968	17829968	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr4:17829968C>A	ENST00000251496.2	+	12	1897	c.1721C>A	c.(1720-1722)tCa>tAa	p.S574*		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	574					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		ATGTCCATTTCAACAGGCTTA	0.343																																					p.S574X		Atlas-SNP	.											.	NCAPG	76	.	0			c.C1721A						.						155.0	148.0	150.0					4																	17829968		2203	4300	6503	SO:0001587	stop_gained	64151	exon12			CCATTTCAACAGG	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.1721C>A	chr4.hg19:g.17829968C>A	ENSP00000251496:p.Ser574*	89.0	0.0		60.0	29.0	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Nonsense_Mutation	SNP	ENST00000251496.2	hg19	CCDS3424.1	.	.	.	.	.	.	.	.	.	.	C	39	7.420824	0.98272	.	.	ENSG00000109805	ENST00000251496;ENST00000510063	.	.	.	5.01	4.16	0.48862	.	0.193867	0.45606	D	0.000347	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.332	12.7885	0.57520	0.0:0.9203:0.0:0.0797	.	.	.	.	X	574;139	.	ENSP00000251496:S574X	S	+	2	0	NCAPG	17439066	1.000000	0.71417	0.963000	0.40424	0.804000	0.45430	3.753000	0.55180	2.309000	0.77851	0.585000	0.79938	TCA	.	.		0.343	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
PGM2	55276	hgsc.bcm.edu	37	4	37848658	37848658	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr4:37848658A>G	ENST00000381967.4	+	9	1214	c.1114A>G	c.(1114-1116)Acg>Gcg	p.T372A	PGM2_ENST00000544359.1_Missense_Mutation_p.T233A|PGM2_ENST00000537241.1_Missense_Mutation_p.T212A	NM_018290.3	NP_060760.2	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	372					carbohydrate metabolic process (GO:0005975)|deoxyribose phosphate catabolic process (GO:0046386)|galactose catabolic process (GO:0019388)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)|phosphopentomutase activity (GO:0008973)			breast(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	19						TCTCAAAGACACGTACATGTT	0.498																																					p.T372A		Atlas-SNP	.											.	PGM2	45	.	0			c.A1114G						.						131.0	134.0	133.0					4																	37848658		2203	4300	6503	SO:0001583	missense	55276	exon9			AAAGACACGTACA	BC010087	CCDS3443.1	4p14	2012-10-02			ENSG00000169299	ENSG00000169299	5.4.2.2		8906	protein-coding gene	gene with protein product	"""phosphopentomutase"""	172000				9549096	Standard	NM_018290		Approved	FLJ10983	uc011byb.1	Q96G03	OTTHUMG00000097813	ENST00000381967.4:c.1114A>G	chr4.hg19:g.37848658A>G	ENSP00000371393:p.Thr372Ala	77.0	0.0		70.0	27.0	NM_018290	B4E0G8|Q53FP5|Q5QTR0|Q9H0P9|Q9NV22	Missense_Mutation	SNP	ENST00000381967.4	hg19	CCDS3443.1	.	.	.	.	.	.	.	.	.	.	A	8.416	0.845297	0.16963	.	.	ENSG00000169299	ENST00000381967;ENST00000544359;ENST00000537241	T;T;T	0.39406	1.08;1.08;1.08	5.78	-1.26	0.09376	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.660508	0.16568	N	0.208754	T	0.14013	0.0339	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.0;0.004	T	0.14117	-1.0484	10	0.12430	T	0.62	1.0458	0.4514	0.00501	0.385:0.1291:0.2342:0.2516	.	372;233	Q96G03;B4E0G8	PGM2_HUMAN;.	A	372;233;212	ENSP00000371393:T372A;ENSP00000438025:T233A;ENSP00000437342:T212A	ENSP00000371393:T372A	T	+	1	0	PGM2	37525053	0.000000	0.05858	0.072000	0.20136	0.411000	0.31082	0.044000	0.13992	0.098000	0.17522	0.533000	0.62120	ACG	.	.		0.498	PGM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215079.2	NM_018290	
LARP1B	55132	hgsc.bcm.edu	37	4	129043173	129043173	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr4:129043173A>G	ENST00000326639.6	+	11	1565	c.1354A>G	c.(1354-1356)Act>Gct	p.T452A	LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000512292.1_Missense_Mutation_p.T452A|LARP1B_ENST00000441387.1_Missense_Mutation_p.T452A|LARP1B_ENST00000427266.1_Missense_Mutation_p.T452A|LARP1B_ENST00000264584.5_Missense_Mutation_p.T405A	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	452						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TTTGATTGTAACTCAGACACC	0.363																																					p.T452A		Atlas-SNP	.											.	LARP1B	120	.	0			c.A1354G						.						95.0	92.0	93.0					4																	129043173		2203	4298	6501	SO:0001583	missense	55132	exon11			ATTGTAACTCAGA		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1354A>G	chr4.hg19:g.129043173A>G	ENSP00000321997:p.Thr452Ala	244.0	0.0		196.0	74.0	NM_178043	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	hg19	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.69|14.69	2.610270|2.610270	0.46527|0.46527	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000507377|ENST00000326639;ENST00000512292;ENST00000508819;ENST00000264584;ENST00000441387;ENST00000427266	.|T;T;T;T;T;T	.|0.62498	.|0.58;0.04;0.05;0.81;0.55;0.02	5.27|5.27	4.1|4.1	0.47936|0.47936	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77356|0.77356	0.4118|0.4118	M|M	0.76938|0.76938	2.355|2.355	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;0.998	.|D;D;D	.|0.91635	.|0.999;0.998;0.994	T|T	0.78966|0.78966	-0.1995|-0.1995	5|10	.|0.72032	.|D	.|0.01	.|.	11.0305|11.0305	0.47769|0.47769	0.9276:0.0:0.0723:0.0|0.9276:0.0:0.0723:0.0	.|.	.|405;452;452	.|D6RJB0;Q659C4;G3XAJ5	.|.;LAR1B_HUMAN;.	S|A	420|452;452;405;405;452;452	.|ENSP00000321997:T452A;ENSP00000422850:T452A;ENSP00000427281:T405A;ENSP00000264584:T405A;ENSP00000396521:T452A;ENSP00000403586:T452A	.|ENSP00000264584:T405A	N|T	+|+	2|1	0|0	LARP1B|LARP1B	129262623|129262623	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.052000|0.052000	0.14988|0.14988	8.794000|8.794000	0.91867|0.91867	1.030000|1.030000	0.39839|0.39839	-0.256000|-0.256000	0.11100|0.11100	AAC|ACT	.	.		0.363	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
DCP2	167227	hgsc.bcm.edu	37	5	112339697	112339697	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr5:112339697T>C	ENST00000389063.2	+	8	1063	c.865T>C	c.(865-867)Tgg>Cgg	p.W289R	DCP2_ENST00000515408.1_Missense_Mutation_p.W289R|DCP2_ENST00000543319.1_Missense_Mutation_p.W78R	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	289					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		TGGTGACCAGTGGGTAAAGCA	0.393																																					p.W289R		Atlas-SNP	.											.	DCP2	34	.	0			c.T865C						.						71.0	67.0	68.0					5																	112339697		2202	4300	6502	SO:0001583	missense	167227	exon8			GACCAGTGGGTAA	AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.865T>C	chr5.hg19:g.112339697T>C	ENSP00000373715:p.Trp289Arg	207.0	0.0		208.0	73.0	NM_152624	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Missense_Mutation	SNP	ENST00000389063.2	hg19	CCDS34210.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.33|17.33	3.362825|3.362825	0.61403|0.61403	.|.	.|.	ENSG00000172795|ENSG00000172795	ENST00000513585|ENST00000515408;ENST00000389063;ENST00000543319	.|T;T	.|0.41400	.|1.02;1.0	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.265855	.|0.41001	.|D	.|0.000979	T|T	0.28433|0.28433	0.0703|0.0703	L|L	0.29908|0.29908	0.895|0.895	0.44188|0.44188	D|D	0.997004|0.997004	.|P;P	.|0.45283	.|0.846;0.855	.|B;B	.|0.39258	.|0.295;0.216	T|T	0.06267|0.06267	-1.0836|-1.0836	5|10	.|0.15952	.|T	.|0.53	.|.	11.2467|11.2467	0.49002|0.49002	0.1364:0.0:0.0:0.8636|0.1364:0.0:0.0:0.8636	.|.	.|289;289	.|Q8IU60-2;Q8IU60	.|.;DCP2_HUMAN	A|R	270|289;289;78	.|ENSP00000425770:W289R;ENSP00000373715:W289R	.|ENSP00000373715:W289R	V|W	+|+	2|1	0|0	DCP2|DCP2	112367596|112367596	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.895000|0.895000	0.52256|0.52256	3.356000|3.356000	0.52269|0.52269	2.202000|2.202000	0.70862|0.70862	0.523000|0.523000	0.50628|0.50628	GTG|TGG	.	.		0.393	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370765.3	NM_152624	
PCDHB1	29930	hgsc.bcm.edu	37	5	140431371	140431371	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr5:140431371T>C	ENST00000306549.3	+	1	393	c.316T>C	c.(316-318)Ttt>Ctt	p.F106L		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	106	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCTGCACTTTGAAGTAGT	0.522																																					p.F106L		Atlas-SNP	.											.	PCDHB1	148	.	0			c.T316C						.						57.0	62.0	60.0					5																	140431371		2203	4300	6503	SO:0001583	missense	29930	exon1			CTGCACTTTGAAG	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.316T>C	chr5.hg19:g.140431371T>C	ENSP00000307234:p.Phe106Leu	123.0	0.0		108.0	42.0	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	hg19	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479205	0.26511	.	.	ENSG00000171815	ENST00000306549	T	0.23147	1.92	5.81	5.81	0.92471	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.49305	D	0.000160	T	0.29783	0.0744	L	0.33093	0.98	0.35298	D	0.782752	B	0.27932	0.194	B	0.40256	0.324	T	0.39099	-0.9630	10	0.41790	T	0.15	.	16.162	0.81727	0.0:0.0:0.0:1.0	.	106	Q9Y5F3	PCDB1_HUMAN	L	106	ENSP00000307234:F106L	ENSP00000307234:F106L	F	+	1	0	PCDHB1	140411555	0.338000	0.24775	1.000000	0.80357	0.621000	0.37620	0.647000	0.24812	2.224000	0.72417	0.533000	0.62120	TTT	.	.		0.522	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
DSP	1832	hgsc.bcm.edu	37	6	7568673	7568673	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:7568673G>T	ENST00000379802.3	+	11	1611	c.1270G>T	c.(1270-1272)Gaa>Taa	p.E424*	DSP_ENST00000418664.2_Nonsense_Mutation_p.E424*	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	424	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATTGCAGAAAGAACGAGAGAA	0.393																																					p.E424X		Atlas-SNP	.											.	DSP	306	.	0			c.G1270T						.						97.0	95.0	95.0					6																	7568673		2203	4300	6503	SO:0001587	stop_gained	1832	exon11			CAGAAAGAACGAG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1270G>T	chr6.hg19:g.7568673G>T	ENSP00000369129:p.Glu424*	97.0	0.0		59.0	25.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Nonsense_Mutation	SNP	ENST00000379802.3	hg19	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	42	9.437047	0.99171	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	.	.	.	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	.	.	.	X	424;424;229	.	ENSP00000369129:E424X	E	+	1	0	DSP	7513672	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.961000	0.87903	2.788000	0.95919	0.650000	0.86243	GAA	.	.		0.393	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
PPP1R10	5514	hgsc.bcm.edu	37	6	30571840	30571840	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:30571840T>C	ENST00000376511.2	-	14	2005	c.1453A>G	c.(1453-1455)Atc>Gtc	p.I485V		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	485	Interaction with WDR82. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						TCAGCCTGGATATATCGCTCC	0.582																																					p.I485V		Atlas-SNP	.											.	PPP1R10	60	.	0			c.A1453G						.						104.0	116.0	112.0					6																	30571840		2203	4300	6503	SO:0001583	missense	5514	exon14			CCTGGATATATCG	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.1453A>G	chr6.hg19:g.30571840T>C	ENSP00000365694:p.Ile485Val	89.0	0.0		45.0	17.0	NM_002714	O00405	Missense_Mutation	SNP	ENST00000376511.2	hg19	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	T	8.861	0.947055	0.18356	.	.	ENSG00000204569	ENST00000376511	T	0.27104	1.69	4.71	2.33	0.28932	.	0.350989	0.31760	N	0.007113	T	0.05044	0.0135	N	0.17631	0.505	0.28869	N	0.895072	B	0.02656	0.0	B	0.04013	0.001	T	0.37056	-0.9722	10	0.27785	T	0.31	-13.2476	8.2445	0.31680	0.0:0.1949:0.0:0.8051	.	485	Q96QC0	PP1RA_HUMAN	V	485	ENSP00000365694:I485V	ENSP00000365694:I485V	I	-	1	0	PPP1R10	30679819	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	3.392000	0.52537	0.834000	0.34852	0.383000	0.25322	ATC	.	.		0.582	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714	
STK19	8859	hgsc.bcm.edu	37	6	31939824	31939824	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:31939824G>C	ENST00000375333.2	+	1	104	c.51G>C	c.(49-51)tgG>tgC	p.W17C	STK19_ENST00000375331.2_Missense_Mutation_p.W17C|DXO_ENST00000478221.1_5'UTR|DXO_ENST00000375349.3_5'UTR|DXO_ENST00000337523.5_5'UTR|DXO_ENST00000375356.3_5'Flank	NM_032454.1	NP_115830.1	P49842	STK19_HUMAN	serine/threonine kinase 19	17					protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			skin(5)|upper_aerodigestive_tract(2)	7						AGCGACAGTGGCGGGCAAACC	0.632																																					p.W17C		Atlas-SNP	.											.	STK19	33	.	0			c.G51C						.						76.0	85.0	82.0					6																	31939824		2203	4300	6503	SO:0001583	missense	8859	exon1			ACAGTGGCGGGCA	X77474	CCDS4733.1, CCDS34417.1	6p21.33	2011-09-15			ENSG00000204344	ENSG00000204344			11398	protein-coding gene	gene with protein product		604977				8012361, 9812991	Standard	NM_032454		Approved	D6S60, G11, RP1	uc003nyv.3	P49842	OTTHUMG00000166424	ENST00000375333.2:c.51G>C	chr6.hg19:g.31939824G>C	ENSP00000364482:p.Trp17Cys	111.0	0.0		80.0	15.0	NM_032454	A6NF95|A6NFW8|B0QZR5|Q13159|Q31617|Q5JP77|Q5ST72|Q5ST75	Missense_Mutation	SNP	ENST00000375333.2	hg19	CCDS4733.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669176	0.29604	.	.	ENSG00000204344	ENST00000460018;ENST00000375331;ENST00000375333	T;T;T	0.56444	0.46;1.48;1.47	4.46	0.348	0.16026	.	.	.	.	.	T	0.20373	0.0490	N	0.14661	0.345	0.09310	N	1	D;P;P	0.63046	0.992;0.867;0.79	P;B;B	0.51385	0.668;0.325;0.173	T	0.07328	-1.0778	9	0.87932	D	0	.	1.4823	0.02439	0.1951:0.1665:0.4673:0.1711	.	17;17;17	B4E0M4;P49842-2;P49842	.;.;STK19_HUMAN	C	17	ENSP00000418350:W17C;ENSP00000364480:W17C;ENSP00000364482:W17C	ENSP00000364480:W17C	W	+	3	0	STK19	32047803	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-1.659000	0.01975	-0.056000	0.13221	0.561000	0.74099	TGG	.	.		0.632	STK19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076484.3		
KIF6	221458	hgsc.bcm.edu	37	6	39387781	39387781	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:39387781T>C	ENST00000287152.7	-	15	1849		c.e15-2		KIF6_ENST00000538893.1_Splice_Site|KIF6_ENST00000541946.1_Splice_Site|KIF6_ENST00000373213.4_Splice_Site|KIF6_ENST00000373216.3_Splice_Site|KIF6_ENST00000394362.1_Splice_Site|KIF6_ENST00000373215.3_Splice_Site|KIF6_ENST00000229913.5_Splice_Site	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TCAGAAAATCTGGAGGGGAAA	0.323																																					.		Atlas-SNP	.											.	KIF6	233	.	0			c.1755-2A>G						.						90.0	94.0	92.0					6																	39387781		2203	4300	6503	SO:0001630	splice_region_variant	221458	exon16			AAAATCTGGAGGG	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1755-2A>G	chr6.hg19:g.39387781T>C		148.0	0.0		135.0	40.0	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Splice_Site	SNP	ENST00000287152.7	hg19	CCDS4844.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.313409	0.60414	.	.	ENSG00000164627	ENST00000287152;ENST00000458470;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000373215;ENST00000538893;ENST00000541946;ENST00000540362	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6796	0.51451	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF6	39495759	0.999000	0.42202	0.978000	0.43139	0.880000	0.50808	3.356000	0.52269	2.246000	0.74042	0.533000	0.62120	.	.	.		0.323	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	Intron
GPR116	221395	hgsc.bcm.edu	37	6	46828584	46828584	+	Silent	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:46828584C>A	ENST00000283296.7	-	16	2535	c.2247G>T	c.(2245-2247)ctG>ctT	p.L749L	GPR116_ENST00000456426.2_Silent_p.L607L|GPR116_ENST00000362015.4_Silent_p.L749L|GPR116_ENST00000265417.7_Silent_p.L749L|GPR116_ENST00000545669.1_Silent_p.L178L	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	749					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			AAAGATCCTTCAGGTATGTAG	0.413																																					p.L749L	NSCLC(59;410 1274 8751 36715 50546)	Atlas-SNP	.											.	GPR116	133	.	0			c.G2247T						.						103.0	101.0	102.0					6																	46828584		2203	4300	6503	SO:0001819	synonymous_variant	221395	exon16			ATCCTTCAGGTAT	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2247G>T	chr6.hg19:g.46828584C>A		95.0	0.0		91.0	9.0	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Silent	SNP	ENST00000283296.7	hg19	CCDS4919.1																																																																																			.	.		0.413	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
BAG2	9532	hgsc.bcm.edu	37	6	57037534	57037534	+	Silent	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:57037534G>T	ENST00000370693.5	+	1	411	c.39G>T	c.(37-39)ggG>ggT	p.G13G	RP11-203B9.4_ENST00000589394.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000586234.1_RNA|RP11-203B9.4_ENST00000592785.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000609545.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589312.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000588819.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000585414.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000590164.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|BAG2_ENST00000545080.1_5'Flank	NM_004282.3	NP_004273.1	O95816	BAG2_HUMAN	BCL2-associated athanogene 2	13					protein folding (GO:0006457)|protein metabolic process (GO:0019538)		identical protein binding (GO:0042802)			endometrium(1)|large_intestine(1)	2	Lung NSC(77;0.126)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CCAACGAGGGGCGCTTCTGCC	0.692																																					p.G13G		Atlas-SNP	.											.	BAG2	10	.	0			c.G39T						.						31.0	27.0	28.0					6																	57037534		2200	4297	6497	SO:0001819	synonymous_variant	9532	exon1			CGAGGGGCGCTTC	AF095192	CCDS4961.1	6p12.3-p11.2	2008-02-05			ENSG00000112208	ENSG00000112208			938	protein-coding gene	gene with protein product		603882				9873016	Standard	NM_004282		Approved		uc003pdr.3	O95816	OTTHUMG00000014919	ENST00000370693.5:c.39G>T	chr6.hg19:g.57037534G>T		239.0	0.0		214.0	48.0	NM_004282	B4DXE2|Q08AS9|Q6FID0	Silent	SNP	ENST00000370693.5	hg19	CCDS4961.1																																																																																			.	.		0.692	BAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041044.2		
FHL5	9457	hgsc.bcm.edu	37	6	97052637	97052637	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:97052637C>A	ENST00000326771.2	+	4	551	c.171C>A	c.(169-171)taC>taA	p.Y57*	FHL5_ENST00000541107.1_Nonsense_Mutation_p.Y57*	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	57	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		ATCTTTGTTACAAAGACCGGC	0.428																																					p.Y57X		Atlas-SNP	.											.	FHL5	73	.	0			c.C171A						.						79.0	74.0	76.0					6																	97052637		2203	4300	6503	SO:0001587	stop_gained	9457	exon4			TTGTTACAAAGAC	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.171C>A	chr6.hg19:g.97052637C>A	ENSP00000326022:p.Tyr57*	63.0	0.0		57.0	16.0	NM_020482	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Nonsense_Mutation	SNP	ENST00000326771.2	hg19	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011812	0.93346	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	.	.	.	5.36	3.57	0.40892	.	0.000000	0.41001	D	0.000972	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3192	0.32119	0.0:0.7007:0.0:0.2993	.	.	.	.	X	57	.	ENSP00000326022:Y57X	Y	+	3	2	FHL5	97159358	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.789000	0.26886	0.747000	0.32809	0.655000	0.94253	TAC	.	.		0.428	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
PNLDC1	154197	hgsc.bcm.edu	37	6	160240288	160240288	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr6:160240288C>T	ENST00000610273.1	+	18	1574	c.1403C>T	c.(1402-1404)gCg>gTg	p.A468V	PNLDC1_ENST00000392167.3_Missense_Mutation_p.A479V	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	468						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TTTGGCAGTGCGCGGAACATC	0.597																																					p.A468V		Atlas-SNP	.											.	PNLDC1	66	.	0			c.C1403T						.						96.0	74.0	81.0					6																	160240288		2203	4300	6503	SO:0001583	missense	154197	exon18			GCAGTGCGCGGAA	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1403C>T	chr6.hg19:g.160240288C>T	ENSP00000476448:p.Ala468Val	54.0	0.0		43.0	18.0	NM_173516	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	hg19	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	C	9.613	1.131898	0.21041	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.86	3.11	0.35812	.	0.225470	0.31381	N	0.007748	T	0.04092	0.0114	N	0.04880	-0.145	0.09310	N	1	B;B	0.17667	0.023;0.009	B;B	0.09377	0.003;0.004	T	0.41179	-0.9523	9	0.07030	T	0.85	.	6.2774	0.20989	0.0:0.6582:0.0:0.3418	.	479;468	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	V	468;479	.	ENSP00000275275:A468V	A	+	2	0	PNLDC1	160160278	0.230000	0.23740	0.042000	0.18584	0.001000	0.01503	1.676000	0.37565	1.482000	0.48325	0.561000	0.74099	GCG	.	.		0.597	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
TAS2R60	338398	hgsc.bcm.edu	37	7	143141236	143141236	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr7:143141236A>G	ENST00000332690.1	+	1	691	c.691A>G	c.(691-693)Acc>Gcc	p.T231A	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	231					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					TCTCCTTACAACCTCAGGATT	0.463																																					p.T231A		Atlas-SNP	.											.	TAS2R60	55	.	0			c.A691G						.						121.0	124.0	123.0					7																	143141236		2203	4300	6503	SO:0001583	missense	338398	exon1			CTTACAACCTCAG	AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.691A>G	chr7.hg19:g.143141236A>G	ENSP00000327724:p.Thr231Ala	77.0	0.0		42.0	26.0	NM_177437	A4D2G8|Q645W8|Q7RTR7	Missense_Mutation	SNP	ENST00000332690.1	hg19	CCDS5885.1	.	.	.	.	.	.	.	.	.	.	A	2.387	-0.340668	0.05243	.	.	ENSG00000185899	ENST00000332690	T	0.35789	1.29	5.47	-1.98	0.07480	.	1.366100	0.05290	U	0.520835	T	0.14442	0.0349	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.23332	-1.0191	10	0.02654	T	1	.	5.226	0.15396	0.3391:0.323:0.3379:0.0	.	231	P59551	T2R60_HUMAN	A	231	ENSP00000327724:T231A	ENSP00000327724:T231A	T	+	1	0	TAS2R60	142851358	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.295000	0.08298	-0.286000	0.09076	0.482000	0.46254	ACC	.	.		0.463	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337541.1		
CSMD1	64478	hgsc.bcm.edu	37	8	3087644	3087644	+	Silent	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:3087644A>G	ENST00000520002.1	-	28	4821	c.4266T>C	c.(4264-4266)taT>taC	p.Y1422Y	CSMD1_ENST00000537824.1_Silent_p.Y1421Y|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602723.1_Silent_p.Y1422Y|CSMD1_ENST00000400186.3_Silent_p.Y1422Y|CSMD1_ENST00000542608.1_Silent_p.Y1421Y|CSMD1_ENST00000602557.1_Silent_p.Y1422Y|CSMD1_ENST00000539096.1_Silent_p.Y1421Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1422	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.Y1421Y(1)|p.Y1150Y(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTGGAGCTGATAGCCAGGGT	0.522																																					p.Y1421Y		Atlas-SNP	.											CSMD1_ENST00000537824,NS,carcinoma,0,2	CSMD1	1469	.	2	Substitution - coding silent(2)	kidney(2)	c.T4263C						.						92.0	92.0	92.0					8																	3087644		1989	4169	6158	SO:0001819	synonymous_variant	64478	exon27			GAGCTGATAGCCA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4266T>C	chr8.hg19:g.3087644A>G		148.0	0.0		58.0	16.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.756	1.168829	0.21621	.	.	ENSG00000183117	ENST00000335551	.	.	.	6.16	-2.87	0.05700	.	.	.	.	.	T	0.64011	0.2560	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63532	-0.6616	4	.	.	.	.	14.166	0.65477	0.8398:0.0:0.1602:0.0	.	.	.	.	P	902	.	.	S	-	1	0	CSMD1	3075051	0.992000	0.36948	0.819000	0.32651	0.880000	0.50808	0.289000	0.18957	-0.354000	0.08212	0.528000	0.53228	TCA	.	.		0.522	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSMD1	64478	hgsc.bcm.edu	37	8	3326340	3326340	+	Silent	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:3326340C>A	ENST00000520002.1	-	13	2013	c.1458G>T	c.(1456-1458)acG>acT	p.T486T	CSMD1_ENST00000537824.1_Silent_p.T485T|CSMD1_ENST00000602723.1_Silent_p.T486T|CSMD1_ENST00000400186.3_Silent_p.T486T|CSMD1_ENST00000542608.1_Silent_p.T485T|CSMD1_ENST00000602557.1_Silent_p.T486T|CSMD1_ENST00000539096.1_Silent_p.T485T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	486	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.T485T(2)|p.T214T(2)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CACTGGATCCCGTGAGCCTGC	0.468																																					p.T485T		Atlas-SNP	.											CSMD1_ENST00000537824,NS,lymphoid_neoplasm,0,4	CSMD1	1469	.	4	Substitution - coding silent(4)	haematopoietic_and_lymphoid_tissue(4)	c.G1455T						.						51.0	50.0	50.0					8																	3326340		1950	4151	6101	SO:0001819	synonymous_variant	64478	exon12			GGATCCCGTGAGC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1458G>T	chr8.hg19:g.3326340C>A		46.0	0.0		18.0	6.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	hg19																																																																																				.	.		0.468	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
DLC1	10395	hgsc.bcm.edu	37	8	12952358	12952358	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:12952358C>A	ENST00000276297.4	-	12	3845	c.3436G>T	c.(3436-3438)Gtg>Ttg	p.V1146L	DLC1_ENST00000512044.2_Missense_Mutation_p.V743L|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Missense_Mutation_p.V635L|DLC1_ENST00000358919.2_Missense_Mutation_p.V709L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1146	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						ATGTCTGCCACGTCATAAGCA	0.483																																					p.V1146L		Atlas-SNP	.											.	DLC1	411	.	0			c.G3436T						.						95.0	90.0	92.0					8																	12952358		2203	4300	6503	SO:0001583	missense	10395	exon12			CTGCCACGTCATA	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3436G>T	chr8.hg19:g.12952358C>A	ENSP00000276297:p.Val1146Leu	115.0	0.0		36.0	15.0	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	hg19	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	35	5.525498	0.96431	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	4.97	4.97	0.65823	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.058370	0.64402	D	0.000002	T	0.53061	0.1773	M	0.76727	2.345	0.80722	D	1	P;D;P	0.76494	0.868;0.999;0.811	P;D;P	0.73380	0.654;0.98;0.654	T	0.56390	-0.7987	10	0.87932	D	0	.	18.8143	0.92071	0.0:1.0:0.0:0.0	.	1146;743;709	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	L	1146;709;85;743;635	ENSP00000276297:V1146L;ENSP00000351797:V709L;ENSP00000422595:V743L;ENSP00000428028:V635L	ENSP00000276297:V1146L	V	-	1	0	DLC1	12996729	1.000000	0.71417	0.972000	0.41901	0.995000	0.86356	7.646000	0.83445	2.761000	0.94854	0.650000	0.86243	GTG	.	.		0.483	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
PSD3	23362	hgsc.bcm.edu	37	8	18658787	18658787	+	Silent	SNP	A	A	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:18658787A>C	ENST00000327040.8	-	7	2118	c.2016T>G	c.(2014-2016)gcT>gcG	p.A672A	PSD3_ENST00000523619.1_Silent_p.A607A|PSD3_ENST00000286485.8_Silent_p.A138A|PSD3_ENST00000440756.2_Silent_p.A672A	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	672	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		TACCTTGTGAAGCAATGGTAT	0.289																																					p.A672A		Atlas-SNP	.											.	PSD3	142	.	0			c.T2016G						.						50.0	55.0	54.0					8																	18658787		2200	4285	6485	SO:0001819	synonymous_variant	23362	exon7			TTGTGAAGCAATG	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2016T>G	chr8.hg19:g.18658787A>C		505.0	0.0		194.0	76.0	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Silent	SNP	ENST00000327040.8	hg19	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	A	7.207	0.594581	0.13875	.	.	ENSG00000156011	ENST00000520858	.	.	.	5.79	2.0	0.26442	.	.	.	.	.	T	0.52677	0.1749	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45804	-0.9236	4	.	.	.	.	5.8298	0.18574	0.6901:0.1446:0.1653:0.0	.	.	.	.	V	105	.	.	F	-	1	0	PSD3	18703067	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	0.722000	0.25925	1.029000	0.39812	0.523000	0.50628	TTC	.	.		0.289	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
VPS13B	157680	hgsc.bcm.edu	37	8	100127975	100127975	+	Silent	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:100127975A>G	ENST00000358544.2	+	7	921	c.810A>G	c.(808-810)caA>caG	p.Q270Q	VPS13B_ENST00000395996.1_Silent_p.Q270Q|VPS13B_ENST00000357162.2_Silent_p.Q270Q|VPS13B_ENST00000441350.2_Silent_p.Q270Q|VPS13B_ENST00000355155.1_Silent_p.Q270Q	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	270					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CAGATCAACAACTGCCTATGT	0.323																																					p.Q270Q	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.A810G						.						88.0	89.0	89.0					8																	100127975		2203	4293	6496	SO:0001819	synonymous_variant	157680	exon7			TCAACAACTGCCT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.810A>G	chr8.hg19:g.100127975A>G		388.0	0.0		747.0	50.0	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	hg19	CCDS6280.1																																																																																			.	.		0.323	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
LRP12	29967	hgsc.bcm.edu	37	8	105509945	105509945	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:105509945A>C	ENST00000276654.5	-	5	943	c.835T>G	c.(835-837)Tat>Gat	p.Y279D	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.Y260D	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	279	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CCAGGAGGATAAAAGTCTGGA	0.398																																					p.Y279D		Atlas-SNP	.											.	LRP12	124	.	0			c.T835G						.						63.0	66.0	65.0					8																	105509945		2203	4300	6503	SO:0001583	missense	29967	exon5			GAGGATAAAAGTC	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.835T>G	chr8.hg19:g.105509945A>C	ENSP00000276654:p.Tyr279Asp	146.0	0.0		240.0	192.0	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	hg19	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	A	19.76	3.888207	0.72524	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.29655	1.56;1.56	5.66	5.66	0.87406	CUB (5);	0.000000	0.85682	D	0.000000	T	0.63815	0.2543	M	0.91612	3.225	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.69258	-0.5192	10	0.37606	T	0.19	-31.0306	15.9017	0.79384	1.0:0.0:0.0:0.0	.	260;279	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	D	260;279	ENSP00000399148:Y260D;ENSP00000276654:Y279D	ENSP00000276654:Y279D	Y	-	1	0	LRP12	105579121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.153000	0.67306	0.460000	0.39030	TAT	.	.		0.398	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110457250	110457250	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:110457250G>A	ENST00000378402.5	+	38	5256	c.5152G>A	c.(5152-5154)Gcc>Acc	p.A1718T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1718	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATCCCCTGCTGCCCAACAGCT	0.443										HNSCC(38;0.096)																											p.A1718T		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G5152A						.						201.0	194.0	196.0					8																	110457250		1918	4130	6048	SO:0001583	missense	93035	exon38			CCTGCTGCCCAAC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5152G>A	chr8.hg19:g.110457250G>A	ENSP00000367655:p.Ala1718Thr	131.0	0.0		276.0	30.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	1.711	-0.498998	0.04291	.	.	ENSG00000205038	ENST00000378402	T	0.76839	-1.05	6.17	3.45	0.39498	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.560686	0.18974	N	0.126079	T	0.51398	0.1672	N	0.11756	0.17	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.35325	-0.9793	10	0.07030	T	0.85	.	2.9744	0.05933	0.1417:0.5556:0.1485:0.1542	.	1718	Q86WI1	PKHL1_HUMAN	T	1718	ENSP00000367655:A1718T	ENSP00000367655:A1718T	A	+	1	0	PKHD1L1	110526426	0.000000	0.05858	0.358000	0.25811	0.375000	0.29983	-0.201000	0.09464	0.493000	0.27837	-0.165000	0.13383	GCC	.	.		0.443	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CSMD3	114788	hgsc.bcm.edu	37	8	113249531	113249531	+	Silent	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:113249531G>A	ENST00000297405.5	-	67	10759	c.10515C>T	c.(10513-10515)taC>taT	p.Y3505Y	CSMD3_ENST00000343508.3_Silent_p.Y3465Y|CSMD3_ENST00000352409.3_Silent_p.Y3435Y|CSMD3_ENST00000455883.2_Silent_p.Y3336Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3505						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTTGAAATTGTAAGAGCCTT	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.Y3505Y		Atlas-SNP	.											.	CSMD3	2325	.	0			c.C10515T						.						157.0	144.0	148.0					8																	113249531		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon67			GAAATTGTAAGAG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10515C>T	chr8.hg19:g.113249531G>A		140.0	1.0		193.0	151.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
EXT1	2131	hgsc.bcm.edu	37	8	119122935	119122935	+	Silent	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr8:119122935G>A	ENST00000378204.2	-	1	1157	c.351C>T	c.(349-351)taC>taT	p.Y117Y		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	117					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			GTGGGTATACGTAGACTTTGA	0.512			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.Y117Y		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	EXT1	98	.	0			c.C351T						.						78.0	82.0	81.0					8																	119122935		2203	4300	6503	SO:0001819	synonymous_variant	2131	exon1	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	GTATACGTAGACT	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.351C>T	chr8.hg19:g.119122935G>A		233.0	0.0		354.0	19.0	NM_000127	B2R7V2|Q9BVI9	Silent	SNP	ENST00000378204.2	hg19	CCDS6324.1																																																																																			.	.		0.512	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
PTAR1	375743	hgsc.bcm.edu	37	9	72374805	72374805	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr9:72374805T>C	ENST00000340434.4	-	1	53	c.50A>G	c.(49-51)aAg>aGg	p.K17R	PTAR1_ENST00000472967.2_Missense_Mutation_p.K17R|PTAR1_ENST00000377200.5_Missense_Mutation_p.K17R	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	17					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						AGTGATGTCCTTCACAACCCG	0.726																																					p.K17R		Atlas-SNP	.											.	PTAR1	46	.	0			c.A50G						.						15.0	18.0	17.0					9																	72374805		2026	4141	6167	SO:0001583	missense	375743	exon1			ATGTCCTTCACAA	BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.50A>G	chr9.hg19:g.72374805T>C	ENSP00000344299:p.Lys17Arg	170.0	0.0		96.0	44.0	NM_001099666	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	hg19	CCDS47978.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.004203	0.35320	.	.	ENSG00000188647	ENST00000377200;ENST00000340434;ENST00000472967	.	.	.	4.05	2.72	0.32119	.	0.130381	0.49916	D	0.000137	T	0.29158	0.0725	L	0.27053	0.805	0.22017	N	0.999412	B	0.27791	0.189	B	0.34991	0.193	T	0.23547	-1.0185	9	0.18710	T	0.47	-0.6132	9.0194	0.36191	0.2162:0.0:0.0:0.7838	.	17	Q7Z6K3	PTAR1_HUMAN	R	17	.	ENSP00000344299:K17R	K	-	2	0	PTAR1	71564625	1.000000	0.71417	0.960000	0.40013	0.733000	0.41908	2.881000	0.48538	0.392000	0.25172	0.240000	0.17902	AAG	.	.		0.726	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666	
HELLS	3070	hgsc.bcm.edu	37	10	96350289	96350289	+	Silent	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr10:96350289G>A	ENST00000348459.5	+	14	1713	c.1608G>A	c.(1606-1608)caG>caA	p.Q536Q	HELLS_ENST00000394036.1_3'UTR|RP11-119K6.6_ENST00000432120.1_RNA|HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394045.1_Silent_p.Q438Q|HELLS_ENST00000371332.4_Silent_p.Q582Q	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		GTCAAATACAGCCAGAGGTGG	0.333																																					p.Q536Q		Atlas-SNP	.											.	HELLS	63	.	0			c.G1608A						.						79.0	80.0	80.0					10																	96350289		2203	4299	6502	SO:0001819	synonymous_variant	3070	exon14			AATACAGCCAGAG	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.1608G>A	chr10.hg19:g.96350289G>A		330.0	0.0		183.0	36.0	NM_018063		Silent	SNP	ENST00000348459.5	hg19	CCDS7434.1																																																																																			.	.		0.333	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
NHLRC2	374354	hgsc.bcm.edu	37	10	115662337	115662337	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr10:115662337C>G	ENST00000369301.3	+	8	1691	c.1479C>G	c.(1477-1479)gaC>gaG	p.D493E		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	493										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		ATGTTGCAGACTCCTACAATC	0.388																																					p.D493E		Atlas-SNP	.											.	NHLRC2	56	.	0			c.C1479G						.						101.0	101.0	101.0					10																	115662337		2203	4300	6503	SO:0001583	missense	374354	exon8			TGCAGACTCCTAC	AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1479C>G	chr10.hg19:g.115662337C>G	ENSP00000358307:p.Asp493Glu	254.0	0.0		126.0	17.0	NM_198514	Q8N1H1|Q8N5A6	Missense_Mutation	SNP	ENST00000369301.3	hg19	CCDS7585.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600177	0.66332	.	.	ENSG00000196865	ENST00000369301	D	0.89939	-2.59	5.58	3.74	0.42951	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.94974	0.8374	H	0.95679	3.705	0.51767	D	0.999934	D	0.89917	1.0	D	0.97110	1.0	D	0.93837	0.7133	10	0.62326	D	0.03	-19.6535	5.7076	0.17917	0.0:0.692:0.0:0.308	.	493	Q8NBF2	NHLC2_HUMAN	E	493	ENSP00000358307:D493E	ENSP00000358307:D493E	D	+	3	2	NHLRC2	115652327	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	1.617000	0.36943	1.379000	0.46325	0.561000	0.74099	GAC	.	.		0.388	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514	
DCHS1	8642	hgsc.bcm.edu	37	11	6643621	6643621	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:6643621C>T	ENST00000299441.3	-	21	9697	c.9286G>A	c.(9286-9288)Ggg>Agg	p.G3096R	RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000299427.6_5'Flank|RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000528657.1_5'Flank|TPP1_ENST00000534644.1_5'Flank	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3096					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCAGCAGCCCTGCCTTTCGG	0.652																																					p.G3096R		Atlas-SNP	.											.	DCHS1	277	.	0			c.G9286A						.						10.0	10.0	10.0					11																	6643621		2185	4268	6453	SO:0001583	missense	8642	exon21			GCAGCCCTGCCTT	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9286G>A	chr11.hg19:g.6643621C>T	ENSP00000299441:p.Gly3096Arg	91.0	0.0		68.0	22.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	hg19	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.685795	0.47991	.	.	ENSG00000166341	ENST00000299441	T	0.56103	0.48	5.04	5.04	0.67666	.	0.159460	0.29515	N	0.011935	T	0.44808	0.1311	N	0.22421	0.69	0.52099	D	0.999944	P	0.50943	0.94	P	0.47915	0.561	T	0.19910	-1.0291	10	0.19590	T	0.45	.	15.2361	0.73432	0.0:1.0:0.0:0.0	.	3096	Q96JQ0	PCD16_HUMAN	R	3096	ENSP00000299441:G3096R	ENSP00000299441:G3096R	G	-	1	0	DCHS1	6600197	0.993000	0.37304	1.000000	0.80357	0.946000	0.59487	1.977000	0.40589	2.613000	0.88420	0.462000	0.41574	GGG	.	.		0.652	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
TRAF6	7189	hgsc.bcm.edu	37	11	36520132	36520132	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:36520132G>T	ENST00000526995.1	-	3	601	c.355C>A	c.(355-357)Cca>Aca	p.P119T	TRAF6_ENST00000348124.5_Missense_Mutation_p.P119T|TRAF6_ENST00000529150.1_5'Flank	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	119	Interaction with TAX1BP1.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				AAATTGTCTGGAAATAGTTGA	0.358																																					p.P119T		Atlas-SNP	.											.	TRAF6	56	.	0			c.C355A						.						111.0	103.0	106.0					11																	36520132		2202	4298	6500	SO:0001583	missense	7189	exon3			TGTCTGGAAATAG		CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.355C>A	chr11.hg19:g.36520132G>T	ENSP00000433623:p.Pro119Thr	102.0	0.0		55.0	13.0	NM_004620	A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	ENST00000526995.1	hg19	CCDS7901.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125643	0.77436	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	D;D	0.84146	-1.81;-1.81	5.43	5.43	0.79202	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.90786	0.7107	M	0.92219	3.285	0.80722	D	1	P	0.51791	0.948	P	0.45538	0.484	D	0.92974	0.6400	10	0.72032	D	0.01	-12.6803	19.6031	0.95572	0.0:0.0:1.0:0.0	.	119	Q9Y4K3	TRAF6_HUMAN	T	119	ENSP00000433623:P119T;ENSP00000337853:P119T	ENSP00000337853:P119T	P	-	1	0	TRAF6	36476708	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.708000	0.92522	0.655000	0.94253	CCA	.	.		0.358	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803	
KBTBD4	55709	hgsc.bcm.edu	37	11	47599068	47599068	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:47599068G>A	ENST00000526005.1	-	2	637	c.484C>T	c.(484-486)Ctc>Ttc	p.L162F	NDUFS3_ENST00000263774.4_5'Flank|NDUFS3_ENST00000534716.2_5'Flank|NDUFS3_ENST00000533507.1_Intron|NDUFS3_ENST00000529276.1_5'Flank|NDUFS3_ENST00000534208.1_5'Flank|KBTBD4_ENST00000395288.2_Missense_Mutation_p.L162F|KBTBD4_ENST00000525720.1_Missense_Mutation_p.L211F|RNU5E-10P_ENST00000363506.1_RNA|KBTBD4_ENST00000450908.1_5'Flank|NDUFS3_ENST00000528192.1_5'Flank|KBTBD4_ENST00000533290.1_Missense_Mutation_p.L187F|KBTBD4_ENST00000430070.2_Missense_Mutation_p.L178F			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	162	BACK.									NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						GCCGTATAGAGCTCAGGATCA	0.537																																					p.L178F		Atlas-SNP	.											.	KBTBD4	55	.	0			c.C532T						.						148.0	144.0	145.0					11																	47599068		2201	4298	6499	SO:0001583	missense	55709	exon2			TATAGAGCTCAGG	AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.484C>T	chr11.hg19:g.47599068G>A	ENSP00000433340:p.Leu162Phe	99.0	0.0		66.0	11.0	NM_018095	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	ENST00000526005.1	hg19	CCDS7940.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279711	0.80692	.	.	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000430070;ENST00000525720;ENST00000529499	D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	5.54	5.54	0.83059	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.91188	0.7224	M	0.85373	2.75	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.994;0.996;0.996	D	0.92107	0.5693	10	0.87932	D	0	-12.1682	19.478	0.94996	0.0:0.0:1.0:0.0	.	178;162;187	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	F	162;187;162;178;211;162	ENSP00000433340:L162F;ENSP00000436713:L187F;ENSP00000378703:L162F;ENSP00000415106:L178F;ENSP00000434477:L211F;ENSP00000433404:L162F	ENSP00000378703:L162F	L	-	1	0	KBTBD4	47555644	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.468000	0.60162	2.607000	0.88179	0.462000	0.41574	CTC	.	.		0.537	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000391763.1	NM_016506	
OR5R1	219479	hgsc.bcm.edu	37	11	56185178	56185178	+	Silent	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:56185178G>A	ENST00000312253.1	-	1	530	c.531C>T	c.(529-531)ttC>ttT	p.F177F		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					CATCACAATAGAAATGGTTAA	0.438																																					p.F177F		Atlas-SNP	.											.	OR5R1	83	.	0			c.C531T						.						102.0	96.0	98.0					11																	56185178		2201	4296	6497	SO:0001819	synonymous_variant	219479	exon1			ACAATAGAAATGG	AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.531C>T	chr11.hg19:g.56185178G>A		178.0	0.0		92.0	38.0	NM_001004744		Silent	SNP	ENST00000312253.1	hg19	CCDS31530.1																																																																																			.	.		0.438	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744	
TMEM223	79064	hgsc.bcm.edu	37	11	62558364	62558364	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:62558364G>C	ENST00000307366.7	-	2	366	c.340C>G	c.(340-342)Ctt>Gtt	p.L114V	TMEM223_ENST00000527073.1_Intron|NXF1_ENST00000533048.1_5'Flank|TMEM223_ENST00000525631.1_Intron	NM_001080501.2	NP_001073970.1	A0PJW6	TM223_HUMAN	transmembrane protein 223	114						integral component of membrane (GO:0016021)											GAGAAGAGAAGACCAGCACCG	0.597																																					p.L114V		Atlas-SNP	.											.	TMEM223	22	.	0			c.C340G						.						22.0	24.0	23.0					11																	62558364		2071	4201	6272	SO:0001583	missense	79064	exon2			AGAGAAGACCAGC		CCDS44628.1	11q12.3	2008-12-08				ENSG00000168569			28464	protein-coding gene	gene with protein product							Standard	NM_001080501		Approved	MGC3196	uc001nve.2	A0PJW6		ENST00000307366.7:c.340C>G	chr11.hg19:g.62558364G>C	ENSP00000303987:p.Leu114Val	125.0	0.0		65.0	32.0	NM_001080501	Q504S0|Q86YD4|Q8WUC5|Q96HG0	Missense_Mutation	SNP	ENST00000307366.7	hg19	CCDS44628.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362788	0.24684	.	.	ENSG00000168569	ENST00000307366	T	0.46819	0.86	5.32	2.36	0.29203	.	0.601836	0.15659	N	0.250987	T	0.38585	0.1046	L	0.53249	1.67	0.18873	N	0.999989	B	0.25563	0.129	B	0.23419	0.046	T	0.28870	-1.0030	10	0.41790	T	0.15	-5.3003	5.6699	0.17717	0.1686:0.3111:0.5203:0.0	.	114	A0PJW6	TM223_HUMAN	V	114	ENSP00000303987:L114V	ENSP00000303987:L114V	L	-	1	0	TMEM223	62314940	0.991000	0.36638	0.119000	0.21687	0.605000	0.37080	1.660000	0.37397	0.220000	0.20860	0.455000	0.32223	CTT	.	.		0.597	TMEM223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395674.1		
PGR	5241	hgsc.bcm.edu	37	11	100996767	100996767	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:100996767C>G	ENST00000325455.5	-	2	3213	c.1760G>C	c.(1759-1761)tGt>tCt	p.C587S	PGR_ENST00000263463.5_Missense_Mutation_p.C587S|PGR_ENST00000534013.1_5'UTR	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	587					cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	GAAGACCTTACAGCTCCCACA	0.413																																					p.C587S	Pancreas(124;2271 2354 21954 22882)	Atlas-SNP	.											.	PGR	115	.	0			c.G1760C						.						102.0	89.0	93.0					11																	100996767		2203	4300	6503	SO:0001583	missense	5241	exon2			ACCTTACAGCTCC	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.1760G>C	chr11.hg19:g.100996767C>G	ENSP00000325120:p.Cys587Ser	100.0	0.0		66.0	13.0	NM_000926	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	hg19	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669204	0.88348	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	D;D	0.99803	-6.82;-6.82	5.4	5.4	0.78164	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.99871	0.9939	H	0.96365	3.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96611	0.9452	10	0.72032	D	0.01	.	19.1896	0.93660	0.0:1.0:0.0:0.0	.	587;587	Q8TDS3;P06401	.;PRGR_HUMAN	S	587	ENSP00000325120:C587S;ENSP00000263463:C587S	ENSP00000263463:C587S	C	-	2	0	PGR	100501977	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.519000	0.84933	0.655000	0.94253	TGT	.	.		0.413	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
EXPH5	23086	hgsc.bcm.edu	37	11	108389093	108389093	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:108389093T>G	ENST00000265843.4	-	5	610	c.500A>C	c.(499-501)aAa>aCa	p.K167T	EXPH5_ENST00000428840.1_Missense_Mutation_p.K91T|EXPH5_ENST00000525344.1_Missense_Mutation_p.K160T|EXPH5_ENST00000443411.1_5'UTR|EXPH5_ENST00000524840.1_5'UTR	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	167					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		ATTGTATATTTTTGCCTGCTA	0.433																																					p.K167T		Atlas-SNP	.											.	EXPH5	193	.	0			c.A500C						.						61.0	55.0	57.0					11																	108389093		2201	4298	6499	SO:0001583	missense	23086	exon5			TATATTTTTGCCT		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.500A>C	chr11.hg19:g.108389093T>G	ENSP00000265843:p.Lys167Thr	95.0	0.0		60.0	18.0	NM_015065	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	hg19	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.641717	0.67244	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000525344;ENST00000439956;ENST00000526312	T;T;T;T	0.03386	4.11;4.03;4.11;3.95	5.12	3.97	0.46021	.	0.312451	0.28182	N	0.016294	T	0.11367	0.0277	M	0.67953	2.075	0.80722	D	1	D	0.67145	0.996	P	0.59948	0.866	T	0.00643	-1.1630	10	0.52906	T	0.07	-18.8221	9.0827	0.36561	0.0:0.0903:0.0:0.9097	.	167	Q8NEV8	EXPH5_HUMAN	T	167;91;160;11;91	ENSP00000265843:K167T;ENSP00000391966:K91T;ENSP00000432546:K160T;ENSP00000432683:K91T	ENSP00000265843:K167T	K	-	2	0	EXPH5	107894303	1.000000	0.71417	0.989000	0.46669	0.749000	0.42624	1.961000	0.40432	2.056000	0.61249	0.533000	0.62120	AAA	.	.		0.433	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
SIK2	23235	hgsc.bcm.edu	37	11	111591262	111591262	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr11:111591262T>C	ENST00000304987.3	+	11	1729	c.1556T>C	c.(1555-1557)aTg>aCg	p.M519T	SIK2_ENST00000533868.1_3'UTR	NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	519					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GAGTATGATATGGGGTCTGTT	0.458																																					p.M519T		Atlas-SNP	.											.	SIK2	89	.	0			c.T1556C						.						113.0	113.0	113.0					11																	111591262		2201	4297	6498	SO:0001583	missense	23235	exon11			ATGATATGGGGTC	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1556T>C	chr11.hg19:g.111591262T>C	ENSP00000305976:p.Met519Thr	145.0	0.0		83.0	16.0	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	hg19	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.265745	0.40095	.	.	ENSG00000170145	ENST00000304987	T	0.75367	-0.93	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	L	0.57536	1.79	0.58432	D	0.999999	B	0.26002	0.139	B	0.23574	0.047	T	0.65899	-0.6056	10	0.21540	T	0.41	.	15.4975	0.75666	0.0:0.0:0.0:1.0	.	519	Q9H0K1	SIK2_HUMAN	T	519	ENSP00000305976:M519T	ENSP00000305976:M519T	M	+	2	0	SIK2	111096472	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.434000	0.80377	2.324000	0.78689	0.533000	0.62120	ATG	.	.		0.458	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
PTPRR	5801	hgsc.bcm.edu	37	12	71155351	71155351	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr12:71155351A>G	ENST00000283228.2	-	4	979	c.527T>C	c.(526-528)aTt>aCt	p.I176T	PTPRR_ENST00000342084.4_Missense_Mutation_p.I64T	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	176					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGCATCAGAAATTCCTGTTTT	0.348																																					p.I176T		Atlas-SNP	.											.	PTPRR	109	.	0			c.T527C						.						132.0	130.0	131.0					12																	71155351		2203	4300	6503	SO:0001583	missense	5801	exon4			TCAGAAATTCCTG	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.527T>C	chr12.hg19:g.71155351A>G	ENSP00000283228:p.Ile176Thr	178.0	0.0		107.0	44.0	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	hg19	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	A	8.910	0.958480	0.18507	.	.	ENSG00000153233	ENST00000283228;ENST00000342084	T;T	0.33654	1.4;1.4	5.48	3.09	0.35607	.	0.764738	0.10983	U	0.612522	T	0.15739	0.0379	N	0.03608	-0.345	0.19300	N	0.99998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23976	-1.0173	10	0.25106	T	0.35	-0.7167	6.751	0.23487	0.7856:0.0:0.074:0.1404	.	64;176	F5GXR7;Q15256	.;PTPRR_HUMAN	T	176;64	ENSP00000283228:I176T;ENSP00000339605:I64T	ENSP00000283228:I176T	I	-	2	0	PTPRR	69441618	0.001000	0.12720	0.117000	0.21633	0.995000	0.86356	1.306000	0.33505	0.874000	0.35823	0.368000	0.22195	ATT	.	.		0.348	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
USP44	84101	hgsc.bcm.edu	37	12	95927545	95927545	+	Missense_Mutation	SNP	C	C	A	rs371620070		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr12:95927545C>A	ENST00000258499.3	-	2	776	c.488G>T	c.(487-489)cGa>cTa	p.R163L	USP44_ENST00000393091.2_Missense_Mutation_p.R163L|USP44_ENST00000552440.1_Missense_Mutation_p.R163L|USP44_ENST00000537435.2_Missense_Mutation_p.R163L	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	163					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R163Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						AAACCATGTTCGAAAGATTTT	0.373																																					p.R163L		Atlas-SNP	.											USP44,caecum,carcinoma,0,1	USP44	83	.	1	Substitution - Missense(1)	large_intestine(1)	c.G488T						.						108.0	107.0	107.0					12																	95927545		2203	4300	6503	SO:0001583	missense	84101	exon2			CATGTTCGAAAGA	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.488G>T	chr12.hg19:g.95927545C>A	ENSP00000258499:p.Arg163Leu	119.0	0.0		127.0	49.0	NM_032147	B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	hg19	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140562	0.37825	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000552440;ENST00000537435;ENST00000551837	T;T;T;T;T	0.50277	3.67;3.67;2.39;3.67;0.75	5.0	5.0	0.66597	.	0.059766	0.64402	D	0.000004	T	0.48502	0.1503	M	0.62723	1.935	0.58432	D	0.999998	B	0.32409	0.37	B	0.33890	0.172	T	0.44019	-0.9355	10	0.23302	T	0.38	.	18.6628	0.91477	0.0:1.0:0.0:0.0	.	163	Q9H0E7	UBP44_HUMAN	L	163	ENSP00000258499:R163L;ENSP00000376806:R163L;ENSP00000448670:R163L;ENSP00000442629:R163L;ENSP00000448601:R163L	ENSP00000258499:R163L	R	-	2	0	USP44	94451676	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	4.472000	0.60189	2.474000	0.83562	0.561000	0.74099	CGA	.	.		0.373	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
MYO16	23026	hgsc.bcm.edu	37	13	109777634	109777634	+	Missense_Mutation	SNP	G	G	A	rs375704783		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr13:109777634G>A	ENST00000357550.2	+	29	3685	c.3644G>A	c.(3643-3645)cGt>cAt	p.R1215H	MYO16_ENST00000356711.2_Missense_Mutation_p.R1215H|MYO16_ENST00000457511.2_Missense_Mutation_p.R727H	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GACCGGCTCCGTAGTGAAATG	0.463																																					p.R1237H		Atlas-SNP	.											.	MYO16	285	.	0			c.G3710A						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	60.0	56.0	57.0		3710,3644	4.9	0.2	13		57	0,8600		0,0,4300	no	missense,missense	MYO16	NM_001198950.1,NM_015011.1	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	1237/1881,1215/1859	109777634	1,13005	2203	4300	6503	SO:0001583	missense	23026	exon30			GGCTCCGTAGTGA		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3644G>A	chr13.hg19:g.109777634G>A	ENSP00000350160:p.Arg1215His	514.0	0.0		294.0	32.0	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	hg19	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221228	0.79464	2.27E-4	0.0	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	T;T;T	0.59906	0.23;0.23;0.23	5.75	4.9	0.64082	.	0.000000	0.38959	U	0.001511	T	0.71099	0.3300	M	0.76328	2.33	0.43942	D	0.9966	D;D	0.89917	1.0;0.999	D;P	0.67382	0.951;0.894	T	0.71826	-0.4475	9	.	.	.	.	9.5836	0.39504	0.1528:0.0:0.8472:0.0	.	727;1215	F8W883;Q9Y6X6	.;MYO16_HUMAN	H	1215;1215;727	ENSP00000349145:R1215H;ENSP00000350160:R1215H;ENSP00000401633:R727H	.	R	+	2	0	MYO16	108575635	0.999000	0.42202	0.227000	0.23927	0.915000	0.54546	4.783000	0.62403	2.716000	0.92895	0.655000	0.94253	CGT	.	.		0.463	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
PSMB5	5693	hgsc.bcm.edu	37	14	23503937	23503937	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr14:23503937G>A	ENST00000361611.6	-	1	417	c.154C>T	c.(154-156)Cca>Tca	p.P52S	AL132780.1_ENST00000385031.1_RNA|PSMB5_ENST00000460922.2_Missense_Mutation_p.P52S|PSMB5_ENST00000493471.2_Missense_Mutation_p.P52S|PSMB5_ENST00000425762.2_Intron	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	52					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	TCGATTCCTGGCTCTTCTGGG	0.612																																					p.P52S		Atlas-SNP	.											.	PSMB5	31	.	0			c.C154T						.						51.0	47.0	48.0					14																	23503937		2203	4300	6503	SO:0001583	missense	5693	exon1			TTCCTGGCTCTTC	D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.154C>T	chr14.hg19:g.23503937G>A	ENSP00000355325:p.Pro52Ser	64.0	0.0		59.0	15.0	NM_001144932	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	hg19	CCDS9584.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547653	0.45383	.	.	ENSG00000100804	ENST00000361611;ENST00000493471;ENST00000460922	T;T;T	0.49432	0.78;0.78;0.78	5.04	5.04	0.67666	.	0.065101	0.64402	D	0.000009	T	0.38585	0.1046	N	0.24115	0.695	0.80722	D	1	B;B	0.33171	0.4;0.016	B;B	0.36808	0.233;0.01	T	0.19976	-1.0289	10	0.29301	T	0.29	-11.1309	17.1802	0.86853	0.0:0.0:1.0:0.0	.	52;52	P28074-2;P28074	.;PSB5_HUMAN	S	52	ENSP00000355325:P52S;ENSP00000452424:P52S;ENSP00000451286:P52S	ENSP00000334973:P52S	P	-	1	0	PSMB5	22573777	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	4.432000	0.59922	2.348000	0.79779	0.555000	0.69702	CCA	.	.		0.612	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797	
AKAP6	9472	hgsc.bcm.edu	37	14	33014464	33014464	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr14:33014464A>T	ENST00000280979.4	+	4	775	c.605A>T	c.(604-606)gAt>gTt	p.D202V	AKAP6_ENST00000557272.1_Missense_Mutation_p.D202V|AKAP6_ENST00000557354.1_Missense_Mutation_p.D202V	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	202					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACAGAAGTGGATGACTCAGGA	0.398																																					p.D202V	Melanoma(49;821 1200 7288 13647 42351)	Atlas-SNP	.											.	AKAP6	308	.	0			c.A605T						.						147.0	141.0	143.0					14																	33014464		2203	4300	6503	SO:0001583	missense	9472	exon4			AAGTGGATGACTC	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.605A>T	chr14.hg19:g.33014464A>T	ENSP00000280979:p.Asp202Val	163.0	0.0		68.0	15.0	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	hg19	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.009664	0.75046	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.39056	2.36;1.12;1.1	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.66984	-0.5785	10	0.87932	D	0	-19.4019	16.6438	0.85155	1.0:0.0:0.0:0.0	.	202;202	A7E242;Q13023	.;AKAP6_HUMAN	V	202	ENSP00000280979:D202V;ENSP00000450531:D202V;ENSP00000451247:D202V	ENSP00000280979:D202V	D	+	2	0	AKAP6	32084215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.555000	0.90693	2.333000	0.79357	0.533000	0.62120	GAT	.	.		0.398	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36211696	36211696	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr14:36211696C>T	ENST00000389698.3	-	11	1717	c.1327G>A	c.(1327-1329)Gag>Aag	p.E443K	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.E443K|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.E443K|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.E443K	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	443					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGTTTTTCCTCTTGTTGGATC	0.368																																					p.E443K		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.G1327A						.						51.0	50.0	50.0					14																	36211696		2201	4279	6480	SO:0001583	missense	253959	exon11			TTTCCTCTTGTTG	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.1327G>A	chr14.hg19:g.36211696C>T	ENSP00000374348:p.Glu443Lys	351.0	0.0		207.0	37.0	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335662	0.41398	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36	4.98	4.98	0.66077	.	0.054420	0.64402	D	0.000001	D	0.87861	0.6284	L	0.29908	0.895	0.42217	D	0.991832	B;B;B;B;B	0.21606	0.056;0.034;0.004;0.004;0.058	B;B;B;B;B	0.21917	0.027;0.012;0.012;0.009;0.037	D	0.83656	0.0158	10	0.25751	T	0.34	-11.8038	11.7238	0.51698	0.0:0.9188:0.0:0.0812	.	443;443;443;443;443	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	K	443	ENSP00000374348:E443K;ENSP00000302647:E443K;ENSP00000258840:E443K;ENSP00000371803:E443K;ENSP00000451877:E443K	ENSP00000258840:E443K	E	-	1	0	RALGAPA1	35281447	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.760000	0.55235	2.310000	0.77875	0.484000	0.47621	GAG	.	.		0.368	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
CATSPERB	79820	hgsc.bcm.edu	37	14	92076871	92076871	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr14:92076871C>T	ENST00000256343.3	-	21	2707	c.2551G>A	c.(2551-2553)Gga>Aga	p.G851R		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	851					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TTATGAACTCCACTAATCCAG	0.358																																					p.G851R		Atlas-SNP	.											.	CATSPERB	114	.	0			c.G2551A						.						88.0	86.0	86.0					14																	92076871		2203	4300	6503	SO:0001583	missense	79820	exon21			GAACTCCACTAAT	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2551G>A	chr14.hg19:g.92076871C>T	ENSP00000256343:p.Gly851Arg	75.0	0.0		40.0	8.0	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	hg19	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898519	0.52227	.	.	ENSG00000133962	ENST00000256343	T	0.56776	0.44	5.75	3.87	0.44632	.	0.129707	0.34652	N	0.003785	T	0.58921	0.2156	M	0.64404	1.975	0.09310	N	0.999996	D	0.64830	0.994	P	0.56474	0.799	T	0.53229	-0.8468	10	0.72032	D	0.01	-19.2889	6.3682	0.21468	0.183:0.7264:0.0:0.0906	.	851	Q9H7T0	CTSRB_HUMAN	R	851	ENSP00000256343:G851R	ENSP00000256343:G851R	G	-	1	0	CATSPERB	91146624	0.481000	0.25941	0.056000	0.19401	0.022000	0.10575	2.425000	0.44723	1.363000	0.46019	0.563000	0.77884	GGA	.	.		0.358	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
RASGRP1	10125	hgsc.bcm.edu	37	15	38798090	38798090	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr15:38798090T>C	ENST00000310803.5	-	10	1451	c.1274A>G	c.(1273-1275)gAa>gGa	p.E425G	RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000450598.2_Missense_Mutation_p.E425G|RASGRP1_ENST00000559830.1_Missense_Mutation_p.E425G|RASGRP1_ENST00000539159.1_Missense_Mutation_p.E377G|RASGRP1_ENST00000561180.1_Missense_Mutation_p.E476G|RASGRP1_ENST00000558164.1_Missense_Mutation_p.E425G	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	425	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		CTCATAGATTTCATCCTCAGT	0.448																																					p.E425G		Atlas-SNP	.											.	RASGRP1	50	.	0			c.A1274G						.						84.0	83.0	83.0					15																	38798090		1889	4104	5993	SO:0001583	missense	10125	exon10			TAGATTTCATCCT	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1274A>G	chr15.hg19:g.38798090T>C	ENSP00000310244:p.Glu425Gly	101.0	0.0		71.0	29.0	NM_001128602	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	hg19	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634764	0.87660	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	4.6	4.6	0.57074	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.76737	0.4029	M	0.90542	3.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.83275	0.996;0.988;0.98;0.996	T	0.82581	-0.0386	10	0.87932	D	0	-19.4816	14.1614	0.65450	0.0:0.0:0.0:1.0	.	425;425;425;425	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	G	425;425;425;425;377;425;425	ENSP00000310244:E425G;ENSP00000388540:E425G;ENSP00000444762:E377G;ENSP00000413105:E425G	ENSP00000310244:E425G	E	-	2	0	RASGRP1	36585382	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.698000	0.84413	1.909000	0.55274	0.533000	0.62120	GAA	.	.		0.448	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
RHOV	171177	hgsc.bcm.edu	37	15	41165411	41165411	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr15:41165411A>G	ENST00000220507.4	-	3	705	c.556T>C	c.(556-558)Tgc>Cgc	p.C186R	AC025166.1_ENST00000582049.1_RNA	NM_133639.3	NP_598378.3			ras homolog family member V											central_nervous_system(1)|large_intestine(1)	2		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.58e-05)|COAD - Colon adenocarcinoma(120;0.149)|BRCA - Breast invasive adenocarcinoma(123;0.163)		AAGGCTGAGCACTCAAGGTAG	0.577																																					p.C186R	Pancreas(13;103 483 3593 12123 44457)	Atlas-SNP	.											.	RHOV	6	.	0			c.T556C						.						89.0	91.0	90.0					15																	41165411		2203	4300	6503	SO:0001583	missense	171177	exon3			CTGAGCACTCAAG	AY059636	CCDS10068.1	15q13.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000104140	ENSG00000104140			18313	protein-coding gene	gene with protein product			"""ras homolog gene family, member V"""	ARHV		11839775	Standard	NM_133639		Approved	Chp, WRCH2	uc001znd.3	Q96L33	OTTHUMG00000130134	ENST00000220507.4:c.556T>C	chr15.hg19:g.41165411A>G	ENSP00000220507:p.Cys186Arg	87.0	0.0		74.0	18.0	NM_133639		Missense_Mutation	SNP	ENST00000220507.4	hg19	CCDS10068.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.195131	0.78902	.	.	ENSG00000104140	ENST00000220507	T	0.71461	-0.57	5.63	5.63	0.86233	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89217	0.6652	H	0.96175	3.78	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92595	0.6086	10	0.87932	D	0	-11.6267	15.8478	0.78905	1.0:0.0:0.0:0.0	.	186	Q96L33	RHOV_HUMAN	R	186	ENSP00000220507:C186R	ENSP00000220507:C186R	C	-	1	0	RHOV	38952703	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	9.321000	0.96353	2.157000	0.67596	0.374000	0.22700	TGC	.	.		0.577	RHOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252442.1		
VPS18	57617	hgsc.bcm.edu	37	15	41191757	41191757	+	Silent	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr15:41191757C>T	ENST00000220509.5	+	4	1080	c.741C>T	c.(739-741)ctC>ctT	p.L247L	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	247					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TCTCAGGGCTCTTTGCAGCTT	0.607																																					p.L247L		Atlas-SNP	.											.	VPS18	67	.	0			c.C741T						.						65.0	70.0	68.0					15																	41191757		2203	4300	6503	SO:0001819	synonymous_variant	57617	exon4			AGGGCTCTTTGCA	AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.741C>T	chr15.hg19:g.41191757C>T		25.0	0.0		24.0	12.0	NM_020857	Q8TCG0|Q96DI3|Q9H268	Silent	SNP	ENST00000220509.5	hg19	CCDS10069.1																																																																																			.	.		0.607	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252443.2		
NKD1	85407	hgsc.bcm.edu	37	16	50667280	50667280	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr16:50667280G>T	ENST00000268459.3	+	10	1225	c.1001G>T	c.(1000-1002)cGg>cTg	p.R334L		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	334					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CTCCAGCAACGGCTCCGGGGC	0.642																																					p.R334L		Atlas-SNP	.											.	NKD1	43	.	0			c.G1001T						.						82.0	94.0	90.0					16																	50667280		2198	4300	6498	SO:0001583	missense	85407	exon10			AGCAACGGCTCCG	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.1001G>T	chr16.hg19:g.50667280G>T	ENSP00000268459:p.Arg334Leu	309.0	0.0		232.0	67.0	NM_033119	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	hg19	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534299	0.64972	.	.	ENSG00000140807	ENST00000268459	T	0.70749	-0.51	4.44	2.5	0.30297	.	0.142167	0.45606	D	0.000357	T	0.75125	0.3807	M	0.79258	2.445	0.46774	D	0.999193	P	0.46064	0.872	P	0.50896	0.653	T	0.73572	-0.3940	10	0.49607	T	0.09	-12.9994	8.8198	0.35018	0.1731:0.0:0.8269:0.0	.	334	Q969G9	NKD1_HUMAN	L	334	ENSP00000268459:R334L	ENSP00000268459:R334L	R	+	2	0	NKD1	49224781	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.692000	0.54727	0.515000	0.28320	-0.203000	0.12734	CGG	.	.		0.642	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1		
CX3CL1	6376	hgsc.bcm.edu	37	16	57416592	57416592	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr16:57416592G>A	ENST00000006053.6	+	3	953	c.842G>A	c.(841-843)gGc>gAc	p.G281D	CX3CL1_ENST00000563383.1_Missense_Mutation_p.G287D|CX3CL1_ENST00000565912.1_Missense_Mutation_p.G243D	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	281	Mucin-like stalk.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						TGGGGGCCTGGCAGCATGGCC	0.667																																					p.G281D		Atlas-SNP	.											.	CX3CL1	27	.	0			c.G842A						.						36.0	40.0	38.0					16																	57416592		2198	4300	6498	SO:0001583	missense	6376	exon3			GGCCTGGCAGCAT	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.842G>A	chr16.hg19:g.57416592G>A	ENSP00000006053:p.Gly281Asp	79.0	0.0		67.0	23.0	NM_002996	O00672	Missense_Mutation	SNP	ENST00000006053.6	hg19	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	G	4.626	0.116295	0.08881	.	.	ENSG00000006210	ENST00000006053	T	0.03772	3.81	4.63	-0.314	0.12750	.	1.752800	0.03874	N	0.276091	T	0.02848	0.0085	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43798	-0.9369	10	0.87932	D	0	-25.7703	3.2983	0.06974	0.4146:0.211:0.3744:0.0	.	281	P78423	X3CL1_HUMAN	D	281	ENSP00000006053:G281D	ENSP00000006053:G281D	G	+	2	0	CX3CL1	55974093	0.001000	0.12720	0.000000	0.03702	0.449000	0.32228	0.694000	0.25512	0.063000	0.16370	-0.259000	0.10710	GGC	.	.		0.667	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996	
AGRP	181	hgsc.bcm.edu	37	16	67517252	67517252	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr16:67517252G>A	ENST00000290953.2	-	2	349	c.50C>T	c.(49-51)gCc>gTc	p.A17V	ATP6V0D1_ENST00000540149.1_5'Flank|ATP6V0D1_ENST00000290949.3_5'Flank|RP11-297D21.4_ENST00000602596.1_RNA	NM_001138.1	NP_001129.1	O00253	AGRP_HUMAN	agouti related neuropeptide	17					adult feeding behavior (GO:0008343)|eating behavior (GO:0042755)|feeding behavior (GO:0007631)|hormone-mediated signaling pathway (GO:0009755)|maternal process involved in female pregnancy (GO:0060135)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of feeding behavior (GO:2000253)|regulation of feeding behavior (GO:0060259)|response to insulin (GO:0032868)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|neuronal cell body (GO:0043025)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			endometrium(1)	1		Acute lymphoblastic leukemia(13;0.00263)|all_hematologic(13;0.0274)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0717)|Epithelial(162;0.16)		TCCTCGCGTGGCAGGCAGTGC	0.642																																					p.A17V		Atlas-SNP	.											.	AGRP	8	.	0			c.C50T						.						29.0	27.0	28.0					16																	67517252		2196	4299	6495	SO:0001583	missense	181	exon2			CGCGTGGCAGGCA	U88063	CCDS10839.1	16q22	2014-07-15	2014-07-15		ENSG00000159723	ENSG00000159723		"""Endogenous ligands"""	330	protein-coding gene	gene with protein product		602311	"""agouti (mouse) related protein"", ""agouti related protein homolog (mouse)"""			9119224, 9311920	Standard	NM_001138		Approved	Agrt, ART, ASIP2	uc002etg.1	O00253	OTTHUMG00000137509	ENST00000290953.2:c.50C>T	chr16.hg19:g.67517252G>A	ENSP00000290953:p.Ala17Val	92.0	0.0		95.0	16.0	NM_001138	O15459|Q2TBD9	Missense_Mutation	SNP	ENST00000290953.2	hg19	CCDS10839.1	.	.	.	.	.	.	.	.	.	.	G	9.436	1.086911	0.20390	.	.	ENSG00000159723	ENST00000290953	T	0.43688	0.94	5.67	1.56	0.23342	.	1.767970	0.02185	N	0.060828	T	0.31734	0.0806	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24905	-1.0147	10	0.46703	T	0.11	-9.8371	8.2418	0.31665	0.3188:0.0:0.6812:0.0	.	17	O00253	AGRP_HUMAN	V	17	ENSP00000290953:A17V	ENSP00000290953:A17V	A	-	2	0	AGRP	66074753	0.000000	0.05858	0.001000	0.08648	0.068000	0.16541	0.018000	0.13422	0.351000	0.24027	-0.251000	0.11542	GCC	.	.		0.642	AGRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268828.1		
ESRP2	80004	hgsc.bcm.edu	37	16	68265859	68265859	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr16:68265859A>C	ENST00000565858.1	-	10	1261	c.1175T>G	c.(1174-1176)cTc>cGc	p.L392R	ESRP2_ENST00000473183.2_Missense_Mutation_p.L382R|RP11-96D1.11_ENST00000571197.1_RNA	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	392	RRM 2.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						GCGCACAAAGAGCAGCCCCTC	0.662																																					p.L382R		Atlas-SNP	.											.	ESRP2	118	.	0			c.T1145G						.						45.0	44.0	44.0					16																	68265859		2198	4300	6498	SO:0001583	missense	80004	exon10			ACAAAGAGCAGCC	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1175T>G	chr16.hg19:g.68265859A>C	ENSP00000454554:p.Leu392Arg	134.0	0.0		118.0	17.0	NM_024939	Q8N6H8|Q8WZ15|Q9H6I4	Missense_Mutation	SNP	ENST00000565858.1	hg19		.	.	.	.	.	.	.	.	.	.	A	22.1	4.239418	0.79800	.	.	ENSG00000103067	ENST00000473183	T	0.06687	3.27	5.83	5.83	0.93111	RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	L	0.46947	1.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.00237	-1.1890	10	0.51188	T	0.08	-24.0184	16.1883	0.81967	1.0:0.0:0.0:0.0	.	392;382	Q9H6T0;Q9H6T0-2	ESRP2_HUMAN;.	R	382	ENSP00000418748:L382R	ENSP00000418748:L382R	L	-	2	0	ESRP2	66823360	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.281000	0.95811	2.231000	0.72958	0.454000	0.30748	CTC	.	.		0.662	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	
DNAH9	1770	hgsc.bcm.edu	37	17	11660954	11660954	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr17:11660954T>A	ENST00000262442.4	+	35	7008	c.6940T>A	c.(6940-6942)Tta>Ata	p.L2314I	DNAH9_ENST00000454412.2_Missense_Mutation_p.L2314I	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2314	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAGAGCCAACTTAACCATTTT	0.473																																					p.L2314I		Atlas-SNP	.											.	DNAH9	695	.	0			c.T6940A						.						129.0	112.0	117.0					17																	11660954		2203	4300	6503	SO:0001583	missense	1770	exon35			GCCAACTTAACCA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6940T>A	chr17.hg19:g.11660954T>A	ENSP00000262442:p.Leu2314Ile	145.0	0.0		91.0	51.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.170956	0.57584	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.28666	1.6;1.6	5.11	-1.96	0.07525	.	0.000000	0.64402	D	0.000010	T	0.54351	0.1853	H	0.94222	3.51	0.80722	D	1	D	0.63046	0.992	P	0.62184	0.899	T	0.55835	-0.8078	10	0.72032	D	0.01	.	6.4239	0.21758	0.1089:0.5031:0.0:0.388	.	2314	Q9NYC9	DYH9_HUMAN	I	2314;2314;896	ENSP00000262442:L2314I;ENSP00000414874:L2314I	ENSP00000262442:L2314I	L	+	1	2	DNAH9	11601679	0.997000	0.39634	0.936000	0.37596	0.483000	0.33249	0.709000	0.25734	-0.521000	0.06426	-1.092000	0.02172	TTA	.	.		0.473	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
MYOCD	93649	hgsc.bcm.edu	37	17	12656632	12656632	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr17:12656632C>T	ENST00000343344.4	+	10	2027	c.2027C>T	c.(2026-2028)tCg>tTg	p.S676L	AC005358.1_ENST00000609971.1_Missense_Mutation_p.S580L|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.S676L			Q8IZQ8	MYCD_HUMAN	myocardin	676					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AGGGTCTCCTCGCCCATCAGC	0.567																																					p.S676L		Atlas-SNP	.											.	MYOCD	291	.	0			c.C2027T						.						52.0	56.0	55.0					17																	12656632		2203	4300	6503	SO:0001583	missense	93649	exon10			TCTCCTCGCCCAT	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2027C>T	chr17.hg19:g.12656632C>T	ENSP00000341835:p.Ser676Leu	74.0	0.0		32.0	20.0	NM_001146312	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	hg19	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479353	0.63849	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.46063	0.9;0.88	5.49	5.49	0.81192	.	0.869934	0.10124	N	0.713025	T	0.49270	0.1547	L	0.57536	1.79	0.44976	D	0.99799	P;D;D;P	0.59357	0.931;0.959;0.985;0.929	B;B;P;B	0.44561	0.129;0.254;0.453;0.173	T	0.54241	-0.8323	10	0.56958	D	0.05	-4.1821	18.2062	0.89855	0.0:1.0:0.0:0.0	.	395;580;676;676	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	L	395;676;676;580;381	ENSP00000341835:S676L;ENSP00000400148:S381L	ENSP00000341835:S676L	S	+	2	0	MYOCD	12597357	1.000000	0.71417	0.204000	0.23530	0.062000	0.15995	6.057000	0.71119	2.613000	0.88420	0.644000	0.83932	TCG	.	.		0.567	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305699	39305699	+	Silent	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr17:39305699T>C	ENST00000343246.4	-	1	355	c.321A>G	c.(319-321)agA>agG	p.R107R		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	107	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGTCTgcagcagc	0.662																																					p.R107R		Atlas-SNP	.											.	KRTAP4-5	34	.	0			c.A321G						.						20.0	24.0	23.0					17																	39305699		2163	4217	6380	SO:0001819	synonymous_variant	85289	exon1			CTGGGGTCTGCAG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.321A>G	chr17.hg19:g.39305699T>C		80.0	0.0		53.0	26.0	NM_033188		Silent	SNP	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.		0.662	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
HLF	3131	hgsc.bcm.edu	37	17	53345280	53345280	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr17:53345280A>G	ENST00000226067.5	+	2	757	c.284A>G	c.(283-285)aAt>aGt	p.N95S	HLF_ENST00000573945.1_Missense_Mutation_p.N10S|HLF_ENST00000430986.2_Missense_Mutation_p.N10S|HLF_ENST00000575345.1_Missense_Mutation_p.N10S	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	95					multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(2)	3						TTGTCAGAAAATGGCATTCCC	0.572			T	TCF3	ALL																																p.N95S		Atlas-SNP	.		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	.	HLF	39	.	0			c.A284G						.						112.0	109.0	110.0					17																	53345280		2203	4300	6503	SO:0001583	missense	3131	exon2			CAGAAAATGGCAT		CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.284A>G	chr17.hg19:g.53345280A>G	ENSP00000226067:p.Asn95Ser	155.0	0.0		124.0	38.0	NM_002126	A8K1X8|Q6FHS9	Missense_Mutation	SNP	ENST00000226067.5	hg19	CCDS11585.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.557548	0.86231	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.81014	0.4735	M	0.84683	2.71	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.83944	0.0313	9	0.66056	D	0.02	.	15.389	0.74726	1.0:0.0:0.0:0.0	.	95	Q16534	HLF_HUMAN	S	95;10	.	ENSP00000226067:N95S	N	+	2	0	HLF	50700279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.779000	0.91792	2.224000	0.72417	0.533000	0.62120	AAT	.	.		0.572	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439185.1	NM_002126	
JMJD6	23210	hgsc.bcm.edu	37	17	74722553	74722553	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr17:74722553T>G	ENST00000397625.4	-	1	119	c.5A>C	c.(4-6)aAc>aCc	p.N2T	METTL23_ENST00000341249.6_5'Flank|METTL23_ENST00000588783.1_5'Flank|METTL23_ENST00000589977.1_5'Flank|METTL23_ENST00000588822.1_5'Flank|METTL23_ENST00000586200.1_5'Flank|JMJD6_ENST00000585429.1_Missense_Mutation_p.N2T|JMJD6_ENST00000445478.2_Missense_Mutation_p.N2T|METTL23_ENST00000586752.1_5'Flank|METTL23_ENST00000591571.1_5'Flank|METTL23_ENST00000586738.1_5'Flank|METTL23_ENST00000590964.1_5'Flank|METTL23_ENST00000588302.1_5'Flank	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6	2					cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						GCTCTTGTGGTTCATTCTGCG	0.672																																					p.N2T		Atlas-SNP	.											.	JMJD6	57	.	0			c.A5C						.						34.0	39.0	38.0					17																	74722553		2034	4192	6226	SO:0001583	missense	23210	exon1			TTGTGGTTCATTC	AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.5A>C	chr17.hg19:g.74722553T>G	ENSP00000380750:p.Asn2Thr	60.0	0.0		56.0	32.0	NM_001081461	B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Missense_Mutation	SNP	ENST00000397625.4	hg19	CCDS42384.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.897905	0.52227	.	.	ENSG00000070495	ENST00000445478;ENST00000344991;ENST00000397625	.	.	.	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.52581	0.1743	L	0.57536	1.79	0.80722	D	1	B;P;P	0.39094	0.18;0.659;0.519	B;B;B	0.34722	0.043;0.188;0.153	T	0.59096	-0.7518	9	0.51188	T	0.08	0.2916	14.2737	0.66166	0.0:0.0:0.0:1.0	.	2;2;2	B2WTI3;Q6NYC1;Q6NYC1-3	.;JMJD6_HUMAN;.	T	2	.	ENSP00000302916:N2T	N	-	2	0	JMJD6	72234148	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	7.352000	0.79404	1.967000	0.57214	0.402000	0.26972	AAC	.	.		0.672	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403211.1	NM_015167	
ANKRD12	23253	hgsc.bcm.edu	37	18	9208736	9208736	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr18:9208736A>G	ENST00000262126.4	+	5	626	c.386A>G	c.(385-387)tAt>tGt	p.Y129C	ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000400020.3_Missense_Mutation_p.Y106C|ANKRD12_ENST00000383440.2_Missense_Mutation_p.Y106C	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	129						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CTTTTTGGTTATCCACTCTCT	0.388																																					p.Y129C		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A386G						.						191.0	169.0	176.0					18																	9208736		2203	4300	6503	SO:0001583	missense	23253	exon5			TTGGTTATCCACT	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.386A>G	chr18.hg19:g.9208736A>G	ENSP00000262126:p.Tyr129Cys	297.0	0.0		250.0	65.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.696804	0.48202	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T;T	0.51817	3.38;0.69;3.45	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.62440	-0.6854	10	0.87932	D	0	-21.552	16.1777	0.81874	1.0:0.0:0.0:0.0	.	129;106;129	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	C	106;106;129;129	ENSP00000372932:Y106C;ENSP00000441510:Y106C;ENSP00000262126:Y129C	ENSP00000262126:Y129C	Y	+	2	0	ANKRD12	9198736	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.222000	0.72286	0.383000	0.25322	TAT	.	.		0.388	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
KATNAL2	83473	hgsc.bcm.edu	37	18	44580795	44580795	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr18:44580795A>T	ENST00000245121.5	+	3	296	c.102A>T	c.(100-102)agA>agT	p.R34S	KATNAL2_ENST00000356157.7_Missense_Mutation_p.R106S|KATNAL2_ENST00000592005.1_Intron	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						AAAGAAGTAGAGGGAAGACCA	0.398																																					p.R34S		Atlas-SNP	.											.	KATNAL2	64	.	0			c.A102T						.						188.0	200.0	196.0					18																	44580795		2203	4300	6503	SO:0001583	missense	83473	exon3			AAGTAGAGGGAAG	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.102A>T	chr18.hg19:g.44580795A>T	ENSP00000245121:p.Arg34Ser	347.0	0.0		227.0	41.0	NM_031303		Missense_Mutation	SNP	ENST00000245121.5	hg19	CCDS32828.1	.	.	.	.	.	.	.	.	.	.	A	10.21	1.286809	0.23478	.	.	ENSG00000167216	ENST00000356157;ENST00000245121	D;D	0.93133	-3.17;-3.15	5.57	4.41	0.53225	.	0.116998	0.56097	N	0.000025	D	0.83018	0.5163	N	0.08118	0	0.19300	N	0.999979	.	.	.	.	.	.	T	0.69221	-0.5202	8	0.10902	T	0.67	-1.2462	10.2457	0.43339	0.8161:0.1839:0.0:0.0	.	.	.	.	S	106;34	ENSP00000348478:R106S;ENSP00000245121:R34S	ENSP00000245121:R34S	R	+	3	2	KATNAL2	42834793	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.270000	0.51600	0.943000	0.37553	0.379000	0.24179	AGA	.	.		0.398	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446138.2	NM_031303	
ATP9B	374868	hgsc.bcm.edu	37	18	77137276	77137276	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr18:77137276C>A	ENST00000426216.2	+	30	3354	c.3337C>A	c.(3337-3339)Ctg>Atg	p.L1113M	ATP9B_ENST00000543761.1_Missense_Mutation_p.L423M|ATP9B_ENST00000307671.7_Missense_Mutation_p.L1102M	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	1113					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CGTGACCTTCCTGTGGAAAGT	0.562																																					p.L1113M		Atlas-SNP	.											.	ATP9B	96	.	0			c.C3337A						.						153.0	129.0	137.0					18																	77137276		2203	4300	6503	SO:0001583	missense	374868	exon30			ACCTTCCTGTGGA	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.3337C>A	chr18.hg19:g.77137276C>A	ENSP00000398076:p.Leu1113Met	71.0	0.0		39.0	9.0	NM_198531	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	hg19	CCDS12014.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349614	0.41599	.	.	ENSG00000166377	ENST00000426216;ENST00000307671;ENST00000543761	T;T	0.41065	1.01;1.01	4.5	1.02	0.19986	.	0.082491	0.49916	D	0.000122	T	0.40222	0.1108	M	0.68728	2.09	0.54753	D	0.999982	B;B	0.27264	0.173;0.058	B;B	0.32465	0.146;0.107	T	0.22208	-1.0223	10	0.62326	D	0.03	.	8.1104	0.30911	0.0:0.6678:0.2148:0.1174	.	1113;1102	O43861;O43861-2	ATP9B_HUMAN;.	M	1102;1113;423	ENSP00000398076:L1102M;ENSP00000442015:L423M	ENSP00000304500:L1113M	L	+	1	2	ATP9B	75238264	1.000000	0.71417	0.995000	0.50966	0.888000	0.51559	1.142000	0.31540	-0.155000	0.11098	0.543000	0.68304	CTG	.	.		0.562	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
ZNF560	147741	hgsc.bcm.edu	37	19	9577581	9577581	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:9577581T>C	ENST00000301480.4	-	10	2255	c.2042A>G	c.(2041-2043)gAg>gGg	p.E681G		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	681					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						AGAGGTCTTCTCTGCTGCATG	0.358																																					p.E681G		Atlas-SNP	.											.	ZNF560	162	.	0			c.A2042G						.						118.0	122.0	120.0					19																	9577581		2203	4300	6503	SO:0001583	missense	147741	exon10			GTCTTCTCTGCTG	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.2042A>G	chr19.hg19:g.9577581T>C	ENSP00000301480:p.Glu681Gly	96.0	0.0		62.0	25.0	NM_152476	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	hg19	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883218	0.33255	.	.	ENSG00000198028	ENST00000301480	T	0.20200	2.09	1.69	1.69	0.24217	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46444	0.1393	M	0.86805	2.84	0.31694	N	0.641469	D	0.89917	1.0	D	0.85130	0.997	T	0.52902	-0.8513	9	0.66056	D	0.02	.	7.3583	0.26731	0.0:0.0:0.0:1.0	.	681	Q96MR9	ZN560_HUMAN	G	681	ENSP00000301480:E681G	ENSP00000301480:E681G	E	-	2	0	ZNF560	9438581	0.022000	0.18835	0.011000	0.14972	0.071000	0.16799	1.766000	0.38491	1.019000	0.39547	0.379000	0.24179	GAG	.	.		0.358	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
SMARCA4	6597	hgsc.bcm.edu	37	19	11145796	11145796	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:11145796G>T	ENST00000429416.3	+	30	4439	c.4158G>T	c.(4156-4158)aaG>aaT	p.K1386N	SMARCA4_ENST00000450717.3_Missense_Mutation_p.K1353N|SMARCA4_ENST00000444061.3_Missense_Mutation_p.K1353N|SMARCA4_ENST00000413806.3_Missense_Mutation_p.K1353N|SMARCA4_ENST00000358026.2_Missense_Mutation_p.K1386N|SMARCA4_ENST00000344626.4_Missense_Mutation_p.K1386N|SMARCA4_ENST00000590574.1_Missense_Mutation_p.K1353N|SMARCA4_ENST00000538456.3_3'UTR|SMARCA4_ENST00000541122.2_Missense_Mutation_p.K1353N|SMARCA4_ENST00000589677.1_Missense_Mutation_p.K1353N	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1386					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGACGGAGAAGCAGTGGCTCA	0.662			"""F, N, Mis"""		NSCLC																																p.K1386N		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,NS,carcinoma,0,2	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.G4158T						.						38.0	32.0	34.0					19																	11145796		2199	4300	6499	SO:0001583	missense	6597	exon29			GGAGAAGCAGTGG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.4158G>T	chr19.hg19:g.11145796G>T	ENSP00000395654:p.Lys1386Asn	169.0	0.0		111.0	38.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.7|20.7	4.037129|4.037129	0.75617|0.75617	.|.	.|.	ENSG00000127616|ENSG00000127616	ENST00000538456|ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.|D;D;D;D;D;D;D	.|0.87412	.|-2.2;-2.17;-2.2;-2.24;-2.23;-2.25;-2.24	4.59|4.59	4.59|4.59	0.56863|0.56863	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91801|0.91801	0.7406|0.7406	L|L	0.60957|0.60957	1.885|1.885	0.52099|0.52099	D|D	0.999942|0.999942	.|P;P;P;P;D;P;P	.|0.89917	.|0.944;0.944;0.944;0.944;1.0;0.788;0.944	.|P;P;P;P;D;B;P	.|0.73380	.|0.829;0.829;0.829;0.829;0.98;0.368;0.829	D|D	0.92762|0.92762	0.6225|0.6225	5|10	.|0.87932	.|D	.|0	-41.5199|-41.5199	16.3525|16.3525	0.83220|0.83220	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1353;1353;1353;1386;1353;573;1386	.|B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.|.;.;.;.;.;.;SMCA4_HUMAN	S|N	123|1386;1386;1417;1386;1353;1353;1353;1353	.|ENSP00000395654:K1386N;ENSP00000350720:K1386N;ENSP00000343896:K1386N;ENSP00000445036:K1353N;ENSP00000392837:K1353N;ENSP00000397783:K1353N;ENSP00000414727:K1353N	.|ENSP00000343896:K1386N	A|K	+|+	1|3	0|2	SMARCA4|SMARCA4	11006796|11006796	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	0.907000|0.907000	0.28531|0.28531	2.385000|2.385000	0.81259|0.81259	0.558000|0.558000	0.71614|0.71614	GCA|AAG	.	.		0.662	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
OR10H2	26538	hgsc.bcm.edu	37	19	15839113	15839113	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:15839113C>T	ENST00000305899.3	+	1	280	c.260C>T	c.(259-261)tCc>tTc	p.S87F		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GACCTGCTGTCCACCCAGCGC	0.612																																					p.S87F		Atlas-SNP	.											.	OR10H2	59	.	0			c.C260T						.						77.0	65.0	69.0					19																	15839113		2203	4297	6500	SO:0001583	missense	26538	exon1			TGCTGTCCACCCA	AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.260C>T	chr19.hg19:g.15839113C>T	ENSP00000306095:p.Ser87Phe	184.0	0.0		127.0	19.0	NM_013939	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	hg19	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	6.075	0.382065	0.11524	.	.	ENSG00000171942	ENST00000305899	T	0.78924	-1.22	3.4	3.4	0.38934	GPCR, rhodopsin-like superfamily (1);	0.141093	0.32563	N	0.005938	T	0.76205	0.3955	M	0.76170	2.325	0.09310	N	1	B	0.15719	0.014	B	0.19946	0.027	T	0.69224	-0.5201	10	0.49607	T	0.09	.	12.3469	0.55126	0.0:1.0:0.0:0.0	.	87	O60403	O10H2_HUMAN	F	87	ENSP00000306095:S87F	ENSP00000306095:S87F	S	+	2	0	OR10H2	15700113	0.000000	0.05858	0.491000	0.27477	0.069000	0.16628	0.259000	0.18405	1.446000	0.47643	0.537000	0.68136	TCC	.	.		0.612	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
CERS1	10715	hgsc.bcm.edu	37	19	18991094	18991094	+	Missense_Mutation	SNP	G	G	T	rs566462746		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:18991094G>T	ENST00000427170.2	-	4	812	c.741C>A	c.(739-741)ttC>ttA	p.F247L	CERS1_ENST00000429504.2_Missense_Mutation_p.F247L|GDF1_ENST00000247005.6_5'UTR|AC005197.2_ENST00000597769.1_RNA|CERS1_ENST00000542296.2_Missense_Mutation_p.F149L	NM_001492.4|NM_021267.3	NP_001483.3|NP_067090.1	P27544	CERS1_HUMAN	ceramide synthase 1	247	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular response to dithiothreitol (GO:0072721)|cellular response to drug (GO:0035690)|cellular response to mycotoxin (GO:0036146)|cellular response to UV-A (GO:0071492)|ceramide biosynthetic process (GO:0046513)|negative regulation of telomerase activity (GO:0051974)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	sphingosine N-acyltransferase activity (GO:0050291)			endometrium(3)|lung(2)	5						AGCTGAAGCCGAAGCTGAGGC	0.617																																					p.F247L		Atlas-SNP	.											.	CERS1	19	.	0			c.C741A						.						20.0	24.0	22.0					19																	18991094		2000	4105	6105	SO:0001583	missense	10715	exon4			GAAGCCGAAGCTG	AF105005	CCDS46021.1	19p12	2011-07-08	2011-07-08	2011-07-08		ENSG00000223802			14253	protein-coding gene	gene with protein product		606919	"""longevity assurance (LAG1, S. cerevisiae) homolog 1"", ""LAG1 longevity assurance homolog 1 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 1"""	LASS1		9872981, 2034669	Standard	NM_198207		Approved	LAG1, UOG1	uc002nkj.3	P27544		ENST00000427170.2:c.741C>A	chr19.hg19:g.18991094G>T	ENSP00000402697:p.Phe247Leu	41.0	0.0		31.0	14.0	NM_198207		Missense_Mutation	SNP	ENST00000427170.2	hg19	CCDS46020.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390884	0.82902	.	.	ENSG00000223802	ENST00000427170;ENST00000429504;ENST00000542296	D;D;D	0.85773	-2.03;-2.03;-2.03	3.85	2.79	0.32731	TRAM/LAG1/CLN8 homology domain (3);	.	.	.	.	D	0.91600	0.7346	M	0.87758	2.905	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.91925	0.5550	9	0.87932	D	0	.	9.7999	0.40757	0.1067:0.0:0.8933:0.0	.	247	P27544	CERS1_HUMAN	L	247;247;149	ENSP00000402697:F247L;ENSP00000389044:F247L;ENSP00000437648:F149L	ENSP00000402697:F247L	F	-	3	2	CERS1	18852094	1.000000	0.71417	0.884000	0.34674	0.993000	0.82548	7.266000	0.78452	1.869000	0.54173	0.430000	0.28490	TTC	.	.		0.617	CERS1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CEBPA	1050	hgsc.bcm.edu	37	19	33792755	33792755	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:33792755G>T	ENST00000498907.2	-	1	715	c.566C>A	c.(565-567)cCc>cAc	p.P189H	CTD-2540B15.11_ENST00000589932.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.7_ENST00000587312.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	189	Poly-Pro.				acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P185_P197del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					CGGGTGCGAGggcggcggcgg	0.751			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.P189H		Atlas-SNP	.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA	986	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.C566A						.						1.0	1.0	1.0					19																	33792755		447	1075	1522	SO:0001583	missense	1050	exon1	Familial Cancer Database	Familial AML	TGCGAGGGCGGCG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.566C>A	chr19.hg19:g.33792755G>T	ENSP00000427514:p.Pro189His	209.0	0.0		226.0	25.0	NM_004364	A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	ENST00000498907.2	hg19	CCDS54243.1	.	.	.	.	.	.	.	.	.	.	G	5.519	0.280743	0.10458	.	.	ENSG00000245848	ENST00000498907	T	0.23754	1.89	3.5	1.14	0.20703	.	.	.	.	.	T	0.12263	0.0298	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30119	-0.9989	9	0.32370	T	0.25	.	8.2882	0.31941	0.0:0.0:0.3118:0.6881	.	189	P49715	CEBPA_HUMAN	H	189	ENSP00000427514:P189H	ENSP00000427514:P189H	P	-	2	0	CEBPA	38484595	0.982000	0.34865	0.123000	0.21794	0.139000	0.21198	0.311000	0.19380	0.009000	0.14813	0.064000	0.15345	CCC	.	.		0.751	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
CEBPA	1050	hgsc.bcm.edu	37	19	33792759	33792759	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:33792759G>A	ENST00000498907.2	-	1	711	c.562C>T	c.(562-564)Ccg>Tcg	p.P188S	CTD-2540B15.11_ENST00000589932.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.7_ENST00000587312.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	188	Poly-Pro.				acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P188del(4)|p.P185_P197del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					TGCGAGggcggcggcggcggc	0.746			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.P188S		Atlas-SNP	.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA	986	.	5	Deletion - In frame(5)	haematopoietic_and_lymphoid_tissue(5)	c.C562T						.						1.0	1.0	1.0					19																	33792759		371	891	1262	SO:0001583	missense	1050	exon1	Familial Cancer Database	Familial AML	AGGGCGGCGGCGG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.562C>T	chr19.hg19:g.33792759G>A	ENSP00000427514:p.Pro188Ser	222.0	0.0		227.0	20.0	NM_004364	A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	ENST00000498907.2	hg19	CCDS54243.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906015	0.33628	.	.	ENSG00000245848	ENST00000498907	T	0.21932	1.98	3.67	3.67	0.42095	.	.	.	.	.	T	0.13372	0.0324	N	0.22421	0.69	0.18873	N	0.999985	B	0.21688	0.059	B	0.11329	0.006	T	0.21109	-1.0255	9	0.15499	T	0.54	.	11.04	0.47825	0.0:0.0:1.0:0.0	.	188	P49715	CEBPA_HUMAN	S	188	ENSP00000427514:P188S	ENSP00000427514:P188S	P	-	1	0	CEBPA	38484599	0.968000	0.33430	0.769000	0.31535	0.114000	0.19823	-0.017000	0.12590	1.631000	0.50456	0.064000	0.15345	CCG	.	.		0.746	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
NCR1	9437	hgsc.bcm.edu	37	19	55417692	55417692	+	Splice_Site	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:55417692C>T	ENST00000291890.4	+	2	108	c.70C>T	c.(70-72)Cag>Tag	p.Q24*	NCR1_ENST00000594765.1_Splice_Site_p.Q24*|NCR1_ENST00000357397.5_Intron|NCR1_ENST00000350790.5_Splice_Site_p.Q24*|NCR1_ENST00000598576.1_Intron|NCR1_ENST00000447255.1_Splice_Site_p.Q24*|NCR1_ENST00000338835.5_Splice_Site_p.Q24*	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	24					cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CGCCCAGCAGCGTGAGTCCTT	0.617																																					p.Q24X		Atlas-SNP	.											.	NCR1	60	.	0			c.C70T						.						92.0	78.0	83.0					19																	55417692		2203	4300	6503	SO:0001630	splice_region_variant	9437	exon2			CAGCAGCGTGAGT	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.70+1C>T	chr19.hg19:g.55417692C>T		35.0	0.0		30.0	16.0	NM_001145458	B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Nonsense_Mutation	SNP	ENST00000291890.4	hg19	CCDS12911.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431849	0.43122	.	.	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835;ENST00000350790	.	.	.	3.2	-1.84	0.07809	.	1.396620	0.04740	N	0.422626	.	.	.	.	.	.	0.43835	D	0.996414	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	6.9521	0.24550	0.0:0.3578:0.5308:0.1114	.	.	.	.	X	24	.	ENSP00000291890:Q24X	Q	+	1	0	NCR1	60109504	0.000000	0.05858	0.063000	0.19743	0.195000	0.23768	-1.955000	0.01523	-0.216000	0.10048	-0.182000	0.12963	CAG;CAG;CAG;CAA	.	.		0.617	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1		Nonsense_Mutation
NLRP2	55655	hgsc.bcm.edu	37	19	55493985	55493985	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr19:55493985G>T	ENST00000543010.1	+	6	1062	c.919G>T	c.(919-921)Gac>Tac	p.D307Y	NLRP2_ENST00000339757.7_Missense_Mutation_p.D285Y|NLRP2_ENST00000537859.1_Missense_Mutation_p.D285Y|NLRP2_ENST00000263437.6_Missense_Mutation_p.D304Y|NLRP2_ENST00000448584.2_Missense_Mutation_p.D307Y|NLRP2_ENST00000427260.2_Missense_Mutation_p.D284Y|NLRP2_ENST00000391721.4_Missense_Mutation_p.D283Y|NLRP2_ENST00000538819.1_Missense_Mutation_p.D283Y	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	307	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CATCTGCGGGGACTGGGAGAA	0.617																																					p.D307Y		Atlas-SNP	.											.	NLRP2	161	.	0			c.G919T						.						49.0	48.0	48.0					19																	55493985		2203	4300	6503	SO:0001583	missense	55655	exon6			TGCGGGGACTGGG	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.919G>T	chr19.hg19:g.55493985G>T	ENSP00000445135:p.Asp307Tyr	75.0	0.0		52.0	17.0	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	hg19	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729391	0.30684	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.81330	-1.44;-1.38;-1.38;-1.44;-1.38;-1.48;-1.38;-1.43	1.55	-2.06	0.07298	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.88142	0.6357	M	0.88979	2.995	0.18873	N	0.999982	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.995;0.999;0.992;0.999	T	0.77351	-0.2620	9	0.87932	D	0	.	5.0778	0.14640	0.5851:0.0:0.4149:0.0	.	284;285;304;283;307	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	Y	307;283;285;307;285;284;283;304	ENSP00000445135:D307Y;ENSP00000375601:D283Y;ENSP00000344074:D285Y;ENSP00000409370:D307Y;ENSP00000440601:D285Y;ENSP00000402474:D284Y;ENSP00000441133:D283Y;ENSP00000263437:D304Y	ENSP00000263437:D304Y	D	+	1	0	NLRP2	60185797	0.002000	0.14202	0.006000	0.13384	0.004000	0.04260	0.175000	0.16762	-0.521000	0.06426	-0.350000	0.07774	GAC	.	.		0.617	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
MICALL1	85377	hgsc.bcm.edu	37	22	38318092	38318092	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr22:38318092G>A	ENST00000215957.6	+	6	809	c.683G>A	c.(682-684)gGg>gAg	p.G228E		NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	228					endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					ACACGGTCGGGGACCAGGCCT	0.642																																					p.G228E		Atlas-SNP	.											.	MICALL1	53	.	0			c.G683A						.						33.0	33.0	33.0					22																	38318092		2203	4300	6503	SO:0001583	missense	85377	exon6			GGTCGGGGACCAG	BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.683G>A	chr22.hg19:g.38318092G>A	ENSP00000215957:p.Gly228Glu	173.0	0.0		131.0	54.0	NM_033386	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Missense_Mutation	SNP	ENST00000215957.6	hg19	CCDS13961.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480417	0.44044	.	.	ENSG00000100139	ENST00000445494;ENST00000215957	T;T	0.72394	-0.65;0.5	4.87	2.55	0.30701	.	0.198284	0.35013	N	0.003509	T	0.52901	0.1763	L	0.48362	1.52	0.46011	D	0.998811	B	0.17852	0.024	B	0.15052	0.012	T	0.35325	-0.9793	10	0.13853	T	0.58	.	1.897	0.03260	0.2322:0.0:0.4383:0.3295	.	228	Q8N3F8	MILK1_HUMAN	E	144;228	ENSP00000404543:G144E;ENSP00000215957:G228E	ENSP00000215957:G228E	G	+	2	0	MICALL1	36648038	0.679000	0.27596	0.012000	0.15200	0.004000	0.04260	1.009000	0.29886	1.011000	0.39340	0.400000	0.26472	GGG	.	.		0.642	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	NM_033386	
DMD	1756	hgsc.bcm.edu	37	X	32862919	32862919	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chrX:32862919C>A	ENST00000357033.4	-	4	451	c.245G>T	c.(244-246)cGg>cTg	p.R82L	DMD_ENST00000378677.2_Missense_Mutation_p.R78L|DMD_ENST00000288447.4_Missense_Mutation_p.R74L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	82	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGCAAAACCCGCAGTGCCTT	0.458																																					p.R82L		Atlas-SNP	.											.	DMD	2127	.	0			c.G245T	GRCh37	CM051908	DMD	M		.						190.0	134.0	153.0					X																	32862919		2202	4300	6502	SO:0001583	missense	1756	exon4			AAAACCCGCAGTG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.245G>T	chrX.hg19:g.32862919C>A	ENSP00000354923:p.Arg82Leu	62.0	0.0		44.0	28.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243481	0.39697	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000288447;ENST00000447523	D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57	5.74	0.0358	0.14189	Calponin homology domain (5);	0.578074	0.12895	U	0.430300	D	0.89832	0.6829	L	0.36672	1.1	0.50171	D	0.999852	B;B;B;B	0.25235	0.121;0.061;0.008;0.075	B;B;B;B	0.25291	0.059;0.022;0.005;0.037	T	0.82178	-0.0586	10	0.87932	D	0	.	9.3333	0.38034	0.0:0.257:0.0:0.743	.	74;74;82;78	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	L	74;78;82;82;74;45	ENSP00000367948:R78L;ENSP00000354923:R82L;ENSP00000288447:R74L;ENSP00000395904:R45L	ENSP00000288447:R74L	R	-	2	0	DMD	32772840	0.235000	0.23794	0.286000	0.24833	0.954000	0.61252	0.563000	0.23547	-0.052000	0.13311	-0.192000	0.12808	CGG	.	.		0.458	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
RP2	6102	hgsc.bcm.edu	37	X	46713384	46713384	+	Silent	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chrX:46713384T>C	ENST00000218340.3	+	2	737	c.576T>C	c.(574-576)gaT>gaC	p.D192D		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	192					cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						TTCCAGAAGATGCTGTGGTTC	0.443																																					p.D192D		Atlas-SNP	.											.	RP2	37	.	0			c.T576C						.						96.0	77.0	84.0					X																	46713384		2203	4300	6503	SO:0001819	synonymous_variant	6102	exon2			AGAAGATGCTGTG	AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.576T>C	chrX.hg19:g.46713384T>C		115.0	0.0		55.0	32.0	NM_006915	Q86XJ7|Q9NU67	Silent	SNP	ENST00000218340.3	hg19	CCDS14270.1																																																																																			.	.		0.443	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056375.1	NM_006915	
FAM133A	286499	hgsc.bcm.edu	37	X	92964868	92964868	+	Silent	SNP	A	A	G			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chrX:92964868A>G	ENST00000355813.5	+	4	976	c.450A>G	c.(448-450)gaA>gaG	p.E150E	FAM133A_ENST00000322139.4_Silent_p.E150E|FAM133A_ENST00000332647.4_Silent_p.E150E|FAM133A_ENST00000538690.1_Silent_p.E150E	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	150	Lys-rich.|Ser-rich.									breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						ATGAATCAGAATCAGAGAGCA	0.358																																					p.E150E		Atlas-SNP	.											.	FAM133A	37	.	0			c.A450G						.						28.0	25.0	26.0					X																	92964868		2200	4297	6497	SO:0001819	synonymous_variant	286499	exon4			ATCAGAATCAGAG	AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.450A>G	chrX.hg19:g.92964868A>G		81.0	0.0		48.0	26.0	NM_173698		Silent	SNP	ENST00000355813.5	hg19	CCDS14466.1																																																																																			.	.		0.358	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	NM_173698	
ATP2B3	492	hgsc.bcm.edu	37	X	152814216	152814216	+	Silent	SNP	C	C	T			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chrX:152814216C>T	ENST00000349466.2	+	9	1568	c.1242C>T	c.(1240-1242)ttC>ttT	p.F414F	ATP2B3_ENST00000263519.4_Silent_p.F414F|ATP2B3_ENST00000359149.3_Silent_p.F414F|ATP2B3_ENST00000370186.1_Silent_p.F400F|ATP2B3_ENST00000393842.1_Silent_p.F400F|ATP2B3_ENST00000370181.2_Silent_p.F400F			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	414					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TACAATACTTCGTGAAGTTCT	0.522													C|||	1	0.000264901	0.0	0.0	3775	,	,		13933	0.0		0.0	False		,,,				2504	0.001				p.F414F		Atlas-SNP	.											.	ATP2B3	552	.	0			c.C1242T						.						203.0	129.0	154.0					X																	152814216		2203	4300	6503	SO:0001819	synonymous_variant	492	exon8			ATACTTCGTGAAG	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1242C>T	chrX.hg19:g.152814216C>T		59.0	0.0		30.0	19.0	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	hg19	CCDS35440.1																																																																																			.	.		0.522	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
PCDH11Y	83259	hgsc.bcm.edu	37	Y	4967388	4967388	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chrY:4967388T>C	ENST00000333703.4	+	5	2249	c.1736T>C	c.(1735-1737)gTa>gCa	p.V579A	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.V590A|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.V590A	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	590	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ACAGTCTTTGTAAGCATTATT	0.368																																					p.V590A		Atlas-SNP	.											.	PCDH11Y	163	.	0			c.T1769C						.						51.0	42.0	44.0					Y																	4967388		696	2073	2769	SO:0001583	missense	83259	exon2			TCTTTGTAAGCAT	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1736T>C	chrY.hg19:g.4967388T>C	ENSP00000330552:p.Val579Ala	192.0	0.0		115.0	43.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	hg19	CCDS14776.1																																																																																			.	.		0.368	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
MT-ND2	4536	hgsc.bcm.edu	37	M	5116	5116	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chrM:5116T>C	ENST00000361453.3	+	1	647	c.647T>C	c.(646-648)tTc>tCc	p.F216S	MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	216					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TACTACCGCATTCCTACTACT	0.393																																					p.F216S		Atlas-SNP	.											.	.	.	.	0			c.T647C						.																																			SO:0001583	missense	0	exon1			CCGCATTCCTACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.647T>C	chrM.hg19:g.5116T>C	ENSP00000355046:p.Phe216Ser	19.0	0.0		37.0	36.0	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.		0.393	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
TP53	7157	hgsc.bcm.edu	37	17	7578237	7578238	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr17:7578237_7578238delCT	ENST00000269305.4	-	6	800_801	c.611_612delAG	c.(610-612)gagfs	p.E204fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.E204fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.E204fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.E204fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.E204fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.E204fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	204	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|VE -> LV (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(5)|p.E204D(4)|p.E204E(2)|p.E204fs*5(2)|p.E204G(2)|p.E204A(1)|p.E111D(1)|p.Y205fs*43(1)|p.E204fs*4(1)|p.E72D(1)|p.E204V(1)|p.V203_E204>LV(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATCCAAATACTCCACACGCAA	0.54		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.204_205del	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,temporoparietal,glioma,+1,1	TP53	33396	.	33	Substitution - Missense(10)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Substitution - coding silent(2)|Deletion - In frame(1)|Complex - compound substitution(1)	biliary_tract(5)|endometrium(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|central_nervous_system(2)|lung(2)|oesophagus(2)|stomach(1)|soft_tissue(1)|large_intestine(1)|urinary_tract(1)|ovary(1)|autonomic_ganglia(1)|pancreas(1)	c.612_613del						.																																			SO:0001589	frameshift_variant	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.611_612delAG	chr17.hg19:g.7578237_7578238delCT	ENSP00000269305:p.Glu204fs	163.0	0.0		114.0	63.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.540	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
STRIP1	85369	hgsc.bcm.edu	37	1	110596387	110596387	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr1:110596387delC	ENST00000369795.3	+	21	2389	c.2367delC	c.(2365-2367)aacfs	p.N789fs	STRIP1_ENST00000369796.1_Frame_Shift_Del_p.N694fs	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	789					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CCCACAGCAACCCTGACTTCC	0.582											OREG0013647	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N789fs		Atlas-Indel,Pindel	.											.	STRIP1	1	.	0			c.2366delA						.						53.0	51.0	52.0					1																	110596387		2203	4300	6503	SO:0001589	frameshift_variant	85369	exon21			.	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.2367delC	chr1.hg19:g.110596387delC	ENSP00000358810:p.Asn789fs	85.0	0.0	1428	56.0	25.0	NM_033088	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Frame_Shift_Del	DEL	ENST00000369795.3	hg19	CCDS30798.1																																																																																			.	.		0.582	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032213.1	NM_033088	
FAM171B	165215	hgsc.bcm.edu	37	2	187618658	187618673	+	Splice_Site	DEL	TTACATACCTTTTTAG	TTACATACCTTTTTAG	-	rs17855085		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	TTACATACCTTTTTAG	TTACATACCTTTTTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:187618658_187618673delTTACATACCTTTTTAG	ENST00000304698.5	+	6	1098_1112	c.895_909delTTACATACCTTTTTAG	c.(895-909)ttacatacctttttadel	p.LHTFL299fs		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	299						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						ATACCTTTTTAGGTGCTTGGGTAAATCATGGTCGGG	0.37																																					.		Atlas-Indel,Pindel	.											.	FAM171B	146	.	0			.						.																																			SO:0001630	splice_region_variant	165215	.			.	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.896-1TTACATACCTTTTTAG>-	chr2.hg19:g.187618658_187618673delTTACATACCTTTTTAG		98.0	0.0		58.0	18.0	.	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Splice_Site	DEL	ENST00000304698.5	hg19	CCDS33347.1																																																																																			.	.		0.370	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	Frame_Shift_Del
SESTD1	91404	hgsc.bcm.edu	37	2	179979934	179979935	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr2:179979934_179979935insA	ENST00000428443.3	-	16	2012_2013	c.1696_1697insT	c.(1696-1698)tgcfs	p.C566fs		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	566							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			CAAAGATTGGCATAACACAACT	0.391																																					p.C566fs		Atlas-INDEL	.											SESTD1,colon,carcinoma,0,1	SESTD1	66	.	0			c.1697_1698insT						.																																			SO:0001589	frameshift_variant	91404	exon16			.	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1697dupT	chr2.hg19:g.179979935_179979935dupA	ENSP00000415332:p.Cys566fs	90.0	0.0		76.0	10.0	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Frame_Shift_Ins	INS	ENST00000428443.3	hg19	CCDS33338.1																																																																																			.	.		0.391	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
GRK7	131890	hgsc.bcm.edu	37	3	141499234	141499234	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:141499234delA	ENST00000264952.2	+	2	768	c.631delA	c.(631-633)aaafs	p.K211fs		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						CGTCCAGGTGAAAAACACTGG	0.458																																					p.V210fs		Atlas-Indel,Pindel	.											.	GRK7	65	.	0			c.630delG						.						54.0	55.0	54.0					3																	141499234		2203	4300	6503	SO:0001589	frameshift_variant	131890	exon2			.		CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.631delA	chr3.hg19:g.141499234delA	ENSP00000264952:p.Lys211fs	161.0	0.0		135.0	41.0	NM_139209		Frame_Shift_Del	DEL	ENST00000264952.2	hg19	CCDS3120.1																																																																																			.	.		0.458	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353168.1	NM_139209	
CMYA5	202333	hgsc.bcm.edu	37	5	79026111	79026111	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr5:79026111delA	ENST00000446378.2	+	2	1554	c.1523delA	c.(1522-1524)gaafs	p.E508fs		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	508	Glu-rich.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GAGAAAGAAGAAATAGAAACT	0.413																																					p.E508fs		Pindel	.											.	CMYA5	643	.	0			c.1522delG						.						112.0	107.0	109.0					5																	79026111		1880	4113	5993	SO:0001589	frameshift_variant	202333	exon2			.	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.1523delA	chr5.hg19:g.79026111delA	ENSP00000394770:p.Glu508fs	180.0	0.0		164.0	27.0	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Frame_Shift_Del	DEL	ENST00000446378.2	hg19	CCDS47238.1																																																																																			.	.		0.413	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
ZNF860	344787	hgsc.bcm.edu	37	3	32030993	32030994	+	In_Frame_Ins	INS	-	-	TGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGG	rs187640039		TCGA-DD-AADN-01A-11D-A40R-10	TCGA-DD-AADN-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b5fdeb5e-38a1-4da0-b372-045b08809738	9a4390a9-935c-4d95-aa5e-55b7dcfb8fbe	g.chr3:32030993_32030994insTGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGG	ENST00000360311.4	+	2	971_972	c.422_423insTGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGG	c.(421-426)tatgat>taTGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGGtgat	p.142_143insRRHPGNKPIKDQLGD		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						ACCGACAGATATGATCGAAGGC	0.396																																					p.Y141delinsYDRRHPGNKPIKDQLG		Pindel	.											.	ZNF860	96	.	0			c.422_423insTGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGG						.																																			SO:0001652	inframe_insertion	344787	exon2			.	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.423_467dupTGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGG	chr3.hg19:g.32030993_32030994insTGATCGAAGGCATCCTGGAAACAAGCCTATCAAAGATCAGCTTGG	ENSP00000373274:p.Asp142_Arg143insArgArgHisProGlyAsnLysProIleLysAspGlnLeuGlyAsp	287.0	0.0		388.0	25.0	NM_001137674	B4DFA4	In_Frame_Ins	INS	ENST00000360311.4	hg19	CCDS46784.1																																																																																			.	.		0.396	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1		
