#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	hgsc.bcm.edu	37	1	17296811	17296811	+	Missense_Mutation	SNP	G	G	A	rs572688461		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:17296811G>A	ENST00000375541.5	+	34	5584	c.5515G>A	c.(5515-5517)Gag>Aag	p.E1839K		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCTGCAAGACGAGCGGCGGCT	0.692																																					p.E1839K		Atlas-SNP	.											.	CROCC	185	.	0			c.G5515A						.						5.0	5.0	5.0					1																	17296811		1858	3791	5649	SO:0001583	missense	9696	exon34			CAAGACGAGCGGC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.5515G>A	chr1.hg19:g.17296811G>A	ENSP00000364691:p.Glu1839Lys	92.0	0.0		165.0	27.0	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	hg19	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661241	0.88154	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.21031	2.03	4.81	4.81	0.61882	.	.	.	.	.	T	0.49115	0.1538	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.991;0.998;0.994	T	0.52946	-0.8507	9	0.56958	D	0.05	.	15.7617	0.78087	0.0:0.0:1.0:0.0	.	1720;1142;1839	B1AKD8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	K	1839;1720	ENSP00000364691:E1839K	ENSP00000364691:E1839K	E	+	1	0	CROCC	17169398	1.000000	0.71417	0.940000	0.37924	0.507000	0.33981	6.848000	0.75409	2.395000	0.81488	0.655000	0.94253	GAG	.	.		0.692	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
CFAP57	149465	hgsc.bcm.edu	37	1	43638006	43638006	+	5'UTR	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:43638006C>T	ENST00000372492.4	+	0	187				EBNA1BP2_ENST00000472982.1_5'Flank|EBNA1BP2_ENST00000431635.2_Silent_p.P29P|WDR65_ENST00000528956.1_5'UTR|EBNA1BP2_ENST00000236051.2_5'Flank	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN												NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACCATACTTCCGGTTTGTCGT	0.562																																					p.P29P		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.G87A						.						68.0	64.0	66.0					1																	43638006		692	1591	2283	SO:0001623	5_prime_UTR_variant	10969	exon1			TACTTCCGGTTTG																												ENST00000372492.4:c.-138C>T	chr1.hg19:g.43638006C>T		65.0	0.0		60.0	25.0	NM_001159936	A6NKQ3|Q17RI9|Q5TAI0	Silent	SNP	ENST00000372492.4	hg19																																																																																				.	.		0.562	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
COL24A1	255631	hgsc.bcm.edu	37	1	86289219	86289219	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:86289219T>C	ENST00000370571.2	-	45	4155	c.3789A>G	c.(3787-3789)gaA>gaG	p.E1263E	COL24A1_ENST00000436319.1_Splice_Site_p.E1263E	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1263	Collagen-like 14.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCAACTTACTTCAGATCCTC	0.343																																					p.E1263E		Atlas-SNP	.											.	COL24A1	202	.	0			c.A3789G						.						106.0	100.0	102.0					1																	86289219		1856	4099	5955	SO:0001630	splice_region_variant	255631	exon45			ACTTACTTCAGAT	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.3789+1A>G	chr1.hg19:g.86289219T>C		147.0	0.0		133.0	33.0	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Silent	SNP	ENST00000370571.2	hg19	CCDS41353.1																																																																																			.	.		0.343	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	Silent
DPYD	1806	hgsc.bcm.edu	37	1	98015267	98015267	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:98015267C>T	ENST00000370192.3	-	12	1473	c.1373G>A	c.(1372-1374)aGa>aAa	p.R458K		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	458					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.R458K(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	GAGACCCCATCTGTTAAATTT	0.373																																					p.R458K		Atlas-SNP	.											DPYD,acral,malignant_melanoma,0,2	DPYD	219	.	1	Substitution - Missense(1)	lung(1)	c.G1373A						.						70.0	65.0	67.0					1																	98015267		2203	4300	6503	SO:0001583	missense	1806	exon12			CCCCATCTGTTAA	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1373G>A	chr1.hg19:g.98015267C>T	ENSP00000359211:p.Arg458Lys	78.0	0.0		67.0	14.0	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	hg19	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.275007	0.23307	.	.	ENSG00000188641	ENST00000370192	D	0.92249	-3.0	6.16	3.34	0.38264	.	0.151926	0.56097	N	0.000024	T	0.68952	0.3057	N	0.17922	0.545	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.62613	-0.6817	10	0.02654	T	1	-15.0585	11.0603	0.47944	0.0:0.7682:0.0:0.2318	.	458	Q12882	DPYD_HUMAN	K	458	ENSP00000359211:R458K	ENSP00000359211:R458K	R	-	2	0	DPYD	97787855	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.466000	0.35310	0.498000	0.27948	0.650000	0.86243	AGA	.	.		0.373	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144886226	144886226	+	Missense_Mutation	SNP	T	T	G	rs139542367		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:144886226T>G	ENST00000369354.3	-	23	3197	c.3008A>C	c.(3007-3009)cAg>cCg	p.Q1003P	PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.Q1140P|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.Q1003P|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.Q1069P|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.Q1140P			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1003					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CATTTCTTCCTGAAGACACCT	0.507			T	PDGFRB	MPD																																p.Q1069P		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.A3206C						.						214.0	214.0	214.0					1																	144886226		2203	4296	6499	SO:0001583	missense	9659	exon26			TCTTCCTGAAGAC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3008A>C	chr1.hg19:g.144886226T>G	ENSP00000358360:p.Gln1003Pro	137.0	0.0		163.0	19.0	NM_001198832	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	10.05	1.244139	0.22796	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01647	4.71;4.79;4.79;4.79;4.78	5.56	5.56	0.83823	.	.	.	.	.	T	0.01627	0.0052	L	0.29908	0.895	0.80722	D	1	B;D	0.60575	0.119;0.988	B;P	0.53313	0.028;0.723	T	0.72487	-0.4278	9	0.36615	T	0.2	.	13.676	0.62454	0.0:0.0:0.0:1.0	.	1069;1003	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	P	1069;1003;1003;1140;1140	ENSP00000327209:Q1069P;ENSP00000358360:Q1003P;ENSP00000358363:Q1003P;ENSP00000435654:Q1140P;ENSP00000358366:Q1140P	ENSP00000327209:Q1069P	Q	-	2	0	PDE4DIP	143597583	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	1.995000	0.40767	2.128000	0.65567	0.459000	0.35465	CAG	.	.		0.507	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
RFX5	5993	hgsc.bcm.edu	37	1	151315082	151315082	+	Silent	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:151315082C>T	ENST00000290524.4	-	11	1609	c.1431G>A	c.(1429-1431)ggG>ggA	p.G477G	RFX5_ENST00000478564.1_5'Flank|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452513.2_Silent_p.G437G|RFX5_ENST00000452671.2_Silent_p.G477G|RFX5_ENST00000368870.2_Silent_p.G477G	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	477					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AATTCCTTTCCCCACTTCCAC	0.537																																					p.G477G		Atlas-SNP	.											.	RFX5	69	.	0			c.G1431A						.						212.0	232.0	225.0					1																	151315082		2203	4300	6503	SO:0001819	synonymous_variant	5993	exon11			CCTTTCCCCACTT		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1431G>A	chr1.hg19:g.151315082C>T		90.0	0.0		122.0	15.0	NM_000449	B7Z848|D3DV19|E9PFU4|Q5VWC3	Silent	SNP	ENST00000290524.4	hg19	CCDS994.1																																																																																			.	.		0.537	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
TCHH	7062	hgsc.bcm.edu	37	1	152083480	152083480	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:152083480T>A	ENST00000368804.1	-	2	2212	c.2213A>T	c.(2212-2214)aAg>aTg	p.K738M		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	738					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGCCGCCTCTTTTCCTCCTG	0.652																																					p.K738M		Atlas-SNP	.											.	TCHH	275	.	0			c.A2213T						.						83.0	103.0	97.0					1																	152083480		1949	4125	6074	SO:0001583	missense	7062	exon3			CGCCTCTTTTCCT	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2213A>T	chr1.hg19:g.152083480T>A	ENSP00000357794:p.Lys738Met	52.0	0.0		91.0	6.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	t	11.21	1.572701	0.28092	.	.	ENSG00000159450	ENST00000368804	T	0.06142	3.34	4.09	0.299	0.15771	.	.	.	.	.	T	0.01627	0.0052	N	0.14661	0.345	0.09310	N	1	P	0.49961	0.93	P	0.48368	0.575	T	0.40117	-0.9580	9	0.59425	D	0.04	-1.6725	3.5021	0.07677	0.1664:0.1999:0.0:0.6338	.	738	Q07283	TRHY_HUMAN	M	738	ENSP00000357794:K738M	ENSP00000357794:K738M	K	-	2	0	TCHH	150350104	0.000000	0.05858	0.001000	0.08648	0.552000	0.35366	-0.003000	0.12901	-0.238000	0.09724	0.375000	0.23000	AAG	.	.		0.652	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
FLG	2312	hgsc.bcm.edu	37	1	152280916	152280916	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:152280916C>T	ENST00000368799.1	-	3	6481	c.6446G>A	c.(6445-6447)aGa>aAa	p.R2149K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2149	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGACCCCTGTCTTCCTCCTCT	0.587									Ichthyosis																												p.R2149K		Atlas-SNP	.											.	FLG	900	.	0			c.G6446A						.						401.0	324.0	350.0					1																	152280916		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCCTGTCTTCCTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6446G>A	chr1.hg19:g.152280916C>T	ENSP00000357789:p.Arg2149Lys	91.0	0.0		162.0	24.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	c	7.808	0.715007	0.15306	.	.	ENSG00000143631	ENST00000368799	T	0.03920	3.76	2.87	0.751	0.18392	.	.	.	.	.	T	0.01905	0.0060	M	0.79805	2.47	0.09310	N	1	P	0.45531	0.86	B	0.40534	0.332	T	0.36915	-0.9728	9	0.05721	T	0.95	.	8.5764	0.33601	0.0:0.5299:0.4701:0.0	.	2149	P20930	FILA_HUMAN	K	2149	ENSP00000357789:R2149K	ENSP00000357789:R2149K	R	-	2	0	FLG	150547540	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.561000	0.05957	0.052000	0.16007	0.485000	0.47835	AGA	.	.		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
NTRK1	4914	hgsc.bcm.edu	37	1	156851354	156851354	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:156851354C>T	ENST00000524377.1	+	17	2352	c.2311C>T	c.(2311-2313)Cgc>Tgc	p.R771C	NTRK1_ENST00000531606.1_3'UTR|NTRK1_ENST00000392302.2_Missense_Mutation_p.R735C|NTRK1_ENST00000368196.3_Missense_Mutation_p.R765C|NTRK1_ENST00000358660.3_Missense_Mutation_p.R768C	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	771	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GCCCCAGCAACGCCACAGCAT	0.692			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.R771C		Atlas-SNP	.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1	287	.	0			c.C2311T						.						27.0	26.0	26.0					1																	156851354		2202	4297	6499	SO:0001583	missense	4914	exon17			CAGCAACGCCACA	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2311C>T	chr1.hg19:g.156851354C>T	ENSP00000431418:p.Arg771Cys	147.0	0.0		202.0	25.0	NM_002529	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	hg19	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951991	0.73787	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	4.87	4.87	0.63330	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000008	D	0.99318	0.9761	H	0.97896	4.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98686	1.0694	10	0.87932	D	0	.	11.911	0.52739	0.1741:0.8259:0.0:0.0	.	768;765;771;735	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	C	735;765;771;768	ENSP00000376120:R735C;ENSP00000357179:R765C;ENSP00000431418:R771C;ENSP00000351486:R768C	ENSP00000351486:R768C	R	+	1	0	NTRK1	155117978	0.995000	0.38212	0.994000	0.49952	0.863000	0.49368	3.201000	0.51059	2.518000	0.84900	0.655000	0.94253	CGC	.	.		0.692	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
KIRREL	55243	hgsc.bcm.edu	37	1	158061204	158061204	+	Silent	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:158061204G>T	ENST00000359209.6	+	11	1396	c.1329G>T	c.(1327-1329)gtG>gtT	p.V443V	KIRREL_ENST00000368173.3_Silent_p.V459V|KIRREL_ENST00000392272.2_Silent_p.V340V|KIRREL_ENST00000368172.1_Silent_p.V257V|KIRREL_ENST00000416935.2_Silent_p.V343V|KIRREL_ENST00000360089.4_Silent_p.V279V			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	443	Ig-like C2-type 5.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GCTATACAGTGGAGAGGACCA	0.567																																					p.V443V		Atlas-SNP	.											.	KIRREL	346	.	0			c.G1329T						.						127.0	119.0	122.0					1																	158061204		2203	4300	6503	SO:0001819	synonymous_variant	55243	exon11			TACAGTGGAGAGG	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1329G>T	chr1.hg19:g.158061204G>T		99.0	0.0		151.0	79.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Silent	SNP	ENST00000359209.6	hg19	CCDS1172.2																																																																																			.	.		0.567	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
ADAMTS4	9507	hgsc.bcm.edu	37	1	161163059	161163059	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:161163059A>C	ENST00000367996.5	-	7	2283	c.1855T>G	c.(1855-1857)Tgc>Ggc	p.C619G	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	619	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	GTGAGTTTGCACTGGTCCTGG	0.632																																					p.C619G		Atlas-SNP	.											.	ADAMTS4	171	.	0			c.T1855G						.						51.0	48.0	49.0					1																	161163059		2203	4300	6503	SO:0001583	missense	9507	exon7			GTTTGCACTGGTC	AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1855T>G	chr1.hg19:g.161163059A>C	ENSP00000356975:p.Cys619Gly	43.0	0.0		71.0	5.0	NM_005099	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	hg19	CCDS1223.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406768	0.83230	.	.	ENSG00000158859	ENST00000367996	T	0.74842	-0.88	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000002	D	0.90376	0.6988	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93758	0.7064	10	0.87932	D	0	.	13.4839	0.61353	1.0:0.0:0.0:0.0	.	619	O75173	ATS4_HUMAN	G	619	ENSP00000356975:C619G	ENSP00000356975:C619G	C	-	1	0	ADAMTS4	159429683	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.139000	0.94554	2.007000	0.58848	0.455000	0.32223	TGC	.	.		0.632	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099	
UAP1	6675	hgsc.bcm.edu	37	1	162551100	162551100	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:162551100G>A	ENST00000367925.1	+	4	717	c.685G>A	c.(685-687)Gca>Aca	p.A229T	UAP1_ENST00000367926.4_Missense_Mutation_p.A229T|UAP1_ENST00000367924.1_Missense_Mutation_p.A229T|UAP1_ENST00000271469.3_Missense_Mutation_p.A229T			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	229					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)			breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TCTTTATCGGGCACTTGCAGC	0.403																																					p.A229T		Atlas-SNP	.											.	UAP1	47	.	0			c.G685A						.						226.0	229.0	228.0					1																	162551100		2203	4300	6503	SO:0001583	missense	6675	exon5			TATCGGGCACTTG	AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.685G>A	chr1.hg19:g.162551100G>A	ENSP00000356902:p.Ala229Thr	125.0	0.0		161.0	20.0	NM_003115	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Missense_Mutation	SNP	ENST00000367925.1	hg19		.	.	.	.	.	.	.	.	.	.	G	35	5.446404	0.96187	.	.	ENSG00000117143	ENST00000367926;ENST00000271469;ENST00000367925;ENST00000367924	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.50922	0.1644	M	0.92219	3.285	0.58432	D	0.999991	D	0.89917	1.0	D	0.76575	0.988	T	0.64202	-0.6463	9	0.87932	D	0	-8.6366	17.5485	0.87870	0.0:0.0:1.0:0.0	.	229	Q16222-2	.	T	229	ENSP00000356903:A229T;ENSP00000271469:A229T;ENSP00000356902:A229T;ENSP00000356901:A229T	ENSP00000271469:A229T	A	+	1	0	UAP1	160817724	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.628000	0.83189	2.548000	0.85928	0.591000	0.81541	GCA	.	.		0.403	UAP1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000083203.1	NM_003115	
PBX1	5087	hgsc.bcm.edu	37	1	164776788	164776788	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:164776788A>G	ENST00000420696.2	+	5	899	c.711A>G	c.(709-711)agA>agG	p.R237R	PBX1_ENST00000559240.1_Silent_p.R237R|PBX1_ENST00000540246.1_Silent_p.R132R|PBX1_ENST00000540236.1_Silent_p.R237R|PBX1_ENST00000367897.1_Silent_p.R237R|PBX1_ENST00000560641.1_Silent_p.R132R|PBX1_ENST00000401534.1_Silent_p.R237R	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	237					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						GGCGGAAGAGACGGAATTTCA	0.393			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.R237R		Atlas-SNP	.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	60	.	0			c.A711G						.						102.0	112.0	109.0					1																	164776788		2203	4300	6503	SO:0001819	synonymous_variant	5087	exon5			GAAGAGACGGAAT	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.711A>G	chr1.hg19:g.164776788A>G		180.0	0.0		308.0	46.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Silent	SNP	ENST00000420696.2	hg19	CCDS1246.1																																																																																			.	.		0.393	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
UCK2	7371	hgsc.bcm.edu	37	1	165865569	165865569	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:165865569G>A	ENST00000367879.4	+	4	802	c.499G>A	c.(499-501)Gta>Ata	p.V167I	UCK2_ENST00000469256.2_Splice_Site_p.V17I|UCK2_ENST00000372212.4_Intron|RP11-525G13.2_ENST00000455257.2_RNA|UCK2_ENST00000470820.1_Splice_Site_p.V17I|UCK2_ENST00000462329.1_3'UTR	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	167					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					CTCACGCAGAGGTGCGTTCTA	0.602																																					p.V167I		Atlas-SNP	.											.	UCK2	31	.	0			c.G499A						.						114.0	119.0	117.0					1																	165865569		2203	4300	6503	SO:0001630	splice_region_variant	7371	exon4			CGCAGAGGTGCGT	AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.499+1G>A	chr1.hg19:g.165865569G>A		68.0	0.0		113.0	15.0	NM_012474	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Missense_Mutation	SNP	ENST00000367879.4	hg19	CCDS1252.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890994	0.72524	.	.	ENSG00000143179	ENST00000367879	.	.	.	4.97	4.97	0.65823	Phosphoribulokinase/uridine kinase (1);	0.060192	0.64402	D	0.000003	T	0.41465	0.1160	L	0.28556	0.865	.	.	.	D	0.67145	0.996	P	0.61132	0.884	T	0.25984	-1.0116	8	0.08599	T	0.76	-5.9114	15.7418	0.77905	0.0:0.0:1.0:0.0	.	167	Q9BZX2	UCK2_HUMAN	I	167	.	ENSP00000356853:V167I	V	+	1	0	UCK2	164132193	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.517000	0.98020	2.309000	0.77851	0.655000	0.94253	GTA	.	.		0.602	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096753.1	NM_012474	Missense_Mutation
TNFSF4	7292	hgsc.bcm.edu	37	1	173176191	173176191	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:173176191T>G	ENST00000281834.3	-	1	261	c.125A>C	c.(124-126)tAc>tCc	p.Y42S	TNFSF4_ENST00000488053.1_5'Flank|TNFSF4_ENST00000367718.1_5'Flank	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	42					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						CAGGCAGATGTAGGTGAAGCA	0.542																																					p.Y42S		Atlas-SNP	.											.	TNFSF4	29	.	0			c.A125C						.						112.0	95.0	101.0					1																	173176191		2203	4300	6503	SO:0001583	missense	7292	exon1			CAGATGTAGGTGA	D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.125A>C	chr1.hg19:g.173176191T>G	ENSP00000281834:p.Tyr42Ser	86.0	0.0		107.0	57.0	NM_003326	Q5JZA5|Q8IV74|Q9HCN9	Missense_Mutation	SNP	ENST00000281834.3	hg19	CCDS1306.1	.	.	.	.	.	.	.	.	.	.	T	8.887	0.953071	0.18431	.	.	ENSG00000117586	ENST00000281834	.	.	.	5.67	1.93	0.25924	.	0.349225	0.24920	N	0.034556	T	0.37517	0.1006	M	0.71581	2.175	0.27245	N	0.959055	D	0.58268	0.982	P	0.55824	0.785	T	0.27739	-1.0065	9	0.87932	D	0	-7.8065	8.7487	0.34602	0.4457:0.0:0.0:0.5543	.	42	P23510	TNFL4_HUMAN	S	42	.	ENSP00000281834:Y42S	Y	-	2	0	TNFSF4	171442814	0.990000	0.36364	0.109000	0.21407	0.011000	0.07611	0.678000	0.25277	0.062000	0.16340	-1.385000	0.01166	TAC	.	.		0.542	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084271.1		
ZBTB37	84614	hgsc.bcm.edu	37	1	173839522	173839522	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:173839522C>G	ENST00000367701.5	+	2	350	c.159C>G	c.(157-159)agC>agG	p.S53R	ZBTB37_ENST00000367702.1_Missense_Mutation_p.S53R|ZBTB37_ENST00000427304.1_Missense_Mutation_p.S53R|ZBTB37_ENST00000432989.1_Missense_Mutation_p.S53R|ZBTB37_ENST00000367704.1_Missense_Mutation_p.S53R|GAS5_ENST00000364084.1_RNA			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	53	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						TGGCTGCCAGCTCCCCCTATT	0.488																																					p.S53R		Atlas-SNP	.											.	ZBTB37	38	.	0			c.C159G						.						113.0	112.0	113.0					1																	173839522		2203	4300	6503	SO:0001583	missense	84614	exon3			TGCCAGCTCCCCC	AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.159C>G	chr1.hg19:g.173839522C>G	ENSP00000356674:p.Ser53Arg	141.0	0.0		218.0	30.0	NM_032522	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	ENST00000367701.5	hg19	CCDS44278.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559583	0.65538	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367701	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	5.6	1.58	0.23477	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.071297	0.85682	D	0.000000	T	0.55386	0.1917	L	0.31926	0.97	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.993;0.997	T	0.59107	-0.7516	10	0.66056	D	0.02	.	9.7332	0.40374	0.0:0.7124:0.0:0.2876	.	53;53	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	R	53	ENSP00000356677:S53R;ENSP00000415293:S53R;ENSP00000409408:S53R;ENSP00000356675:S53R;ENSP00000356674:S53R	ENSP00000356674:S53R	S	+	3	2	ZBTB37	172106145	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.243000	0.43115	0.039000	0.15632	0.563000	0.77884	AGC	.	.		0.488	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090729.2	NM_032522	
TOR1AIP2	163590	hgsc.bcm.edu	37	1	179815788	179815788	+	Silent	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:179815788T>A	ENST00000367612.3	-	6	1218	c.831A>T	c.(829-831)ggA>ggT	p.G277G	TOR1AIP2_ENST00000609928.1_Silent_p.G277G	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						GAAACTTCCGTCCTCTCTGCC	0.517																																					p.G277G		Atlas-SNP	.											.	TOR1AIP2	38	.	0			c.A831T						.						71.0	71.0	71.0					1																	179815788		2203	4300	6503	SO:0001819	synonymous_variant	163590	exon7			CTTCCGTCCTCTC		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.831A>T	chr1.hg19:g.179815788T>A		97.0	0.0		103.0	10.0	NM_001199260	Q05BU2	Silent	SNP	ENST00000367612.3	hg19	CCDS1334.1																																																																																			.	.		0.517	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034	
FAM129A	116496	hgsc.bcm.edu	37	1	184764664	184764664	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:184764664T>A	ENST00000367511.3	-	14	2427	c.2234A>T	c.(2233-2235)gAa>gTa	p.E745V	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	745	Glu-rich.				negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						CTCTTCTTCTTCATTTTCTTG	0.542																																					p.E745V		Atlas-SNP	.											.	FAM129A	98	.	0			c.A2234T						.						147.0	156.0	153.0					1																	184764664		2203	4300	6503	SO:0001583	missense	116496	exon14			TCTTCTTCATTTT	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2234A>T	chr1.hg19:g.184764664T>A	ENSP00000356481:p.Glu745Val	61.0	0.0		87.0	11.0	NM_052966	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	hg19	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.082091	0.36758	.	.	ENSG00000135842	ENST00000367511	T	0.11385	2.78	5.44	0.117	0.14652	.	1.131090	0.06718	N	0.774372	T	0.06735	0.0172	L	0.29908	0.895	0.09310	N	1	B	0.29646	0.253	B	0.24541	0.054	T	0.40270	-0.9572	10	0.30854	T	0.27	-3.0053	1.9748	0.03413	0.1162:0.1507:0.3094:0.4237	.	745	Q9BZQ8	NIBAN_HUMAN	V	745	ENSP00000356481:E745V	ENSP00000356481:E745V	E	-	2	0	FAM129A	183031287	0.000000	0.05858	0.017000	0.16124	0.345000	0.29048	0.246000	0.18160	0.013000	0.14918	0.402000	0.26972	GAA	.	.		0.542	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
SERTAD4	56256	hgsc.bcm.edu	37	1	210414923	210414923	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:210414923A>G	ENST00000367012.3	+	4	542	c.312A>G	c.(310-312)gaA>gaG	p.E104E	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	104	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.					nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		TTTTTGAGGAACGAGCCCACA	0.318																																					p.E104E		Atlas-SNP	.											.	SERTAD4	53	.	0			c.A312G						.						59.0	62.0	61.0					1																	210414923		2203	4300	6503	SO:0001819	synonymous_variant	56256	exon4			TGAGGAACGAGCC	BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.312A>G	chr1.hg19:g.210414923A>G		100.0	0.0		160.0	22.0	NM_019605	B2RD32	Silent	SNP	ENST00000367012.3	hg19	CCDS1494.1																																																																																			.	.		0.318	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088577.1	NM_019605	
CENPF	1063	hgsc.bcm.edu	37	1	214814115	214814115	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:214814115A>C	ENST00000366955.3	+	12	2602	c.2434A>C	c.(2434-2436)Agt>Cgt	p.S812R		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTCAGAGAGGAGTGAATGTCG	0.388																																					p.S812R	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.A2434C						.						51.0	53.0	52.0					1																	214814115		2198	4299	6497	SO:0001583	missense	1063	exon12			GAGAGGAGTGAAT	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.2434A>C	chr1.hg19:g.214814115A>C	ENSP00000355922:p.Ser812Arg	151.0	0.0		249.0	35.0	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	4.477	0.088490	0.08583	.	.	ENSG00000117724	ENST00000366955	T	0.03272	3.99	5.59	0.569	0.17340	.	0.324291	0.22475	N	0.059577	T	0.03305	0.0096	.	.	.	0.09310	N	1	D	0.54601	0.967	P	0.46629	0.522	T	0.45571	-0.9252	9	0.23302	T	0.38	.	4.7063	0.12851	0.4936:0.0:0.3555:0.1509	.	812	P49454	CENPF_HUMAN	R	812	ENSP00000355922:S812R	ENSP00000355922:S812R	S	+	1	0	CENPF	212880738	0.000000	0.05858	0.035000	0.18076	0.105000	0.19272	0.467000	0.22035	0.092000	0.17331	0.496000	0.49642	AGT	.	.		0.388	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
RAB3GAP2	25782	hgsc.bcm.edu	37	1	220364508	220364508	+	Silent	SNP	T	T	C	rs149874983		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:220364508T>C	ENST00000358951.2	-	14	1505	c.1389A>G	c.(1387-1389)caA>caG	p.Q463Q		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	463					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TCACAAGGAATTGAGCTACTC	0.478																																					p.Q463Q		Atlas-SNP	.											.	RAB3GAP2	120	.	0			c.A1389G						.						125.0	123.0	124.0					1																	220364508		2203	4300	6503	SO:0001819	synonymous_variant	25782	exon14			AAGGAATTGAGCT	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.1389A>G	chr1.hg19:g.220364508T>C		105.0	0.0		147.0	22.0	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	hg19	CCDS31028.1																																																																																			.	T|1.000;G|0.000		0.478	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
EPHX1	2052	hgsc.bcm.edu	37	1	226030084	226030084	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:226030084T>A	ENST00000366837.4	+	7	1145	c.949T>A	c.(949-951)Tct>Act	p.S317T	EPHX1_ENST00000272167.5_Missense_Mutation_p.S317T|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	317					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					TCTGAATGACTCTCCTGTGGG	0.587																																					p.S317T		Atlas-SNP	.											.	EPHX1	57	.	0			c.T949A						.						101.0	108.0	105.0					1																	226030084		2203	4300	6503	SO:0001583	missense	2052	exon7			AATGACTCTCCTG	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.949T>A	chr1.hg19:g.226030084T>A	ENSP00000355802:p.Ser317Thr	52.0	0.0		74.0	9.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	hg19	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.758823	0.89843	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.62105	0.05;0.05	5.33	5.33	0.75918	Alpha/beta hydrolase fold-1 (1);	0.058311	0.64402	D	0.000001	D	0.84964	0.5589	H	0.95365	3.66	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.89568	0.3811	10	0.72032	D	0.01	-19.5836	15.5961	0.76583	0.0:0.0:0.0:1.0	.	317	P07099	HYEP_HUMAN	T	317	ENSP00000272167:S317T;ENSP00000355802:S317T	ENSP00000272167:S317T	S	+	1	0	EPHX1	224096707	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.914000	0.87478	2.137000	0.66172	0.533000	0.62120	TCT	.	.		0.587	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
PLD5	200150	hgsc.bcm.edu	37	1	242511470	242511470	+	Silent	SNP	G	G	A	rs374810811		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:242511470G>A	ENST00000536534.2	-	2	505	c.264C>T	c.(262-264)gcC>gcT	p.A88A	PLD5_ENST00000442594.2_5'UTR|PLD5_ENST00000427495.1_Silent_p.A26A			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	88						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TGATGTCCACGGCTGAAAAGA	0.443																																					p.A88A		Atlas-SNP	.											.	PLD5	216	.	0			c.C264T						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	92.0	87.0	89.0		78,,264	-10.5	0.0	1		89	0,8594		0,0,4297	no	coding-synonymous,utr-5,coding-synonymous	PLD5	NM_001195811.1,NM_001195812.1,NM_152666.2	,,	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	,,	26/475,,88/537	242511470	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	200150	exon3			GTCCACGGCTGAA	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.264C>T	chr1.hg19:g.242511470G>A		43.0	0.0		62.0	22.0	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	ENST00000536534.2	hg19	CCDS1621.2																																																																																			.	.		0.443	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
ZBTB18	10472	hgsc.bcm.edu	37	1	244217368	244217368	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:244217368T>C	ENST00000358704.4	+	2	441	c.292T>C	c.(292-294)Ttc>Ctc	p.F98L		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	89					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAAACTCCAGTTCAAAGACTT	0.458																																					p.F98L		Atlas-SNP	.											.	.	.	.	0			c.T292C						.						68.0	69.0	69.0					1																	244217368		2203	4300	6503	SO:0001583	missense	10472	exon2			CTCCAGTTCAAAG	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.292T>C	chr1.hg19:g.244217368T>C	ENSP00000351539:p.Phe98Leu	74.0	0.0		112.0	42.0	NM_205768	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	hg19	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	T	9.701	1.154584	0.21371	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.66460	-0.21	4.98	4.98	0.66077	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.50480	0.1618	N	0.00801	-1.175	0.80722	D	1	D;B;B	0.57257	0.979;0.129;0.14	D;B;B	0.71414	0.973;0.161;0.171	T	0.57700	-0.7766	10	0.02654	T	1	.	14.6603	0.68865	0.0:0.0:0.0:1.0	.	98;89;98	B4DF20;Q99592;Q99592-2	.;ZN238_HUMAN;.	L	98	ENSP00000351539:F98L	ENSP00000351539:F98L	F	+	1	0	ZNF238	242283991	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	1.876000	0.54355	0.533000	0.62120	TTC	.	.		0.458	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
TRIM58	25893	hgsc.bcm.edu	37	1	248039449	248039449	+	Silent	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr1:248039449C>T	ENST00000366481.3	+	6	1167	c.1119C>T	c.(1117-1119)acC>acT	p.T373T	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	373	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGGGGGAAACCACGCCATCTC	0.557																																					p.T373T		Atlas-SNP	.											.	TRIM58	143	.	0			c.C1119T						.						116.0	113.0	114.0					1																	248039449		2203	4300	6503	SO:0001819	synonymous_variant	25893	exon6			GGAAACCACGCCA	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1119C>T	chr1.hg19:g.248039449C>T		114.0	0.0		169.0	23.0	NM_015431	Q6B0H9	Silent	SNP	ENST00000366481.3	hg19	CCDS1636.1																																																																																			.	.		0.557	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
KIDINS220	57498	hgsc.bcm.edu	37	2	8871439	8871439	+	Missense_Mutation	SNP	G	G	T	rs202036173		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:8871439G>T	ENST00000256707.3	-	30	4908	c.4727C>A	c.(4726-4728)gCg>gAg	p.A1576E	KIDINS220_ENST00000427284.1_Missense_Mutation_p.A1557E|KIDINS220_ENST00000418530.1_Missense_Mutation_p.A1477E|KIDINS220_ENST00000473731.1_Missense_Mutation_p.A1557E	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1576					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.A1576V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTCAAGGAGCGCATCCGATAA	0.473																																					p.A1576E		Atlas-SNP	.											KIDINS220,NS,carcinoma,0,1	KIDINS220	136	.	1	Substitution - Missense(1)	lung(1)	c.C4727A						.						132.0	128.0	129.0					2																	8871439		1978	4174	6152	SO:0001583	missense	57498	exon30			AGGAGCGCATCCG	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.4727C>A	chr2.hg19:g.8871439G>T	ENSP00000256707:p.Ala1576Glu	53.0	0.0		88.0	4.0	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	hg19	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808634	0.70797	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731	T;T;T;T	0.69561	-0.4;-0.39;-0.41;-0.39	5.92	5.92	0.95590	.	0.227294	0.45867	D	0.000338	T	0.75170	0.3813	L	0.27053	0.805	0.44417	D	0.997338	D;D;D	0.89917	0.991;0.994;1.0	D;P;D	0.97110	0.916;0.826;1.0	T	0.76898	-0.2789	10	0.72032	D	0.01	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	1477;1576;430	Q9ULH0-2;Q9ULH0;B4DG84	.;KDIS_HUMAN;.	E	1576;1557;1477;1557	ENSP00000256707:A1576E;ENSP00000411849:A1557E;ENSP00000414923:A1477E;ENSP00000418974:A1557E	ENSP00000256707:A1576E	A	-	2	0	KIDINS220	8788890	1.000000	0.71417	0.388000	0.26195	0.768000	0.43524	4.254000	0.58798	2.804000	0.96469	0.655000	0.94253	GCG	.	.		0.473	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
GREB1	9687	hgsc.bcm.edu	37	2	11777860	11777860	+	Missense_Mutation	SNP	G	G	T	rs553020411		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:11777860G>T	ENST00000381486.2	+	31	5665	c.5365G>T	c.(5365-5367)Gcg>Tcg	p.A1789S	GREB1_ENST00000396123.1_Missense_Mutation_p.A787S|GREB1_ENST00000234142.5_Missense_Mutation_p.A1789S	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1789						integral component of membrane (GO:0016021)		p.A1789T(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TAACTCTGCCGCGGTCGTGCC	0.667																																					p.A1789S	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											GREB1_ENST00000381486,NS,carcinoma,0,1	GREB1	308	.	1	Substitution - Missense(1)	endometrium(1)	c.G5365T						.						44.0	50.0	48.0					2																	11777860		2065	4202	6267	SO:0001583	missense	9687	exon31			TCTGCCGCGGTCG		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5365G>T	chr2.hg19:g.11777860G>T	ENSP00000370896:p.Ala1789Ser	38.0	0.0		48.0	3.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	3.342	-0.134352	0.06711	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.21734	3.33;3.33;1.99	4.75	3.78	0.43462	.	0.129539	0.53938	D	0.000050	T	0.06872	0.0175	N	0.01576	-0.805	0.34301	D	0.684343	B	0.14438	0.01	B	0.19391	0.025	T	0.19712	-1.0297	10	0.06757	T	0.87	-26.8203	11.8034	0.52141	0.0:0.0:0.6865:0.3135	.	1789	Q4ZG55	GREB1_HUMAN	S	1789;1789;787	ENSP00000370896:A1789S;ENSP00000234142:A1789S;ENSP00000379429:A787S	ENSP00000234142:A1789S	A	+	1	0	GREB1	11695311	0.820000	0.29190	0.051000	0.19133	0.125000	0.20455	1.233000	0.32648	2.186000	0.69663	0.557000	0.71058	GCG	.	.		0.667	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
NT5C1B	93034	hgsc.bcm.edu	37	2	18765411	18765411	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:18765411A>T	ENST00000359846.2	-	6	1091	c.1014T>A	c.(1012-1014)taT>taA	p.Y338*	NT5C1B_ENST00000600945.1_Nonsense_Mutation_p.Y338*|NT5C1B-RDH14_ENST00000532967.1_Nonsense_Mutation_p.Y338*|NT5C1B_ENST00000304081.4_Nonsense_Mutation_p.Y278*|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000460052.1_5'Flank	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	338					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TGGTGAGCTGATACTCCATGT	0.557																																					p.Y355X		Atlas-SNP	.											.	NT5C1B	72	.	0			c.T1065A						.						172.0	164.0	167.0					2																	18765411		2203	4300	6503	SO:0001587	stop_gained	93034	exon6			GAGCTGATACTCC	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.1014T>A	chr2.hg19:g.18765411A>T	ENSP00000352904:p.Tyr338*	115.0	0.0		187.0	30.0	NM_001199087	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Nonsense_Mutation	SNP	ENST00000359846.2	hg19	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	A	36	5.907847	0.97093	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846	.	.	.	5.58	-6.4	0.01944	.	0.231990	0.46145	D	0.000310	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.1702	19.7889	0.96450	0.2169:0.0:0.7831:0.0	.	.	.	.	X	338;280;278;338	.	ENSP00000305979:Y278X	Y	-	3	2	NT5C1B-RDH14;NT5C1B	18628892	0.996000	0.38824	0.450000	0.26969	0.951000	0.60555	0.505000	0.22642	-1.173000	0.02758	-0.297000	0.09499	TAT	.	.		0.557	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
HADHB	3032	hgsc.bcm.edu	37	2	26502110	26502110	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:26502110G>A	ENST00000317799.5	+	9	842	c.738G>A	c.(736-738)ctG>ctA	p.L246L	HADHB_ENST00000545822.1_Silent_p.L224L|HADHB_ENST00000405867.3_Intron|HADHB_ENST00000537713.1_Silent_p.L231L|HADHB_ENST00000494615.1_3'UTR	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	246					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATATGCACTGCGCTCTCACA	0.512																																					p.L246L		Atlas-SNP	.											.	HADHB	50	.	0			c.G738A						.						108.0	99.0	102.0					2																	26502110		2203	4300	6503	SO:0001819	synonymous_variant	3032	exon9			TGCACTGCGCTCT		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.738G>A	chr2.hg19:g.26502110G>A		91.0	0.0		92.0	11.0	NM_000183	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Silent	SNP	ENST00000317799.5	hg19	CCDS1722.1																																																																																			.	.		0.512	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
PPP1R21	129285	hgsc.bcm.edu	37	2	48692100	48692100	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:48692100A>C	ENST00000294952.8	+	8	876	c.719A>C	c.(718-720)aAc>aCc	p.N240T	PPP1R21_ENST00000281394.4_Missense_Mutation_p.N240T|PPP1R21_ENST00000449090.2_Missense_Mutation_p.N240T	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	240						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						AACGCTCTGAACGTTCCACTC	0.313																																					p.N240T		Atlas-SNP	.											.	PPP1R21	47	.	0			c.A719C						.						121.0	121.0	121.0					2																	48692100		2203	4300	6503	SO:0001583	missense	129285	exon8			CTCTGAACGTTCC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.719A>C	chr2.hg19:g.48692100A>C	ENSP00000294952:p.Asn240Thr	241.0	0.0		291.0	29.0	NM_152994	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	ENST00000294952.8	hg19	CCDS46278.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487127	0.84854	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.76040	0.3932	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.989;0.998;0.998;0.998	T	0.77378	-0.2610	9	0.54805	T	0.06	-23.0109	15.6865	0.77415	1.0:0.0:0.0:0.0	.	240;240;240;240;240	E1B6W7;Q6ZMI0;Q6ZMI0-2;Q6ZMI0-3;Q6ZMI0-4	.;PPR21_HUMAN;.;.;.	T	240	.	ENSP00000281394:N240T	N	+	2	0	KLRAQ1	48545604	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	8.655000	0.91098	2.168000	0.68352	0.528000	0.53228	AAC	.	.		0.313	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
PEX13	5194	hgsc.bcm.edu	37	2	61258830	61258830	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:61258830A>G	ENST00000295030.5	+	2	407	c.369A>G	c.(367-369)gaA>gaG	p.E123E	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	123					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			AGCAAGCTGAAGAAAGCAGCA	0.443																																					p.E123E		Atlas-SNP	.											.	PEX13	27	.	0			c.A369G						.						148.0	140.0	143.0					2																	61258830		2203	4300	6503	SO:0001819	synonymous_variant	5194	exon2			AGCTGAAGAAAGC	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.369A>G	chr2.hg19:g.61258830A>G		91.0	0.0		102.0	34.0	NM_002618	B2RCS1	Silent	SNP	ENST00000295030.5	hg19	CCDS1866.1																																																																																			.	.		0.443	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	124.0	0.0		168.0	10.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
DQX1	165545	hgsc.bcm.edu	37	2	74752644	74752644	+	Silent	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:74752644C>T	ENST00000404568.3	-	2	432	c.213G>A	c.(211-213)gaG>gaA	p.E71E	DQX1_ENST00000393951.2_Silent_p.E71E|DQX1_ENST00000495597.1_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	71	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						CAGAACCAGGCTCCCCAGACA	0.592																																					p.E71E		Atlas-SNP	.											.	DQX1	95	.	0			c.G213A						.						29.0	31.0	31.0					2																	74752644		692	1591	2283	SO:0001819	synonymous_variant	165545	exon2			ACCAGGCTCCCCA	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.213G>A	chr2.hg19:g.74752644C>T		79.0	0.0		107.0	19.0	NM_133637	Q6B017|Q8NAM8	Silent	SNP	ENST00000404568.3	hg19	CCDS1949.2																																																																																			.	.		0.592	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
MGAT4A	11320	hgsc.bcm.edu	37	2	99242216	99242216	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:99242216C>A	ENST00000264968.3	-	14	1914	c.1551G>T	c.(1549-1551)caG>caT	p.Q517H	MGAT4A_ENST00000414521.2_Missense_Mutation_p.Q389H|MGAT4A_ENST00000409391.1_Missense_Mutation_p.Q517H|MGAT4A_ENST00000393487.1_Missense_Mutation_p.Q517H			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	517					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						CAGCAGAATTCTGAATAACTG	0.313																																					p.Q517H		Atlas-SNP	.											.	MGAT4A	51	.	0			c.G1551T						.						73.0	67.0	69.0					2																	99242216		2203	4300	6503	SO:0001583	missense	11320	exon15			AGAATTCTGAATA	AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.1551G>T	chr2.hg19:g.99242216C>A	ENSP00000264968:p.Gln517His	285.0	0.0		247.0	45.0	NM_012214	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Missense_Mutation	SNP	ENST00000264968.3	hg19	CCDS2036.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877873	0.33162	.	.	ENSG00000071073	ENST00000393487;ENST00000414521;ENST00000264968;ENST00000409391	T;T;T;T	0.23552	1.91;1.9;1.91;1.91	5.63	2.74	0.32292	.	0.201867	0.52532	N	0.000069	T	0.20333	0.0489	L	0.50333	1.59	0.43657	D	0.996075	B;B	0.10296	0.003;0.003	B;B	0.08055	0.001;0.003	T	0.07252	-1.0782	10	0.66056	D	0.02	.	4.5018	0.11867	0.1278:0.6087:0.1237:0.1398	.	389;517	E9PEN2;Q9UM21	.;MGT4A_HUMAN	H	517;389;517;517	ENSP00000377127:Q517H;ENSP00000404889:Q389H;ENSP00000264968:Q517H;ENSP00000386841:Q517H	ENSP00000264968:Q517H	Q	-	3	2	MGAT4A	98608648	0.964000	0.33143	1.000000	0.80357	0.999000	0.98932	0.065000	0.14466	0.272000	0.22027	0.655000	0.94253	CAG	.	.		0.313	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252988.2	NM_012214	
TBC1D8	11138	hgsc.bcm.edu	37	2	101650198	101650198	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:101650198T>C	ENST00000376840.4	-	10	1580	c.1581A>G	c.(1579-1581)tcA>tcG	p.S527S	TBC1D8_ENST00000409318.1_Silent_p.S542S			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	527	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						AACCAGGGTGTGAGGCAAGAT	0.522																																					p.S527S		Atlas-SNP	.											.	TBC1D8	169	.	0			c.A1581G						.						73.0	81.0	78.0					2																	101650198		2181	4290	6471	SO:0001819	synonymous_variant	11138	exon10			AGGGTGTGAGGCA	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1581A>G	chr2.hg19:g.101650198T>C		117.0	0.0		109.0	24.0	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	ENST00000376840.4	hg19	CCDS46375.1																																																																																			.	.		0.522	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
RANBP2	5903	hgsc.bcm.edu	37	2	109384438	109384438	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:109384438T>C	ENST00000283195.6	+	20	7569	c.7443T>C	c.(7441-7443)gaT>gaC	p.D2481D		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2481					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AGAGGACAGATGTTATTCAGG	0.433																																					p.D2481D		Atlas-SNP	.											.	RANBP2	488	.	0			c.T7443C						.						111.0	116.0	114.0					2																	109384438		2203	4297	6500	SO:0001819	synonymous_variant	5903	exon20			GACAGATGTTATT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.7443T>C	chr2.hg19:g.109384438T>C		98.0	0.0		131.0	25.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	hg19	CCDS2079.1																																																																																			.	.		0.433	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SCN2A	6326	hgsc.bcm.edu	37	2	166243456	166243456	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:166243456T>C	ENST00000375437.2	+	26	5042	c.4752T>C	c.(4750-4752)tcT>tcC	p.S1584S	SCN2A_ENST00000283256.6_Silent_p.S1584S|SCN2A_ENST00000357398.3_Silent_p.S1584S|SCN2A_ENST00000375427.2_Silent_p.S1584S	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1584					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACTGATCTCTCTTCGTTACT	0.368																																					p.S1584S		Atlas-SNP	.											.	SCN2A	589	.	0			c.T4752C						.						237.0	217.0	224.0					2																	166243456		2203	4300	6503	SO:0001819	synonymous_variant	6326	exon25			GATCTCTCTTCGT	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4752T>C	chr2.hg19:g.166243456T>C		95.0	0.0		179.0	18.0	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	hg19	CCDS33314.1																																																																																			.	.		0.368	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
GALNT3	2591	hgsc.bcm.edu	37	2	166605296	166605296	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:166605296C>G	ENST00000392701.3	-	11	2672	c.1897G>C	c.(1897-1899)Gat>Cat	p.D633H	GALNT3_ENST00000409882.1_Missense_Mutation_p.D371H	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	633					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						AACACTTAATCATTTTGGCTA	0.338																																					p.D633H		Atlas-SNP	.											.	GALNT3	65	.	0			c.G1897C						.						64.0	63.0	63.0					2																	166605296		2203	4297	6500	SO:0001583	missense	2591	exon11			CTTAATCATTTTG		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1897G>C	chr2.hg19:g.166605296C>G	ENSP00000376465:p.Asp633His	46.0	0.0		85.0	55.0	NM_004482	Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	hg19	CCDS2226.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.946986	0.34377	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	T;T	0.61627	0.31;0.09	5.86	3.09	0.35607	.	0.317119	0.28683	N	0.014494	T	0.34890	0.0913	N	0.08118	0	0.27954	N	0.937043	B	0.34015	0.435	B	0.32465	0.146	T	0.32851	-0.9891	10	0.87932	D	0	.	9.8267	0.40916	0.0:0.6769:0.0:0.3231	.	633	Q14435	GALT3_HUMAN	H	633;371	ENSP00000376465:D633H;ENSP00000386955:D371H	ENSP00000376465:D633H	D	-	1	0	GALNT3	166313542	0.001000	0.12720	1.000000	0.80357	0.997000	0.91878	0.093000	0.15086	0.813000	0.34350	0.563000	0.77884	GAT	.	.		0.338	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482	
GLS	2744	hgsc.bcm.edu	37	2	191819351	191819351	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:191819351A>T	ENST00000320717.3	+	16	2012	c.1754A>T	c.(1753-1755)gAt>gTt	p.D585V	GLS_ENST00000409428.1_Missense_Mutation_p.D90V	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	585					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	CGGGACTATGATTCTAGAACA	0.353																																					p.D585V		Atlas-SNP	.											.	GLS	47	.	0			c.A1754T						.						84.0	86.0	85.0					2																	191819351		2203	4300	6503	SO:0001583	missense	2744	exon16			ACTATGATTCTAG	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1754A>T	chr2.hg19:g.191819351A>T	ENSP00000317379:p.Asp585Val	187.0	0.0		239.0	42.0	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.686004	0.88639	.	.	ENSG00000115419	ENST00000320717;ENST00000457316;ENST00000409428;ENST00000412247	T;T;T;T	0.35605	1.3;1.3;1.3;1.49	5.38	5.38	0.77491	Ankyrin repeat-containing domain (4);	0.150326	0.64402	D	0.000017	T	0.63010	0.2475	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.983;0.998;0.998	T	0.68454	-0.5404	10	0.87932	D	0	-11.345	15.566	0.76294	1.0:0.0:0.0:0.0	.	156;585;585	B7Z2P1;A8K132;O94925	.;.;GLSK_HUMAN	V	585;156;90;106	ENSP00000317379:D585V;ENSP00000395596:D156V;ENSP00000387177:D90V;ENSP00000403329:D106V	ENSP00000317379:D585V	D	+	2	0	GLS	191527596	1.000000	0.71417	0.975000	0.42487	0.987000	0.75469	8.761000	0.91691	2.254000	0.74563	0.533000	0.62120	GAT	.	.		0.353	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
DNAH7	56171	hgsc.bcm.edu	37	2	196620956	196620956	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:196620956A>G	ENST00000312428.6	-	62	11587	c.11487T>C	c.(11485-11487)aaT>aaC	p.N3829N	DNAH7_ENST00000409063.1_Silent_p.N312N	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3829					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAATTTTGACATTCAAAATGC	0.378																																					p.N3829N		Atlas-SNP	.											.	DNAH7	512	.	0			c.T11487C						.						115.0	108.0	110.0					2																	196620956		1844	4099	5943	SO:0001819	synonymous_variant	56171	exon62			TTTGACATTCAAA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11487T>C	chr2.hg19:g.196620956A>G		236.0	0.0		314.0	47.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.		0.378	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DNAH7	56171	hgsc.bcm.edu	37	2	196774843	196774843	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:196774843T>A	ENST00000312428.6	-	25	4112	c.4012A>T	c.(4012-4014)Acc>Tcc	p.T1338S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1338	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AAATCCTTGGTAGTTTCAGTC	0.423																																					p.T1338S		Atlas-SNP	.											.	DNAH7	512	.	0			c.A4012T						.						74.0	73.0	73.0					2																	196774843		1876	4120	5996	SO:0001583	missense	56171	exon25			CCTTGGTAGTTTC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4012A>T	chr2.hg19:g.196774843T>A	ENSP00000311273:p.Thr1338Ser	107.0	0.0		125.0	16.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.825853	0.90955	.	.	ENSG00000118997	ENST00000312428	T	0.39997	1.05	5.6	5.6	0.85130	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.67961	0.2949	M	0.85041	2.73	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.72991	-0.4123	10	0.56958	D	0.05	.	15.4358	0.75146	0.0:0.0:0.0:1.0	.	1338	Q8WXX0	DYH7_HUMAN	S	1338	ENSP00000311273:T1338S	ENSP00000311273:T1338S	T	-	1	0	DNAH7	196483088	1.000000	0.71417	0.968000	0.41197	0.996000	0.88848	8.036000	0.88901	2.122000	0.65172	0.533000	0.62120	ACC	.	.		0.423	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
PTH2R	5746	hgsc.bcm.edu	37	2	209353870	209353870	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:209353870T>A	ENST00000272847.2	+	11	1423	c.1210T>A	c.(1210-1212)Ttt>Att	p.F404I	PTH2R_ENST00000413482.1_3'UTR|AC019185.4_ENST00000424628.1_RNA	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	404					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	CTTCAACTCCTTTCAGGTAAA	0.468																																					p.F404I		Atlas-SNP	.											.	PTH2R	92	.	0			c.T1210A						.						170.0	158.0	162.0					2																	209353870		2203	4300	6503	SO:0001583	missense	5746	exon11			AACTCCTTTCAGG	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1210T>A	chr2.hg19:g.209353870T>A	ENSP00000272847:p.Phe404Ile	46.0	0.0		50.0	5.0	NM_005048	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	hg19	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.401481	0.83120	.	.	ENSG00000144407	ENST00000272847	T	0.51071	0.72	5.6	5.6	0.85130	GPCR, family 2-like (1);	0.000000	0.49916	D	0.000140	T	0.75317	0.3833	M	0.93420	3.415	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	D;D	0.70227	0.968;0.968	T	0.82329	-0.0511	9	.	.	.	.	13.7336	0.62804	0.0:0.0:0.0:1.0	.	293;404	B4DFN8;P49190	.;PTH2R_HUMAN	I	404	ENSP00000272847:F404I	.	F	+	1	0	PTH2R	209062115	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.618000	0.83043	2.130000	0.65690	0.482000	0.46254	TTT	.	.		0.468	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
ZNF142	7701	hgsc.bcm.edu	37	2	219508527	219508527	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:219508527T>C	ENST00000449707.1	-	8	3133	c.2712A>G	c.(2710-2712)tcA>tcG	p.S904S	ZNF142_ENST00000411696.2_Silent_p.S904S	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	904					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GAGGGATGGGTGAATCTGGTC	0.572																																					p.S904S	Colon(170;867 1942 8995 15834 18053)	Atlas-SNP	.											.	ZNF142	190	.	0			c.A2712G						.						129.0	136.0	134.0					2																	219508527		1991	4158	6149	SO:0001819	synonymous_variant	7701	exon8			GATGGGTGAATCT	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.2712A>G	chr2.hg19:g.219508527T>C		60.0	0.0		89.0	4.0	NM_001105537	Q92510	Silent	SNP	ENST00000449707.1	hg19	CCDS42817.1																																																																																			.	.		0.572	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
DOCK10	55619	hgsc.bcm.edu	37	2	225642958	225642958	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:225642958T>A	ENST00000258390.7	-	51	5766	c.5699A>T	c.(5698-5700)gAg>gTg	p.E1900V	DOCK10_ENST00000409592.3_Missense_Mutation_p.E1894V	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1900	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CAGCTTAGGCTCTTTATAAAT	0.353																																					p.E1900V		Atlas-SNP	.											.	DOCK10	308	.	0			c.A5699T						.						81.0	72.0	75.0					2																	225642958		1815	4066	5881	SO:0001583	missense	55619	exon51			TTAGGCTCTTTAT	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5699A>T	chr2.hg19:g.225642958T>A	ENSP00000258390:p.Glu1900Val	97.0	0.0		94.0	12.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.6|27.6	4.845847|4.845847	0.91277|0.91277	.|.	.|.	ENSG00000135905|ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702|ENST00000535663	T;T|.	0.25085|.	1.82;1.82|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.118681|.	0.64402|.	D|.	0.000009|.	D|D	0.87184|0.87184	0.6114|0.6114	H|H	0.94503|0.94503	3.545|3.545	0.80722|0.80722	D|D	1|1	D;D;D|.	0.71674|.	0.997;0.997;0.998|.	D;D;D|.	0.69479|.	0.937;0.964;0.963|.	D|D	0.90497|0.90497	0.4471|0.4471	10|5	0.87932|.	D|.	0|.	.|.	16.8061|16.8061	0.85666|0.85666	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1900;1894;562|.	Q96BY6;B3FL70;B4DEY4|.	DOC10_HUMAN;.;.|.	V|S	1894;1900;407|49	ENSP00000386694:E1894V;ENSP00000258390:E1900V|.	ENSP00000258390:E1900V|.	E|R	-|-	2|3	0|2	DOCK10|DOCK10	225351202|225351202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.698000|7.698000	0.84413|0.84413	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	GAG|AGA	.	.		0.353	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DOCK10	55619	hgsc.bcm.edu	37	2	225684228	225684228	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr2:225684228C>T	ENST00000258390.7	-	29	3269	c.3202G>A	c.(3202-3204)Gac>Aac	p.D1068N	DOCK10_ENST00000409592.3_Missense_Mutation_p.D1062N	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1068					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TACCCTCGGTCCATAAATGTA	0.313																																					p.D1068N		Atlas-SNP	.											.	DOCK10	308	.	0			c.G3202A						.						104.0	98.0	100.0					2																	225684228		1824	4083	5907	SO:0001583	missense	55619	exon29			CTCGGTCCATAAA	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3202G>A	chr2.hg19:g.225684228C>T	ENSP00000258390:p.Asp1068Asn	260.0	0.0		298.0	54.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156080	0.57259	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.65364	1.91;-0.15	6.15	6.15	0.99193	.	0.044610	0.85682	D	0.000000	T	0.60996	0.2312	L	0.58810	1.83	0.45867	D	0.998721	B;B	0.27594	0.146;0.182	B;B	0.30251	0.022;0.113	T	0.59679	-0.7409	10	0.59425	D	0.04	.	13.9607	0.64177	0.0:0.9313:0.0:0.0687	.	1068;1062	Q96BY6;B3FL70	DOC10_HUMAN;.	N	1062;1068	ENSP00000386694:D1062N;ENSP00000258390:D1068N	ENSP00000258390:D1068N	D	-	1	0	DOCK10	225392472	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.787000	0.55439	2.932000	0.99384	0.643000	0.83706	GAC	.	.		0.313	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
SH3BP5	9467	hgsc.bcm.edu	37	3	15300443	15300443	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:15300443G>C	ENST00000383791.3	-	7	1004	c.784C>G	c.(784-786)Cgc>Ggc	p.R262G	SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5_ENST00000426925.1_Missense_Mutation_p.R105G|SH3BP5_ENST00000408919.3_Missense_Mutation_p.R105G|SH3BP5_ENST00000253688.5_Missense_Mutation_p.R105G	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	262					intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GCACTGGAGCGCCGCCGCTCG	0.597																																					p.R262G		Atlas-SNP	.											.	SH3BP5	32	.	0			c.C784G						.						77.0	70.0	73.0					3																	15300443		2203	4300	6503	SO:0001583	missense	9467	exon7			TGGAGCGCCGCCG	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.784C>G	chr3.hg19:g.15300443G>C	ENSP00000373301:p.Arg262Gly	63.0	0.0		77.0	14.0	NM_004844	B3KQW6|Q5JWV9	Missense_Mutation	SNP	ENST00000383791.3	hg19	CCDS2625.2	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502387	0.44455	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919;ENST00000366391	.	.	.	5.47	4.59	0.56863	.	0.050281	0.85682	D	0.000000	T	0.50718	0.1632	L	0.39245	1.2	0.48632	D	0.999689	B	0.33318	0.408	B	0.39904	0.313	T	0.50162	-0.8860	9	0.42905	T	0.14	-4.3348	9.087	0.36587	0.0749:0.0:0.7797:0.1454	.	262	O60239	3BP5_HUMAN	G	262;105;105;105;105	.	ENSP00000253688:R105G	R	-	1	0	SH3BP5	15275447	1.000000	0.71417	0.999000	0.59377	0.670000	0.39368	5.429000	0.66495	1.327000	0.45338	-0.422000	0.05995	CGC	.	.		0.597	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844	
UBE2E1	7324	hgsc.bcm.edu	37	3	23932096	23932096	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:23932096A>G	ENST00000306627.3	+	6	800	c.581A>G	c.(580-582)tAa>tGa	p.*194*	UBE2E1_ENST00000424381.1_Silent_p.*161*|UBE2E1_ENST00000346855.3_Silent_p.*177*|UBE2E1_ENST00000475680.1_3'UTR	NM_003341.4	NP_003332.1	P51965	UB2E1_HUMAN	ubiquitin-conjugating enzyme E2E 1	0					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cytokine-mediated signaling pathway (GO:0019221)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ISG15-protein conjugation (GO:0032020)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)	7						TACGCTACATAAATTGGGGTT	0.468																																					p.X194X		Atlas-SNP	.											.	UBE2E1	15	.	0			c.A581G						.						89.0	80.0	83.0					3																	23932096		2203	4300	6503	SO:0001819	synonymous_variant	7324	exon6			CTACATAAATTGG	X92963	CCDS2638.1, CCDS2639.1, CCDS56244.1	3p24.2	2011-05-19	2011-05-19		ENSG00000170142	ENSG00000170142		"""Ubiquitin-conjugating enzymes E2"""	12477	protein-coding gene	gene with protein product		602916	"""ubiquitin-conjugating enzyme E2E 1 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)"""			8576257	Standard	NM_003341		Approved	UbcH6	uc003cch.3	P51965	OTTHUMG00000130483	ENST00000306627.3:c.581A>G	chr3.hg19:g.23932096A>G		147.0	0.0		168.0	47.0	NM_003341	B2RBX4|C9J8K2|K4DI90	Silent	SNP	ENST00000306627.3	hg19	CCDS2638.1																																																																																			.	.		0.468	UBE2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252882.2	NM_003341	
MLH1	4292	hgsc.bcm.edu	37	3	37059089	37059089	+	Splice_Site	SNP	A	A	T	rs587779050|rs63751598|rs267607800		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:37059089A>T	ENST00000231790.2	+	10	1099	c.883A>T	c.(883-885)Agt>Tgt	p.S295C	MLH1_ENST00000435176.1_Splice_Site_p.S197C|MLH1_ENST00000458205.2_Splice_Site_p.S54C|MLH1_ENST00000536378.1_Splice_Site_p.S54C|MLH1_ENST00000539477.1_Splice_Site_p.S54C|MLH1_ENST00000455445.2_Splice_Site_p.S54C	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	295			Missing (in HNPCC2).|S -> T (in HNPCC2). {ECO:0000269|PubMed:9399661}.		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CCTGTACCTCAGGTAATGTAG	0.418		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.S295C		Atlas-SNP	.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1	226	.	1	Whole gene deletion(1)	ovary(1)	c.A883T	GRCh37	CS064424|CS971799	MLH1	S		.						184.0	162.0	170.0					3																	37059089		2203	4300	6503	SO:0001630	splice_region_variant	4292	exon10	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	TACCTCAGGTAAT	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.884+1A>T	chr3.hg19:g.37059089A>T		123.0	0.0		96.0	4.0	NM_000249	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	hg19	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.7|25.7	4.661367|4.661367	0.88154|0.88154	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000537937|ENST00000231790;ENST00000436867;ENST00000383761;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000441265;ENST00000536378	.|D;D;D;D;D;D;D	.|0.84944	.|-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Ribosomal protein S5 domain 2-type fold (1);DNA mismatch repair protein, N-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA mismatch repair protein, C-terminal (1);	.|0.040715	.|0.85682	.|D	.|0.000000	.|D	.|0.93275	.|0.7857	M|M	0.89478|0.89478	3.035|3.035	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.78314	.|0.991;0.986;0.986	.|D	.|0.94521	.|0.7727	.|10	0.87932|0.87932	D|D	0|0	-14.8511|-14.8511	15.3325|15.3325	0.74226|0.74226	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|197;295;295	.|E9PCU2;Q53GX1;P40692	.|.;.;MLH1_HUMAN	X|C	261|295;261;159;54;54;54;197;54;54	.|ENSP00000231790:S295C;ENSP00000402667:S54C;ENSP00000443665:S54C;ENSP00000398272:S54C;ENSP00000402564:S197C;ENSP00000398392:S54C;ENSP00000444286:S54C	ENSP00000442802:R261X|ENSP00000231790:S295C	R|S	+|+	1|1	2|0	MLH1|MLH1	37034093|37034093	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.825000|0.825000	0.46686|0.46686	8.953000|8.953000	0.93041|0.93041	2.024000|2.024000	0.59613|0.59613	0.482000|0.482000	0.46254|0.46254	AGA|AGT	.	.		0.418	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	Missense_Mutation
SCN10A	6336	hgsc.bcm.edu	37	3	38739345	38739345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:38739345T>C	ENST00000449082.2	-	27	5365	c.5366A>G	c.(5365-5367)gAc>gGc	p.D1789G		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1789					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CAAAGGCAGGTCCATCTGGAT	0.468																																					p.D1789G		Atlas-SNP	.											.	SCN10A	359	.	0			c.A5366G						.						60.0	63.0	62.0					3																	38739345		2203	4300	6503	SO:0001583	missense	6336	exon27			GGCAGGTCCATCT	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5366A>G	chr3.hg19:g.38739345T>C	ENSP00000390600:p.Asp1789Gly	86.0	0.0		80.0	24.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	hg19	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628743	0.67015	.	.	ENSG00000185313	ENST00000449082	D	0.96619	-4.07	5.28	4.1	0.47936	.	0.055121	0.64402	D	0.000001	D	0.98413	0.9472	M	0.93898	3.47	0.47476	D	0.999433	D	0.89917	1.0	D	0.91635	0.999	D	0.98826	1.0749	10	0.87932	D	0	.	12.4293	0.55565	0.0:0.0:0.1404:0.8596	.	1789	Q9Y5Y9	SCNAA_HUMAN	G	1789	ENSP00000390600:D1789G	ENSP00000390600:D1789G	D	-	2	0	SCN10A	38714349	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.868000	0.87116	0.995000	0.38917	0.533000	0.62120	GAC	.	.		0.468	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
ABHD14A	25864	hgsc.bcm.edu	37	3	52011894	52011894	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:52011894T>A	ENST00000273596.3	+	2	145	c.77T>A	c.(76-78)gTa>gAa	p.V26E	ABHD14A_ENST00000491470.1_Missense_Mutation_p.V26E|ACY1_ENST00000458031.2_5'UTR|ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.V26E|ABHD14B_ENST00000483233.1_Intron	NM_015407.4	NP_056222.2	Q9BUJ0	ABHEA_HUMAN	abhydrolase domain containing 14A	26						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAGACTGTGGTACAGACCTCC	0.612																																					p.V26E		Atlas-SNP	.											.	ABHD14A	15	.	0			c.T77A						.						100.0	111.0	107.0					3																	52011894		2203	4300	6503	SO:0001583	missense	25864	exon2			CTGTGGTACAGAC	AY358201	CCDS2843.1	3p21.1	2011-02-14			ENSG00000248487	ENSG00000248487		"""Abhydrolase domain containing"""	24538	protein-coding gene	gene with protein product							Standard	NM_015407		Approved	DKFZP564O243, DORZ1	uc003dco.3	Q9BUJ0	OTTHUMG00000157818	ENST00000273596.3:c.77T>A	chr3.hg19:g.52011894T>A	ENSP00000273596:p.Val26Glu	44.0	0.0		27.0	6.0	NM_015407	Q6UXU8|Q9Y3T7	Missense_Mutation	SNP	ENST00000273596.3	hg19	CCDS2843.1	.	.	.	.	.	.	.	.	.	.	T	17.84	3.488049	0.64074	.	.	ENSG00000248487;ENSG00000248487;ENSG00000248487;ENSG00000248487;ENSG00000114786	ENST00000497864;ENST00000494478;ENST00000273596;ENST00000491470;ENST00000463937	T;T;T;T;T	0.71222	0.96;1.1;1.14;0.96;-0.55	5.09	-0.131	0.13494	.	1.364740	0.04835	N	0.439348	T	0.58552	0.2130	L	0.50333	1.59	0.09310	N	1	P;B	0.37864	0.61;0.421	B;B	0.33042	0.157;0.143	T	0.52275	-0.8597	10	0.72032	D	0.01	0.0526	0.5592	0.00676	0.1729:0.1901:0.1795:0.4574	.	26;26	C9JMV9;Q9BUJ0	.;ABHEA_HUMAN	E	91;21;26;26;26	ENSP00000418242:V91E;ENSP00000420475:V21E;ENSP00000273596:V26E;ENSP00000418824:V26E;ENSP00000420487:V26E	ENSP00000273596:V26E	V	+	2	0	RP11-155D18.11;ABHD14A	51986934	0.084000	0.21492	0.482000	0.27366	0.983000	0.72400	0.319000	0.19522	0.088000	0.17205	0.533000	0.62120	GTA	.	.		0.612	ABHD14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349689.1	NM_015407	
TLR9	54106	hgsc.bcm.edu	37	3	52255355	52255355	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:52255355G>A	ENST00000360658.2	-	2	3610	c.2977C>T	c.(2977-2979)Ctc>Ttc	p.L993F	TLR9_ENST00000494383.1_Missense_Mutation_p.P1146L|TLR9_ENST00000597542.1_Missense_Mutation_p.L1017F	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	993	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GGCCAGAGGAGGACACTCTGG	0.677																																					p.L993F		Atlas-SNP	.											.	TLR9	72	.	0			c.C2977T						.						37.0	41.0	40.0					3																	52255355		2203	4299	6502	SO:0001583	missense	54106	exon2			AGAGGAGGACACT	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2977C>T	chr3.hg19:g.52255355G>A	ENSP00000353874:p.Leu993Phe	113.0	0.0		89.0	25.0	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	hg19	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.85|16.85	3.235379|3.235379	0.58886|0.58886	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.09911|.	2.93|.	5.18|5.18	4.3|4.3	0.51218|0.51218	Toll/interleukin-1 receptor homology (TIR) domain (3);|.	0.000000|.	0.37219|.	N|.	0.002198|.	T|T	0.77075|0.77075	0.4077|0.4077	M|M	0.91038|0.91038	3.17|3.17	0.49130|0.49130	D|D	0.999751|0.999751	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.988;1.0|.	T|T	0.79070|0.79070	-0.1954|-0.1954	10|5	0.87932|.	D|.	0|.	.|.	6.4251|6.4251	0.21766|0.21766	0.0901:0.0:0.7272:0.1827|0.0901:0.0:0.7272:0.1827	.|.	1090;993|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	F|L	993|1146	ENSP00000353874:L993F|.	ENSP00000353874:L993F|.	L|P	-|-	1|2	0|0	TLR9|RP11-330H6.5	52230395|52230395	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.713000|0.713000	0.41058|0.41058	2.489000|2.489000	0.45285|0.45285	1.390000|1.390000	0.46547|0.46547	0.591000|0.591000	0.81541|0.81541	CTC|CCT	.	.		0.677	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
ERC2	26059	hgsc.bcm.edu	37	3	56468944	56468944	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:56468944C>A	ENST00000288221.6	-	2	347	c.92G>T	c.(91-93)aGa>aTa	p.R31I		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	31						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		ACTACTTGTTCTTCGGTGGCC	0.502																																					p.R31I		Atlas-SNP	.											.	ERC2	221	.	0			c.G92T						.						107.0	103.0	104.0					3																	56468944		1938	4144	6082	SO:0001583	missense	26059	exon2			CTTGTTCTTCGGT	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.92G>T	chr3.hg19:g.56468944C>A	ENSP00000288221:p.Arg31Ile	71.0	0.0		70.0	15.0	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	hg19	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418606	0.83559	.	.	ENSG00000187672	ENST00000288221	T	0.57436	0.4	5.76	4.89	0.63831	.	0.046054	0.85682	D	0.000000	T	0.48095	0.1481	L	0.52573	1.65	0.58432	D	0.999999	P	0.44578	0.838	B	0.38655	0.278	T	0.55003	-0.8208	10	0.87932	D	0	-20.3351	14.798	0.69891	0.0:0.9311:0.0:0.0689	.	31	O15083	ERC2_HUMAN	I	31	ENSP00000288221:R31I	ENSP00000288221:R31I	R	-	2	0	ERC2	56443984	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	1.432000	0.47375	0.655000	0.94253	AGA	.	.		0.502	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
POU1F1	5449	hgsc.bcm.edu	37	3	87313643	87313643	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:87313643A>G	ENST00000350375.2	-	3	358	c.234T>C	c.(232-234)ctT>ctC	p.L78L	POU1F1_ENST00000344265.3_Silent_p.L104L|POU1F1_ENST00000560656.1_Silent_p.L78L	NM_000306.2	NP_000297.1	P28069	PIT1_HUMAN	POU class 1 homeobox 1	78					B cell differentiation (GO:0030183)|cell fate specification (GO:0001708)|determination of adult lifespan (GO:0008340)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear transport (GO:0051169)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|somatotropin secreting cell development (GO:0060133)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(2)	18	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		GAAATTTATAAAGACAAGGGG	0.403																																					p.L104L		Atlas-SNP	.											.	POU1F1	70	.	0			c.T312C						.						60.0	66.0	64.0					3																	87313643		2203	4299	6502	SO:0001819	synonymous_variant	5449	exon3			TTTATAAAGACAA	D10216	CCDS2919.1, CCDS46873.1	3p11.2	2011-06-20	2007-07-13		ENSG00000064835	ENSG00000064835		"""Homeoboxes / POU class"""	9210	protein-coding gene	gene with protein product	"""growth hormone factor 1"""	173110	"""POU domain class 1, transcription factor 1"""	PIT1		1956794	Standard	NM_001122757		Approved	GHF-1, POU1F1a	uc010hoj.1	P28069	OTTHUMG00000158992	ENST00000350375.2:c.234T>C	chr3.hg19:g.87313643A>G		203.0	0.0		172.0	29.0	NM_001122757	O75757|Q15132|Q15133|Q9UD34|Q9UEL3	Silent	SNP	ENST00000350375.2	hg19	CCDS2919.1																																																																																			.	.		0.403	POU1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352827.1	NM_000306	
ABHD10	55347	hgsc.bcm.edu	37	3	111710309	111710309	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:111710309T>A	ENST00000273359.3	+	5	689	c.662T>A	c.(661-663)tTc>tAc	p.F221Y	ABHD10_ENST00000534857.1_Missense_Mutation_p.F64Y|ABHD10_ENST00000494817.1_3'UTR	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	221					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						CAGTACAGTTTCATTAAAGAA	0.398																																					p.F221Y		Atlas-SNP	.											.	ABHD10	20	.	0			c.T662A						.						143.0	131.0	135.0					3																	111710309		2203	4300	6503	SO:0001583	missense	55347	exon5			ACAGTTTCATTAA	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.662T>A	chr3.hg19:g.111710309T>A	ENSP00000273359:p.Phe221Tyr	181.0	0.0		162.0	46.0	NM_018394	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	ENST00000273359.3	hg19	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.935008	0.73442	.	.	ENSG00000144827	ENST00000534857;ENST00000273359	T;T	0.66460	0.92;-0.21	5.53	4.38	0.52667	.	0.098116	0.64402	D	0.000001	T	0.73853	0.3640	M	0.79475	2.455	0.47094	D	0.999311	P	0.49447	0.924	P	0.51945	0.685	T	0.74051	-0.3789	10	0.44086	T	0.13	-5.8023	10.6179	0.45462	0.0:0.0771:0.0:0.9229	.	221	Q9NUJ1	ABHDA_HUMAN	Y	64;221	ENSP00000442932:F64Y;ENSP00000273359:F221Y	ENSP00000273359:F221Y	F	+	2	0	ABHD10	113192999	1.000000	0.71417	0.999000	0.59377	0.766000	0.43426	7.632000	0.83247	1.048000	0.40298	0.482000	0.46254	TTC	.	.		0.398	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	
CCDC80	151887	hgsc.bcm.edu	37	3	112357345	112357345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:112357345T>C	ENST00000206423.3	-	2	2361	c.1408A>G	c.(1408-1410)Agg>Ggg	p.R470G	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.R470G	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	470					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TGTTCCCGCCTGTCCATGCGG	0.582																																					p.R470G		Atlas-SNP	.											.	CCDC80	100	.	0			c.A1408G						.						66.0	68.0	67.0					3																	112357345		2203	4300	6503	SO:0001583	missense	151887	exon2			CCCGCCTGTCCAT	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1408A>G	chr3.hg19:g.112357345T>C	ENSP00000206423:p.Arg470Gly	91.0	0.0		71.0	32.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	hg19	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065597	0.55539	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.56103	0.48;0.48	5.15	-0.617	0.11579	.	0.323582	0.35903	N	0.002915	T	0.38026	0.1025	N	0.24115	0.695	0.32958	D	0.520627	P;P;P	0.39665	0.675;0.682;0.546	B;B;B	0.39379	0.298;0.244;0.156	T	0.53457	-0.8436	10	0.54805	T	0.06	-18.503	14.3871	0.66953	0.0:0.0:0.5171:0.4829	.	481;470;470	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	G	470;470;98	ENSP00000206423:R470G;ENSP00000411814:R470G	ENSP00000206423:R470G	R	-	1	2	CCDC80	113840035	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	0.807000	0.27140	0.059000	0.16252	0.454000	0.30748	AGG	.	.		0.582	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
NR1I2	8856	hgsc.bcm.edu	37	3	119530393	119530394	+	Missense_Mutation	DNP	GT	GT	CA			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:119530393_119530394GT>CA	ENST00000337940.4	+	4	504_505	c.456_457GT>CA	c.(454-459)atGTcc>atCAcc	p.152_153MS>IT	NR1I2_ENST00000466380.1_Missense_Mutation_p.113_114MS>IT|NR1I2_ENST00000393716.2_Missense_Mutation_p.113_114MS>IT	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	113	Hinge.				drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	CAGTGATCATGTCCGACGAGGC	0.629																																					p.M152I|p.S153T		Atlas-SNP	.											.	NR1I2	44	.	0			c.G456C|c.T457A						.																																			SO:0001583	missense	8856	exon4			GATCATGTCCGAC|ATCATGTCCGACG	AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	Exception_encountered	chr3.hg19:g.119530393_119530394delinsCA	ENSP00000336528:p.M152_S153delinsIT	96.0|99.0	0.0		77.0|81.0	15.0|17.0	NM_022002	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	ENST00000337940.4	hg19	CCDS2995.1																																																																																			.	.		0.629	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355126.1		
CASR	846	hgsc.bcm.edu	37	3	122002614	122002614	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:122002614T>C	ENST00000490131.1	+	7	2185	c.1813T>C	c.(1813-1815)Ttt>Ctt	p.F605L	CASR_ENST00000296154.5_Missense_Mutation_p.F605L|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Missense_Mutation_p.F615L	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	605					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GGAGATCGAGTTTCTGTCGTG	0.522																																					p.F615L		Atlas-SNP	.											.	CASR	190	.	0			c.T1843C						.						151.0	124.0	133.0					3																	122002614		2203	4300	6503	SO:0001583	missense	846	exon7			ATCGAGTTTCTGT	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1813T>C	chr3.hg19:g.122002614T>C	ENSP00000418685:p.Phe605Leu	74.0	0.0		72.0	8.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	hg19	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652760	0.67472	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.91237	-2.78;-2.81;-2.78	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.93025	0.7780	M	0.93507	3.425	0.80722	D	1	P;B	0.35612	0.512;0.451	B;B	0.34346	0.18;0.112	D	0.93580	0.6912	10	0.87932	D	0	.	15.5237	0.75885	0.0:0.0:0.0:1.0	.	615;605	E7ENE0;P41180	.;CASR_HUMAN	L	605;615;605	ENSP00000418685:F605L;ENSP00000420194:F615L;ENSP00000296154:F605L	ENSP00000296154:F605L	F	+	1	0	CASR	123485304	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.040000	0.89188	2.263000	0.75096	0.379000	0.24179	TTT	.	.		0.522	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
CCDC14	64770	hgsc.bcm.edu	37	3	123674900	123674900	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:123674900T>C	ENST00000488653.2	-	4	456	c.366A>G	c.(364-366)gaA>gaG	p.E122E	CCDC14_ENST00000489746.1_5'UTR|CCDC14_ENST00000433542.2_Silent_p.E122E|CCDC14_ENST00000485727.1_5'UTR|CCDC14_ENST00000483247.1_Intron			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	122					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		AACCTGAATCTTCATTTCTCA	0.308																																					p.E122E		Atlas-SNP	.											.	CCDC14	97	.	0			c.A366G						.						94.0	91.0	92.0					3																	123674900		692	1591	2283	SO:0001819	synonymous_variant	64770	exon4			TGAATCTTCATTT	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.366A>G	chr3.hg19:g.123674900T>C		129.0	0.0		101.0	11.0	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Silent	SNP	ENST00000488653.2	hg19																																																																																				.	.		0.308	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
MSL2	55167	hgsc.bcm.edu	37	3	135870012	135870012	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:135870012T>C	ENST00000309993.2	-	2	2443	c.1711A>G	c.(1711-1713)Ata>Gta	p.I571V	MSL2_ENST00000434835.2_Missense_Mutation_p.I497V	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	571					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						CTCATGTCTATAGCTTCATCC	0.413																																					p.I571V		Atlas-SNP	.											.	MSL2	63	.	0			c.A1711G						.						127.0	130.0	129.0					3																	135870012		2203	4300	6503	SO:0001583	missense	55167	exon2			TGTCTATAGCTTC	AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.1711A>G	chr3.hg19:g.135870012T>C	ENSP00000311827:p.Ile571Val	118.0	0.0		104.0	20.0	NM_018133	B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	hg19	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	T	9.644	1.139723	0.21205	.	.	ENSG00000174579	ENST00000309993;ENST00000434835	.	.	.	5.33	5.33	0.75918	.	0.053759	0.85682	D	0.000000	T	0.49047	0.1534	L	0.36672	1.1	0.37956	D	0.932805	B	0.25441	0.126	B	0.22880	0.042	T	0.53655	-0.8408	9	0.52906	T	0.07	-8.2677	14.7844	0.69790	0.0:0.0:0.0:1.0	.	571	Q9HCI7	MSL2_HUMAN	V	571;497	.	ENSP00000311827:I571V	I	-	1	0	MSL2	137352702	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.901000	0.39838	2.142000	0.66516	0.383000	0.25322	ATA	.	.		0.413	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133	
MME	4311	hgsc.bcm.edu	37	3	154878219	154878219	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:154878219T>A	ENST00000460393.1	+	17	1762	c.1642T>A	c.(1642-1644)Tca>Aca	p.S548T	MME_ENST00000360490.2_Missense_Mutation_p.S548T|MME_ENST00000493237.1_Missense_Mutation_p.S548T|MME_ENST00000462745.1_Missense_Mutation_p.S548T|MME_ENST00000492661.1_Missense_Mutation_p.S548T|MME-AS1_ENST00000484721.1_RNA	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	548					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ATTTTACTCTTCAGGAAGAAA	0.343																																					p.S548T		Atlas-SNP	.											.	MME	133	.	0			c.T1642A						.						184.0	197.0	193.0					3																	154878219		2203	4300	6503	SO:0001583	missense	4311	exon17			TACTCTTCAGGAA		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1642T>A	chr3.hg19:g.154878219T>A	ENSP00000418525:p.Ser548Thr	102.0	0.0		92.0	20.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	hg19	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927939	0.34002	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	5.5	3.07	0.35406	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.482715	0.21875	N	0.067840	T	0.66587	0.2804	L	0.28458	0.855	0.39363	D	0.965952	B	0.27765	0.188	B	0.22753	0.041	T	0.61845	-0.6979	10	0.87932	D	0	-2.3276	5.9082	0.19012	0.0:0.1541:0.3543:0.4916	.	548	P08473	NEP_HUMAN	T	548	ENSP00000420389:S548T;ENSP00000418525:S548T;ENSP00000419653:S548T;ENSP00000417079:S548T;ENSP00000353679:S548T	ENSP00000353679:S548T	S	+	1	0	MME	156360913	0.944000	0.32072	0.999000	0.59377	0.997000	0.91878	0.536000	0.23129	0.370000	0.24538	0.528000	0.53228	TCA	.	.		0.343	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
ST6GAL1	6480	hgsc.bcm.edu	37	3	186790725	186790725	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:186790725A>G	ENST00000169298.3	+	6	1468	c.794A>G	c.(793-795)gAt>gGt	p.D265G	ST6GAL1_ENST00000457772.2_Missense_Mutation_p.D34G|ST6GAL1_ENST00000448044.1_Missense_Mutation_p.D265G	NM_173216.2	NP_775323.1	P15907	SIAT1_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 1	265					cellular protein metabolic process (GO:0044267)|humoral immune response (GO:0006959)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)|sialyltransferase activity (GO:0008373)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		TACCACTCAGATATCCCAAAG	0.438																																					p.D265G		Atlas-SNP	.											.	ST6GAL1	36	.	0			c.A794G						.						102.0	100.0	101.0					3																	186790725		2203	4300	6503	SO:0001583	missense	6480	exon5			ACTCAGATATCCC	X62822	CCDS3285.1, CCDS46973.1	3q27-q28	2013-02-26	2003-01-14	2005-02-07	ENSG00000073849	ENSG00000073849	2.4.99.1		10860	protein-coding gene	gene with protein product	"""ST6Gal I"""	109675	"""sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)"""	SIAT1		2408023	Standard	NM_003032		Approved		uc003frd.3	P15907	OTTHUMG00000156500	ENST00000169298.3:c.794A>G	chr3.hg19:g.186790725A>G	ENSP00000169298:p.Asp265Gly	130.0	0.0		127.0	31.0	NM_003032	A8KA14|B2R513|D3DNV3	Missense_Mutation	SNP	ENST00000169298.3	hg19	CCDS3285.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.521643	0.44866	.	.	ENSG00000073849	ENST00000169298;ENST00000457772;ENST00000427315;ENST00000448044;ENST00000442023	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	4.5	4.5	0.54988	.	0.142257	0.64402	D	0.000007	T	0.33673	0.0871	M	0.83223	2.63	0.45806	D	0.998689	B	0.33777	0.425	B	0.33196	0.159	T	0.11036	-1.0604	10	0.15499	T	0.54	-14.1272	10.4944	0.44768	1.0:0.0:0.0:0.0	.	265	P15907	SIAT1_HUMAN	G	265;34;34;265;34	ENSP00000169298:D265G;ENSP00000412221:D34G;ENSP00000389337:D265G;ENSP00000403063:D34G	ENSP00000169298:D265G	D	+	2	0	ST6GAL1	188273419	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	5.022000	0.64078	2.257000	0.74773	0.459000	0.35465	GAT	.	.		0.438	ST6GAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344399.1	NM_173216	
ATP13A5	344905	hgsc.bcm.edu	37	3	192992998	192992998	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:192992998G>C	ENST00000342358.4	-	30	3607	c.3490C>G	c.(3490-3492)Cta>Gta	p.L1164V	ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	1164						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TCTTCTGCTAGCTTCTTTTGC	0.398																																					p.L1164V		Atlas-SNP	.											.	ATP13A5	171	.	0			c.C3490G						.						151.0	141.0	145.0					3																	192992998		2203	4300	6503	SO:0001583	missense	344905	exon30			CTGCTAGCTTCTT	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.3490C>G	chr3.hg19:g.192992998G>C	ENSP00000341942:p.Leu1164Val	91.0	0.0		83.0	20.0	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	hg19	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945722	0.34377	.	.	ENSG00000187527	ENST00000342358	T	0.58652	0.32	5.59	2.79	0.32731	.	0.108809	0.41001	D	0.000977	T	0.32071	0.0817	N	0.14661	0.345	0.27674	N	0.946671	P	0.41041	0.736	B	0.35312	0.2	T	0.23368	-1.0190	10	0.56958	D	0.05	-8.6316	5.029	0.14400	0.2358:0.1629:0.6012:0.0	.	1164	Q4VNC0	AT135_HUMAN	V	1164	ENSP00000341942:L1164V	ENSP00000341942:L1164V	L	-	1	2	ATP13A5	194475692	0.875000	0.30112	0.981000	0.43875	0.909000	0.53808	0.231000	0.17872	1.366000	0.46076	0.563000	0.77884	CTA	.	.		0.398	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
COMMD8	54951	hgsc.bcm.edu	37	4	47465616	47465616	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr4:47465616T>A	ENST00000381571.4	-	1	120	c.53A>T	c.(52-54)gAg>gTg	p.E18V		NM_017845.3	NP_060315.1	Q9NX08	COMD8_HUMAN	COMM domain containing 8	18										large_intestine(2)|lung(5)|prostate(1)	8						CGGGCCCAGCTCGGCCGGCAG	0.741																																					p.E18V		Atlas-SNP	.											.	COMMD8	15	.	0			c.A53T						.						4.0	4.0	4.0					4																	47465616		1664	3187	4851	SO:0001583	missense	54951	exon1			CCCAGCTCGGCCG	AY542163	CCDS3475.1	4p12	2008-02-05			ENSG00000169019	ENSG00000169019			26036	protein-coding gene	gene with protein product						15799966	Standard	NM_017845		Approved	FLJ20502	uc003gxi.3	Q9NX08	OTTHUMG00000099435	ENST00000381571.4:c.53A>T	chr4.hg19:g.47465616T>A	ENSP00000370984:p.Glu18Val	57.0	0.0		69.0	13.0	NM_017845	Q8WUR4|Q9HC15	Missense_Mutation	SNP	ENST00000381571.4	hg19	CCDS3475.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.314639	0.81358	.	.	ENSG00000169019	ENST00000381571	T	0.09630	2.96	5.17	5.17	0.71159	.	0.387514	0.28653	N	0.014597	T	0.23965	0.0580	M	0.65498	2.005	0.41436	D	0.987898	D	0.58970	0.984	P	0.56343	0.796	T	0.00708	-1.1600	10	0.52906	T	0.07	-27.9928	11.3169	0.49396	0.0:0.0:0.0:1.0	.	18	Q9NX08	COMD8_HUMAN	V	18	ENSP00000370984:E18V	ENSP00000370984:E18V	E	-	2	0	COMMD8	47160373	0.994000	0.37717	0.970000	0.41538	0.683000	0.39861	3.299000	0.51826	2.168000	0.68352	0.533000	0.62120	GAG	.	.		0.741	COMMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216898.2	NM_017845	
FAM13A	10144	hgsc.bcm.edu	37	4	89689194	89689194	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr4:89689194T>G	ENST00000264344.5	-	12	1682	c.1475A>C	c.(1474-1476)aAt>aCt	p.N492T	FAM13A_ENST00000511976.1_Missense_Mutation_p.N78T|FAM13A_ENST00000503556.1_Missense_Mutation_p.N152T|FAM13A_ENST00000502459.1_5'UTR|FAM13A_ENST00000395002.2_Missense_Mutation_p.N166T|FAM13A_ENST00000508369.1_Missense_Mutation_p.N166T|FAM13A_ENST00000513837.1_Missense_Mutation_p.N138T	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	492					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						TCGTGTGGAATTGAGACTTTC	0.358																																					p.N492T		Atlas-SNP	.											.	FAM13A	181	.	0			c.A1475C						.						93.0	87.0	89.0					4																	89689194		2203	4300	6503	SO:0001583	missense	10144	exon12			GTGGAATTGAGAC	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1475A>C	chr4.hg19:g.89689194T>G	ENSP00000264344:p.Asn492Thr	206.0	0.0		134.0	33.0	NM_014883	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	hg19	CCDS34029.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.497742	0.26861	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T;T	0.62941	-0.01;-0.01;1.46;1.53;-0.01;1.46	5.13	-7.72	0.01250	.	1.035740	0.07534	N	0.912755	T	0.49695	0.1572	L	0.43152	1.355	0.09310	N	1	B;B;B;B;B;B	0.25904	0.034;0.137;0.029;0.034;0.034;0.034	B;B;B;B;B;B	0.21917	0.036;0.037;0.006;0.023;0.023;0.023	T	0.31586	-0.9938	10	0.33141	T	0.24	.	14.5637	0.68159	0.0:0.6775:0.1983:0.1242	.	138;78;492;166;152;166	O94988-6;E9PGM7;O94988;O94988-3;O94988-5;O94988-1	.;.;FA13A_HUMAN;.;.;.	T	166;492;152;78;166;138	ENSP00000378450:N166T;ENSP00000264344:N492T;ENSP00000427189:N152T;ENSP00000421914:N78T;ENSP00000421562:N166T;ENSP00000423252:N138T	ENSP00000264344:N492T	N	-	2	0	FAM13A	89908217	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.707000	0.05041	-1.775000	0.01287	-0.924000	0.02725	AAT	.	.		0.358	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1		
FSTL5	56884	hgsc.bcm.edu	37	4	162307147	162307147	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr4:162307147C>T	ENST00000306100.5	-	16	2732	c.2296G>A	c.(2296-2298)Gtg>Atg	p.V766M	FSTL5_ENST00000427802.2_Missense_Mutation_p.V756M|FSTL5_ENST00000536695.1_Missense_Mutation_p.V765M|RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000379164.4_Missense_Mutation_p.V765M	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	766						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		ACAAAGAGCACATCAGTTTGT	0.433																																					p.V766M		Atlas-SNP	.											.	FSTL5	207	.	0			c.G2296A						.						128.0	119.0	122.0					4																	162307147		2203	4300	6503	SO:0001583	missense	56884	exon16			AGAGCACATCAGT	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2296G>A	chr4.hg19:g.162307147C>T	ENSP00000305334:p.Val766Met	145.0	0.0		84.0	26.0	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	hg19	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443101	0.83993	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);	0.114370	0.64402	D	0.000013	T	0.56426	0.1984	M	0.71036	2.16	0.58432	D	0.99999	D;D;D	0.67145	0.978;0.996;0.987	P;D;P	0.67548	0.836;0.952;0.812	T	0.57751	-0.7757	10	0.87932	D	0	.	18.9648	0.92692	0.0:1.0:0.0:0.0	.	756;765;766	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	M	766;765;756;765	ENSP00000305334:V766M;ENSP00000368462:V765M;ENSP00000389270:V756M;ENSP00000440409:V765M	ENSP00000305334:V766M	V	-	1	0	FSTL5	162526597	1.000000	0.71417	0.962000	0.40283	0.987000	0.75469	7.380000	0.79704	2.702000	0.92279	0.655000	0.94253	GTG	.	.		0.433	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
TLR3	7098	hgsc.bcm.edu	37	4	187004594	187004594	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr4:187004594T>C	ENST00000296795.3	+	4	1858	c.1754T>C	c.(1753-1755)tTa>tCa	p.L585S	TLR3_ENST00000504367.1_Missense_Mutation_p.L308S	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	585					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TTCAAGGATTTATTTGAACTA	0.398																																					p.L585S		Atlas-SNP	.											.	TLR3	83	.	0			c.T1754C						.						76.0	76.0	76.0					4																	187004594		2203	4300	6503	SO:0001583	missense	7098	exon4			AGGATTTATTTGA	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1754T>C	chr4.hg19:g.187004594T>C	ENSP00000296795:p.Leu585Ser	177.0	0.0		145.0	18.0	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	hg19	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.955634	0.53293	.	.	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.70631	-0.5;-0.5	5.88	5.88	0.94601	.	0.063079	0.64402	D	0.000005	D	0.87144	0.6104	M	0.89904	3.07	0.36853	D	0.888013	D	0.89917	1.0	D	0.97110	1.0	D	0.91611	0.5303	10	0.72032	D	0.01	.	16.2948	0.82765	0.0:0.0:0.0:1.0	.	585	O15455	TLR3_HUMAN	S	585;585;308	ENSP00000296795:L585S;ENSP00000423684:L308S	ENSP00000296795:L585S	L	+	2	0	TLR3	187241588	0.996000	0.38824	0.039000	0.18376	0.556000	0.35491	8.040000	0.89188	2.253000	0.74438	0.455000	0.32223	TTA	.	.		0.398	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
NIPBL	25836	hgsc.bcm.edu	37	5	36986168	36986168	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:36986168G>A	ENST00000282516.8	+	10	3385	c.2886G>A	c.(2884-2886)aaG>aaA	p.K962K	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Silent_p.K962K	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	962					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CGAAAATCAAGAGGGATAAAG	0.378																																					p.K962K		Atlas-SNP	.											.	NIPBL	513	.	0			c.G2886A						.						121.0	128.0	126.0					5																	36986168		2203	4300	6503	SO:0001819	synonymous_variant	25836	exon10			AATCAAGAGGGAT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.2886G>A	chr5.hg19:g.36986168G>A		1313.0	2.0		1463.0	280.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.		0.378	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
LRRC70	100130733	hgsc.bcm.edu	37	5	61875597	61875597	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:61875597A>G	ENST00000334994.5	+	2	571	c.332A>G	c.(331-333)tAt>tGt	p.Y111C	LRRC70_ENST00000491184.2_Intron|LRRC70_ENST00000448151.2_Intron|IPO11_ENST00000409534.1_Intron|IPO11_ENST00000409296.3_Intron|IPO11_ENST00000325324.6_Intron	NM_181506.4	NP_852607.3	Q7Z2Q7	LRR70_HUMAN	leucine rich repeat containing 70	111						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						AGGCATCTATATTTTCTATTT	0.279																																					p.Y111C		Atlas-SNP	.											.	LRRC70	19	.	0			c.A332G						.						13.0	11.0	11.0					5																	61875597		692	1561	2253	SO:0001583	missense	100130733	exon2			ATCTATATTTTCT		CCDS47218.1	5q12.1	2008-12-18			ENSG00000186105	ENSG00000186105			35155	protein-coding gene	gene with protein product	"""synleurin"""						Standard	NM_181506		Approved	SLRN, LOC100130733	uc011cqs.1	Q7Z2Q7	OTTHUMG00000154401	ENST00000334994.5:c.332A>G	chr5.hg19:g.61875597A>G	ENSP00000399441:p.Tyr111Cys	129.0	0.0		153.0	20.0	NM_181506	Q6ZWI5	Missense_Mutation	SNP	ENST00000334994.5	hg19	CCDS47218.1	.	.	.	.	.	.	.	.	.	.	A	0.179	-1.063750	0.01934	.	.	ENSG00000186105	ENST00000334994	T	0.57752	0.38	4.62	0.926	0.19430	.	.	.	.	.	T	0.31136	0.0787	N	0.16368	0.405	0.80722	D	1	B	0.14438	0.01	B	0.17722	0.019	T	0.05500	-1.0881	8	.	.	.	.	8.3569	0.32335	0.6235:0.0:0.3765:0.0	.	111	Q7Z2Q7	LRR70_HUMAN	C	111	ENSP00000399441:Y111C	.	Y	+	2	0	LRRC70	61911354	0.901000	0.30685	0.625000	0.29200	0.075000	0.17131	0.659000	0.24994	0.065000	0.16485	0.460000	0.39030	TAT	.	.		0.279	LRRC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335067.3	XR_042302	
ZNF366	167465	hgsc.bcm.edu	37	5	71756336	71756336	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:71756336G>A	ENST00000318442.5	-	2	1478	c.988C>T	c.(988-990)Cag>Tag	p.Q330*		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	330					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TCGCTGTGCTGCATCATGTGG	0.667																																					p.Q330X		Atlas-SNP	.											.	ZNF366	108	.	0			c.C988T						.						40.0	38.0	39.0					5																	71756336		2203	4300	6503	SO:0001587	stop_gained	167465	exon2			TGTGCTGCATCAT	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.988C>T	chr5.hg19:g.71756336G>A	ENSP00000313158:p.Gln330*	52.0	0.0		44.0	14.0	NM_152625	Q5HYI9|Q7RTV4	Nonsense_Mutation	SNP	ENST00000318442.5	hg19	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	G	41	8.555257	0.98861	.	.	ENSG00000178175	ENST00000318442	.	.	.	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-48.1929	19.7279	0.96172	0.0:0.0:1.0:0.0	.	.	.	.	X	330	.	ENSP00000313158:Q330X	Q	-	1	0	ZNF366	71792092	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.659000	0.90383	0.561000	0.74099	CAG	.	.		0.667	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
LRRTM2	26045	hgsc.bcm.edu	37	5	138209107	138209107	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:138209107A>G	ENST00000274711.6	-	2	1521	c.1143T>C	c.(1141-1143)taT>taC	p.Y381Y	CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000518825.1_Intron|LRRTM2_ENST00000523537.1_5'Flank|CTNNA1_ENST00000520400.1_Intron|LRRTM2_ENST00000518785.1_3'UTR|LRRTM2_ENST00000521094.2_Intron|CTNNA1_ENST00000540387.1_5'Flank	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	381					long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTCTTTTTGTATATTCAGTGG	0.423																																					p.Y381Y		Atlas-SNP	.											.	LRRTM2	42	.	0			c.T1143C						.						180.0	155.0	163.0					5																	138209107		1900	4121	6021	SO:0001819	synonymous_variant	26045	exon2			TTTTGTATATTCA	AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.1143T>C	chr5.hg19:g.138209107A>G		90.0	0.0		99.0	11.0	NM_015564	A0AVL3|A8K4U9|B7ZLN8|Q7L770	Silent	SNP	ENST00000274711.6	hg19	CCDS47272.1																																																																																			.	.		0.423	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374043.2		
UBE2D2	7322	hgsc.bcm.edu	37	5	138994470	138994471	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:138994470_138994471CA>AT	ENST00000398733.3	+	5	849_850	c.223_224CA>AT	c.(223-225)CAt>ATt	p.H75I	UBE2D2_ENST00000253815.2_Missense_Mutation_p.H46I|UBE2D2_ENST00000505548.1_Missense_Mutation_p.H46I|UBE2D2_ENST00000511725.1_Missense_Mutation_p.H46I	NM_003339.2	NP_003330.1	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2	75					cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAGAATTTATCATCCAAATATT	0.322																																					p.H75N|p.H75L		Atlas-SNP	.											.	UBE2D2	17	.	0			c.C223A|c.A224T						.																																			SO:0001583	missense	7322	exon5			ATTTATCATCCAA|TTTATCATCCAAA	L40146	CCDS43369.1, CCDS47275.1	5q31.2	2013-10-18	2011-05-19		ENSG00000131508	ENSG00000131508		"""Ubiquitin-conjugating enzymes E2"""	12475	protein-coding gene	gene with protein product		602962	"""ubiquitin-conjugating enzyme E2D 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181838		Approved	UbcH5B, UBC4	uc003ler.3	P62837	OTTHUMG00000163282	Exception_encountered	chr5.hg19:g.138994470_138994471delinsAT	ENSP00000381717:p.His75Ile	276.0|273.0	0.0		261.0|259.0	136.0|135.0	NM_003339	D3DQC9|P51669|Q3MN78|Q96RP6	Missense_Mutation	SNP	ENST00000398733.3	hg19	CCDS43369.1																																																																																			.	.		0.322	UBE2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372454.3	NM_181838	
ANKHD1	54882	hgsc.bcm.edu	37	5	139917018	139917018	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:139917018G>T	ENST00000360839.2	+	31	7226	c.7072G>T	c.(7072-7074)Gcc>Tcc	p.A2358S	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.A2358S|ANKHD1_ENST00000544120.1_Missense_Mutation_p.A682S|ANKHD1_ENST00000297183.6_Missense_Mutation_p.A2358S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2358						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAGTCAGTGCCAGTCAAGA	0.542																																					p.A2358S		Atlas-SNP	.											.	ANKHD1	233	.	0			c.G7072T						.						100.0	96.0	97.0					5																	139917018		2203	4300	6503	SO:0001583	missense	54882	exon31			GTCAGTGCCAGTC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.7072G>T	chr5.hg19:g.139917018G>T	ENSP00000354085:p.Ala2358Ser	137.0	0.0		137.0	67.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	hg19	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.46|14.46	2.542862|2.542862	0.45280|0.45280	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000433049;ENST00000544120;ENST00000532219;ENST00000437495|ENST00000435794;ENST00000432301	T;T;T;T;T;T;T|.	0.64618|.	-0.06;-0.11;1.99;1.99;1.55;-0.11;0.97|.	5.78|5.78	4.87|4.87	0.63330|0.63330	.|.	0.256502|.	0.40385|.	N|.	0.001119|.	T|T	0.28001|0.28001	0.0690|0.0690	L|L	0.29908|0.29908	0.895|0.895	0.23546|0.23546	N|N	0.997442|0.997442	B;B;B;B;B;B|.	0.25390|.	0.077;0.01;0.125;0.001;0.001;0.02|.	B;B;B;B;B;B|.	0.28916|.	0.044;0.017;0.096;0.002;0.004;0.017|.	T|T	0.12268|0.12268	-1.0554|-1.0554	10|5	0.15952|.	T|.	0.53|.	.|.	5.4802|5.4802	0.16719|0.16719	0.1066:0.1285:0.6329:0.132|0.1066:0.1285:0.6329:0.132	.|.	682;805;682;2375;2358;2358|.	Q8IWG5;Q9H059;F6WFL0;E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;.;.;.;ANKH1_HUMAN|.	S|F	2358;2358;2375;1031;897;682;2358;386|848;749	ENSP00000354085:A2358S;ENSP00000297183:A2358S;ENSP00000393204:A1031S;ENSP00000390034:A897S;ENSP00000437687:A682S;ENSP00000432016:A2358S;ENSP00000396882:A386S|.	ENSP00000396882:A386S|.	A|C	+|+	1|2	0|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139897202|139897202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	1.144000|1.144000	0.31565|0.31565	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GCC|TGC	.	.		0.542	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHA10	56139	hgsc.bcm.edu	37	5	140237595	140237595	+	Silent	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:140237595C>G	ENST00000307360.5	+	1	1962	c.1962C>G	c.(1960-1962)ggC>ggG	p.G654G	PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	654	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGACCATGGCGAGCCGTCGC	0.682																																					p.G654G		Atlas-SNP	.											.	PCDHA10	358	.	0			c.C1962G						.						16.0	22.0	20.0					5																	140237595		1322	2284	3606	SO:0001819	synonymous_variant	56139	exon1			CCATGGCGAGCCG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1962C>G	chr5.hg19:g.140237595C>G		82.0	0.0		115.0	23.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	hg19	CCDS54921.1																																																																																			.	.		0.682	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
PCDHGB7	56099	hgsc.bcm.edu	37	5	140797663	140797663	+	Silent	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:140797663G>T	ENST00000398594.2	+	1	237	c.237G>T	c.(235-237)gcG>gcT	p.A79A	PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTAGACGCGCAGAGCGGGG	0.537																																					p.A79A		Atlas-SNP	.											.	PCDHGB7	117	.	0			c.G237T						.						129.0	134.0	132.0					5																	140797663		1950	4152	6102	SO:0001819	synonymous_variant	56099	exon1			AGACGCGCAGAGC	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.237G>T	chr5.hg19:g.140797663G>T		134.0	0.0		98.0	37.0	NM_018927	Q9UN63	Silent	SNP	ENST00000398594.2	hg19	CCDS47293.1																																																																																			.	.		0.537	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
SPINK5	11005	hgsc.bcm.edu	37	5	147450013	147450013	+	Splice_Site	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:147450013T>G	ENST00000256084.7	+	3	251	c.209T>G	c.(208-210)cTg>cGg	p.L70R	SPINK5_ENST00000398454.1_Splice_Site_p.L70R|SPINK5_ENST00000359874.3_Splice_Site_p.L70R	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	70					anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAATGATACTGTGAGTAAAG	0.323																																					p.L70R		Atlas-SNP	.											.	SPINK5	245	.	0			c.T209G						.						75.0	74.0	74.0					5																	147450013		1833	4084	5917	SO:0001630	splice_region_variant	11005	exon3			TGATACTGTGAGT	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.209+1T>G	chr5.hg19:g.147450013T>G		326.0	0.0		301.0	19.0	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	hg19	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694205	0.48202	.	.	ENSG00000133710	ENST00000521206;ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18	5.33	5.33	0.75918	.	0.000000	0.35040	N	0.003484	T	0.24084	0.0583	M	0.66939	2.045	0.33678	D	0.611786	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.97110	0.997;1.0;0.999;0.956	T	0.21518	-1.0243	10	0.23891	T	0.37	-4.2526	12.2661	0.54679	0.0:0.0:0.0:1.0	.	51;70;70;70	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	R	51;70;70;51;70	ENSP00000430264:L51R;ENSP00000381472:L70R;ENSP00000352936:L70R;ENSP00000421519:L51R;ENSP00000256084:L70R	ENSP00000256084:L70R	L	+	2	0	SPINK5	147430206	0.979000	0.34478	0.938000	0.37757	0.285000	0.27093	2.153000	0.42282	2.322000	0.78497	0.528000	0.53228	CTG	.	.		0.323	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	Missense_Mutation
FOXI1	2299	hgsc.bcm.edu	37	5	169533520	169533520	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:169533520G>A	ENST00000306268.6	+	1	620	c.559G>A	c.(559-561)Gac>Aac	p.D187N	FOXI1_ENST00000449804.2_Missense_Mutation_p.D187N			Q12951	FOXI1_HUMAN	forkhead box I1	187					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTGCCCCGCGACGAGGACGA	0.582									Pendred syndrome																												p.D187N		Atlas-SNP	.											.	FOXI1	70	.	0			c.G559A						.						38.0	41.0	40.0					5																	169533520		2203	4300	6503	SO:0001583	missense	2299	exon1	Familial Cancer Database	Goiter-Deafness syndrome	CCCCGCGACGAGG	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.559G>A	chr5.hg19:g.169533520G>A	ENSP00000304286:p.Asp187Asn	96.0	0.0		101.0	31.0	NM_012188	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	hg19	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429315	0.43122	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.95482	-3.72;-3.72	4.86	4.86	0.63082	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.056515	0.64402	D	0.000002	D	0.95262	0.8463	N	0.20445	0.575	0.80722	D	1	D;D	0.67145	0.995;0.996	P;D	0.64595	0.88;0.927	D	0.96440	0.9326	10	0.87932	D	0	.	18.1961	0.89822	0.0:0.0:1.0:0.0	.	187;187	Q12951-2;Q12951	.;FOXI1_HUMAN	N	187	ENSP00000304286:D187N;ENSP00000415483:D187N	ENSP00000304286:D187N	D	+	1	0	FOXI1	169466098	1.000000	0.71417	0.331000	0.25455	0.202000	0.24057	9.651000	0.98493	2.513000	0.84729	0.650000	0.86243	GAC	.	.		0.582	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
CDHR2	54825	hgsc.bcm.edu	37	5	176019770	176019770	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:176019770C>G	ENST00000510636.1	+	31	4055	c.3781C>G	c.(3781-3783)Cag>Gag	p.Q1261E	CDHR2_ENST00000506348.1_Missense_Mutation_p.Q1261E|CDHR2_ENST00000261944.5_Missense_Mutation_p.Q1261E	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1261					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CAAGAACAGTCAGGAAATCAA	0.547																																					p.Q1261E		Atlas-SNP	.											.	CDHR2	152	.	0			c.C3781G						.						154.0	128.0	137.0					5																	176019770		2203	4300	6503	SO:0001583	missense	54825	exon31			AACAGTCAGGAAA	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.3781C>G	chr5.hg19:g.176019770C>G	ENSP00000424565:p.Gln1261Glu	103.0	0.0		112.0	54.0	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	c	0.021	-1.422716	0.01126	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.54479	0.57;0.57;0.57	3.63	-5.51	0.02568	.	.	.	.	.	T	0.20088	0.0483	N	0.04636	-0.2	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36065	-0.9763	9	0.05721	T	0.95	-4.7353	7.2803	0.26308	0.407:0.208:0.385:0.0	.	1261	Q9BYE9	CDHR2_HUMAN	E	1261	ENSP00000424565:Q1261E;ENSP00000261944:Q1261E;ENSP00000421078:Q1261E	ENSP00000261944:Q1261E	Q	+	1	0	CDHR2	175952376	0.000000	0.05858	0.004000	0.12327	0.084000	0.17831	-1.790000	0.01759	-0.749000	0.04747	-1.533000	0.00918	CAG	.	.		0.547	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
TMED9	54732	hgsc.bcm.edu	37	5	177019635	177019635	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:177019635G>T	ENST00000332598.6	+	2	301	c.244G>T	c.(244-246)Ggg>Tgg	p.G82W		NM_017510.4	NP_059980.2	Q9BVK6	TMED9_HUMAN	transmembrane emp24 protein transport domain containing 9	82	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				COPI coating of Golgi vesicle (GO:0048205)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network transport vesicle (GO:0030140)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(2)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCACCCCGGGGCTTGGCAT	0.652																																					p.G82W		Atlas-SNP	.											.	TMED9	18	.	0			c.G244T						.						26.0	31.0	29.0					5																	177019635		2203	4300	6503	SO:0001583	missense	54732	exon2			ACCCCGGGGCTTG	AF441399	CCDS4428.1	5q35.3	2008-02-05			ENSG00000184840	ENSG00000184840			24878	protein-coding gene	gene with protein product						12477932	Standard	NM_017510		Approved	HSGP25L2G	uc003mhx.3	Q9BVK6	OTTHUMG00000130859	ENST00000332598.6:c.244G>T	chr5.hg19:g.177019635G>T	ENSP00000330945:p.Gly82Trp	227.0	0.0		223.0	116.0	NM_017510	Q14437|Q8WZ61	Missense_Mutation	SNP	ENST00000332598.6	hg19	CCDS4428.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316351	0.60524	.	.	ENSG00000184840	ENST00000332598	T	0.19105	2.17	5.05	4.17	0.49024	GOLD (2);	0.100180	0.64402	N	0.000002	T	0.41305	0.1153	M	0.82630	2.6	0.80722	D	1	P	0.40282	0.711	P	0.50934	0.654	T	0.41716	-0.9493	10	0.62326	D	0.03	-20.5084	13.0372	0.58879	0.0:0.0:0.8381:0.1619	.	82	Q9BVK6	TMED9_HUMAN	W	82	ENSP00000330945:G82W	ENSP00000330945:G82W	G	+	1	0	TMED9	176952241	1.000000	0.71417	0.961000	0.40146	0.966000	0.64601	7.402000	0.79972	1.216000	0.43427	0.462000	0.41574	GGG	.	.		0.652	TMED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253433.1	NM_017510	
N4BP3	23138	hgsc.bcm.edu	37	5	177547301	177547301	+	Silent	SNP	G	G	T	rs374439291		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:177547301G>T	ENST00000274605.5	+	3	812	c.453G>T	c.(451-453)acG>acT	p.T151T		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	151						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCTGCACACGCTGGCCTGCC	0.697																																					p.T151T		Atlas-SNP	.											.	N4BP3	25	.	0			c.G453T						.	G		0,4406		0,0,2203	16.0	19.0	18.0		453	-10.3	0.3	5		18	1,8591		0,1,4295	no	coding-synonymous	N4BP3	NM_015111.1		0,1,6498	TT,TG,GG		0.0116,0.0,0.0077		151/545	177547301	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	23138	exon3			GCACACGCTGGCC	AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.453G>T	chr5.hg19:g.177547301G>T		109.0	0.0		130.0	24.0	NM_015111	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Silent	SNP	ENST00000274605.5	hg19	CCDS34307.1																																																																																			.	.		0.697	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373552.2	NM_015111	
CLK4	57396	hgsc.bcm.edu	37	5	178043910	178043910	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr5:178043910T>G	ENST00000316308.4	-	5	683	c.515A>C	c.(514-516)aAa>aCa	p.K172T	CLK4_ENST00000522749.1_5'UTR|RN7SKP70_ENST00000516655.1_RNA	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	172	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		CTCTACAACTTTGCCAAAGGC	0.378																																					p.K172T		Atlas-SNP	.											.	CLK4	103	.	0			c.A515C						.						120.0	110.0	114.0					5																	178043910		2203	4300	6503	SO:0001583	missense	57396	exon5			ACAACTTTGCCAA	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.515A>C	chr5.hg19:g.178043910T>G	ENSP00000316948:p.Lys172Thr	280.0	0.0		277.0	58.0	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646827	0.29246	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.65732	-0.17	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71459	0.3342	L	0.39514	1.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.992;0.992	T	0.74506	-0.3643	10	0.87932	D	0	.	13.3639	0.60671	0.0:0.0:0.0:1.0	.	172;172;172	B7ZL31;B9EG64;Q9HAZ1	.;.;CLK4_HUMAN	T	172	ENSP00000316948:K172T	ENSP00000316948:K172T	K	-	2	0	CLK4	177976516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.146000	0.71777	2.047000	0.60756	0.528000	0.53228	AAA	.	.		0.378	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
TRIM10	10107	hgsc.bcm.edu	37	6	30122220	30122220	+	Silent	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:30122220G>T	ENST00000449742.2	-	7	1047	c.972C>A	c.(970-972)ctC>ctA	p.L324L	TRIM10_ENST00000376704.3_Silent_p.L324L	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	324	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						CCTCGGACAAGAGGAGCTTGG	0.537																																					p.L324L		Atlas-SNP	.											.	TRIM10	65	.	0			c.C972A						.						61.0	74.0	69.0					6																	30122220		1509	2708	4217	SO:0001819	synonymous_variant	10107	exon7			GGACAAGAGGAGC	Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.972C>A	chr6.hg19:g.30122220G>T		39.0	0.0		50.0	5.0	NM_052828	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Silent	SNP	ENST00000449742.2	hg19	CCDS34375.1																																																																																			.	.		0.537	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076634.1		
ITPR3	3710	hgsc.bcm.edu	37	6	33652240	33652240	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:33652240C>T	ENST00000374316.5	+	38	6104	c.5044C>T	c.(5044-5046)Cgg>Tgg	p.R1682W	ITPR3_ENST00000605930.1_Missense_Mutation_p.R1682W			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1682					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GTACGGGGACCGGGTGAGTGC	0.632																																					p.R1682W		Atlas-SNP	.											.	ITPR3	409	.	0			c.C5044T						.						52.0	56.0	55.0					6																	33652240		2203	4300	6503	SO:0001583	missense	3710	exon37			GGGGACCGGGTGA	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5044C>T	chr6.hg19:g.33652240C>T	ENSP00000363435:p.Arg1682Trp	94.0	0.0		138.0	11.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352482	0.82132	.	.	ENSG00000096433	ENST00000374316	D	0.90261	-2.64	5.02	4.09	0.47781	.	0.113529	0.64402	D	0.000018	D	0.86125	0.5858	L	0.34521	1.04	0.42224	D	0.991865	D	0.69078	0.997	P	0.53490	0.727	D	0.87687	0.2551	10	0.62326	D	0.03	-36.0857	10.928	0.47201	0.3833:0.6167:0.0:0.0	.	1682	Q14573	ITPR3_HUMAN	W	1682	ENSP00000363435:R1682W	ENSP00000363435:R1682W	R	+	1	2	ITPR3	33760218	0.959000	0.32827	0.998000	0.56505	0.929000	0.56500	2.197000	0.42696	2.306000	0.77630	0.650000	0.86243	CGG	.	.		0.632	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
XPO5	57510	hgsc.bcm.edu	37	6	43492932	43492932	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:43492932T>C	ENST00000265351.7	-	29	3297	c.3087A>G	c.(3085-3087)ttA>ttG	p.L1029L	POLR1C_ENST00000304004.3_Intron	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	1029					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AGGCTGTAATTAATAGCGCTG	0.438																																					p.L1029L		Atlas-SNP	.											.	XPO5	79	.	0			c.A3087G						.						41.0	41.0	41.0					6																	43492932		1881	4115	5996	SO:0001819	synonymous_variant	57510	exon29			TGTAATTAATAGC	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.3087A>G	chr6.hg19:g.43492932T>C		70.0	0.0		72.0	12.0	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	ENST00000265351.7	hg19	CCDS47430.1																																																																																			.	.		0.438	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
DST	667	hgsc.bcm.edu	37	6	56342211	56342211	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:56342211T>C	ENST00000361203.3	-	86	20654	c.20647A>G	c.(20647-20649)Atc>Gtc	p.I6883V	DST_ENST00000421834.2_Missense_Mutation_p.I4906V|DST_ENST00000370769.4_Missense_Mutation_p.I6994V|DST_ENST00000370754.5_Missense_Mutation_p.I7172V|DST_ENST00000312431.6_3'UTR|DST_ENST00000244364.6_Missense_Mutation_p.I4580V|DST_ENST00000446842.2_Missense_Mutation_p.I6668V|DST_ENST00000370788.2_Missense_Mutation_p.I4797V			Q03001	DYST_HUMAN	dystonin	6884					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGGTGGCAGATAGCCAAAACG	0.453																																					p.I4580V		Atlas-SNP	.											.	DST	1427	.	0			c.A13738G						.						190.0	199.0	196.0					6																	56342211		1948	4157	6105	SO:0001583	missense	667	exon72			GGCAGATAGCCAA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20647A>G	chr6.hg19:g.56342211T>C	ENSP00000354508:p.Ile6883Val	106.0	0.0		99.0	15.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	T	12.38	1.921875	0.33908	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.58	-1.57	0.08506	.	0.256160	0.27139	N	0.020746	T	0.14743	0.0356	N	0.08118	0	0.24783	N	0.992805	P;B;B;B;B	0.46277	0.875;0.035;0.017;0.001;0.0	P;B;B;B;B	0.48815	0.591;0.074;0.02;0.004;0.006	T	0.16041	-1.0416	9	0.28530	T	0.3	.	9.8118	0.40828	0.0:0.0642:0.4794:0.4564	.	4906;6994;7172;6992;4580	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	4580;7172;6994;4906;6668;4797;6883	ENSP00000244364:I4580V;ENSP00000359790:I7172V;ENSP00000359805:I6994V;ENSP00000400883:I4906V;ENSP00000393645:I6668V;ENSP00000359824:I4797V;ENSP00000354508:I6883V	ENSP00000244364:I4580V	I	-	1	0	DST	56450170	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	2.825000	0.48096	-0.387000	0.07809	-0.438000	0.05819	ATC	.	.		0.453	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
ZNF451	26036	hgsc.bcm.edu	37	6	57012444	57012444	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:57012444C>T	ENST00000370706.4	+	10	1805	c.1561C>T	c.(1561-1563)Cac>Tac	p.H521Y	RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.H521Y|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.H521Y|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GAGCCGGATTCACGGAGGGGC	0.403																																					p.H521Y		Atlas-SNP	.											.	ZNF451	181	.	0			c.C1561T						.						188.0	180.0	183.0					6																	57012444		2203	4300	6503	SO:0001583	missense	26036	exon10			CGGATTCACGGAG	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1561C>T	chr6.hg19:g.57012444C>T	ENSP00000359740:p.His521Tyr	96.0	0.0		144.0	25.0	NM_001031623	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	hg19	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226616	0.79576	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.09163	3.01;3.01;3.01	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	H	0.97806	4.08	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.85130	0.997;0.99;0.997;0.99	T	0.68625	-0.5359	10	0.87932	D	0	-15.7279	19.216	0.93778	0.0:1.0:0.0:0.0	.	521;521;521;521	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	Y	521	ENSP00000359740:H521Y;ENSP00000350083:H521Y;ENSP00000421645:H521Y	ENSP00000350083:H521Y	H	+	1	0	ZNF451	57120403	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.142000	0.77339	2.529000	0.85273	0.650000	0.86243	CAC	.	.		0.403	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	
RIMS1	22999	hgsc.bcm.edu	37	6	72967920	72967920	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:72967920T>C	ENST00000521978.1	+	17	2863	c.2863T>C	c.(2863-2865)Tct>Cct	p.S955P	RIMS1_ENST00000425662.2_Missense_Mutation_p.S348P|RIMS1_ENST00000517827.1_Missense_Mutation_p.S414P|RIMS1_ENST00000520567.1_Missense_Mutation_p.S954P|RIMS1_ENST00000538414.1_5'UTR|RIMS1_ENST00000522291.1_Missense_Mutation_p.S954P|RIMS1_ENST00000348717.5_Missense_Mutation_p.S954P|RIMS1_ENST00000517960.1_Missense_Mutation_p.S954P|RIMS1_ENST00000491071.2_Missense_Mutation_p.S955P|RIMS1_ENST00000523963.1_Missense_Mutation_p.S429P|RIMS1_ENST00000264839.7_Missense_Mutation_p.S955P|RIMS1_ENST00000401910.3_Missense_Mutation_p.S428P|RIMS1_ENST00000518273.1_Missense_Mutation_p.S955P	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	955					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ACGTTCAGTATCTCCTCATCG	0.463																																					p.S955P		Atlas-SNP	.											.	RIMS1	278	.	0			c.T2863C						.						92.0	87.0	89.0					6																	72967920		1992	4166	6158	SO:0001583	missense	22999	exon17			TCAGTATCTCCTC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2863T>C	chr6.hg19:g.72967920T>C	ENSP00000428417:p.Ser955Pro	46.0	0.0		69.0	20.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.34|18.34	3.602249|3.602249	0.66445|0.66445	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.20200	.|2.35;2.35;2.37;2.35;2.43;2.44;2.44;2.35;2.38;2.48;2.45;2.4;2.45;2.09	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.64402	.|D	.|0.000007	T|T	0.29355|0.29355	0.0731|0.0731	L|L	0.45137|0.45137	1.4|1.4	0.80722|0.80722	D|D	1|1	.|B;D;D;D;B;D;D;B;D;D;D;D	.|0.76494	.|0.103;0.995;0.999;0.999;0.054;0.999;0.977;0.33;0.987;0.998;0.999;0.999	.|B;D;D;D;B;D;P;B;D;D;D;D	.|0.87578	.|0.082;0.969;0.993;0.993;0.046;0.998;0.551;0.084;0.958;0.995;0.993;0.993	T|T	0.05649|0.05649	-1.0872|-1.0872	5|10	.|0.66056	.|D	.|0.02	-12.0825|-12.0825	15.0624|15.0624	0.71964|0.71964	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|414;429;955;414;428;954;207;955;954;208;955;955	.|B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN	T|P	528|955;955;955;954;955;954;955;954;955;954;954;955;428;429;348;348;414;180	.|ENSP00000430101:S955P;ENSP00000275037:S954P;ENSP00000264839:S955P;ENSP00000429959:S954P;ENSP00000430408:S955P;ENSP00000430502:S954P;ENSP00000430932:S954P;ENSP00000428417:S955P;ENSP00000385649:S428P;ENSP00000428328:S429P;ENSP00000411235:S348P;ENSP00000389503:S348P;ENSP00000428367:S414P;ENSP00000359448:S180P	.|ENSP00000264839:S955P	I|S	+|+	2|1	0|0	RIMS1|RIMS1	73024641|73024641	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.859000|0.859000	0.49053|0.49053	7.823000|7.823000	0.86660|0.86660	1.971000|1.971000	0.57363|0.57363	0.477000|0.477000	0.44152|0.44152	ATC|TCT	.	.		0.463	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
COL12A1	1303	hgsc.bcm.edu	37	6	75843108	75843108	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:75843108T>A	ENST00000322507.8	-	34	6004	c.5695A>T	c.(5695-5697)Att>Ttt	p.I1899F	COL12A1_ENST00000416123.2_Missense_Mutation_p.I1899F|COL12A1_ENST00000483888.2_Missense_Mutation_p.I1899F|COL12A1_ENST00000345356.6_Missense_Mutation_p.I735F	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1899	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TTCCTAAGAATGGCATAATTG	0.373																																					p.I1899F		Atlas-SNP	.											.	COL12A1	385	.	0			c.A5695T						.						115.0	105.0	108.0					6																	75843108		1856	4087	5943	SO:0001583	missense	1303	exon34			TAAGAATGGCATA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5695A>T	chr6.hg19:g.75843108T>A	ENSP00000325146:p.Ile1899Phe	125.0	0.0		145.0	41.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.9|21.9	4.222114|4.222114	0.79464|0.79464	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|T;T;T;T	.|0.58060	.|0.36;0.36;0.36;0.36	5.4|5.4	4.24|4.24	0.50183|0.50183	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.080371	.|0.52532	.|D	.|0.000067	T|T	0.46718|0.46718	0.1407|0.1407	L|L	0.52573|0.52573	1.65|1.65	0.48571|0.48571	D|D	0.999672|0.999672	.|P;D	.|0.60575	.|0.941;0.988	.|P;P	.|0.55455	.|0.571;0.776	T|T	0.53078|0.53078	-0.8489|-0.8489	5|10	.|0.66056	.|D	.|0.02	.|.	8.3231|8.3231	0.32140|0.32140	0.0:0.149:0.0:0.851|0.0:0.149:0.0:0.851	.|.	.|735;1899	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	L|F	633|1899;1899;735;1899;1899	.|ENSP00000325146:I1899F;ENSP00000305147:I735F;ENSP00000412864:I1899F;ENSP00000421216:I1899F	.|ENSP00000325146:I1899F	H|I	-|-	2|1	0|0	COL12A1|COL12A1	75899828|75899828	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	2.645000|2.645000	0.46621|0.46621	2.169000|2.169000	0.68431|0.68431	0.528000|0.528000	0.53228|0.53228	CAT|ATT	.	.		0.373	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
MYO6	4646	hgsc.bcm.edu	37	6	76596595	76596595	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:76596595A>G	ENST00000369977.3	+	25	2681	c.2542A>G	c.(2542-2544)Aaa>Gaa	p.K848E	MYO6_ENST00000369981.3_Missense_Mutation_p.K848E|MYO6_ENST00000369975.1_Missense_Mutation_p.K848E|MYO6_ENST00000369985.4_Missense_Mutation_p.K848E	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	848					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CACACTGAAAAAACGACTTGA	0.323																																					p.K848E		Atlas-SNP	.											.	MYO6	124	.	0			c.A2542G						.						84.0	89.0	88.0					6																	76596595		2203	4300	6503	SO:0001583	missense	4646	exon25			CTGAAAAAACGAC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2542A>G	chr6.hg19:g.76596595A>G	ENSP00000358994:p.Lys848Glu	123.0	0.0		180.0	26.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	hg19	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568264	0.28003	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;T	0.89123	-2.47;-2.47;-2.45;1.99	5.93	4.71	0.59529	.	0.192580	0.53938	D	0.000057	T	0.79209	0.4407	L	0.54323	1.7	0.58432	D	0.999996	B;B	0.18741	0.007;0.03	B;B	0.18871	0.023;0.022	T	0.76152	-0.3064	10	0.26408	T	0.33	.	12.8806	0.58014	0.8644:0.1356:0.0:0.0	.	848;848	Q9UM54-2;Q9UM54-1	.;.	E	848	ENSP00000358998:K848E;ENSP00000359002:K848E;ENSP00000358994:K848E;ENSP00000358992:K848E	ENSP00000358992:K848E	K	+	1	0	MYO6	76653315	1.000000	0.71417	0.991000	0.47740	0.675000	0.39556	6.953000	0.75995	2.258000	0.74832	0.533000	0.62120	AAA	.	.		0.323	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
MYO6	4646	hgsc.bcm.edu	37	6	76599977	76599977	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:76599977G>A	ENST00000369977.3	+	26	3001	c.2862G>A	c.(2860-2862)agG>agA	p.R954R	MYO6_ENST00000369981.3_Silent_p.R954R|MYO6_ENST00000369975.1_Silent_p.R954R|MYO6_ENST00000369985.4_Silent_p.R954R	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	954	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AGGAGGAAAGGCGGATGTGAG	0.353																																					p.R954R		Atlas-SNP	.											.	MYO6	124	.	0			c.G2862A						.						80.0	98.0	92.0					6																	76599977		2201	4299	6500	SO:0001819	synonymous_variant	4646	exon26			GGAAAGGCGGATG	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2862G>A	chr6.hg19:g.76599977G>A		501.0	0.0		601.0	88.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Silent	SNP	ENST00000369977.3	hg19	CCDS34487.1																																																																																			.	.		0.353	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
MYCT1	80177	hgsc.bcm.edu	37	6	153019044	153019044	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr6:153019044A>G	ENST00000367245.5	+	1	15	c.7A>G	c.(7-9)Aca>Gca	p.T3A	MYCT1_ENST00000529453.1_Missense_Mutation_p.T3A	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	3						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		TTTTATGCGAACACAAGTATA	0.328																																					p.T3A		Atlas-SNP	.											.	MYCT1	48	.	0			c.A7G						.						72.0	73.0	73.0					6																	153019044		2203	4297	6500	SO:0001583	missense	80177	exon1			ATGCGAACACAAG	AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.7A>G	chr6.hg19:g.153019044A>G	ENSP00000356214:p.Thr3Ala	146.0	0.0		147.0	23.0	NM_025107	Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	hg19	CCDS5239.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.792706	0.70452	.	.	ENSG00000120279	ENST00000367245;ENST00000529453	T	0.32272	1.46	5.86	5.86	0.93980	.	0.345759	0.21124	N	0.079768	T	0.22627	0.0546	N	0.19112	0.55	0.27966	N	0.936584	D	0.69078	0.997	P	0.60789	0.879	T	0.14839	-1.0458	10	0.87932	D	0	-4.5686	11.0739	0.48019	0.8616:0.0:0.0:0.1384	.	3	Q8N699	MYCT1_HUMAN	A	3	ENSP00000356214:T3A	ENSP00000356214:T3A	T	+	1	0	MYCT1	153060737	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.452000	0.44961	2.244000	0.73946	0.528000	0.53228	ACA	.	.		0.328	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107	
COL28A1	340267	hgsc.bcm.edu	37	7	7571326	7571326	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:7571326T>G	ENST00000399429.3	-	3	474	c.334A>C	c.(334-336)Aag>Cag	p.K112Q		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	112	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TGCAGGTCCTTCCAGGAAGAA	0.428																																					p.K112Q		Atlas-SNP	.											.	COL28A1	113	.	0			c.A334C						.						67.0	64.0	65.0					7																	7571326		1880	4116	5996	SO:0001583	missense	340267	exon3			GGTCCTTCCAGGA	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.334A>C	chr7.hg19:g.7571326T>G	ENSP00000382356:p.Lys112Gln	225.0	0.0		207.0	44.0	NM_001037763	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	hg19	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	T	15.54	2.863256	0.51482	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	D	0.83163	-1.69	4.2	4.2	0.49525	von Willebrand factor, type A (3);	0.167251	0.37955	U	0.001871	T	0.66781	0.2824	N	0.05351	-0.065	0.32474	N	0.5424	B	0.30482	0.281	B	0.31442	0.13	T	0.69397	-0.5156	10	0.20519	T	0.43	-5.9075	13.3961	0.60853	0.0:0.0:0.0:1.0	.	112	Q2UY09	COSA1_HUMAN	Q	112	ENSP00000382356:K112Q	ENSP00000382347:K112Q	K	-	1	0	COL28A1	7537851	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.543000	0.36147	1.911000	0.55334	0.533000	0.62120	AAG	.	.		0.428	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
FAM126A	84668	hgsc.bcm.edu	37	7	22985357	22985357	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:22985357C>T	ENST00000432176.2	-	11	1649	c.1417G>A	c.(1417-1419)Ggg>Agg	p.G473R	FAM126A_ENST00000498833.1_5'Flank|FAM126A_ENST00000409923.1_3'UTR	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	473					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						GTCCCAGCCCCACAACCAACA	0.448																																					p.G473R		Atlas-SNP	.											.	FAM126A	53	.	0			c.G1417A						.						103.0	96.0	98.0					7																	22985357		2203	4299	6502	SO:0001583	missense	84668	exon11			CAGCCCCACAACC	BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.1417G>A	chr7.hg19:g.22985357C>T	ENSP00000403396:p.Gly473Arg	113.0	0.0		111.0	30.0	NM_032581	A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Missense_Mutation	SNP	ENST00000432176.2	hg19	CCDS5377.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559449	0.45590	.	.	ENSG00000122591	ENST00000432176	T	0.75938	-0.98	6.16	6.16	0.99307	.	0.430599	0.26638	N	0.023277	T	0.65228	0.2671	N	0.22421	0.69	0.80722	D	1	P	0.36733	0.567	B	0.38327	0.271	T	0.60172	-0.7315	10	0.15952	T	0.53	0.623	19.848	0.96722	0.0:1.0:0.0:0.0	.	473	Q9BYI3	HYCCI_HUMAN	R	473	ENSP00000403396:G473R	ENSP00000403396:G473R	G	-	1	0	FAM126A	22951882	0.996000	0.38824	0.999000	0.59377	0.995000	0.86356	4.188000	0.58351	2.937000	0.99478	0.650000	0.86243	GGG	.	.		0.448	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250230.1	NM_032581	
HNRNPA2B1	3181	hgsc.bcm.edu	37	7	26232908	26232908	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:26232908A>G	ENST00000354667.4	-	10	1131	c.963T>C	c.(961-963)ttT>ttC	p.F321F	HNRNPA2B1_ENST00000356674.7_Silent_p.F309F|HNRNPA2B1_ENST00000476233.1_5'Flank	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	321	Gly-rich.|Nuclear targeting sequence. {ECO:0000250}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						TGCTACCACCAAAGTTTCCAC	0.348			T	ETV1	prostate																																p.F321F		Atlas-SNP	.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.,2	HNRNPA2B1	70	.	0			c.T963C						.						122.0	118.0	119.0					7																	26232908		2203	4300	6503	SO:0001819	synonymous_variant	3181	exon10			ACCACCAAAGTTT	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.963T>C	chr7.hg19:g.26232908A>G		67.0	0.0		154.0	49.0	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Silent	SNP	ENST00000354667.4	hg19	CCDS43557.1																																																																																			.	.		0.348	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
HOXA3	3200	hgsc.bcm.edu	37	7	27149809	27149809	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:27149809C>T	ENST00000396352.4	-	2	650	c.451G>A	c.(451-453)Gtg>Atg	p.V151M	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank|HOXA3_ENST00000317201.2_Missense_Mutation_p.V151M	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	151					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						TGTTTGGCCACTGTGGGTGAG	0.582																																					p.V151M	Esophageal Squamous(136;1368 1743 5685 7935 50360)	Atlas-SNP	.											.	HOXA3	62	.	0			c.G451A						.						104.0	105.0	104.0					7																	27149809		2203	4300	6503	SO:0001583	missense	3200	exon2			TGGCCACTGTGGG		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.451G>A	chr7.hg19:g.27149809C>T	ENSP00000379640:p.Val151Met	78.0	0.0		116.0	15.0	NM_030661	A4D181	Missense_Mutation	SNP	ENST00000396352.4	hg19	CCDS5404.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682593	0.47991	.	.	ENSG00000105997	ENST00000396352;ENST00000317201	T;T	0.07021	3.23;3.23	5.83	4.84	0.62591	.	0.230990	0.39834	N	0.001247	T	0.02267	0.0070	N	0.00538	-1.39	0.38306	D	0.94311	B	0.15473	0.013	B	0.13407	0.009	T	0.47824	-0.9087	10	0.30854	T	0.27	.	7.7092	0.28667	0.0:0.7623:0.0:0.2377	.	151	O43365	HXA3_HUMAN	M	151	ENSP00000379640:V151M;ENSP00000324884:V151M	ENSP00000324884:V151M	V	-	1	0	HOXA3	27116334	0.985000	0.35326	0.997000	0.53966	0.983000	0.72400	1.364000	0.34171	2.769000	0.95229	0.655000	0.94253	GTG	.	.		0.582	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2		
VPS41	27072	hgsc.bcm.edu	37	7	38783021	38783021	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:38783021T>G	ENST00000310301.4	-	24	2157	c.2103A>C	c.(2101-2103)ttA>ttC	p.L701F	VPS41_ENST00000395969.2_Missense_Mutation_p.L676F	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	701					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CAATGGAATATAAAATCAAAT	0.353																																					p.L701F		Atlas-SNP	.											.	VPS41	102	.	0			c.A2103C						.						138.0	131.0	133.0					7																	38783021		2203	4300	6503	SO:0001583	missense	27072	exon24			GGAATATAAAATC	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.2103A>C	chr7.hg19:g.38783021T>G	ENSP00000309457:p.Leu701Phe	84.0	0.0		162.0	15.0	NM_014396	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	hg19	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019161	0.54576	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000439468	T;T;T	0.19250	2.16;2.16;2.16	5.74	0.7	0.18099	Tetratricopeptide-like helical (1);	0.157757	0.46442	D	0.000297	T	0.16471	0.0396	L	0.29908	0.895	0.44380	D	0.997288	P;P;P	0.39883	0.693;0.693;0.693	B;B;B	0.42282	0.382;0.382;0.382	T	0.03576	-1.1023	10	0.59425	D	0.04	-9.7244	9.8084	0.40808	0.0:0.374:0.0:0.626	.	701;676;701	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	F	701;676;42	ENSP00000309457:L701F;ENSP00000379297:L676F;ENSP00000395410:L42F	ENSP00000309457:L701F	L	-	3	2	VPS41	38749546	0.621000	0.27077	0.998000	0.56505	0.915000	0.54546	-0.215000	0.09279	0.189000	0.20188	-0.263000	0.10527	TTA	.	.		0.353	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3		
SEMA3E	9723	hgsc.bcm.edu	37	7	83037794	83037794	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:83037794A>T	ENST00000307792.3	-	6	1027	c.560T>A	c.(559-561)tTg>tAg	p.L187*	SEMA3E_ENST00000427262.1_Nonsense_Mutation_p.L127*	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	187	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TCCAGCAAACAATTCACTACC	0.423																																					p.L187X		Atlas-SNP	.											.	SEMA3E	125	.	0			c.T560A						.						51.0	47.0	48.0					7																	83037794		2203	4300	6503	SO:0001587	stop_gained	9723	exon6			GCAAACAATTCAC	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.560T>A	chr7.hg19:g.83037794A>T	ENSP00000303212:p.Leu187*	104.0	0.0		125.0	23.0	NM_012431	B4E1P1|Q75M94|Q75M97	Nonsense_Mutation	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.446833	0.84101	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514;ENST00000442159	.	.	.	5.97	5.97	0.96955	.	0.073669	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4383	0.83889	1.0:0.0:0.0:0.0	.	.	.	.	X	187;127;187;127	.	ENSP00000303212:L187X	L	-	2	0	SEMA3E	82875730	1.000000	0.71417	0.856000	0.33681	0.427000	0.31564	8.773000	0.91762	2.287000	0.76781	0.482000	0.46254	TTG	.	.		0.423	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
ASB4	51666	hgsc.bcm.edu	37	7	95125087	95125087	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:95125087T>C	ENST00000325885.5	+	2	276	c.205T>C	c.(205-207)Tat>Cat	p.Y69H	ASB4_ENST00000257621.4_3'UTR|ASB4_ENST00000428113.1_Missense_Mutation_p.Y69H	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	69					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			GTTGCCTAGCTATAAATTGAA	0.408																																					p.Y69H		Atlas-SNP	.											.	ASB4	52	.	0			c.T205C						.						74.0	66.0	69.0					7																	95125087		2203	4300	6503	SO:0001583	missense	51666	exon2			CCTAGCTATAAAT	AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.205T>C	chr7.hg19:g.95125087T>C	ENSP00000321388:p.Tyr69His	109.0	0.0		115.0	19.0	NM_016116	A4D1H6|O14586|Q14D68|Q8TBT2	Missense_Mutation	SNP	ENST00000325885.5	hg19	CCDS5641.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822310	0.71028	.	.	ENSG00000005981	ENST00000325885;ENST00000428113	T;T	0.54675	0.56;0.56	5.35	4.12	0.48240	Ankyrin repeat-containing domain (1);	0.060741	0.64402	D	0.000002	T	0.55465	0.1922	L	0.27053	0.805	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.985	T	0.47649	-0.9101	10	0.19147	T	0.46	-15.2019	12.2489	0.54587	0.0:0.0:0.1417:0.8583	.	69;69	Q9Y574;Q14D68	ASB4_HUMAN;.	H	69	ENSP00000321388:Y69H;ENSP00000397070:Y69H	ENSP00000321388:Y69H	Y	+	1	0	ASB4	94963023	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	5.659000	0.68010	2.165000	0.68154	0.533000	0.62120	TAT	.	.		0.408	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333225.2	NM_016116	
ACTL6B	51412	hgsc.bcm.edu	37	7	100246398	100246398	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:100246398G>A	ENST00000160382.5	-	6	622	c.516C>T	c.(514-516)acC>acT	p.T172T		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	172					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CCGTGGTGTGGGTGGCTCCAC	0.627																																					p.T172T		Atlas-SNP	.											.	ACTL6B	47	.	0			c.C516T						.						73.0	66.0	68.0					7																	100246398		2203	4300	6503	SO:0001819	synonymous_variant	51412	exon6			GGTGTGGGTGGCT	AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.516C>T	chr7.hg19:g.100246398G>A		69.0	0.0		88.0	16.0	NM_016188	A4D2D0|O75421	Silent	SNP	ENST00000160382.5	hg19	CCDS5702.1																																																																																			.	.		0.627	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356745.1	NM_016188	
ORC5	5001	hgsc.bcm.edu	37	7	103801580	103801580	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:103801580T>C	ENST00000297431.4	-	12	1231	c.1089A>G	c.(1087-1089)ttA>ttG	p.L363L	ORC5_ENST00000545943.1_Silent_p.L231L	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	363					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						ATAATATTGCTAATAATCTGT	0.353																																					p.L363L		Atlas-SNP	.											.	ORC5	48	.	0			c.A1089G						.						128.0	132.0	130.0					7																	103801580		2203	4300	6503	SO:0001819	synonymous_variant	5001	exon12			TATTGCTAATAAT		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.1089A>G	chr7.hg19:g.103801580T>C		113.0	0.0		121.0	25.0	NM_002553	A4D0P8|O60590|O95268	Silent	SNP	ENST00000297431.4	hg19	CCDS5734.1																																																																																			.	.		0.353	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553	
CADPS2	93664	hgsc.bcm.edu	37	7	121985695	121985695	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:121985695A>T	ENST00000449022.2	-	28	3564	c.3545T>A	c.(3544-3546)gTt>gAt	p.V1182D	CADPS2_ENST00000334010.7_Missense_Mutation_p.V1180D|RP5-1101C3.1_ENST00000593910.1_RNA|RP5-1101C3.1_ENST00000591140.1_RNA|RP5-1101C3.1_ENST00000602012.1_RNA|CADPS2_ENST00000412584.2_Missense_Mutation_p.V1141D|RP5-1101C3.1_ENST00000482375.1_RNA|CADPS2_ENST00000313070.7_Missense_Mutation_p.V1141D|RP5-1101C3.1_ENST00000602199.1_RNA	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	1182					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						GTTTTGCCGAACAAACATAAT	0.368																																					p.V1186D		Atlas-SNP	.											.	CADPS2	116	.	0			c.T3557A						.						173.0	165.0	167.0					7																	121985695		1819	4080	5899	SO:0001583	missense	93664	exon28			TGCCGAACAAACA		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.3545T>A	chr7.hg19:g.121985695A>T	ENSP00000398481:p.Val1182Asp	63.0	0.0		56.0	11.0	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	hg19	CCDS55158.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	34|34|34	5.308313|5.308313|5.308313	0.95629|0.95629|0.95629	.|.|.	.|.|.	ENSG00000081803|ENSG00000081803|ENSG00000081803	ENST00000397721|ENST00000462699|ENST00000360097;ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	.|.|T;T;T;T	.|.|0.36878	.|.|1.23;1.23;1.23;1.23	6.08|6.08|6.08	6.08|6.08|6.08	0.98989|0.98989|0.98989	.|.|.	.|.|0.073354	.|.|0.56097	.|.|D	.|.|0.000027	.|T|T	.|0.60881|0.60881	.|0.2303|0.2303	M|M|M	0.78637|0.78637|0.78637	2.42|2.42|2.42	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;P;D;D	.|.|0.67145	.|.|0.995;0.942;0.995;0.996	.|.|P;P;P;D	.|.|0.63877	.|.|0.883;0.786;0.883;0.919	.|T|T	.|0.65228|0.65228	.|-0.6219|-0.6219	.|5|10	.|.|0.87932	.|.|D	.|.|0	-20.8227|-20.8227|-20.8227	16.6438|16.6438|16.6438	0.85155|0.85155|0.85155	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|1186;1141;1182;1136	.|.|B7ZM57;Q86UW7-2;Q86UW7;Q86UW7-3	.|.|.;.;CAPS2_HUMAN;.	X|I|D	784|376|355;1141;1180;1187;1108;1141;1182	.|.|ENSP00000325581:V1141D;ENSP00000333940:V1180D;ENSP00000400401:V1141D;ENSP00000398481:V1182D	.|.|ENSP00000325581:V1141D	C|F|V	-|-|-	3|1|2	2|0|0	CADPS2|CADPS2|CADPS2	121772931|121772931|121772931	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.996000|0.996000|0.996000	0.88848|0.88848|0.88848	9.339000|9.339000|9.339000	0.96797|0.96797|0.96797	2.333000|2.333000|2.333000	0.79357|0.79357|0.79357	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TGT|TTC|GTT	.	.		0.368	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
GRM8	2918	hgsc.bcm.edu	37	7	126883030	126883030	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:126883030C>T	ENST00000339582.2	-	2	1037	c.229G>A	c.(229-231)Gag>Aag	p.E77K	GRM8_ENST00000444921.2_Missense_Mutation_p.E77K|GRM8_ENST00000358373.3_Missense_Mutation_p.E77K|GRM8_ENST00000405249.1_Missense_Mutation_p.E77K			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	77					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AGCATGGCCTCCAGTCTGTGA	0.532										HNSCC(24;0.065)																											p.E77K		Atlas-SNP	.											.	GRM8	377	.	0			c.G229A						.						100.0	74.0	83.0					7																	126883030		2203	4300	6503	SO:0001583	missense	2918	exon1			TGGCCTCCAGTCT		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.229G>A	chr7.hg19:g.126883030C>T	ENSP00000344173:p.Glu77Lys	110.0	0.0		89.0	26.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	hg19	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023426	0.93462	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	6.07	6.07	0.98685	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89560	0.6750	M	0.84326	2.69	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.79784	0.987;0.993	D	0.89845	0.4005	10	0.87932	D	0	.	19.6475	0.95784	0.0:1.0:0.0:0.0	.	77;77	O00222-2;O00222	.;GRM8_HUMAN	K	77	ENSP00000344173:E77K;ENSP00000409790:E77K;ENSP00000351142:E77K;ENSP00000385731:E77K;ENSP00000415522:E77K	ENSP00000344173:E77K	E	-	1	0	GRM8	126670266	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	GAG	.	.		0.532	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
MKLN1	4289	hgsc.bcm.edu	37	7	131113817	131113817	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:131113817G>A	ENST00000352689.6	+	9	913	c.873G>A	c.(871-873)tgG>tgA	p.W291*	MKLN1_ENST00000421797.2_Nonsense_Mutation_p.W199*	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	291					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					TTGGTGGCTGGGATGGAACAC	0.403																																					p.W291X		Atlas-SNP	.											.	MKLN1	67	.	0			c.G873A						.						128.0	123.0	125.0					7																	131113817		2203	4300	6503	SO:0001587	stop_gained	4289	exon9			TGGCTGGGATGGA	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.873G>A	chr7.hg19:g.131113817G>A	ENSP00000323527:p.Trp291*	103.0	0.0		104.0	28.0	NM_013255	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Nonsense_Mutation	SNP	ENST00000352689.6	hg19	CCDS34754.1	.	.	.	.	.	.	.	.	.	.	G	38	6.704980	0.97776	.	.	ENSG00000128585	ENST00000421797;ENST00000352689	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.46	19.5352	0.95251	0.0:0.0:1.0:0.0	.	.	.	.	X	199;291	.	ENSP00000323527:W291X	W	+	3	0	MKLN1	130764357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.651000	0.98493	2.850000	0.98022	0.650000	0.86243	TGG	.	.		0.403	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241029	+	Silent	SNP	G	G	C	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr7:131241029G>C	ENST00000378555.3	-	1	337	c.90C>G	c.(88-90)ccC>ccG	p.P30P	PODXL_ENST00000537928.1_Silent_p.P30P|PODXL_ENST00000322985.9_Silent_p.P30P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_Silent_p.P30P			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcg	0.751																																					p.P30P		Atlas-SNP	.											.	PODXL	53	.	0			c.C90G						.						5.0	7.0	6.0					7																	131241029		1981	3946	5927	SO:0001819	synonymous_variant	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.90C>G	chr7.hg19:g.131241029G>C		86.0	0.0		93.0	7.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.751	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
DOCK5	80005	hgsc.bcm.edu	37	8	25154121	25154121	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:25154121A>T	ENST00000276440.7	+	7	607	c.563A>T	c.(562-564)gAg>gTg	p.E188V	DOCK5_ENST00000481100.1_Missense_Mutation_p.E188V	NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	188					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AAGGCCCATGAGGTGGCCTCC	0.488																																					p.E188V	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.A563T						.						78.0	71.0	74.0					8																	25154121		2203	4300	6503	SO:0001583	missense	80005	exon7			CCCATGAGGTGGC		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.563A>T	chr8.hg19:g.25154121A>T	ENSP00000276440:p.Glu188Val	127.0	0.0		83.0	19.0	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	hg19	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	A	12.42	1.931987	0.34096	.	.	ENSG00000147459	ENST00000481100;ENST00000276440	T;T	0.58940	0.3;0.3	5.65	3.2	0.36748	.	0.058524	0.64402	N	0.000002	T	0.50188	0.1601	L	0.49778	1.585	0.58432	D	0.999996	B	0.33826	0.427	B	0.36885	0.235	T	0.34403	-0.9830	10	0.23891	T	0.37	.	11.1039	0.48190	0.7534:0.0:0.0:0.2466	.	188	Q9H7D0	DOCK5_HUMAN	V	188	ENSP00000429737:E188V;ENSP00000276440:E188V	ENSP00000276440:E188V	E	+	2	0	DOCK5	25210038	1.000000	0.71417	0.471000	0.27229	0.370000	0.29829	6.876000	0.75556	0.517000	0.28361	-0.301000	0.09380	GAG	.	.		0.488	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
ADAM18	8749	hgsc.bcm.edu	37	8	39564351	39564351	+	Silent	SNP	A	A	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:39564351A>C	ENST00000265707.5	+	18	1990	c.1945A>C	c.(1945-1947)Aga>Cga	p.R649R	ADAM18_ENST00000541111.1_Silent_p.R63R|ADAM18_ENST00000379866.1_Silent_p.R625R|ADAM18_ENST00000523755.1_3'UTR	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	649	EGF-like.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CCCTGGACATAGACCTCCAGA	0.348																																					p.R649R		Atlas-SNP	.											.	ADAM18	169	.	0			c.A1945C						.						107.0	108.0	108.0					8																	39564351		2203	4299	6502	SO:0001819	synonymous_variant	8749	exon18			GGACATAGACCTC	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1945A>C	chr8.hg19:g.39564351A>C		132.0	0.0		63.0	38.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	ENST00000265707.5	hg19	CCDS6113.1																																																																																			.	.		0.348	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
VCPIP1	80124	hgsc.bcm.edu	37	8	67547274	67547274	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:67547274C>T	ENST00000310421.4	-	3	3389	c.3131G>A	c.(3130-3132)aGa>aAa	p.R1044K		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1044					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TTCCCTAGCTCTTGGATCAAG	0.403																																					p.R1044K	NSCLC(179;265 2915 6144 43644)	Atlas-SNP	.											.	VCPIP1	110	.	0			c.G3131A						.						169.0	165.0	166.0					8																	67547274		2203	4300	6503	SO:0001583	missense	80124	exon3			CTAGCTCTTGGAT	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3131G>A	chr8.hg19:g.67547274C>T	ENSP00000309031:p.Arg1044Lys	88.0	0.0		73.0	20.0	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	hg19	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473504	0.43942	.	.	ENSG00000175073	ENST00000310421	T	0.30714	1.52	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.29716	0.0742	N	0.20986	0.625	0.37482	D	0.916034	P	0.36392	0.551	P	0.44394	0.448	T	0.15292	-1.0442	10	0.45353	T	0.12	-14.1577	13.8168	0.63297	0.0:0.9305:0.0:0.0695	.	1044	Q96JH7	VCIP1_HUMAN	K	1044	ENSP00000309031:R1044K	ENSP00000309031:R1044K	R	-	2	0	VCPIP1	67709828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.882000	0.48546	2.894000	0.99253	0.591000	0.81541	AGA	.	.		0.403	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
TERF1	7013	hgsc.bcm.edu	37	8	73958317	73958317	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:73958317A>G	ENST00000276603.5	+	10	1288	c.1265A>G	c.(1264-1266)gAc>gGc	p.D422G	TERF1_ENST00000276602.6_Missense_Mutation_p.D402G|RP11-531A24.7_ENST00000607665.1_RNA	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	422	HTH myb-type. {ECO:0000255|PROSITE- ProRule:PRU00625}.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			ATGTTAAAAGACAGATGGAGG	0.368																																					p.D422G		Atlas-SNP	.											.	TERF1	48	.	0			c.A1265G						.						56.0	56.0	56.0					8																	73958317		2202	4296	6498	SO:0001583	missense	7013	exon10			TAAAAGACAGATG	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.1265A>G	chr8.hg19:g.73958317A>G	ENSP00000276603:p.Asp422Gly	287.0	0.0		456.0	220.0	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Missense_Mutation	SNP	ENST00000276603.5	hg19	CCDS6211.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337322	0.81911	.	.	ENSG00000147601	ENST00000276603;ENST00000276602	T;T	0.45276	0.9;0.9	5.52	5.52	0.82312	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.73032	0.3535	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81048	-0.1109	10	0.87932	D	0	.	14.6385	0.68706	1.0:0.0:0.0:0.0	.	402;422	P54274-2;P54274	.;TERF1_HUMAN	G	422;402	ENSP00000276603:D422G;ENSP00000276602:D402G	ENSP00000276602:D402G	D	+	2	0	TERF1	74120871	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.093000	0.76937	2.096000	0.63516	0.455000	0.32223	GAC	.	.		0.368	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
NBN	4683	hgsc.bcm.edu	37	8	90996753	90996753	+	Splice_Site	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:90996753C>A	ENST00000265433.3	-	1	191	c.37G>T	c.(37-39)Gga>Tga	p.G13*	NBN_ENST00000409330.1_5'Flank	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	13					blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			CTGCCCTTACCTCCTGCCGGG	0.706								Homologous recombination			OREG0018856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G13X		Atlas-SNP	.											.	NBN	86	.	0			c.G37T						.						20.0	23.0	22.0					8																	90996753		2201	4298	6499	SO:0001630	splice_region_variant	4683	exon1			CCTTACCTCCTGC	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.37+1G>T	chr8.hg19:g.90996753C>A		382.0	0.0	1279	611.0	74.0	NM_002485	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Nonsense_Mutation	SNP	ENST00000265433.3	hg19	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283662	0.80803	.	.	ENSG00000104320	ENST00000265433;ENST00000452387;ENST00000519426	.	.	.	3.72	3.72	0.42706	.	0.119030	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.236	12.6752	0.56891	0.0:1.0:0.0:0.0	.	.	.	.	X	13	.	.	G	-	1	0	NBN	91065929	1.000000	0.71417	0.998000	0.56505	0.105000	0.19272	3.523000	0.53488	2.060000	0.61445	0.460000	0.39030	GGA	.	.		0.706	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688	Nonsense_Mutation
RUNX1T1	862	hgsc.bcm.edu	37	8	93026961	93026961	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:93026961G>A	ENST00000523629.1	-	4	768	c.314C>T	c.(313-315)tCc>tTc	p.S105F	RUNX1T1_ENST00000521553.1_Missense_Mutation_p.S68F|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.S105F|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.S78F|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.S78F|RUNX1T1_ENST00000522163.1_5'Flank|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.S68F|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.S68F|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.S68F|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.S116F	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	105	Poly-Ser.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			AGAGGAGGAGGAAGAAGAGGA	0.547																																					p.S164F		Atlas-SNP	.											.,3	RUNX1T1	516	.	0			c.C491T						.						59.0	61.0	60.0					8																	93026961		2203	4300	6503	SO:0001583	missense	862	exon4			GAGGAGGAAGAAG	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.314C>T	chr8.hg19:g.93026961G>A	ENSP00000428543:p.Ser105Phe	89.0	0.0		123.0	22.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	hg19	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970520	0.92919	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054;ENST00000519847;ENST00000517792;ENST00000522467;ENST00000517919;ENST00000521733;ENST00000520556;ENST00000521319;ENST00000520583;ENST00000523168;ENST00000518823	T;T;T;T;T;T;T;T;T;T;T	0.50548	1.26;1.27;1.26;1.27;1.27;1.27;1.26;1.27;0.79;0.74;1.38	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	L	0.47190	1.495	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.999;0.992;0.999;0.992	P;D;D;D;D	0.68943	0.904;0.961;0.934;0.961;0.945	T	0.63611	-0.6598	10	0.72032	D	0.01	-15.3138	20.6013	0.99457	0.0:0.0:1.0:0.0	.	116;116;78;105;78	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	F	105;78;105;68;68;68;116;78;68;105;68;105;68;105;105;78;68;68;105;105;78	ENSP00000428543:S105F;ENSP00000379520:S78F;ENSP00000265814:S105F;ENSP00000353504:S68F;ENSP00000390137:S68F;ENSP00000428742:S68F;ENSP00000402257:S116F;ENSP00000430728:S78F;ENSP00000429728:S68F;ENSP00000431094:S105F;ENSP00000427763:S68F	ENSP00000265814:S105F	S	-	2	0	RUNX1T1	93096137	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	9.823000	0.99369	2.878000	0.98634	0.650000	0.86243	TCC	.	.		0.547	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
RUNX1T1	862	hgsc.bcm.edu	37	8	93088272	93088272	+	Silent	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:93088272A>T	ENST00000523629.1	-	2	463	c.9T>A	c.(7-9)tcT>tcA	p.S3S	RUNX1T1_ENST00000265814.3_Silent_p.S3S|RUNX1T1_ENST00000518844.1_5'UTR|RUNX1T1_ENST00000522163.1_5'UTR|RUNX1T1_ENST00000520724.1_Intron|RUNX1T1_ENST00000360348.2_Intron|RUNX1T1_ENST00000436581.2_Intron	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	3					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TTCTTTTGACAGATATCATTC	0.393																																					p.S3S		Atlas-SNP	.											.	RUNX1T1	516	.	0			c.T9A						.						200.0	189.0	193.0					8																	93088272		2203	4299	6502	SO:0001819	synonymous_variant	862	exon2			TTTGACAGATATC	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.9T>A	chr8.hg19:g.93088272A>T		43.0	0.0		79.0	9.0	NM_001198628	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	hg19	CCDS6256.1																																																																																			.	.		0.393	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
VPS13B	157680	hgsc.bcm.edu	37	8	100115264	100115264	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:100115264G>T	ENST00000358544.2	+	5	607	c.496G>T	c.(496-498)Gat>Tat	p.D166Y	VPS13B_ENST00000395996.1_Missense_Mutation_p.D166Y|VPS13B_ENST00000357162.2_Missense_Mutation_p.D166Y|VPS13B_ENST00000355155.1_Missense_Mutation_p.D166Y|VPS13B_ENST00000441350.2_Missense_Mutation_p.D166Y	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	166					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGTTGAAGATGATATCGTCCT	0.318																																					p.D166Y	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.G496T						.						132.0	126.0	128.0					8																	100115264		2203	4300	6503	SO:0001583	missense	157680	exon5			GAAGATGATATCG	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.496G>T	chr8.hg19:g.100115264G>T	ENSP00000351346:p.Asp166Tyr	159.0	0.0		254.0	19.0	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212343	0.58452	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	T;T;T;T;D	0.85088	-1.41;-0.74;-0.74;-0.43;-1.94	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	M	0.79693	2.465	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;1.0;1.0;1.0	D	0.93132	0.6534	10	0.87932	D	0	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	166;166;166;166;166	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	Y	166	ENSP00000347281:D166Y;ENSP00000349685:D166Y;ENSP00000351346:D166Y;ENSP00000379318:D166Y;ENSP00000398472:D166Y	ENSP00000347281:D166Y	D	+	1	0	VPS13B	100184440	1.000000	0.71417	1.000000	0.80357	0.055000	0.15305	9.086000	0.94088	2.812000	0.96745	0.557000	0.71058	GAT	.	.		0.318	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
VPS13B	157680	hgsc.bcm.edu	37	8	100874106	100874106	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:100874106G>A	ENST00000358544.2	+	58	11333	c.11222G>A	c.(11221-11223)cGg>cAg	p.R3741Q	VPS13B_ENST00000357162.2_Missense_Mutation_p.R3716Q|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3741					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GAGTGGCGGCGGCAGCTCCCC	0.672																																					p.R3741Q	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.G11222A						.						26.0	21.0	22.0					8																	100874106		2186	4290	6476	SO:0001583	missense	157680	exon58			GGCGGCGGCAGCT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.11222G>A	chr8.hg19:g.100874106G>A	ENSP00000351346:p.Arg3741Gln	79.0	0.0		157.0	30.0	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	37	6.070232	0.97256	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.74106	-0.81;-0.81	5.79	5.79	0.91817	Autophagy-related, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87341	0.6153	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.87576	0.2481	10	0.66056	D	0.02	.	20.04	0.97581	0.0:0.0:1.0:0.0	.	3716;3741	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	Q	3716;3741	ENSP00000349685:R3716Q;ENSP00000351346:R3741Q	ENSP00000349685:R3716Q	R	+	2	0	VPS13B	100943282	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.441000	0.97557	2.733000	0.93635	0.655000	0.94253	CGG	.	.		0.672	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
SLC25A32	81034	hgsc.bcm.edu	37	8	104415433	104415433	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:104415433C>G	ENST00000297578.4	-	4	677	c.511G>C	c.(511-513)Gtg>Ctg	p.V171L	SLC25A32_ENST00000523701.1_5'Flank|SLC25A32_ENST00000543107.1_Missense_Mutation_p.V39L	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	171					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	TATATTTTCACAAGTGTATCA	0.318																																					p.V171L		Atlas-SNP	.											.	SLC25A32	36	.	0			c.G511C						.						76.0	74.0	75.0					8																	104415433		2203	4300	6503	SO:0001583	missense	81034	exon4			TTTTCACAAGTGT	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.511G>C	chr8.hg19:g.104415433C>G	ENSP00000297578:p.Val171Leu	85.0	0.0		152.0	14.0	NM_030780	Q96JZ6|Q96SU7	Missense_Mutation	SNP	ENST00000297578.4	hg19	CCDS6300.1	.	.	.	.	.	.	.	.	.	.	C	7.623	0.677227	0.14841	.	.	ENSG00000164933	ENST00000297578;ENST00000424899;ENST00000543107	T;T	0.77877	-1.13;-1.13	5.91	-0.32	0.12721	Mitochondrial carrier domain (2);	0.493212	0.23065	N	0.052331	T	0.57036	0.2026	L	0.37630	1.12	0.29827	N	0.83038	B	0.06786	0.001	B	0.10450	0.005	T	0.33007	-0.9885	10	0.14656	T	0.56	-18.6451	0.8017	0.01076	0.2255:0.3303:0.22:0.2242	.	171	Q9H2D1	MFTC_HUMAN	L	171;155;39	ENSP00000297578:V171L;ENSP00000443497:V39L	ENSP00000297578:V171L	V	-	1	0	SLC25A32	104484609	0.140000	0.22579	0.943000	0.38184	0.998000	0.95712	-0.312000	0.08113	-0.372000	0.07992	0.579000	0.79373	GTG	.	.		0.318	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780	
ANGPT1	284	hgsc.bcm.edu	37	8	108296966	108296966	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:108296966G>C	ENST00000520734.1	-	6	834	c.549C>G	c.(547-549)aaC>aaG	p.N183K	ANGPT1_ENST00000518386.1_Intron|ANGPT1_ENST00000520052.1_Missense_Mutation_p.N182K			Q15389	ANGP1_HUMAN	angiopoietin 1	383					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			AATAGGCTCGGTTCCCTTCCC	0.423																																					p.N383K		Atlas-SNP	.											.	ANGPT1	111	.	0			c.C1149G						.						151.0	128.0	136.0					8																	108296966		2203	4300	6503	SO:0001583	missense	284	exon7			GGCTCGGTTCCCT	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.549C>G	chr8.hg19:g.108296966G>C	ENSP00000430750:p.Asn183Lys	136.0	0.0		177.0	9.0	NM_001146	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	hg19		.	.	.	.	.	.	.	.	.	.	G	20.7	4.038845	0.75617	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520734;ENST00000520052	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.73	5.73	0.89815	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.081401	0.85682	D	0.000000	T	0.41119	0.1145	M	0.62266	1.93	0.50039	D	0.999843	B;D;D	0.55800	0.031;0.973;0.973	B;P;P	0.56563	0.041;0.801;0.801	T	0.15435	-1.0437	10	0.12103	T	0.63	.	10.3271	0.43801	0.1456:0.0:0.8544:0.0	.	182;383;383	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	K	383;382;183;182	ENSP00000428340:N383K;ENSP00000297450:N382K;ENSP00000430750:N183K;ENSP00000429349:N182K	ENSP00000297450:N382K	N	-	3	2	ANGPT1	108366142	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	3.127000	0.50484	2.709000	0.92574	0.650000	0.86243	AAC	.	.		0.423	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
EBAG9	9166	hgsc.bcm.edu	37	8	110567069	110567069	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr8:110567069C>A	ENST00000337573.5	+	4	574	c.274C>A	c.(274-276)Cct>Act	p.P92T	EBAG9_ENST00000529502.1_3'UTR|EBAG9_ENST00000531677.1_Missense_Mutation_p.P92T|EBAG9_ENST00000395785.2_Missense_Mutation_p.P92T	NM_001278938.1|NM_004215.3	NP_001265867.1|NP_004206.1	O00559	RCAS1_HUMAN	estrogen receptor binding site associated, antigen, 9	92					regulation of cell growth (GO:0001558)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	peptidase activator activity involved in apoptotic process (GO:0016505)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)	10			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			ACAACTGGAACCTGACTATTT	0.383																																					p.P92T		Atlas-SNP	.											.	EBAG9	23	.	0			c.C274A						.						139.0	126.0	130.0					8																	110567069		2203	4300	6503	SO:0001583	missense	9166	exon4			CTGGAACCTGACT	AB007619	CCDS6313.1	8q23	2013-03-07			ENSG00000147654	ENSG00000147654			3123	protein-coding gene	gene with protein product		605772					Standard	NM_004215		Approved	EB9, RCAS1	uc003ynf.3	O00559	OTTHUMG00000165346	ENST00000337573.5:c.274C>A	chr8.hg19:g.110567069C>A	ENSP00000337675:p.Pro92Thr	117.0	0.0		178.0	52.0	NM_004215	A8K3N6|Q5Y8C7|Q6IB20|Q9BS76	Missense_Mutation	SNP	ENST00000337573.5	hg19	CCDS6313.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197479	0.58126	.	.	ENSG00000147654	ENST00000395785;ENST00000337573;ENST00000530629;ENST00000531677	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	M	0.66939	2.045	0.80722	D	1	P	0.41848	0.763	B	0.37144	0.242	T	0.58885	-0.7557	9	0.33141	T	0.24	0.0769	18.5664	0.91118	0.0:1.0:0.0:0.0	.	92	O00559	RCAS1_HUMAN	T	92	.	ENSP00000337675:P92T	P	+	1	0	EBAG9	110636245	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.711000	0.92665	0.655000	0.94253	CCT	.	.		0.383	EBAG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383536.1	NM_004215	
RLN1	6013	hgsc.bcm.edu	37	9	5335511	5335511	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr9:5335511C>T	ENST00000223862.1	-	2	424	c.298G>A	c.(298-300)Gca>Aca	p.A100T	RLN1_ENST00000487557.2_5'UTR|RLN1_ENST00000223858.4_3'UTR	NM_006911.2	NP_008842.1	P04808	REL1_HUMAN	relaxin 1	100					female pregnancy (GO:0007565)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			large_intestine(1)|lung(4)	5	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.02)|Lung(218;0.0984)		GATAGGGCTGCCTTCAGCTCC	0.363																																					p.A100T		Atlas-SNP	.											.	RLN1	16	.	0			c.G298A						.						96.0	92.0	94.0					9																	5335511		2203	4300	6503	SO:0001583	missense	6013	exon2			GGGCTGCCTTCAG		CCDS6462.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107018	ENSG00000107018		"""Endogenous ligands"""	10026	protein-coding gene	gene with protein product	"""prorelaxin H1"""	179730	"""relaxin 1 (H1)"""				Standard	NM_006911		Approved	H1	uc003zjb.2	P04808	OTTHUMG00000019495	ENST00000223862.1:c.298G>A	chr9.hg19:g.5335511C>T	ENSP00000223862:p.Ala100Thr	72.0	0.0		82.0	6.0	NM_006911	Q99936|Q9UQJ1	Missense_Mutation	SNP	ENST00000223862.1	hg19	CCDS6462.1	.	.	.	.	.	.	.	.	.	.	C	7.757	0.704617	0.15172	.	.	ENSG00000107018	ENST00000223862	T	0.18502	2.21	2.46	0.258	0.15578	Insulin-like (3);	1.137210	0.06920	N	0.809100	T	0.16685	0.0401	L	0.51914	1.62	0.09310	N	1	P	0.41313	0.745	B	0.41202	0.35	T	0.25293	-1.0136	10	0.41790	T	0.15	.	4.4997	0.11858	0.0:0.6094:0.0:0.3906	.	100	P04808	REL1_HUMAN	T	100	ENSP00000223862:A100T	ENSP00000223862:A100T	A	-	1	0	RLN1	5325511	0.000000	0.05858	0.001000	0.08648	0.223000	0.24884	-0.800000	0.04555	0.083000	0.17047	0.388000	0.25769	GCA	.	.		0.363	RLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051617.1		
KIAA2026	158358	hgsc.bcm.edu	37	9	5920853	5920853	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr9:5920853T>C	ENST00000399933.3	-	8	5142	c.5143A>G	c.(5143-5145)Aca>Gca	p.T1715A	KIAA2026_ENST00000381461.2_Missense_Mutation_p.T1685A	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1715										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		AGGTGTCCTGTTTTCACAGTT	0.388																																					p.T1715A		Atlas-SNP	.											.	KIAA2026	231	.	0			c.A5143G						.						120.0	117.0	118.0					9																	5920853		1924	4133	6057	SO:0001583	missense	158358	exon8			GTCCTGTTTTCAC	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5143A>G	chr9.hg19:g.5920853T>C	ENSP00000382815:p.Thr1715Ala	111.0	0.0		97.0	10.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	hg19		.	.	.	.	.	.	.	.	.	.	T	16.43	3.122139	0.56613	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000003	T	0.67822	0.2934	L	0.36672	1.1	0.36443	D	0.865639	D	0.89917	1.0	D	0.83275	0.996	T	0.73697	-0.3901	9	0.51188	T	0.08	-15.3411	15.7326	0.77817	0.0:0.0:0.0:1.0	.	1715	Q5HYC2	K2026_HUMAN	A	1715;1685	.	ENSP00000370870:T1685A	T	-	1	0	KIAA2026	5910853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.733000	0.47360	2.302000	0.77476	0.477000	0.44152	ACA	.	.		0.388	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
TRPM6	140803	hgsc.bcm.edu	37	9	77386661	77386661	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr9:77386661A>G	ENST00000360774.1	-	25	3731	c.3494T>C	c.(3493-3495)gTg>gCg	p.V1165A	TRPM6_ENST00000449912.2_Missense_Mutation_p.V1160A|TRPM6_ENST00000451710.3_Missense_Mutation_p.V1165A|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.V1165A|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.V1160A	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1165					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ACTACAATTCACATCTTCCAT	0.373																																					p.V1165A		Atlas-SNP	.											.	TRPM6	377	.	0			c.T3494C						.						133.0	116.0	122.0					9																	77386661		2203	4300	6503	SO:0001583	missense	140803	exon25			CAATTCACATCTT	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3494T>C	chr9.hg19:g.77386661A>G	ENSP00000354006:p.Val1165Ala	55.0	0.0		25.0	16.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	hg19	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	A	6.646	0.487650	0.12641	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72	5.37	4.2	0.49525	.	0.573276	0.18118	N	0.151144	T	0.08133	0.0203	N	0.08118	0	0.19300	N	0.999977	B;B;B	0.10296	0.001;0.003;0.002	B;B;B	0.09377	0.002;0.004;0.004	T	0.27673	-1.0067	10	0.72032	D	0.01	.	11.4845	0.50346	0.8652:0.0:0.0:0.1348	.	1165;1160;1160	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	A	1165;1165;1160;1160;1165;828;828	ENSP00000354006:V1165A;ENSP00000407341:V1165A;ENSP00000396672:V1160A;ENSP00000354962:V1160A;ENSP00000366060:V1165A	ENSP00000309693:V828A	V	-	2	0	TRPM6	76576481	0.422000	0.25473	0.021000	0.16686	0.014000	0.08584	3.172000	0.50832	0.837000	0.34925	0.533000	0.62120	GTG	.	.		0.373	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
TEX10	54881	hgsc.bcm.edu	37	9	103092453	103092453	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr9:103092453T>C	ENST00000374902.4	-	6	1427		c.e6-2		TEX10_ENST00000535814.1_Splice_Site|TEX10_ENST00000537512.1_Splice_Site	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TGCTTGATGCTAGAAACAAAG	0.353																																					.		Atlas-SNP	.											.	TEX10	99	.	0			c.1260-2A>G						.						123.0	120.0	121.0					9																	103092453		2203	4300	6503	SO:0001630	splice_region_variant	54881	exon7			TGATGCTAGAAAC	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1251-2A>G	chr9.hg19:g.103092453T>C		76.0	0.0		37.0	15.0	NM_001161584	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Splice_Site	SNP	ENST00000374902.4	hg19	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016117	0.75161	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730;ENST00000429235;ENST00000537512	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3466	0.74343	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEX10	102132274	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.110000	0.71535	2.084000	0.62774	0.533000	0.62120	.	.	.		0.353	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	Intron
GOLGA1	2800	hgsc.bcm.edu	37	9	127685404	127685404	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr9:127685404C>A	ENST00000373555.4	-	8	864	c.531G>T	c.(529-531)caG>caT	p.Q177H		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	177					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						GTTCCTGCTGCTGGAACCCCT	0.353																																					p.Q177H		Atlas-SNP	.											.	GOLGA1	60	.	0			c.G531T						.						168.0	151.0	157.0					9																	127685404		2203	4300	6503	SO:0001583	missense	2800	exon8			CTGCTGCTGGAAC	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.531G>T	chr9.hg19:g.127685404C>A	ENSP00000362656:p.Gln177His	34.0	0.0		20.0	9.0	NM_002077	Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	hg19	CCDS6860.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922615	0.73213	.	.	ENSG00000136935	ENST00000373555	T	0.11063	2.81	5.42	4.53	0.55603	.	0.000000	0.42172	U	0.000752	T	0.30417	0.0764	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.993	T	0.01998	-1.1232	10	0.37606	T	0.19	-15.5209	11.5035	0.50451	0.0:0.8494:0.0:0.1506	.	76;177	Q59HA1;Q92805	.;GOGA1_HUMAN	H	177	ENSP00000362656:Q177H	ENSP00000362656:Q177H	Q	-	3	2	GOLGA1	126725225	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.124000	0.42006	1.294000	0.44707	0.591000	0.81541	CAG	.	.		0.353	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077	
ADARB2	105	hgsc.bcm.edu	37	10	1313165	1313165	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:1313165T>C	ENST00000381312.1	-	4	1502	c.1177A>G	c.(1177-1179)Atc>Gtc	p.I393V		NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	393					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GTCATGACGATTCCTGCCAGC	0.537																																					p.I393V		Atlas-SNP	.											.	ADARB2	95	.	0			c.A1177G						.						94.0	78.0	83.0					10																	1313165		2203	4300	6503	SO:0001583	missense	105	exon4			TGACGATTCCTGC	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1177A>G	chr10.hg19:g.1313165T>C	ENSP00000370713:p.Ile393Val	67.0	0.0		75.0	18.0	NM_018702	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	hg19	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	T	9.321	1.058168	0.19987	.	.	ENSG00000185736	ENST00000381312	T	0.27720	1.65	5.42	5.42	0.78866	Adenosine deaminase/editase (1);	0.000000	0.85682	D	0.000000	T	0.37625	0.1010	L	0.57536	1.79	0.80722	D	1	B	0.31581	0.329	B	0.40702	0.338	T	0.12502	-1.0545	10	0.19147	T	0.46	-41.0978	15.4603	0.75349	0.0:0.0:0.0:1.0	.	393	Q9NS39	RED2_HUMAN	V	393	ENSP00000370713:I393V	ENSP00000370713:I393V	I	-	1	0	ADARB2	1303165	1.000000	0.71417	0.998000	0.56505	0.511000	0.34104	4.357000	0.59436	2.056000	0.61249	0.402000	0.26972	ATC	.	.		0.537	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
ASB13	79754	hgsc.bcm.edu	37	10	5683744	5683744	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:5683744T>C	ENST00000357700.6	-	5	724	c.698A>G	c.(697-699)gAg>gGg	p.E233G	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	233	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		TTCGTAGTACTCGAAGCACTT	0.637																																					p.E233G		Atlas-SNP	.											.	ASB13	26	.	0			c.A698G						.						67.0	65.0	66.0					10																	5683744		2203	4300	6503	SO:0001583	missense	79754	exon5			TAGTACTCGAAGC	AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.698A>G	chr10.hg19:g.5683744T>C	ENSP00000350331:p.Glu233Gly	60.0	0.0		83.0	16.0	NM_024701	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Missense_Mutation	SNP	ENST00000357700.6	hg19	CCDS7070.1	.	.	.	.	.	.	.	.	.	.	T	9.893	1.204639	0.22205	.	.	ENSG00000196372	ENST00000357700	T	0.68624	-0.34	5.7	5.7	0.88788	.	0.046293	0.85682	D	0.000000	T	0.61413	0.2345	L	0.58354	1.805	0.47276	D	0.999379	P	0.42296	0.775	B	0.38225	0.268	T	0.60321	-0.7286	10	0.15952	T	0.53	-17.5525	15.6263	0.76859	0.0:0.0:0.0:1.0	.	233	Q8WXK3	ASB13_HUMAN	G	233	ENSP00000350331:E233G	ENSP00000350331:E233G	E	-	2	0	ASB13	5723750	1.000000	0.71417	0.997000	0.53966	0.174000	0.22865	4.644000	0.61397	2.175000	0.68902	0.383000	0.25322	GAG	.	.		0.637	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
ITGA8	8516	hgsc.bcm.edu	37	10	15573079	15573079	+	Silent	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:15573079C>T	ENST00000378076.3	-	28	3305	c.2952G>A	c.(2950-2952)caG>caA	p.Q984Q		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	984					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GTTTTGCTGGCTGATCTGTAT	0.313																																					p.Q984Q		Atlas-SNP	.											.	ITGA8	230	.	0			c.G2952A						.						100.0	100.0	100.0					10																	15573079		2203	4300	6503	SO:0001819	synonymous_variant	8516	exon28			TGCTGGCTGATCT	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2952G>A	chr10.hg19:g.15573079C>T		200.0	0.0		188.0	31.0	NM_003638	B0YJ31|Q5VX94	Silent	SNP	ENST00000378076.3	hg19	CCDS31155.1																																																																																			.	.		0.313	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
GAD2	2572	hgsc.bcm.edu	37	10	26513476	26513476	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:26513476A>T	ENST00000376261.3	+	6	1123	c.620A>T	c.(619-621)tAt>tTt	p.Y207F	GAD2_ENST00000376248.1_Missense_Mutation_p.Y93F|GAD2_ENST00000259271.3_Missense_Mutation_p.Y207F	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	207					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AGGTTCACCTATGAAATTGCT	0.363																																					p.Y207F		Atlas-SNP	.											.	GAD2	116	.	0			c.A620T						.						128.0	126.0	127.0					10																	26513476		2203	4300	6503	SO:0001583	missense	2572	exon6			TCACCTATGAAAT	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.620A>T	chr10.hg19:g.26513476A>T	ENSP00000365437:p.Tyr207Phe	115.0	0.0		146.0	29.0	NM_000818	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	hg19	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	A	19.93	3.917241	0.73098	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000376248	T;T;T	0.38722	1.12;1.12;1.12	5.21	5.21	0.72293	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.122019	0.56097	D	0.000021	T	0.41581	0.1165	L	0.48260	1.515	0.80722	D	1	B	0.19200	0.034	B	0.28709	0.093	T	0.31724	-0.9933	10	0.52906	T	0.07	-13.4372	15.1137	0.72380	1.0:0.0:0.0:0.0	.	207	Q05329	DCE2_HUMAN	F	207;207;93	ENSP00000365437:Y207F;ENSP00000259271:Y207F;ENSP00000365424:Y93F	ENSP00000259271:Y207F	Y	+	2	0	GAD2	26553482	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	1.981000	0.57761	0.533000	0.62120	TAT	.	.		0.363	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
CCDC6	8030	hgsc.bcm.edu	37	10	61566806	61566806	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:61566806T>A	ENST00000263102.6	-	6	1109	c.878A>T	c.(877-879)gAg>gTg	p.E293V		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	293						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GTGACGTTCCTCCTCCAGATA	0.443			T	RET	NSCLC																																p.E293V		Atlas-SNP	.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	CCDC6	44	.	0			c.A878T						.						120.0	103.0	109.0					10																	61566806		2203	4300	6503	SO:0001583	missense	8030	exon6			CGTTCCTCCTCCA	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.878A>T	chr10.hg19:g.61566806T>A	ENSP00000263102:p.Glu293Val	64.0	0.0		66.0	16.0	NM_005436	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	hg19	CCDS7257.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.920907	0.92249	.	.	ENSG00000108091	ENST00000263102	D	0.92965	-3.14	5.37	5.37	0.77165	.	0.104877	0.64402	D	0.000002	D	0.95300	0.8475	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.95723	0.8768	10	0.72032	D	0.01	-16.4066	15.4364	0.75149	0.0:0.0:0.0:1.0	.	293	Q16204	CCDC6_HUMAN	V	293	ENSP00000263102:E293V	ENSP00000263102:E293V	E	-	2	0	CCDC6	61236812	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.037000	0.88933	2.070000	0.61991	0.378000	0.23410	GAG	.	.		0.443	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
CYP17A1	1586	hgsc.bcm.edu	37	10	104595084	104595084	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:104595084C>T	ENST00000369887.3	-	2	534	c.363G>A	c.(361-363)tgG>tgA	p.W121*	CYP17A1-AS1_ENST00000369884.4_RNA|CYP17A1_ENST00000489268.1_5'UTR	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	121					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	GATGCAGCTGCCAGTGTGCGC	0.577											OREG0020487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W121X		Atlas-SNP	.											.	CYP17A1	48	.	0			c.G363A						.						138.0	111.0	120.0					10																	104595084		2203	4300	6503	SO:0001587	stop_gained	1586	exon2			CAGCTGCCAGTGT	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.363G>A	chr10.hg19:g.104595084C>T	ENSP00000358903:p.Trp121*	55.0	0.0	172	74.0	28.0	NM_000102	Q5TZV7	Nonsense_Mutation	SNP	ENST00000369887.3	hg19	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	C	32	5.131922	0.94473	.	.	ENSG00000148795	ENST00000369887	.	.	.	5.8	5.8	0.92144	.	0.116551	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6542	0.95830	0.0:1.0:0.0:0.0	.	.	.	.	X	121	.	ENSP00000358903:W121X	W	-	3	0	CYP17A1	104585074	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	7.148000	0.77389	2.747000	0.94245	0.462000	0.41574	TGG	.	.		0.577	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102	
PDCD11	22984	hgsc.bcm.edu	37	10	105165833	105165833	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:105165833A>T	ENST00000369797.3	+	6	750	c.656A>T	c.(655-657)aAa>aTa	p.K219I		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	219	S1 motif 2. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCACTGCTGAAAGCCCAGGAG	0.507																																					p.K219I		Atlas-SNP	.											.	PDCD11	160	.	0			c.A656T						.						131.0	124.0	126.0					10																	105165833		2203	4300	6503	SO:0001583	missense	22984	exon6			TGCTGAAAGCCCA	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.656A>T	chr10.hg19:g.105165833A>T	ENSP00000358812:p.Lys219Ile	113.0	0.0		129.0	28.0	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	hg19	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391044	0.82902	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.17854	2.25	5.41	5.41	0.78517	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.242700	0.48767	D	0.000171	T	0.49592	0.1566	M	0.88377	2.95	0.58432	D	0.999999	P	0.47910	0.902	D	0.72075	0.976	T	0.57189	-0.7854	10	0.72032	D	0.01	-16.79	15.1042	0.72306	1.0:0.0:0.0:0.0	.	219	Q14690	RRP5_HUMAN	I	219	ENSP00000358812:K219I	ENSP00000358812:K219I	K	+	2	0	PDCD11	105155823	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	4.548000	0.60718	2.055000	0.61198	0.459000	0.35465	AAA	.	.		0.507	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
NRAP	4892	hgsc.bcm.edu	37	10	115372164	115372164	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:115372164G>A	ENST00000359988.3	-	30	3571	c.3327C>T	c.(3325-3327)caC>caT	p.H1109H	NRAP_ENST00000360478.3_Silent_p.H1074H|NRAP_ENST00000369360.3_Silent_p.H1082H|NRAP_ENST00000369358.4_Silent_p.H1117H	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCGCCTTTGAGTGTTCAAAGC	0.527																																					p.H1109H		Atlas-SNP	.											.	NRAP	208	.	0			c.C3327T						.						89.0	77.0	81.0					10																	115372164		2203	4300	6503	SO:0001819	synonymous_variant	4892	exon30			CTTTGAGTGTTCA		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3327C>T	chr10.hg19:g.115372164G>A		98.0	0.0		114.0	26.0	NM_001261463		Silent	SNP	ENST00000359988.3	hg19	CCDS7579.1																																																																																			.	.		0.527	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
DMBT1	1755	hgsc.bcm.edu	37	10	124358530	124358530	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr10:124358530A>G	ENST00000338354.3	+	26	3303	c.3197A>G	c.(3196-3198)gAg>gGg	p.E1066G	DMBT1_ENST00000368956.2_Missense_Mutation_p.E567G|DMBT1_ENST00000368909.3_Missense_Mutation_p.E1066G|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000344338.3_Missense_Mutation_p.E1056G|DMBT1_ENST00000330163.4_Missense_Mutation_p.E567G|DMBT1_ENST00000368955.3_Missense_Mutation_p.E1056G			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1066	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCAGGACACGAGTCTTACCTG	0.592																																					p.E1066G	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	0			c.A3197G						.						117.0	115.0	115.0					10																	124358530		1964	4142	6106	SO:0001583	missense	1755	exon26			GACACGAGTCTTA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3197A>G	chr10.hg19:g.124358530A>G	ENSP00000342210:p.Glu1066Gly	100.0	0.0		100.0	24.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	hg19		.	.	.	.	.	.	.	.	.	.	A	20.6	4.025532	0.75390	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	3.57	3.57	0.40892	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.35407	U	0.003235	D	0.84665	0.5522	H	0.97186	3.955	0.80722	D	1	D;D;D;D;D	0.89917	0.989;0.999;1.0;1.0;1.0	P;D;D;D;D	0.97110	0.898;0.956;0.999;0.999;1.0	D	0.89023	0.3436	10	0.87932	D	0	.	12.5079	0.55991	1.0:0.0:0.0:0.0	.	573;1066;567;1056;1066	Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	G	1066;1066;1066;1066;1066;1066;567;1056;567;567;1066;1056;567	ENSP00000342210:E1066G;ENSP00000343175:E1056G;ENSP00000327747:E567G;ENSP00000357905:E1066G;ENSP00000357951:E1056G;ENSP00000357952:E567G	ENSP00000331522:E567G	E	+	2	0	DMBT1	124348520	1.000000	0.71417	0.520000	0.27837	0.108000	0.19459	5.663000	0.68038	1.402000	0.46780	0.456000	0.33151	GAG	.	.		0.592	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
MUC5B	727897	hgsc.bcm.edu	37	11	1271184	1271184	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:1271184G>A	ENST00000529681.1	+	31	13132	c.13074G>A	c.(13072-13074)gaG>gaA	p.E4358E	MUC5B_ENST00000447027.1_Silent_p.E4361E|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4358	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACTCCGGAGACCACCCACA	0.662																																					p.E4358E		Atlas-SNP	.											.	MUC5B	473	.	0			c.G13074A						.						83.0	107.0	99.0					11																	1271184		2137	4228	6365	SO:0001819	synonymous_variant	727897	exon31			TCCGGAGACCACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13074G>A	chr11.hg19:g.1271184G>A		129.0	0.0		70.0	21.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SOX6	55553	hgsc.bcm.edu	37	11	16077382	16077382	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:16077382T>C	ENST00000352083.6	-	10	1244	c.1167A>G	c.(1165-1167)ccA>ccG	p.P389P	SOX6_ENST00000528429.1_Silent_p.P389P|SOX6_ENST00000528252.1_Silent_p.P348P|SOX6_ENST00000316399.6_Silent_p.P389P|SOX6_ENST00000527619.1_Silent_p.P351P|SOX6_ENST00000396356.3_Silent_p.P389P			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	389					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TTGGTGGCTGTGGAGTTGATG	0.502																																					p.P402P		Atlas-SNP	.											.	SOX6	149	.	0			c.A1206G						.						178.0	145.0	156.0					11																	16077382		2200	4294	6494	SO:0001819	synonymous_variant	55553	exon10			TGGCTGTGGAGTT	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1167A>G	chr11.hg19:g.16077382T>C		68.0	0.0		29.0	14.0	NM_001145819	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Silent	SNP	ENST00000352083.6	hg19																																																																																				.	.		0.502	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	
OR5T2	219464	hgsc.bcm.edu	37	11	55999752	55999752	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:55999752T>A	ENST00000313264.4	-	1	985	c.910A>T	c.(910-912)Agc>Tgc	p.S304C		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					GAAGCATAGCTGGAACTTGGT	0.418																																					p.S304C		Atlas-SNP	.											.	OR5T2	107	.	0			c.A910T						.						198.0	174.0	182.0					11																	55999752		2201	4296	6497	SO:0001583	missense	219464	exon1			CATAGCTGGAACT	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.910A>T	chr11.hg19:g.55999752T>A	ENSP00000323688:p.Ser304Cys	112.0	0.0		99.0	21.0	NM_001004746	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	hg19	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.383347	0.42207	.	.	ENSG00000181718	ENST00000313264	T	0.00179	8.61	5.07	3.86	0.44501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	U	0.000124	T	0.00580	0.0019	M	0.90870	3.155	0.09310	N	1	D	0.76494	0.999	D	0.76071	0.987	T	0.32587	-0.9901	10	0.87932	D	0	.	4.9638	0.14080	0.1634:0.0876:0.0:0.7491	.	304	Q8NGG2	OR5T2_HUMAN	C	304	ENSP00000323688:S304C	ENSP00000323688:S304C	S	-	1	0	OR5T2	55756328	0.000000	0.05858	0.507000	0.27676	0.608000	0.37181	0.730000	0.26043	2.041000	0.60428	0.391000	0.25812	AGC	.	.		0.418	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
OR8K1	390157	hgsc.bcm.edu	37	11	56114330	56114330	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:56114330T>C	ENST00000279783.2	+	1	910	c.816T>C	c.(814-816)caT>caC	p.H272H		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					AGTCCAGTCATACTTTGGCTA	0.408										HNSCC(65;0.19)																											p.H272H		Atlas-SNP	.											.	OR8K1	93	.	0			c.T816C						.						121.0	110.0	114.0					11																	56114330		2201	4296	6497	SO:0001819	synonymous_variant	390157	exon1			CAGTCATACTTTG	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.816T>C	chr11.hg19:g.56114330T>C		101.0	0.0		81.0	16.0	NM_001002907	B9EJB1|Q6IFC3|Q96RC1	Silent	SNP	ENST00000279783.2	hg19	CCDS31528.1																																																																																			.	.		0.408	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907	
OR8U1	219417	hgsc.bcm.edu	37	11	56143186	56143186	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:56143186G>A	ENST00000302270.1	+	1	87	c.87G>A	c.(85-87)gtG>gtA	p.V29V		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CCCTCTTTGTGCTATTCTTAT	0.458																																					p.V29V		Atlas-SNP	.											.	OR8U1	59	.	0			c.G87A						.						227.0	201.0	209.0					11																	56143186		1914	4131	6045	SO:0001819	synonymous_variant	219417	exon1			CTTTGTGCTATTC	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.87G>A	chr11.hg19:g.56143186G>A		67.0	0.0		74.0	12.0	NM_001005204		Silent	SNP	ENST00000302270.1	hg19	CCDS41647.1																																																																																			.	.		0.458	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
OR9Q1	219956	hgsc.bcm.edu	37	11	57946997	57946997	+	Silent	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:57946997C>T	ENST00000335397.3	+	3	397	c.81C>T	c.(79-81)ctC>ctT	p.L27L		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				CACTCCCTCTCTTCCTCTTGT	0.453																																					p.L27L		Atlas-SNP	.											.	OR9Q1	60	.	0			c.C81T						.						223.0	208.0	213.0					11																	57946997		2201	4296	6497	SO:0001819	synonymous_variant	219956	exon3			CCCTCTCTTCCTC	AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.81C>T	chr11.hg19:g.57946997C>T		97.0	0.0		65.0	7.0	NM_001005212	Q2TAN3|Q96RA7	Silent	SNP	ENST00000335397.3	hg19	CCDS31543.1																																																																																			.	.		0.453	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394538.2	NM_001005212	
CABP4	57010	hgsc.bcm.edu	37	11	67222916	67222916	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:67222916G>A	ENST00000325656.5	+	1	99	c.22G>A	c.(22-24)Ggg>Agg	p.G8R	CABP4_ENST00000438189.2_Intron|GPR152_ENST00000312457.2_5'Flank|CABP4_ENST00000542025.2_3'UTR	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	8					photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GCAGGCAAGGGGGCAGCAGGG	0.612																																					p.G8R		Atlas-SNP	.											.	CABP4	33	.	0			c.G22A						.						16.0	19.0	18.0					11																	67222916		2162	4220	6382	SO:0001583	missense	57010	exon1			GCAAGGGGGCAGC	AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.22G>A	chr11.hg19:g.67222916G>A	ENSP00000324960:p.Gly8Arg	67.0	0.0		48.0	6.0	NM_145200	Q8N4Z2|Q8WWY5	Missense_Mutation	SNP	ENST00000325656.5	hg19	CCDS8166.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945722	0.34377	.	.	ENSG00000175544	ENST00000325656	T	0.74947	-0.89	3.51	1.55	0.23275	.	3.634860	0.00848	N	0.001816	T	0.62744	0.2453	L	0.29908	0.895	0.09310	N	1	B	0.29378	0.243	B	0.21360	0.034	T	0.53927	-0.8369	10	0.66056	D	0.02	.	5.0608	0.14557	0.2862:0.0:0.7138:0.0	.	8	P57796	CABP4_HUMAN	R	8	ENSP00000324960:G8R	ENSP00000324960:G8R	G	+	1	0	CABP4	66979492	0.009000	0.17119	0.002000	0.10522	0.147000	0.21601	0.878000	0.28126	0.600000	0.29862	0.491000	0.48974	GGG	.	.		0.612	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397624.2		
WNT11	7481	hgsc.bcm.edu	37	11	75905679	75905679	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:75905679T>A	ENST00000322563.3	-	3	653	c.529A>T	c.(529-531)Aag>Tag	p.K177*	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	177					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						TTTTTCACCTTCATAGGAGCA	0.582																																					p.K177X		Atlas-SNP	.											.	WNT11	44	.	0			c.A529T						.						62.0	53.0	56.0					11																	75905679		1719	3226	4945	SO:0001587	stop_gained	7481	exon3			TCACCTTCATAGG	Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.529A>T	chr11.hg19:g.75905679T>A	ENSP00000325526:p.Lys177*	94.0	0.0		94.0	24.0	NM_004626	B2R8Z6|Q14DE8|Q8WZ98	Nonsense_Mutation	SNP	ENST00000322563.3	hg19	CCDS8242.1	.	.	.	.	.	.	.	.	.	.	T	37	6.204161	0.97376	.	.	ENSG00000085741	ENST00000322563;ENST00000531317;ENST00000447195	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	14.1498	0.65375	0.0:0.0:0.0:1.0	.	.	.	.	X	177	.	ENSP00000325526:K177X	K	-	1	0	WNT11	75583327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.283000	0.72646	1.939000	0.56221	0.454000	0.30748	AAG	.	.		0.582	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626	
FDXACB1	91893	hgsc.bcm.edu	37	11	111742145	111742145	+	IGR	SNP	C	C	G	rs10708475|rs200786242		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:111742145C>G	ENST00000260257.4	-	0	2789				ALG9_ENST00000398006.2_5'Flank|ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000524880.1_Missense_Mutation_p.R254P|ALG9_ENST00000531154.1_5'Flank|ALG9_ENST00000527377.1_5'UTR	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1						phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						GCAGCCGGGGCGCGTATCCCC	0.711																																					p.A21P		Atlas-SNP	.											.	ALG9	77	.	0			c.G61C						.						1.0	1.0	1.0					11																	111742145		776	1973	2749	SO:0001628	intergenic_variant	79796	exon2			CCGGGGCGCGTAT		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795		chr11.hg19:g.111742145C>G		667.0	0.0		625.0	39.0	NM_001077690	A0PJW7|B4DUU2	Missense_Mutation	SNP	ENST00000260257.4	hg19	CCDS44729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.83|11.83	1.756102|1.756102	0.31137|0.31137	.|.	.|.	ENSG00000086848|ENSG00000086848	ENST00000428306|ENST00000428306	.|.	.|.	.|.	4.98|4.98	0.976|0.976	0.19727|0.19727	.|.	.|.	.|.	.|.	.|.	.|T	.|0.17831	.|0.0428	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	0.99999|0.99999	.|B;B	.|0.21147	.|0.0;0.052	.|B;B	.|0.16722	.|0.0;0.016	.|T	.|0.23940	.|-1.0174	.|8	.|0.26408	.|T	.|0.33	.|.	4.2702|4.2702	0.10783|0.10783	0.1565:0.5847:0.0:0.2588|0.1565:0.5847:0.0:0.2588	.|.	.|21;21	.|Q9H6U8-3;Q9H6U8	.|.;ALG9_HUMAN	.|P	-1|254	.|.	.|ENSP00000387627:A254P	.|A	-|-	.|1	.|0	ALG9|ALG9	111247355|111247355	0.130000|0.130000	0.22417|0.22417	0.101000|0.101000	0.21167|0.21167	0.687000|0.687000	0.40016|0.40016	0.758000|0.758000	0.26447|0.26447	0.032000|0.032000	0.15435|0.15435	-0.291000|-0.291000	0.09656|0.09656	.|GCC	.	.		0.711	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378	
PCSK7	9159	hgsc.bcm.edu	37	11	117100406	117100406	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:117100406G>A	ENST00000320934.3	-	3	785	c.155C>T	c.(154-156)cCg>cTg	p.P52L		NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	52				P -> A (in Ref. 1; AAC50417 and 3; AAB03087). {ECO:0000305}.	peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		AGCCCAGCTCGGCCCCCCTGT	0.652			T	IGH@	MLCLS																																p.P52L		Atlas-SNP	.		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	PCSK7,NS,carcinoma,0,1	PCSK7	59	.	0			c.C155T						.						32.0	35.0	34.0					11																	117100406		2201	4296	6497	SO:0001583	missense	9159	exon3			CAGCTCGGCCCCC	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.155C>T	chr11.hg19:g.117100406G>A	ENSP00000325917:p.Pro52Leu	114.0	1.0		110.0	22.0	NM_004716	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	ENST00000320934.3	hg19	CCDS8382.1	.	.	.	.	.	.	.	.	.	.	G	0.034	-1.315806	0.01331	.	.	ENSG00000160613	ENST00000320934;ENST00000543900;ENST00000525027;ENST00000524507;ENST00000532301;ENST00000530269	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	4.21	3.09	0.35607	Proteinase inhibitor, propeptide (1);	0.408692	0.22742	N	0.056198	T	0.13157	0.0319	N	0.00621	-1.32	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25710	-1.0124	10	0.02654	T	1	-2.276	7.9365	0.29933	0.8973:0.0:0.1027:0.0	.	52	Q16549	PCSK7_HUMAN	L	52	ENSP00000325917:P52L;ENSP00000431181:P52L;ENSP00000433841:P52L;ENSP00000436459:P52L;ENSP00000433252:P52L	ENSP00000325917:P52L	P	-	2	0	PCSK7	116605616	0.973000	0.33851	0.663000	0.29738	0.590000	0.36582	3.090000	0.50191	0.676000	0.31285	-0.379000	0.06801	CCG	.	.		0.652	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716	
OR6M1	390261	hgsc.bcm.edu	37	11	123676433	123676433	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:123676433C>A	ENST00000309154.2	-	1	662	c.625G>T	c.(625-627)Gca>Tca	p.A209S		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GTAGTGAATGCCAGGGAGCTC	0.488																																					p.A209S		Atlas-SNP	.											.	OR6M1	60	.	0			c.G625T						.						66.0	60.0	62.0					11																	123676433		2202	4299	6501	SO:0001583	missense	390261	exon1			TGAATGCCAGGGA	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.625G>T	chr11.hg19:g.123676433C>A	ENSP00000311038:p.Ala209Ser	87.0	0.0		66.0	7.0	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	hg19	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	C	0.777	-0.763838	0.02996	.	.	ENSG00000196099	ENST00000309154	T	0.37411	1.2	3.48	2.53	0.30540	GPCR, rhodopsin-like superfamily (1);	0.538685	0.13838	U	0.359236	T	0.17916	0.0430	N	0.05574	-0.02	0.09310	N	0.999999	B	0.15473	0.013	B	0.14023	0.01	T	0.17018	-1.0383	10	0.56958	D	0.05	.	5.8927	0.18921	0.2218:0.5623:0.216:0.0	.	209	Q8NGM8	OR6M1_HUMAN	S	209	ENSP00000311038:A209S	ENSP00000311038:A209S	A	-	1	0	OR6M1	123181643	0.000000	0.05858	0.243000	0.24186	0.008000	0.06430	-3.352000	0.00501	0.597000	0.29811	0.655000	0.94253	GCA	.	.		0.488	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
OR8G5	219865	hgsc.bcm.edu	37	11	124135129	124135129	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:124135129T>C	ENST00000524943.2	+	1	407	c.407T>C	c.(406-408)cTc>cCc	p.L136P	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		ATGACTCAGCTCTACTTCTTC	0.473																																					p.L136P	Ovarian(169;523 1969 8640 31295 51256)	Atlas-SNP	.											.	.	.	.	0			c.T407C						.						164.0	150.0	155.0					11																	124135129		2149	4278	6427	SO:0001583	missense	219865	exon1			CTCAGCTCTACTT	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.407T>C	chr11.hg19:g.124135129T>C	ENSP00000477014:p.Leu136Pro	55.0	0.0		58.0	11.0	NM_001005198	B2RND3|Q6IEU6	Missense_Mutation	SNP	ENST00000524943.2	hg19																																																																																				.	.		0.473	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
PKP2	5318	hgsc.bcm.edu	37	12	33030888	33030888	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr12:33030888G>A	ENST00000070846.6	-	3	950	c.926C>T	c.(925-927)gCc>gTc	p.A309V	PKP2_ENST00000340811.4_Missense_Mutation_p.A309V	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	309					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GGAATCCACGGCGACACTGGG	0.642																																					p.A309V		Atlas-SNP	.											.	PKP2	110	.	0			c.C926T						.						51.0	48.0	49.0					12																	33030888		2203	4300	6503	SO:0001583	missense	5318	exon3			TCCACGGCGACAC	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.926C>T	chr12.hg19:g.33030888G>A	ENSP00000070846:p.Ala309Val	48.0	0.0		33.0	9.0	NM_004572	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	hg19	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	G	9.787	1.176755	0.21704	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.80824	-1.42;-1.35	4.51	3.54	0.40534	.	436.916000	0.00166	N	0.000000	T	0.74741	0.3756	L	0.29908	0.895	0.09310	N	1	B;B;B	0.28713	0.161;0.1;0.22	B;B;B	0.24394	0.053;0.024;0.024	T	0.60403	-0.7270	10	0.34782	T	0.22	-8.9753	13.3223	0.60440	0.0:0.2136:0.7864:0.0	.	309;309;309	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	V	309	ENSP00000342800:A309V;ENSP00000070846:A309V	ENSP00000070846:A309V	A	-	2	0	PKP2	32922155	0.007000	0.16637	0.003000	0.11579	0.312000	0.27988	1.522000	0.35921	2.246000	0.74042	0.555000	0.69702	GCC	.	.		0.642	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
KIF21A	55605	hgsc.bcm.edu	37	12	39756972	39756972	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr12:39756972T>A	ENST00000361418.5	-	7	962	c.947A>T	c.(946-948)aAg>aTg	p.K316M	KIF21A_ENST00000361961.3_Missense_Mutation_p.K316M|KIF21A_ENST00000544797.2_Missense_Mutation_p.K316M|KIF21A_ENST00000541463.2_Missense_Mutation_p.K316M|KIF21A_ENST00000395670.3_Missense_Mutation_p.K316M			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	316	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TGTGGCCCTCTTGCTCTTGTC	0.393																																					p.K316M		Atlas-SNP	.											.	KIF21A	238	.	0			c.A947T						.						153.0	150.0	151.0					12																	39756972		2203	4300	6503	SO:0001583	missense	55605	exon7			GCCCTCTTGCTCT	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.947A>T	chr12.hg19:g.39756972T>A	ENSP00000354878:p.Lys316Met	64.0	0.0		80.0	16.0	NM_001173463	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	hg19	CCDS53776.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635456	0.87760	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463;ENST00000552908	T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	4.98	4.98	0.66077	Kinesin, motor domain (3);	0.000000	0.53938	D	0.000043	D	0.87720	0.6248	M	0.79614	2.46	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;0.997;1.0;0.998	D;D;D;D;D	0.97110	0.982;0.998;0.963;1.0;0.97	D	0.89465	0.3739	10	0.87932	D	0	.	14.7019	0.69162	0.0:0.0:0.0:1.0	.	316;316;316;316;316	F5H219;B9EGE4;F5H0C3;Q7Z4S6;Q7Z4S6-2	.;.;.;KI21A_HUMAN;.	M	316;316;316;316;316;316;139	ENSP00000354851:K316M;ENSP00000379029:K316M;ENSP00000445606:K316M;ENSP00000354878:K316M;ENSP00000438075:K316M;ENSP00000449700:K139M	ENSP00000344501:K316M	K	-	2	0	KIF21A	38043239	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.023000	0.70848	1.880000	0.54463	0.460000	0.39030	AAG	.	.		0.393	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
PPM1H	57460	hgsc.bcm.edu	37	12	63328293	63328293	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr12:63328293G>C	ENST00000228705.6	-	1	524	c.224C>G	c.(223-225)cCc>cGc	p.P75R	Y_RNA_ENST00000516851.1_RNA	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	75							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		AGTGGCCCAGGGCAGCCGCCG	0.701																																					p.P75R		Atlas-SNP	.											.	PPM1H	42	.	0			c.C224G						.						4.0	7.0	6.0					12																	63328293		1886	3945	5831	SO:0001583	missense	57460	exon1			GCCCAGGGCAGCC	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.224C>G	chr12.hg19:g.63328293G>C	ENSP00000228705:p.Pro75Arg	109.0	0.0		81.0	20.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	hg19	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773831	0.90108	.	.	ENSG00000111110	ENST00000228705	T	0.55588	0.51	3.75	3.75	0.43078	Protein phosphatase 2C-like (3);	0.000000	0.85682	D	0.000000	T	0.73598	0.3607	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.78516	-0.2174	9	.	.	.	2.9353	14.2944	0.66302	0.0:0.0:1.0:0.0	.	75	Q9ULR3	PPM1H_HUMAN	R	75	ENSP00000228705:P75R	.	P	-	2	0	PPM1H	61614560	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.219000	0.65262	1.929000	0.55896	0.561000	0.74099	CCC	.	.		0.701	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
UTP20	27340	hgsc.bcm.edu	37	12	101764273	101764273	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr12:101764273C>G	ENST00000261637.4	+	50	6793	c.6619C>G	c.(6619-6621)Cta>Gta	p.L2207V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2207					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GCTCCAAGTTCTACTGGCCTA	0.433																																					p.L2207V		Atlas-SNP	.											.	UTP20	222	.	0			c.C6619G						.						190.0	175.0	180.0					12																	101764273		2203	4300	6503	SO:0001583	missense	27340	exon50			CAAGTTCTACTGG	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6619C>G	chr12.hg19:g.101764273C>G	ENSP00000261637:p.Leu2207Val	73.0	0.0		87.0	11.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	hg19	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722875	0.68959	.	.	ENSG00000120800	ENST00000261637	T	0.75260	-0.92	5.94	4.12	0.48240	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86058	0.5842	M	0.90309	3.105	0.54753	D	0.999981	D	0.89917	1.0	D	0.91635	0.999	D	0.85623	0.1265	10	0.40728	T	0.16	-12.9508	8.1483	0.31126	0.0:0.7111:0.0:0.2889	.	2207	O75691	UTP20_HUMAN	V	2207	ENSP00000261637:L2207V	ENSP00000261637:L2207V	L	+	1	2	UTP20	100288404	1.000000	0.71417	0.793000	0.32043	0.988000	0.76386	3.443000	0.52907	1.524000	0.49035	-0.259000	0.10710	CTA	.	.		0.433	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
NOS1	4842	hgsc.bcm.edu	37	12	117768235	117768235	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr12:117768235T>C	ENST00000338101.4	-	1	644	c.640A>G	c.(640-642)Agc>Ggc	p.S214G	NOS1_ENST00000317775.6_Missense_Mutation_p.S214G|NOS1_ENST00000549189.1_5'Flank|NOS1_ENST00000344089.3_Missense_Mutation_p.S214G			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GTGAGAAGGCTCAGCACAGGC	0.592																																					p.S214G	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.A640G						.						128.0	136.0	134.0					12																	117768235		2055	4205	6260	SO:0001583	missense	4842	exon2			GAAGGCTCAGCAC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.640A>G	chr12.hg19:g.117768235T>C	ENSP00000337459:p.Ser214Gly	41.0	0.0		64.0	11.0	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	hg19	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.453947	0.26161	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000344089;ENST00000338101	T;T;T	0.05717	4.97;3.4;4.97	4.65	2.26	0.28386	.	0.777994	0.13174	N	0.408005	T	0.04227	0.0117	L	0.29908	0.895	0.26070	N	0.981237	B	0.02656	0.0	B	0.01281	0.0	T	0.46275	-0.9203	10	0.17369	T	0.5	-4.2879	4.1645	0.10300	0.0:0.227:0.1776:0.5954	.	214	P29475	NOS1_HUMAN	G	214	ENSP00000320758:S214G;ENSP00000339862:S214G;ENSP00000337459:S214G	ENSP00000320758:S214G	S	-	1	0	NOS1	116252618	0.998000	0.40836	0.519000	0.27824	0.867000	0.49689	2.930000	0.48924	0.296000	0.22592	0.397000	0.26171	AGC	.	.		0.592	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
MAB21L1	4081	hgsc.bcm.edu	37	13	36049724	36049724	+	Silent	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr13:36049724A>T	ENST00000379919.4	-	1	1108	c.552T>A	c.(550-552)gcT>gcA	p.A184A	NBEA_ENST00000310336.4_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000400445.3_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	184					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GCCAGTGGGCAGCACTCCTCG	0.602																																					p.A184A		Atlas-SNP	.											.	MAB21L1	52	.	0			c.T552A						.						48.0	54.0	52.0					13																	36049724		2203	4300	6503	SO:0001819	synonymous_variant	4081	exon1			GTGGGCAGCACTC	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.552T>A	chr13.hg19:g.36049724A>T		68.0	0.0		48.0	11.0	NM_005584	Q6I9T5	Silent	SNP	ENST00000379919.4	hg19	CCDS9353.1																																																																																			.	.		0.602	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
DCLK1	9201	hgsc.bcm.edu	37	13	36385016	36385016	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr13:36385016A>G	ENST00000360631.3	-	12	1855	c.1644T>C	c.(1642-1644)tgT>tgC	p.C548C	DCLK1_ENST00000379893.1_Silent_p.C241C|DCLK1_ENST00000255448.4_Silent_p.C548C			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	548	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TTGGGGTGCCACAGACTGTGT	0.488																																					p.C548C		Atlas-SNP	.											.	DCLK1	350	.	0			c.T1644C						.						173.0	168.0	170.0					13																	36385016		2203	4300	6503	SO:0001819	synonymous_variant	9201	exon12			GGTGCCACAGACT	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1644T>C	chr13.hg19:g.36385016A>G		81.0	0.0		67.0	15.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	hg19																																																																																				.	.		0.488	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
ZC3H13	23091	hgsc.bcm.edu	37	13	46542149	46542149	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr13:46542149T>A	ENST00000242848.4	-	15	4159	c.3811A>T	c.(3811-3813)Aga>Tga	p.R1271*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R1271*|ZC3H13_ENST00000378921.2_Nonsense_Mutation_p.R227*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1271	Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CTATGGCTTCTTGAATCCTGG	0.363																																					p.R1271X	Esophageal Squamous(187;747 2077 11056 31291 44172)	Atlas-SNP	.											.	ZC3H13	197	.	0			c.A3811T						.						101.0	102.0	102.0					13																	46542149		2203	4300	6503	SO:0001587	stop_gained	23091	exon15			GGCTTCTTGAATC	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3811A>T	chr13.hg19:g.46542149T>A	ENSP00000242848:p.Arg1271*	74.0	0.0		56.0	12.0	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	ENST00000242848.4	hg19		.	.	.	.	.	.	.	.	.	.	T	46	12.469775	0.99670	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	.	.	.	5.36	4.15	0.48705	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5356	0.56140	0.0:0.0:0.1395:0.8605	.	.	.	.	X	1271;227;1271	.	ENSP00000242848:R1271X	R	-	1	2	ZC3H13	45440150	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.711000	0.61881	0.944000	0.37579	0.482000	0.46254	AGA	.	.		0.363	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
SAMD4A	23034	hgsc.bcm.edu	37	14	55215638	55215638	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr14:55215638C>G	ENST00000554335.1	+	5	1748	c.1085C>G	c.(1084-1086)gCg>gGg	p.A362G	SAMD4A_ENST00000357634.3_Missense_Mutation_p.A361G|SAMD4A_ENST00000251091.5_Missense_Mutation_p.A274G|SAMD4A_ENST00000392067.3_Missense_Mutation_p.A362G			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	362	SAM.				negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						CAGCTGGAGGCGCAGGTATGT	0.582																																					p.A362G		Atlas-SNP	.											SAMD4A,colon,carcinoma,0,2	SAMD4A	68	.	0			c.C1085G						.						51.0	45.0	47.0					14																	55215638		2160	4227	6387	SO:0001583	missense	23034	exon4			TGGAGGCGCAGGT	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1085C>G	chr14.hg19:g.55215638C>G	ENSP00000452535:p.Ala362Gly	82.0	0.0		65.0	26.0	NM_015589	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	hg19	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233508	0.79688	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634	T;T;T	0.50813	0.73;0.73;0.73	5.32	5.32	0.75619	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	M	0.64170	1.965	0.58432	D	0.99999	P;D	0.63046	0.564;0.992	B;P	0.60117	0.343;0.869	T	0.61402	-0.7070	10	0.41790	T	0.15	-8.0339	19.1782	0.93612	0.0:1.0:0.0:0.0	.	274;362	Q9UPU9-3;Q9UPU9	.;SMAG1_HUMAN	G	362;362;274;273;361	ENSP00000452535:A362G;ENSP00000375919:A362G;ENSP00000350261:A361G	ENSP00000306381:A274G	A	+	2	0	SAMD4A	54285388	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.477000	0.66799	2.769000	0.95229	0.563000	0.77884	GCG	.	.		0.582	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
NUMB	8650	hgsc.bcm.edu	37	14	73750978	73750978	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr14:73750978C>A	ENST00000355058.3	-	10	1038	c.760G>T	c.(760-762)Gag>Tag	p.E254*	NUMB_ENST00000554521.2_Intron|NUMB_ENST00000544991.3_Intron|NUMB_ENST00000559312.1_Intron|NUMB_ENST00000556772.1_Nonsense_Mutation_p.E110*|NUMB_ENST00000359560.3_Nonsense_Mutation_p.E243*|NUMB_ENST00000557597.1_Nonsense_Mutation_p.E243*|NUMB_ENST00000356296.4_Nonsense_Mutation_p.E254*|NUMB_ENST00000454166.4_Intron|NUMB_ENST00000560335.1_Intron|NUMB_ENST00000555394.1_Nonsense_Mutation_p.E254*|NUMB_ENST00000554546.1_Nonsense_Mutation_p.E243*|NUMB_ENST00000555738.2_Intron|NUMB_ENST00000555238.1_Nonsense_Mutation_p.E254*|NUMB_ENST00000535282.1_Nonsense_Mutation_p.E243*			P49757	NUMB_HUMAN	numb homolog (Drosophila)	254					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		TTGTTCATCTCCAGAGAGGTC	0.532																																					p.E254X		Atlas-SNP	.											.	NUMB	56	.	0			c.G760T						.						174.0	165.0	168.0					14																	73750978		2203	4300	6503	SO:0001587	stop_gained	8650	exon10			TCATCTCCAGAGA	L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.760G>T	chr14.hg19:g.73750978C>A	ENSP00000347169:p.Glu254*	159.0	0.0		114.0	53.0	NM_001005744	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Nonsense_Mutation	SNP	ENST00000355058.3	hg19	CCDS32116.1	.	.	.	.	.	.	.	.	.	.	C	37	6.238345	0.97403	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000535282;ENST00000326018;ENST00000555859;ENST00000555307;ENST00000554394	.	.	.	5.39	5.39	0.77823	.	0.173814	0.52532	D	0.000075	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-15.7781	19.34	0.94337	0.0:1.0:0.0:0.0	.	.	.	.	X	243;254;243;254;110;254;243;254;243;218;218;254;254	.	ENSP00000315193:E218X	E	-	1	0	NUMB	72820731	1.000000	0.71417	0.998000	0.56505	0.701000	0.40568	7.427000	0.80284	2.808000	0.96608	0.655000	0.94253	GAG	.	.		0.532	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
ASB2	51676	hgsc.bcm.edu	37	14	94423206	94423206	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr14:94423206G>A	ENST00000315988.4	-	1	561	c.73C>T	c.(73-75)Cct>Tct	p.P25S	ASB2_ENST00000555019.1_Missense_Mutation_p.P73S|ASB2_ENST00000556337.1_Intron	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	25					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CTCTCAGGAGGTGCAGTGGAC	0.577																																					p.P73S		Atlas-SNP	.											.	ASB2	71	.	0			c.C217T						.						93.0	94.0	94.0					14																	94423206		2203	4300	6503	SO:0001583	missense	51676	exon3			CAGGAGGTGCAGT	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.73C>T	chr14.hg19:g.94423206G>A	ENSP00000320675:p.Pro25Ser	112.0	0.0		93.0	15.0	NM_001202429	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	hg19	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	G	0.304	-0.971776	0.02215	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988	T;T	0.67171	-0.25;-0.2	5.42	-0.271	0.12922	.	0.640402	0.14988	N	0.286861	T	0.45994	0.1370	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.25328	-1.0135	10	0.40728	T	0.16	-1.2658	4.6335	0.12513	0.2251:0.0:0.5221:0.2528	.	73;25	B4E166;Q96Q27	.;ASB2_HUMAN	S	73;41;25	ENSP00000451575:P73S;ENSP00000320675:P25S	ENSP00000320675:P25S	P	-	1	0	ASB2	93492959	0.063000	0.20901	0.001000	0.08648	0.005000	0.04900	0.591000	0.23969	-0.042000	0.13535	-0.136000	0.14681	CCT	.	.		0.577	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
C15orf53	400359	hgsc.bcm.edu	37	15	38990484	38990484	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:38990484A>C	ENST00000318792.1	+	2	288	c.278A>C	c.(277-279)cAt>cCt	p.H93P		NM_207444.2	NP_997327.1	Q8NAA6	CO053_HUMAN	chromosome 15 open reading frame 53	93										endometrium(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	6		all_cancers(109;1.75e-13)|all_epithelial(112;1.02e-11)|Lung NSC(122;1.9e-09)|all_lung(180;4.04e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;8.39e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0321)		GCTCCAGCTCATGTCTTCAGA	0.502																																					p.H93P		Atlas-SNP	.											.	C15orf53	12	.	0			c.A278C						.						74.0	70.0	72.0					15																	38990484		2200	4297	6497	SO:0001583	missense	400359	exon2			CAGCTCATGTCTT		CCDS10048.1	15q14	2007-11-21			ENSG00000175779	ENSG00000175779			33796	protein-coding gene	gene with protein product							Standard	NM_207444		Approved	FLJ35695	uc001zkf.1	Q8NAA6	OTTHUMG00000129841	ENST00000318792.1:c.278A>C	chr15.hg19:g.38990484A>C	ENSP00000325144:p.His93Pro	110.0	0.0		83.0	19.0	NM_207444		Missense_Mutation	SNP	ENST00000318792.1	hg19	CCDS10048.1	.	.	.	.	.	.	.	.	.	.	A	8.015	0.758371	0.15846	.	.	ENSG00000175779	ENST00000318792	T	0.37411	1.2	3.29	-1.98	0.07480	.	.	.	.	.	T	0.14270	0.0345	N	0.08118	0	0.09310	N	1	P	0.39862	0.692	B	0.37304	0.246	T	0.13229	-1.0517	9	0.87932	D	0	.	0.3085	0.00284	0.3512:0.2002:0.2536:0.195	.	93	Q8NAA6	CO053_HUMAN	P	93	ENSP00000325144:H93P	ENSP00000325144:H93P	H	+	2	0	C15orf53	36777776	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.001000	0.12947	-0.405000	0.07599	0.402000	0.26972	CAT	.	.		0.502	C15orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252081.1	NM_207444	
SPTBN5	51332	hgsc.bcm.edu	37	15	42150939	42150939	+	Missense_Mutation	SNP	G	G	A	rs372953121		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:42150939G>A	ENST00000320955.6	-	49	8314	c.8087C>T	c.(8086-8088)gCg>gTg	p.A2696V		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2696					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCTCAGCCACGCAGCCACCTG	0.622																																					p.A2661V		Atlas-SNP	.											.	SPTBN5	171	.	0			c.C7982T						.	G	VAL/ALA	0,4256		0,0,2128	22.0	25.0	24.0		7982	-5.9	0.0	15		24	1,8451		0,1,4225	no	missense	SPTBN5	NM_016642.2	64	0,1,6353	AA,AG,GG		0.0118,0.0,0.0079	benign	2661/3640	42150939	1,12707	2128	4226	6354	SO:0001583	missense	51332	exon49			AGCCACGCAGCCA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.8087C>T	chr15.hg19:g.42150939G>A	ENSP00000317790:p.Ala2696Val	58.0	0.0		65.0	15.0	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	hg19		.	.	.	.	.	.	.	.	.	.	.	12.33	1.904967	0.33628	0.0	1.18E-4	ENSG00000137877	ENST00000320955	T	0.52983	0.64	4.7	-5.87	0.02297	.	2.128150	0.02461	N	0.086613	T	0.40862	0.1134	L	0.41961	1.31	0.09310	N	1	B	0.26120	0.142	B	0.21546	0.035	T	0.36407	-0.9749	10	0.42905	T	0.14	.	13.5294	0.61613	0.5079:0.0:0.4921:0.0	.	2696	Q9NRC6	SPTN5_HUMAN	V	2696	ENSP00000317790:A2696V	ENSP00000317790:A2696V	A	-	2	0	SPTBN5	39938231	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.570000	0.23653	-1.279000	0.02405	-1.232000	0.01568	GCG	.	.		0.622	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
DMXL2	23312	hgsc.bcm.edu	37	15	51772972	51772972	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:51772972C>G	ENST00000251076.5	-	24	6618	c.6331G>C	c.(6331-6333)Gat>Cat	p.D2111H	DMXL2_ENST00000449909.3_Missense_Mutation_p.D1475H|DMXL2_ENST00000543779.2_Missense_Mutation_p.D2111H|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2111						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TCTTCCTGATCCAGCAGATCA	0.393																																					p.D2111H		Atlas-SNP	.											DMXL2,bladder,carcinoma,0,1	DMXL2	262	.	0			c.G6331C						.						119.0	114.0	116.0					15																	51772972		2196	4293	6489	SO:0001583	missense	23312	exon24			CCTGATCCAGCAG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.6331G>C	chr15.hg19:g.51772972C>G	ENSP00000251076:p.Asp2111His	101.0	1.0		164.0	13.0	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	hg19	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.499195	0.26861	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.78816	-1.21;-1.21;-1.21	5.77	2.91	0.33838	.	0.334765	0.38837	N	0.001541	T	0.71736	0.3375	N	0.22421	0.69	0.46927	D	0.999256	B;D;P;B	0.60160	0.432;0.987;0.498;0.025	B;P;B;B	0.53809	0.368;0.735;0.259;0.022	T	0.68887	-0.5290	10	0.45353	T	0.12	.	9.4269	0.38586	0.0:0.7519:0.1187:0.1294	.	2111;1475;2111;2111	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	H	2111;2111;1475	ENSP00000251076:D2111H;ENSP00000441858:D2111H;ENSP00000400855:D1475H	ENSP00000251076:D2111H	D	-	1	0	DMXL2	49560264	0.998000	0.40836	0.730000	0.30809	0.218000	0.24690	3.582000	0.53921	0.382000	0.24878	-0.123000	0.14984	GAT	.	.		0.393	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
PSTPIP1	9051	hgsc.bcm.edu	37	15	77320208	77320208	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:77320208G>T	ENST00000558012.1	+	6	859	c.370G>T	c.(370-372)Gac>Tac	p.D124Y	PSTPIP1_ENST00000379595.3_Missense_Mutation_p.D124Y|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.D123Y|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.D124Y	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	124					cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GGCCGTCATGGACCGGGTCCA	0.672																																					p.D124Y		Atlas-SNP	.											.	PSTPIP1	50	.	0			c.G370T						.						22.0	26.0	25.0					15																	77320208		1996	4144	6140	SO:0001583	missense	9051	exon6			GTCATGGACCGGG	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.370G>T	chr15.hg19:g.77320208G>T	ENSP00000452746:p.Asp124Tyr	282.0	0.0		352.0	121.0	NM_003978	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	hg19	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.264821	0.80358	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.42900	0.96;2.56	4.2	4.2	0.49525	Prismane-like (1);	0.116695	0.64402	D	0.000018	T	0.62780	0.2456	M	0.78456	2.415	0.51233	D	0.999917	D;P;D;D	0.71674	0.998;0.816;0.991;0.985	D;P;P;P	0.63381	0.914;0.574;0.73;0.781	T	0.69921	-0.5014	10	0.72032	D	0.01	-18.7755	15.3433	0.74314	0.0:0.0:1.0:0.0	.	2;124;123;124	B4DQC0;O43586-2;C9K004;O43586	.;.;.;PPIP1_HUMAN	Y	124;123	ENSP00000368914:D124Y;ENSP00000267939:D123Y	ENSP00000267939:D123Y	D	+	1	0	PSTPIP1	75107263	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.903000	0.87398	1.895000	0.54865	0.462000	0.41574	GAC	.	.		0.672	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
CTSH	1512	hgsc.bcm.edu	37	15	79223830	79223830	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:79223830C>T	ENST00000220166.5	-	7	620	c.511G>A	c.(511-513)Gac>Aac	p.D171N	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	171					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						TGGGCGCAGTCCACCAGCTGC	0.587																																					p.D171N		Atlas-SNP	.											.	CTSH	23	.	0			c.G511A						.						123.0	99.0	107.0					15																	79223830		2196	4293	6489	SO:0001583	missense	1512	exon7			CGCAGTCCACCAG	X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.511G>A	chr15.hg19:g.79223830C>T	ENSP00000220166:p.Asp171Asn	80.0	0.0		73.0	27.0	NM_004390	B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	ENST00000220166.5	hg19	CCDS10308.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.582774	0.86748	.	.	ENSG00000103811	ENST00000220166;ENST00000394758;ENST00000528741	T;T	0.29142	1.58;1.58	3.68	3.68	0.42216	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	M	0.89534	3.04	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.67829	-0.5569	10	0.87932	D	0	.	11.1069	0.48207	0.0:1.0:0.0:0.0	.	171;159	P09668;E9PBP2	CATH_HUMAN;.	N	171;159;95	ENSP00000220166:D171N;ENSP00000435329:D95N	ENSP00000220166:D171N	D	-	1	0	CTSH	77010885	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	5.969000	0.70422	2.073000	0.62155	0.462000	0.41574	GAC	.	.		0.587	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1	NM_004390	
TMC3	342125	hgsc.bcm.edu	37	15	81628988	81628988	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:81628988C>G	ENST00000359440.5	-	20	2300	c.2165G>C	c.(2164-2166)aGa>aCa	p.R722T	RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.R723T|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						ATCCTCTGATCTTGCCTAAAA	0.368																																					p.R722T		Atlas-SNP	.											.	TMC3	112	.	0			c.G2165C						.						280.0	273.0	275.0					15																	81628988		1895	4102	5997	SO:0001583	missense	342125	exon20			TCTGATCTTGCCT	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.2165G>C	chr15.hg19:g.81628988C>G	ENSP00000352413:p.Arg722Thr	52.0	0.0		89.0	17.0	NM_001080532		Missense_Mutation	SNP	ENST00000359440.5	hg19	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045491	0.75846	.	.	ENSG00000188869	ENST00000359440	T	0.68479	-0.33	5.18	5.18	0.71444	.	1.874750	0.03529	N	0.222210	D	0.84813	0.5555	M	0.86028	2.79	0.41534	D	0.988474	.	.	.	.	.	.	T	0.72734	-0.4204	8	0.66056	D	0.02	-4.6803	16.8735	0.86045	0.0:1.0:0.0:0.0	.	.	.	.	T	722	ENSP00000352413:R722T	ENSP00000352413:R722T	R	-	2	0	TMC3	79416043	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.315000	0.65810	2.387000	0.81309	0.561000	0.74099	AGA	.	.		0.368	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
AGBL1	123624	hgsc.bcm.edu	37	15	87097621	87097621	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:87097621A>G	ENST00000441037.2	+	20	2804	c.2709A>G	c.(2707-2709)gcA>gcG	p.A903A	AGBL1_ENST00000389298.3_Silent_p.A634A|AGBL1_ENST00000421325.2_Silent_p.A903A	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	903					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						ATAAGCTAGCACCAGCATTCA	0.463																																					p.A903A		Atlas-SNP	.											.	AGBL1	151	.	0			c.A2709G						.						33.0	33.0	33.0					15																	87097621		1875	4105	5980	SO:0001819	synonymous_variant	123624	exon20			GCTAGCACCAGCA	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2709A>G	chr15.hg19:g.87097621A>G		99.0	0.0		111.0	21.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	ENST00000441037.2	hg19	CCDS58398.1																																																																																			.	.		0.463	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
DET1	55070	hgsc.bcm.edu	37	15	89074816	89074816	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:89074816C>T	ENST00000268148.8	-	2	266	c.121G>A	c.(121-123)Gtg>Atg	p.V41M	DET1_ENST00000444300.1_Missense_Mutation_p.V52M|DET1_ENST00000558413.1_Intron|DET1_ENST00000564406.1_Missense_Mutation_p.V52M|DET1_ENST00000559656.1_5'Flank	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	41						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGATGGAACACTCGGACTTGG	0.488																																					p.V52M		Atlas-SNP	.											.	DET1	55	.	0			c.G154A						.						161.0	159.0	159.0					15																	89074816		2003	4180	6183	SO:0001583	missense	55070	exon3			GGAACACTCGGAC	BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.121G>A	chr15.hg19:g.89074816C>T	ENSP00000268148:p.Val41Met	134.0	0.0		182.0	17.0	NM_017996	B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	ENST00000268148.8	hg19	CCDS45344.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199349	0.38806	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.91	5.91	0.95273	.	0.221335	0.47455	D	0.000237	T	0.43634	0.1256	N	0.22421	0.69	0.37158	D	0.90246	B;B	0.27117	0.168;0.168	B;B	0.23716	0.029;0.048	T	0.48603	-0.9021	9	0.48119	T	0.1	-19.0177	12.5706	0.56334	0.0:0.9251:0.0:0.0749	.	41;52	Q7L5Y6;B3KNN6	DET1_HUMAN;.	M	52;41	.	ENSP00000268148:V41M	V	-	1	0	DET1	86875820	0.997000	0.39634	0.973000	0.42090	0.962000	0.63368	2.912000	0.48782	2.793000	0.96121	0.655000	0.94253	GTG	.	.		0.488	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2	NM_017996	
MFGE8	4240	hgsc.bcm.edu	37	15	89453089	89453089	+	Missense_Mutation	SNP	C	C	G	rs148213281		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:89453089C>G	ENST00000566497.1	-	2	200	c.139G>C	c.(139-141)Gga>Cga	p.G47R	MFGE8_ENST00000539437.1_Missense_Mutation_p.G39R|MFGE8_ENST00000542878.1_Intron|MFGE8_ENST00000559997.1_Intron|MFGE8_ENST00000268150.8_Missense_Mutation_p.G47R|MFGE8_ENST00000268151.7_Missense_Mutation_p.G47R			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	47	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					AAGACATCTCCTCGCACTTCT	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22778	0.0		0.0	False		,,,				2504	0.0				p.G47R		Atlas-SNP	.											.	MFGE8	60	.	0			c.G139C						.	C	ARG/GLY,ARG/GLY	2,4398	4.2+/-10.8	0,2,2198	185.0	151.0	163.0		139,139	5.4	1.0	15	dbSNP_134	163	0,8598		0,0,4299	no	missense,missense	MFGE8	NM_001114614.1,NM_005928.2	125,125	0,2,6497	GG,GC,CC		0.0,0.0455,0.0154	probably-damaging,probably-damaging	47/336,47/388	89453089	2,12996	2200	4299	6499	SO:0001583	missense	4240	exon2			CATCTCCTCGCAC	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.139G>C	chr15.hg19:g.89453089C>G	ENSP00000456281:p.Gly47Arg	168.0	0.0		190.0	23.0	NM_001114614	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	ENST00000566497.1	hg19	CCDS10347.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915509	0.73098	4.55E-4	0.0	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437	D;D;D	0.98381	-4.74;-4.9;-4.89	5.39	5.39	0.77823	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98482	0.9494	L	0.52905	1.665	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98516	1.0621	10	0.37606	T	0.19	-44.8874	18.0846	0.89453	0.0:1.0:0.0:0.0	.	39;39;47;47	B3KTQ2;F5H7N9;Q08431-3;Q08431	.;.;.;MFGM_HUMAN	R	47;47;39	ENSP00000268150:G47R;ENSP00000268151:G47R;ENSP00000442386:G39R	ENSP00000268150:G47R	G	-	1	0	MFGE8	87254093	1.000000	0.71417	0.957000	0.39632	0.022000	0.10575	7.113000	0.77095	2.700000	0.92200	0.561000	0.74099	GGA	.	C|1.000;G|0.000		0.527	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928	
BLM	641	hgsc.bcm.edu	37	15	91293034	91293034	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:91293034G>T	ENST00000355112.3	+	3	654	c.536G>T	c.(535-537)aGa>aTa	p.R179I	BLM_ENST00000560509.1_Missense_Mutation_p.R179I	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	179					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			CACTTTGTAAGAGTAAGCACT	0.368			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.R179I		Atlas-SNP	.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	122	.	0			c.G536T						.						66.0	65.0	65.0					15																	91293034		2198	4298	6496	SO:0001583	missense	641	exon3	Familial Cancer Database		TTGTAAGAGTAAG	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.536G>T	chr15.hg19:g.91293034G>T	ENSP00000347232:p.Arg179Ile	142.0	0.0		189.0	22.0	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	hg19	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.590168	0.66105	.	.	ENSG00000197299	ENST00000355112	T	0.50548	0.74	6.01	3.93	0.45458	.	0.397165	0.26190	N	0.025804	T	0.41026	0.1141	L	0.34521	1.04	0.43793	D	0.996331	P;P	0.48911	0.917;0.917	P;P	0.49226	0.603;0.603	T	0.35301	-0.9794	10	0.66056	D	0.02	-26.1553	5.817	0.18497	0.2548:0.0:0.7452:0.0	.	179;179	B2RAN0;P54132	.;BLM_HUMAN	I	179	ENSP00000347232:R179I	ENSP00000347232:R179I	R	+	2	0	BLM	89094038	0.996000	0.38824	0.977000	0.42913	0.591000	0.36615	2.651000	0.46674	1.550000	0.49438	0.650000	0.86243	AGA	.	.		0.368	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
N4BP1	9683	hgsc.bcm.edu	37	16	48576816	48576816	+	Nonstop_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr16:48576816C>A	ENST00000262384.3	-	7	2926	c.2690G>T	c.(2689-2691)tGa>tTa	p.*897L	N4BP1_ENST00000565423.1_5'UTR	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	0					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GCACAATCTTCAATCCAACAC	0.463																																					p.X897L		Atlas-SNP	.											.	N4BP1	121	.	0			c.G2690T						.						80.0	74.0	76.0					16																	48576816		1922	4135	6057	SO:0001578	stop_lost	9683	exon7			AATCTTCAATCCA	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2690G>T	chr16.hg19:g.48576816C>A		71.0	0.0		51.0	26.0	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	hg19	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276077	0.40294	.	.	ENSG00000102921	ENST00000262384	.	.	.	5.63	-0.075	0.13728	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.7427	0.05258	0.1174:0.5075:0.1142:0.2608	.	.	.	.	L	897	.	.	X	-	2	2	N4BP1	47134317	0.915000	0.31059	0.216000	0.23742	0.226000	0.24999	0.209000	0.17435	0.302000	0.22762	-0.225000	0.12378	TGA	.	.		0.463	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
ZFHX3	463	hgsc.bcm.edu	37	16	72991690	72991690	+	Silent	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr16:72991690A>G	ENST00000268489.5	-	2	3027	c.2355T>C	c.(2353-2355)aaT>aaC	p.N785N	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	785					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AGCTACTGATATTGgctgccg	0.657																																					p.N785N		Atlas-SNP	.											.	ZFHX3	404	.	0			c.T2355C						.						29.0	35.0	33.0					16																	72991690		2198	4300	6498	SO:0001819	synonymous_variant	463	exon2			ACTGATATTGGCT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2355T>C	chr16.hg19:g.72991690A>G		35.0	0.0		38.0	13.0	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.		0.657	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZNF469	84627	hgsc.bcm.edu	37	16	88502399	88502399	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr16:88502399G>A	ENST00000437464.1	+	2	8437	c.8437G>A	c.(8437-8439)Gcc>Acc	p.A2813T	ZNF469_ENST00000565624.1_Missense_Mutation_p.A2841T	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2813					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CACTCCTGATGCCTCTGGCTC	0.617																																					p.A2813T		Atlas-SNP	.											.	ZNF469	121	.	0			c.G8437A						.						12.0	15.0	14.0					16																	88502399		689	1588	2277	SO:0001583	missense	84627	exon2			CCTGATGCCTCTG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.8437G>A	chr16.hg19:g.88502399G>A	ENSP00000402343:p.Ala2813Thr	40.0	0.0		32.0	8.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434836	0.25813	.	.	ENSG00000225614	ENST00000437464	T	0.10477	2.87	4.89	2.84	0.33178	.	.	.	.	.	T	0.08044	0.0201	L	0.27053	0.805	0.09310	N	1	P	0.43750	0.816	B	0.39840	0.311	T	0.23190	-1.0195	9	0.72032	D	0.01	.	7.1326	0.25510	0.091:0.0:0.7424:0.1667	.	2813	Q96JG9	ZN469_HUMAN	T	2813	ENSP00000402343:A2813T	ENSP00000402343:A2813T	A	+	1	0	ZNF469	87029900	0.004000	0.15560	0.001000	0.08648	0.032000	0.12392	1.382000	0.34374	1.003000	0.39130	0.561000	0.74099	GCC	.	.		0.617	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
RNMTL1	55178	hgsc.bcm.edu	37	17	695150	695150	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:695150G>A	ENST00000304478.4	+	4	1210	c.1104G>A	c.(1102-1104)caG>caA	p.Q368Q	RP11-676J12.8_ENST00000574560.1_RNA	NM_018146.2	NP_060616.1			RNA methyltransferase like 1											breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		AGTCCCTGCAGCTGGCCGAGA	0.622																																					p.Q368Q		Atlas-SNP	.											.	RNMTL1	25	.	0			c.G1104A						.						54.0	53.0	53.0					17																	695150		2203	4300	6503	SO:0001819	synonymous_variant	55178	exon4			CCTGCAGCTGGCC	AF177344	CCDS10997.1	17p13.3	2008-02-05			ENSG00000171861	ENSG00000171861			18485	protein-coding gene	gene with protein product		612600				12296377	Standard	NM_018146		Approved	FLJ10581, HC90	uc002frw.3	Q9HC36	OTTHUMG00000090285	ENST00000304478.4:c.1104G>A	chr17.hg19:g.695150G>A		62.0	0.0		94.0	5.0	NM_018146		Silent	SNP	ENST00000304478.4	hg19	CCDS10997.1																																																																																			.	.		0.622	RNMTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206611.1	NM_018146	
NUP88	4927	hgsc.bcm.edu	37	17	5312086	5312086	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:5312086T>C	ENST00000573584.1	-	5	1333	c.824A>G	c.(823-825)gAg>gGg	p.E275G		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	275					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						CAGGAAAGTCTCTCCATTTTC	0.443																																					p.E275G		Atlas-SNP	.											.	NUP88	47	.	0			c.A824G						.						139.0	124.0	129.0					17																	5312086		2203	4300	6503	SO:0001583	missense	4927	exon5			AAAGTCTCTCCAT	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.824A>G	chr17.hg19:g.5312086T>C	ENSP00000458954:p.Glu275Gly	84.0	0.0		106.0	17.0	NM_002532	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	hg19	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.093697	0.76870	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	5.05	3.95	0.45737	.	0.106421	0.64402	D	0.000007	T	0.67998	0.2953	M	0.68317	2.08	0.52501	D	0.999955	D;P;P	0.57257	0.979;0.951;0.919	P;P;P	0.57846	0.828;0.675;0.686	T	0.70817	-0.4769	9	0.72032	D	0.01	-4.5841	11.5599	0.50769	0.0:0.0:0.1496:0.8504	.	275;144;275	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	G	275;144	.	ENSP00000225696:E275G	E	-	2	0	NUP88	5252810	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	6.868000	0.75516	1.026000	0.39733	0.377000	0.23210	GAG	.	.		0.443	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
ARHGEF15	22899	hgsc.bcm.edu	37	17	8215455	8215455	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:8215455C>T	ENST00000361926.3	+	2	208	c.98C>T	c.(97-99)tCc>tTc	p.S33F	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.S33F	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	33	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GCTGCCCAGTCCCCAGGGCCT	0.632																																					p.S33F		Atlas-SNP	.											.	ARHGEF15	97	.	0			c.C98T						.						80.0	88.0	85.0					17																	8215455		2203	4300	6503	SO:0001583	missense	22899	exon2			CCCAGTCCCCAGG	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.98C>T	chr17.hg19:g.8215455C>T	ENSP00000355026:p.Ser33Phe	174.0	0.0		202.0	73.0	NM_025014	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	hg19	CCDS11139.1	.	.	.	.	.	.	.	.	.	.	C	6.231	0.410832	0.11812	.	.	ENSG00000198844	ENST00000361926;ENST00000421050	T;T	0.72725	-0.68;-0.68	5.0	2.96	0.34315	.	0.275100	0.26359	N	0.024835	T	0.53174	0.1780	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.42832	-0.9428	10	0.38643	T	0.18	-13.2931	7.9577	0.30053	0.0:0.8079:0.0:0.1921	.	33;33	D3DTR7;O94989	.;ARHGF_HUMAN	F	33	ENSP00000355026:S33F;ENSP00000412505:S33F	ENSP00000355026:S33F	S	+	2	0	ARHGEF15	8156180	0.971000	0.33674	0.965000	0.40720	0.520000	0.34377	0.481000	0.22260	1.346000	0.45694	-0.145000	0.13849	TCC	.	.		0.632	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728	
NDEL1	81565	hgsc.bcm.edu	37	17	8363472	8363472	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:8363472A>T	ENST00000334527.7	+	8	1135	c.938A>T	c.(937-939)gAc>gTc	p.D313V	NDEL1_ENST00000299734.7_Missense_Mutation_p.D313V|NDEL1_ENST00000402554.3_Missense_Mutation_p.D313V|NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000380025.4_Intron	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	313	Interaction with CENPF.|Interaction with NEFL. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						TCTTTCTTCGACAAAGGGTAA	0.393																																					p.D313V		Atlas-SNP	.											.	NDEL1	47	.	0			c.A938T						.						108.0	102.0	104.0					17																	8363472		2203	4300	6503	SO:0001583	missense	81565	exon8			TCTTCGACAAAGG	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.938A>T	chr17.hg19:g.8363472A>T	ENSP00000333982:p.Asp313Val	150.0	0.0		142.0	14.0	NM_001025579	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Missense_Mutation	SNP	ENST00000334527.7	hg19	CCDS11143.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.305133	0.81247	.	.	ENSG00000166579	ENST00000299734;ENST00000380025;ENST00000402554;ENST00000334527	.	.	.	5.0	5.0	0.66597	NUDE protein, C-terminal (1);	0.088081	0.85682	D	0.000000	T	0.76169	0.3950	M	0.76328	2.33	0.80722	D	1	P;D	0.63046	0.863;0.992	P;P	0.62740	0.728;0.906	T	0.76921	-0.2780	9	0.41790	T	0.15	-0.682	15.151	0.72700	1.0:0.0:0.0:0.0	.	313;313	Q9GZM8;A6NIZ0	NDEL1_HUMAN;.	V	313;313;368;313	.	ENSP00000299734:D313V	D	+	2	0	NDEL1	8304197	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	8.249000	0.89833	2.227000	0.72691	0.402000	0.26972	GAC	.	.		0.393	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
PSME3	10197	hgsc.bcm.edu	37	17	40989684	40989684	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:40989684A>T	ENST00000590720.1	+	5	495	c.262A>T	c.(262-264)Agg>Tgg	p.R88W	PSME3_ENST00000441946.2_Missense_Mutation_p.R99W|PSME3_ENST00000592169.1_Missense_Mutation_p.R32W|PSME3_ENST00000545225.1_Missense_Mutation_p.R27W|PSME3_ENST00000541124.1_3'UTR|PSME3_ENST00000293362.3_Missense_Mutation_p.R88W			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)	88					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)			NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TAAGAAGCGAAGGTTGGATGA	0.493																																					p.R99W		Atlas-SNP	.											.	PSME3	11	.	0			c.A295T						.						213.0	176.0	189.0					17																	40989684		2203	4300	6503	SO:0001583	missense	10197	exon7			AAGCGAAGGTTGG	U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.262A>T	chr17.hg19:g.40989684A>T	ENSP00000466794:p.Arg88Trp	127.0	0.0		149.0	25.0	NM_001267045	A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Missense_Mutation	SNP	ENST00000590720.1	hg19	CCDS45689.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.955358	0.92726	.	.	ENSG00000131467	ENST00000545225;ENST00000293362;ENST00000441946;ENST00000543428	T;T;T	0.55930	1.21;1.79;0.49	5.35	5.35	0.76521	.	0.230536	0.43919	D	0.000512	T	0.38931	0.1059	N	0.08118	0	0.80722	D	1	P;P;P	0.50272	0.69;0.69;0.933	B;B;P	0.44772	0.271;0.271;0.46	T	0.50432	-0.8829	10	0.87932	D	0	-0.5881	15.503	0.75716	1.0:0.0:0.0:0.0	.	88;88;88	Q6FHK7;P61289;P61289-2	.;PSME3_HUMAN;.	W	27;88;88;88	ENSP00000441682:R27W;ENSP00000293362:R88W;ENSP00000437924:R88W	ENSP00000293362:R88W	R	+	1	2	PSME3	38243210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.382000	0.59594	2.236000	0.73375	0.528000	0.53228	AGG	.	.		0.493	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452430.1	NM_176863	
TBX4	9496	hgsc.bcm.edu	37	17	59560478	59560478	+	Silent	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:59560478T>C	ENST00000240335.1	+	8	1284	c.1239T>C	c.(1237-1239)ccT>ccC	p.P413P	TBX4_ENST00000589449.1_Intron|TBX4_ENST00000393853.4_Silent_p.P414P	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	413					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TGCCCCCACCTCCGCTGAGCT	0.602																																					p.P413P		Atlas-SNP	.											.	TBX4	69	.	0			c.T1239C						.						91.0	80.0	83.0					17																	59560478		2203	4300	6503	SO:0001819	synonymous_variant	9496	exon8			CCCACCTCCGCTG	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1239T>C	chr17.hg19:g.59560478T>C		62.0	0.0		91.0	27.0	NM_018488	A5PKU7|B2RMT1|B7ZLV3	Silent	SNP	ENST00000240335.1	hg19	CCDS11629.1																																																																																			.	.		0.602	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
FASN	2194	hgsc.bcm.edu	37	17	80043416	80043416	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:80043416T>A	ENST00000306749.2	-	23	4282	c.4064A>T	c.(4063-4065)gAc>gTc	p.D1355V	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1355				LGDI -> SGH (in Ref. 2; AAA73576). {ECO:0000305}.	acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGCCACGATGTCCCCGAGGGG	0.701																																					p.D1355V	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.A4064T						.						14.0	17.0	16.0					17																	80043416		2177	4282	6459	SO:0001583	missense	2194	exon23			ACGATGTCCCCGA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4064A>T	chr17.hg19:g.80043416T>A	ENSP00000304592:p.Asp1355Val	198.0	0.0		251.0	32.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.499563	0.26861	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.25749	1.78	4.79	4.79	0.61399	.	0.178574	0.47455	D	0.000229	T	0.15089	0.0364	N	0.08118	0	0.58432	D	0.999994	B	0.11235	0.004	B	0.10450	0.005	T	0.04796	-1.0926	10	0.42905	T	0.14	-25.8548	14.2888	0.66263	0.0:0.0:0.0:1.0	.	1355	P49327	FAS_HUMAN	V	1355;320	ENSP00000304592:D1355V	ENSP00000304592:D1355V	D	-	2	0	FASN	77636705	1.000000	0.71417	0.321000	0.25320	0.062000	0.15995	7.387000	0.79785	1.772000	0.52199	0.379000	0.24179	GAC	.	.		0.701	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
CD7	924	hgsc.bcm.edu	37	17	80274230	80274230	+	Silent	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:80274230G>T	ENST00000312648.3	-	3	559	c.453C>A	c.(451-453)gcC>gcA	p.A151A	CD7_ENST00000578509.1_Silent_p.A51A|CD7_ENST00000583376.1_Silent_p.A51A|CD7_ENST00000584284.1_Silent_p.A151A	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	151	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GGGCAGGGAGGGCAGAGGCCC	0.667																																					p.A151A	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											.	CD7	25	.	0			c.C453A						.						19.0	24.0	22.0					17																	80274230		2191	4296	6487	SO:0001819	synonymous_variant	924	exon3			AGGGAGGGCAGAG	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.453C>A	chr17.hg19:g.80274230G>T		79.0	0.0		100.0	13.0	NM_006137		Silent	SNP	ENST00000312648.3	hg19	CCDS11807.1																																																																																			.	.		0.667	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
LAMA1	284217	hgsc.bcm.edu	37	18	7080342	7080342	+	Missense_Mutation	SNP	C	C	T	rs375547281		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr18:7080342C>T	ENST00000389658.3	-	2	269	c.176G>A	c.(175-177)cGg>cAg	p.R59Q	RP11-76K13.3_ENST00000581502.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	59	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TCGGACGGGCCGACCTGGCAC	0.547																																					p.R59Q		Atlas-SNP	.											LAMA1,colon,carcinoma,0,1	LAMA1	458	.	0			c.G176A						.	C	GLN/ARG	0,4406		0,0,2203	83.0	83.0	83.0		176	4.8	0.0	18		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMA1	NM_005559.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	59/3076	7080342	1,13005	2203	4300	6503	SO:0001583	missense	284217	exon2			ACGGGCCGACCTG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.176G>A	chr18.hg19:g.7080342C>T	ENSP00000374309:p.Arg59Gln	202.0	0.0		183.0	39.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	hg19	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667802	0.29604	0.0	1.16E-4	ENSG00000101680	ENST00000389658	T	0.17370	2.28	5.68	4.8	0.61643	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.21347	0.0514	N	0.20986	0.625	0.09310	N	0.999996	D	0.76494	0.999	P	0.60173	0.87	T	0.13926	-1.0491	10	0.11794	T	0.64	.	14.9131	0.70773	0.0:0.9305:0.0:0.0695	.	59	P25391	LAMA1_HUMAN	Q	59	ENSP00000374309:R59Q	ENSP00000374309:R59Q	R	-	2	0	LAMA1	7070342	0.990000	0.36364	0.011000	0.14972	0.047000	0.14425	3.486000	0.53215	2.677000	0.91161	0.650000	0.86243	CGG	.	.		0.547	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ZCCHC2	54877	hgsc.bcm.edu	37	18	60242385	60242385	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr18:60242385A>T	ENST00000269499.5	+	13	3489	c.3071A>T	c.(3070-3072)aAt>aTt	p.N1024I	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.N703I	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1024						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TGTGGGACCAATGGAAACCTT	0.507																																					p.N1024I		Atlas-SNP	.											.	ZCCHC2	64	.	0			c.A3071T						.						86.0	96.0	93.0					18																	60242385		2141	4249	6390	SO:0001583	missense	54877	exon13			GGACCAATGGAAA	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.3071A>T	chr18.hg19:g.60242385A>T	ENSP00000269499:p.Asn1024Ile	79.0	0.0		71.0	20.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	hg19	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.583415	0.46006	.	.	ENSG00000141664	ENST00000269499	T	0.25749	1.78	4.76	0.643	0.17770	.	0.061171	0.64402	D	0.000007	T	0.21062	0.0507	L	0.43152	1.355	0.46849	D	0.999221	P	0.47409	0.895	B	0.42851	0.4	T	0.02202	-1.1196	10	0.62326	D	0.03	-4.984	8.8979	0.35476	0.7637:0.0:0.2363:0.0	.	1024	Q9C0B9	ZCHC2_HUMAN	I	1024	ENSP00000269499:N1024I	ENSP00000269499:N1024I	N	+	2	0	ZCCHC2	58393365	1.000000	0.71417	0.994000	0.49952	0.962000	0.63368	1.883000	0.39658	0.030000	0.15379	-0.256000	0.11100	AAT	.	.		0.507	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
MUC16	94025	hgsc.bcm.edu	37	19	9076752	9076752	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:9076752T>A	ENST00000397910.4	-	3	10897	c.10694A>T	c.(10693-10695)gAc>gTc	p.D3565V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3566	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CGGGGTGCTGTCCATGGTACT	0.537											OREG0007306	type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.D3565V		Atlas-SNP	.											.	MUC16	4315	.	0			c.A10694T						.						203.0	200.0	201.0					19																	9076752		2125	4233	6358	SO:0001583	missense	94025	exon3			GTGCTGTCCATGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10694A>T	chr19.hg19:g.9076752T>A	ENSP00000381008:p.Asp3565Val	181.0	0.0	654	160.0	28.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	2.985	-0.209550	0.06140	.	.	ENSG00000181143	ENST00000397910	T	0.03065	4.06	1.65	0.539	0.17156	.	.	.	.	.	T	0.02342	0.0072	N	0.08118	0	.	.	.	P	0.52061	0.95	P	0.45138	0.471	T	0.43294	-0.9400	8	0.87932	D	0	.	3.642	0.08170	0.3438:0.0:0.0:0.6562	.	3565	B5ME49	.	V	3565	ENSP00000381008:D3565V	ENSP00000381008:D3565V	D	-	2	0	MUC16	8937752	0.001000	0.12720	0.000000	0.03702	0.043000	0.13939	0.526000	0.22971	0.081000	0.16988	0.260000	0.18958	GAC	.	.		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu	37	19	9083709	9083709	+	Silent	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:9083709T>G	ENST00000397910.4	-	1	8309	c.8106A>C	c.(8104-8106)gtA>gtC	p.V2702V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2702	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGGGTTACTTACTGTCTTAA	0.483																																					p.V2702V		Atlas-SNP	.											.	MUC16	4315	.	0			c.A8106C						.						118.0	110.0	113.0					19																	9083709		1921	4137	6058	SO:0001819	synonymous_variant	94025	exon1			GTTACTTACTGTC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8106A>C	chr19.hg19:g.9083709T>G		59.0	0.0		87.0	4.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PDE4C	5143	hgsc.bcm.edu	37	19	18327687	18327687	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:18327687A>G	ENST00000355502.3	-	16	2220	c.1349T>C	c.(1348-1350)aTg>aCg	p.M450T	PDE4C_ENST00000447275.3_Missense_Mutation_p.M344T|PDE4C_ENST00000594617.3_Missense_Mutation_p.M450T|PDE4C_ENST00000598111.2_Missense_Mutation_p.M165T|PDE4C_ENST00000597297.1_Missense_Mutation_p.M220T|PDE4C_ENST00000539010.1_Missense_Mutation_p.M219T|PDE4C_ENST00000594465.3_Missense_Mutation_p.M450T|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000262805.12_Missense_Mutation_p.M418T			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	450					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GTCGTTGTACATAAGCGCCAG	0.567																																					p.M450T		Atlas-SNP	.											.	PDE4C	80	.	0			c.T1349C						.						73.0	72.0	72.0					19																	18327687		2203	4300	6503	SO:0001583	missense	5143	exon13			TTGTACATAAGCG		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1349T>C	chr19.hg19:g.18327687A>G	ENSP00000347689:p.Met450Thr	68.0	0.0		76.0	34.0	NM_000923	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	hg19	CCDS12373.1	.	.	.	.	.	.	.	.	.	.	a	13.71	2.319359	0.41096	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	4.52	4.52	0.55395	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.61185	0.2327	L	0.38531	1.155	0.37413	D	0.913311	B;B;B;B	0.25563	0.129;0.126;0.011;0.08	B;B;B;B	0.35770	0.179;0.21;0.053;0.074	T	0.67417	-0.5676	10	0.87932	D	0	.	11.8181	0.52222	1.0:0.0:0.0:0.0	.	450;418;256;165	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	T	529;450;438;418;344;256;164;219;559	ENSP00000347689:M450T;ENSP00000262805:M418T;ENSP00000402091:M344T;ENSP00000439470:M219T	ENSP00000262805:M418T	M	-	2	0	PDE4C	18188687	1.000000	0.71417	0.992000	0.48379	0.783000	0.44284	8.803000	0.91915	1.682000	0.51000	0.392000	0.25879	ATG	.	.		0.567	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1		
COMP	1311	hgsc.bcm.edu	37	19	18896571	18896571	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:18896571G>A	ENST00000222271.2	-	14	1624	c.1580C>T	c.(1579-1581)aCg>aTg	p.T527M	COMP_ENST00000425807.1_Missense_Mutation_p.T474M|COMP_ENST00000542601.2_Missense_Mutation_p.T494M	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	527	Mediates cell survival and induction of the IAP family of survival proteins.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GTCGGTGAGCGTGACTTCAGC	0.627																																					p.T527M		Atlas-SNP	.											.	COMP	62	.	0			c.C1580T						.						85.0	71.0	76.0					19																	18896571		2203	4300	6503	SO:0001583	missense	1311	exon14			GTGAGCGTGACTT	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1580C>T	chr19.hg19:g.18896571G>A	ENSP00000222271:p.Thr527Met	45.0	0.0		52.0	5.0	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	ENST00000222271.2	hg19	CCDS12385.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471085	0.84533	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.98400	-4.91;-4.91;-4.91	4.54	4.54	0.55810	.	0.000000	0.85682	U	0.000000	D	0.98648	0.9547	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.81914	0.905;0.995	D	0.98891	1.0773	10	0.35671	T	0.21	-29.1406	15.8171	0.78612	0.0:0.0:1.0:0.0	.	474;527	B4DKJ3;P49747	.;COMP_HUMAN	M	494;527;474;514	ENSP00000439156:T494M;ENSP00000222271:T527M;ENSP00000403792:T474M	ENSP00000222271:T527M	T	-	2	0	COMP	18757571	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	9.642000	0.98461	2.071000	0.62044	0.436000	0.28706	ACG	.	.		0.627	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
PROSER3	148137	hgsc.bcm.edu	37	19	36256011	36256011	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:36256011G>A	ENST00000544099.1	+	7	766	c.703G>A	c.(703-705)Ggc>Agc	p.G235S	C19orf55_ENST00000396908.4_Missense_Mutation_p.G235S			Q2NL68	PRSR3_HUMAN		235	Ser-rich.									cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCTCTGATGGCCTCTCTCC	0.627																																					p.G235S		Atlas-SNP	.											.	C19orf55	39	.	0			c.G703A						.						131.0	135.0	134.0					19																	36256011		2142	4254	6396	SO:0001583	missense	148137	exon7			TCTGATGGCCTCT																												ENST00000544099.1:c.703G>A	chr19.hg19:g.36256011G>A	ENSP00000467267:p.Gly235Ser	56.0	0.0		46.0	12.0	NM_001039887	Q8NDI3|Q8WWC8|Q96NL4	Missense_Mutation	SNP	ENST00000544099.1	hg19		.	.	.	.	.	.	.	.	.	.	G	14.36	2.513328	0.44660	.	.	ENSG00000167595	ENST00000396908;ENST00000301165	T;T	0.46451	0.87;0.87	4.42	4.42	0.53409	.	0.000000	0.40554	N	0.001076	T	0.54631	0.1870	L	0.59436	1.845	0.30998	N	0.720598	D	0.55605	0.972	P	0.61477	0.889	T	0.56105	-0.8034	10	0.34782	T	0.22	-30.2292	12.7703	0.57417	0.0:0.0:1.0:0.0	.	235	E5RFB9	.	S	235;234	ENSP00000380116:G235S;ENSP00000301165:G234S	ENSP00000301165:G234S	G	+	1	0	C19orf55	40947851	0.994000	0.37717	0.998000	0.56505	0.002000	0.02628	4.123000	0.57917	2.460000	0.83146	0.558000	0.71614	GGC	.	.		0.627	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2		
WDR62	284403	hgsc.bcm.edu	37	19	36592199	36592199	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:36592199A>T	ENST00000270301.7	+	24	2951	c.2951A>T	c.(2950-2952)aAg>aTg	p.K984M	WDR62_ENST00000401500.2_Missense_Mutation_p.K984M			O43379	WDR62_HUMAN	WD repeat domain 62	984					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GACAGCCCAAAGGACCAGAGC	0.647																																					p.K984M		Atlas-SNP	.											.	WDR62	102	.	0			c.A2951T						.						24.0	25.0	24.0					19																	36592199		2203	4300	6503	SO:0001583	missense	284403	exon24			GCCCAAAGGACCA	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.2951A>T	chr19.hg19:g.36592199A>T	ENSP00000270301:p.Lys984Met	161.0	0.0		194.0	44.0	NM_173636	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	hg19	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.000646	0.54254	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.52295	0.76;0.67	5.25	5.25	0.73442	.	0.220505	0.39020	N	0.001492	T	0.62938	0.2469	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.65987	0.94;0.872	T	0.63607	-0.6599	10	0.46703	T	0.11	-25.3009	11.7216	0.51685	1.0:0.0:0.0:0.0	.	984;984	O43379-4;O43379	.;WDR62_HUMAN	M	984	ENSP00000384792:K984M;ENSP00000270301:K984M	ENSP00000270301:K984M	K	+	2	0	WDR62	41284039	0.997000	0.39634	0.711000	0.30485	0.487000	0.33371	2.575000	0.46025	2.333000	0.79357	0.533000	0.62120	AAG	.	.		0.647	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671	
ZNF585B	92285	hgsc.bcm.edu	37	19	37678065	37678065	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:37678065G>A	ENST00000532828.2	-	5	625	c.374C>T	c.(373-375)tCt>tTt	p.S125F	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_5'Flank|ZNF585B_ENST00000527838.1_Missense_Mutation_p.S125F|ZNF585B_ENST00000531805.1_Missense_Mutation_p.S70F	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTTCCCCAGAATAAATTTT	0.373																																					p.S125F	Melanoma(93;882 1454 18863 28917 48427)	Atlas-SNP	.											.	ZNF585B	91	.	0			c.C374T						.						60.0	64.0	63.0					19																	37678065		2202	4300	6502	SO:0001583	missense	92285	exon5			TCCCCAGAATAAA	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.374C>T	chr19.hg19:g.37678065G>A	ENSP00000433773:p.Ser125Phe	87.0	0.0		104.0	35.0	NM_152279	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	hg19	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	G	2.302	-0.360046	0.05103	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000527838	T;T;T	0.08282	3.11;3.15;6.78	2.32	2.32	0.28847	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.469425	0.15734	U	0.247298	T	0.10337	0.0253	L	0.55743	1.74	0.80722	D	1	B	0.09022	0.002	B	0.13407	0.009	T	0.09930	-1.0652	10	0.87932	D	0	.	11.6544	0.51309	0.0:0.0:1.0:0.0	.	125	Q52M93	Z585B_HUMAN	F	70;125;125	ENSP00000436774:S70F;ENSP00000433773:S125F;ENSP00000435268:S125F	ENSP00000435268:S125F	S	-	2	0	ZNF585B	42369905	0.845000	0.29573	0.095000	0.20976	0.027000	0.11550	1.420000	0.34804	1.280000	0.44463	0.455000	0.32223	TCT	.	.		0.373	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
WDR87	83889	hgsc.bcm.edu	37	19	38377640	38377640	+	Missense_Mutation	SNP	T	T	C	rs541258135	byFrequency	TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:38377640T>C	ENST00000303868.5	-	6	6778	c.6554A>G	c.(6553-6555)gAa>gGa	p.E2185G	WDR87_ENST00000447313.2_Missense_Mutation_p.E2224G	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2185	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CTCTTCTTCTTCTATTCCTCC	0.398																																					p.E2185G		Atlas-SNP	.											.	WDR87	191	.	0			c.A6554G						.						227.0	165.0	184.0					19																	38377640		692	1591	2283	SO:0001583	missense	83889	exon6			TCTTCTTCTATTC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.6554A>G	chr19.hg19:g.38377640T>C	ENSP00000368025:p.Glu2185Gly	89.0	0.0		99.0	22.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	T	8.956	0.969269	0.18659	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.66099	-0.19;-0.19	4.42	3.29	0.37713	.	.	.	.	.	T	0.49201	0.1543	L	0.27053	0.805	0.09310	N	1	D;D	0.54047	0.964;0.964	P;P	0.47118	0.538;0.538	T	0.25187	-1.0139	9	0.22109	T	0.4	.	6.6943	0.23191	0.3259:0.0:0.0:0.6741	.	2185;2224	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	G	2224;2185	ENSP00000405012:E2224G;ENSP00000368025:E2185G	ENSP00000368025:E2185G	E	-	2	0	WDR87	43069480	0.000000	0.05858	0.178000	0.23040	0.029000	0.11900	0.109000	0.15417	1.921000	0.55644	0.443000	0.29094	GAA	.	.		0.398	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
WDR87	83889	hgsc.bcm.edu	37	19	38380578	38380578	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:38380578T>C	ENST00000303868.5	-	6	3840	c.3616A>G	c.(3616-3618)Act>Gct	p.T1206A	WDR87_ENST00000447313.2_Missense_Mutation_p.T1245A	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1206										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GGAGGTGTAGTTTCCTCATTT	0.438																																					p.T1206A		Atlas-SNP	.											.	WDR87	191	.	0			c.A3616G						.						211.0	154.0	171.0					19																	38380578		692	1591	2283	SO:0001583	missense	83889	exon6			GTGTAGTTTCCTC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3616A>G	chr19.hg19:g.38380578T>C	ENSP00000368025:p.Thr1206Ala	94.0	0.0		81.0	12.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	T	2.329	-0.353867	0.05173	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.09911	2.93;2.93	3.93	-7.85	0.01192	.	2.036920	0.02761	N	0.118553	T	0.04092	0.0114	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31024	-0.9958	10	0.32370	T	0.25	3.6767	1.2247	0.01931	0.333:0.1039:0.144:0.4192	.	1206;1245	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	A	1245;1206	ENSP00000405012:T1245A;ENSP00000368025:T1206A	ENSP00000368025:T1206A	T	-	1	0	WDR87	43072418	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.924000	0.03996	-2.131000	0.00815	-2.400000	0.00224	ACT	.	.		0.438	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
RYR1	6261	hgsc.bcm.edu	37	19	39075613	39075613	+	Missense_Mutation	SNP	C	C	T	rs118192150		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:39075613C>T	ENST00000359596.3	+	102	14677	c.14677C>T	c.(14677-14679)Cgg>Tgg	p.R4893W	RYR1_ENST00000360985.3_Missense_Mutation_p.R4888W|RYR1_ENST00000355481.4_Missense_Mutation_p.R4888W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4893			R -> Q (in CCD). {ECO:0000269|PubMed:12565913}.|R -> W (in CCD; release of calcium from intracellular stores in the absence of any pharmacological activator of RYR; smaller thapsigargin-sensitive intracellular calcium stores; normal sensitivity of the calcium release to the RYR inhibitor dantrolene). {ECO:0000269|PubMed:11709545, ECO:0000269|PubMed:14670767}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGTGGGTGTCCGGGCTGGCGG	0.567																																					p.R4893W		Atlas-SNP	.											.	RYR1	708	.	0			c.C14677T	GRCh37	CM013432	RYR1	M	rs118192150	.						187.0	160.0	169.0					19																	39075613		2203	4300	6503	SO:0001583	missense	6261	exon102			GGTGTCCGGGCTG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14677C>T	chr19.hg19:g.39075613C>T	ENSP00000352608:p.Arg4893Trp	129.0	0.0		155.0	55.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207908	0.39003	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.94687	-3.49;-3.49;-3.49	5.08	4.02	0.46733	Ion transport (1);	0.000000	0.64402	U	0.000015	D	0.97832	0.9288	M	0.94142	3.5	0.48511	D	0.999663	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.98640	1.0675	10	0.87932	D	0	.	13.3753	0.60734	0.2844:0.7156:0.0:0.0	.	4888;4893	P21817-2;P21817	.;RYR1_HUMAN	W	4893;4888;4888	ENSP00000352608:R4893W;ENSP00000347667:R4888W;ENSP00000354254:R4888W	ENSP00000347667:R4888W	R	+	1	2	RYR1	43767453	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.070000	0.30653	1.333000	0.45449	0.449000	0.29647	CGG	.	.		0.567	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
GMFG	9535	hgsc.bcm.edu	37	19	39819668	39819668	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:39819668C>T	ENST00000597595.1	-	6	537	c.329G>A	c.(328-330)aGg>aAg	p.R110K	GMFG_ENST00000253054.8_Missense_Mutation_p.R77K|GMFG_ENST00000595636.1_3'UTR|GMFG_ENST00000600322.1_Missense_Mutation_p.R77K|GMFG_ENST00000601387.1_Missense_Mutation_p.R69K|GMFG_ENST00000598034.1_Missense_Mutation_p.R110K|GMFG_ENST00000602185.1_Missense_Mutation_p.R61K|GMFG_ENST00000594700.1_Intron	NM_004877.2	NP_004868.1	O60234	GMFG_HUMAN	glia maturation factor, gamma	110	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				negative regulation of protein kinase activity (GO:0006469)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)			breast(1)|large_intestine(2)|liver(2)|lung(3)|skin(1)|stomach(1)	10	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.15e-27)|all cancers(26;1.3e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CTGCACCAGCCTGTTTTTACT	0.557																																					p.R110K		Atlas-SNP	.											.	GMFG	16	.	0			c.G329A						.						192.0	159.0	170.0					19																	39819668		2203	4300	6503	SO:0001583	missense	9535	exon6			ACCAGCCTGTTTT	AB001993	CCDS12532.1, CCDS74364.1	19q13.2	2014-08-12			ENSG00000130755	ENSG00000130755			4374	protein-coding gene	gene with protein product		604104				9545571, 9653160, 17127212	Standard	XM_005259440		Approved		uc002okz.4	O60234	OTTHUMG00000182811	ENST00000597595.1:c.329G>A	chr19.hg19:g.39819668C>T	ENSP00000472249:p.Arg110Lys	55.0	0.0		47.0	9.0	NM_004877	Q6IB37	Missense_Mutation	SNP	ENST00000597595.1	hg19	CCDS12532.1	.	.	.	.	.	.	.	.	.	.	C	6.705	0.498785	0.12762	.	.	ENSG00000130755	ENST00000253054	.	.	.	5.44	4.39	0.52855	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	N	0.12182	0.205	0.37693	D	0.923924	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.19811	-1.0294	9	0.05436	T	0.98	-29.8184	8.9142	0.35572	0.0:0.8286:0.0:0.1714	.	110;110	O60234;Q6IB37	GMFG_HUMAN;.	K	110	.	ENSP00000253054:R110K	R	-	2	0	GMFG	44511508	0.657000	0.27393	1.000000	0.80357	0.971000	0.66376	1.110000	0.31147	2.532000	0.85374	0.655000	0.94253	AGG	.	.		0.557	GMFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463839.1		
ZNF526	116115	hgsc.bcm.edu	37	19	42729783	42729783	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:42729783G>T	ENST00000301215.3	+	3	1453	c.1228G>T	c.(1228-1230)Gcc>Tcc	p.A410S		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				GCGCACTCACGCCGGCAAAAG	0.677																																					p.A410S		Atlas-SNP	.											.	ZNF526	51	.	0			c.G1228T						.						33.0	37.0	36.0					19																	42729783		2203	4300	6503	SO:0001583	missense	116115	exon3			ACTCACGCCGGCA	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1228G>T	chr19.hg19:g.42729783G>T	ENSP00000301215:p.Ala410Ser	145.0	0.0		153.0	35.0	NM_133444	B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	ENST00000301215.3	hg19	CCDS12598.1	.	.	.	.	.	.	.	.	.	.	G	5.297	0.240203	0.10023	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.14144	2.53	4.23	-0.718	0.11205	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.413227	0.22873	N	0.054607	T	0.04815	0.0130	N	0.04636	-0.2	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.28427	-1.0044	10	0.54805	T	0.06	-3.0001	3.7137	0.08430	0.2585:0.0:0.4486:0.2929	.	410	Q8TF50	ZN526_HUMAN	S	266;410	ENSP00000301215:A410S	ENSP00000301215:A410S	A	+	1	0	ZNF526	47421623	0.000000	0.05858	0.001000	0.08648	0.368000	0.29767	0.240000	0.18042	-0.096000	0.12329	-0.319000	0.08680	GCC	.	.		0.677	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	XM_057401	
ARHGAP35	2909	hgsc.bcm.edu	37	19	47423310	47423310	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:47423310A>G	ENST00000404338.3	+	1	1378	c.1378A>G	c.(1378-1380)Atg>Gtg	p.M460V		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	460	FF 3.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										TAGTTTTATTATGAATGAGGA	0.398																																					p.M460V		Atlas-SNP	.											.	.	.	.	0			c.A1378G						.						30.0	30.0	30.0					19																	47423310		1821	4076	5897	SO:0001583	missense	2909	exon1			TTTATTATGAATG	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1378A>G	chr19.hg19:g.47423310A>G	ENSP00000385720:p.Met460Val	102.0	0.0		118.0	18.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	hg19	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795990	0.31777	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.08896	3.04	5.95	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.12263	0.0298	M	0.72894	2.215	0.58432	D	0.99999	P	0.36789	0.57	B	0.35240	0.198	T	0.01386	-1.1368	10	0.72032	D	0.01	-47.0498	12.0417	0.53456	0.8561:0.1439:0.0:0.0	.	460	Q9NRY4-2	.	V	460	ENSP00000385720:M460V	ENSP00000324820:M460V	M	+	1	0	ARHGAP35	52115150	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	4.287000	0.59001	2.279000	0.76181	0.533000	0.62120	ATG	.	.		0.398	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
EHD2	30846	hgsc.bcm.edu	37	19	48239730	48239730	+	Silent	SNP	G	G	A	rs536783884	byFrequency	TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:48239730G>A	ENST00000263277.3	+	5	1271	c.1020G>A	c.(1018-1020)gcG>gcA	p.A340A	EHD2_ENST00000538399.1_Silent_p.A204A|EHD2_ENST00000540884.1_3'UTR	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	340					blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		TCATCTTTGCGAAGATTCAGC	0.517													G|||	4	0.000798722	0.0	0.0	5008	,	,		18590	0.0		0.0	False		,,,				2504	0.0041				p.A340A		Atlas-SNP	.											EHD2,NS,carcinoma,0,1	EHD2	59	.	0			c.G1020A						.						147.0	127.0	134.0					19																	48239730		2203	4300	6503	SO:0001819	synonymous_variant	30846	exon5			CTTTGCGAAGATT	AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.1020G>A	chr19.hg19:g.48239730G>A		117.0	0.0		124.0	19.0	NM_014601	B2RDH9|B4DNU6|Q96CB6	Silent	SNP	ENST00000263277.3	hg19	CCDS12704.1																																																																																			.	.		0.517	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465851.1		
LILRB5	10990	hgsc.bcm.edu	37	19	54759241	54759241	+	Missense_Mutation	SNP	C	C	G	rs146167320		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:54759241C>G	ENST00000316219.5	-	5	967	c.860G>C	c.(859-861)cGc>cCc	p.R287P	LILRB5_ENST00000450632.1_Missense_Mutation_p.R278P|LILRB5_ENST00000345866.6_Missense_Mutation_p.R187P|LILRB5_ENST00000449561.2_Missense_Mutation_p.R287P	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	287	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCCGTGGGAGCGGCTCACAGG	0.662																																					p.R287P		Atlas-SNP	.											.	LILRB5	176	.	0			c.G860C						.						42.0	43.0	42.0					19																	54759241		2203	4299	6502	SO:0001583	missense	10990	exon5			TGGGAGCGGCTCA	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.860G>C	chr19.hg19:g.54759241C>G	ENSP00000320390:p.Arg287Pro	149.0	0.0		149.0	7.0	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	hg19	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	0.152	-1.090490	0.01873	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	2.35	-4.71	0.03279	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	3.187420	0.01181	N	0.007095	T	0.04272	0.0118	N	0.03294	-0.36	0.09310	N	1	B;B;B;B;B	0.23185	0.012;0.081;0.034;0.066;0.003	B;B;B;B;B	0.27500	0.036;0.033;0.045;0.08;0.018	T	0.27226	-1.0080	10	0.23302	T	0.38	.	0.448	0.00497	0.3596:0.2013:0.2366:0.2026	.	278;178;187;287;287	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	P	287;278;287;187	ENSP00000320390:R287P;ENSP00000414225:R278P;ENSP00000406478:R287P;ENSP00000263430:R187P	ENSP00000320390:R287P	R	-	2	0	LILRB5	59451053	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.171000	0.00281	-3.550000	0.00142	-0.827000	0.03088	CGC	.	C|0.999;G|0.001		0.662	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
LILRB1	10859	hgsc.bcm.edu	37	19	55144168	55144168	+	Silent	SNP	C	C	T	rs377724258		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:55144168C>T	ENST00000396331.1	+	7	1272	c.915C>T	c.(913-915)tcC>tcT	p.S305S	LILRB1_ENST00000427581.2_Silent_p.S341S|LILRB1_ENST00000396315.1_Silent_p.S305S|LILRB1_ENST00000396332.4_Silent_p.S305S|LILRB1_ENST00000434867.2_Silent_p.S305S|LILRB1_ENST00000396321.2_Silent_p.S305S|LILRB1_ENST00000396317.1_Silent_p.S305S|LILRB1_ENST00000448689.1_Silent_p.S305S|LILRB1_ENST00000418536.2_Silent_p.S305S|LILRB1_ENST00000324602.7_Silent_p.S305S|LILRB1_ENST00000396327.3_Silent_p.S305S	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	305	Ig-like C2-type 3.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		ACCTCTCCTCCGAGTGGTCGG	0.692										HNSCC(37;0.09)																											p.S305S		Atlas-SNP	.											.	LILRB1	140	.	0			c.C915T						.	C	,,,	2,4404	2.1+/-5.4	0,2,2201	40.0	43.0	42.0		915,915,915,915	-3.8	0.0	19		42	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LILRB1	NM_001081637.1,NM_001081638.1,NM_001081639.1,NM_006669.3	,,,	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	,,,	305/653,305/652,305/652,305/651	55144168	2,13000	2203	4298	6501	SO:0001819	synonymous_variant	10859	exon6			CTCCTCCGAGTGG	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.915C>T	chr19.hg19:g.55144168C>T		103.0	0.0		98.0	7.0	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	hg19	CCDS42617.1																																																																																			.	.		0.692	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
PPP6R1	22870	hgsc.bcm.edu	37	19	55743228	55743228	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr19:55743228G>C	ENST00000412770.2	-	19	2814	c.2248C>G	c.(2248-2250)Cag>Gag	p.Q750E	TMEM86B_ENST00000327042.4_5'Flank|PPP6R1_ENST00000587283.1_Missense_Mutation_p.Q750E|AC010327.1_ENST00000581390.1_RNA	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	750	Pro-rich.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						GGGAGGCCCTGGGGCACACTG	0.682																																					p.Q750E		Atlas-SNP	.											.	PPP6R1	63	.	0			c.C2248G						.						9.0	12.0	11.0					19																	55743228		1913	4094	6007	SO:0001583	missense	22870	exon19			GGCCCTGGGGCAC	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.2248C>G	chr19.hg19:g.55743228G>C	ENSP00000414202:p.Gln750Glu	49.0	0.0		66.0	22.0	NM_014931	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	hg19	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.503957	0.00992	.	.	ENSG00000105063	ENST00000444538;ENST00000412770	T	0.41758	0.99	4.01	0.757	0.18427	.	2.216670	0.02914	N	0.137000	T	0.20170	0.0485	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.002;0.017	B;B	0.14023	0.003;0.01	T	0.22173	-1.0224	10	0.02654	T	1	.	5.5823	0.17256	0.3616:0.0:0.6384:0.0	.	750;112	Q9UPN7;Q96ID3	PP6R1_HUMAN;.	E	265;750	ENSP00000414202:Q750E	ENSP00000414202:Q750E	Q	-	1	0	PPP6R1	60435040	0.003000	0.15002	0.001000	0.08648	0.009000	0.06853	1.010000	0.29898	0.267000	0.21916	0.561000	0.74099	CAG	.	.		0.682	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
TMC2	117532	hgsc.bcm.edu	37	20	2593864	2593864	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr20:2593864G>A	ENST00000358864.1	+	14	1783	c.1768G>A	c.(1768-1770)Gac>Aac	p.D590N	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	590					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GACGGTGTCTGACATGCTGGT	0.557																																					p.D590N		Atlas-SNP	.											.	TMC2	121	.	0			c.G1768A						.						185.0	140.0	155.0					20																	2593864		2203	4300	6503	SO:0001583	missense	117532	exon14			GTGTCTGACATGC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1768G>A	chr20.hg19:g.2593864G>A	ENSP00000351732:p.Asp590Asn	83.0	0.0		123.0	42.0	NM_080751	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	hg19	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	G	31	5.092155	0.94149	.	.	ENSG00000149488	ENST00000358864	T	0.72051	-0.62	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.82628	0.5078	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.84655	0.0703	10	0.87932	D	0	-27.6504	16.0339	0.80608	0.0:0.0:1.0:0.0	.	421;422;590;590	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	N	590	ENSP00000351732:D590N	ENSP00000351732:D590N	D	+	1	0	TMC2	2541864	1.000000	0.71417	0.960000	0.40013	0.922000	0.55478	9.544000	0.98092	2.460000	0.83146	0.655000	0.94253	GAC	.	.		0.557	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
FERMT1	55612	hgsc.bcm.edu	37	20	6100146	6100146	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr20:6100146T>C	ENST00000217289.4	-	2	844	c.56A>G	c.(55-57)gAc>gGc	p.D19G	FERMT1_ENST00000536936.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	19					cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						ATTGGGATGGTCAACGCGGAC	0.468																																					p.D19G		Atlas-SNP	.											.	FERMT1	106	.	0			c.A56G						.						201.0	140.0	160.0					20																	6100146		2203	4300	6503	SO:0001583	missense	55612	exon2			GGATGGTCAACGC	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.56A>G	chr20.hg19:g.6100146T>C	ENSP00000217289:p.Asp19Gly	96.0	0.0		136.0	24.0	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	hg19	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	T	10.62	1.399942	0.25291	.	.	ENSG00000101311	ENST00000217289;ENST00000339538;ENST00000378844	T;T	0.58060	0.36;0.36	5.93	5.93	0.95920	.	0.089898	0.85682	D	0.000000	T	0.53997	0.1831	L	0.46741	1.465	0.80722	D	1	P;B	0.37824	0.609;0.262	B;B	0.43990	0.438;0.187	T	0.48801	-0.9003	10	0.27082	T	0.32	0.154	16.3756	0.83387	0.0:0.0:0.0:1.0	.	19;19	Q9BQL6-4;Q9BQL6	.;FERM1_HUMAN	G	19	ENSP00000217289:D19G;ENSP00000368121:D19G	ENSP00000217289:D19G	D	-	2	0	FERMT1	6048146	1.000000	0.71417	0.205000	0.23548	0.012000	0.07955	7.394000	0.79862	2.270000	0.75569	0.460000	0.39030	GAC	.	.		0.468	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
ID1	3397	hgsc.bcm.edu	37	20	30193892	30193892	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr20:30193892C>A	ENST00000376112.3	+	2	568	c.463C>A	c.(463-465)Cgc>Agc	p.R155S	ID1_ENST00000376105.3_3'UTR|MIR3193_ENST00000578262.1_RNA	NM_002165.3	NP_002156.2	P41134	ID1_HUMAN	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	155					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|collagen metabolic process (GO:0032963)|endothelial cell morphogenesis (GO:0001886)|heart development (GO:0007507)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein destabilization (GO:0031648)|regulation of angiogenesis (GO:0045765)|regulation of MAPK cascade (GO:0043408)|response to antibiotic (GO:0046677)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|ovary(1)|pancreas(1)	4	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			CATCTTGTGTCGCTGAAGCGC	0.652																																					p.R155S	NSCLC(123;1618 1779 21803 28680 33854)	Atlas-SNP	.											.	ID1	12	.	0			c.C463A						.						41.0	41.0	41.0					20																	30193892		2203	4300	6503	SO:0001583	missense	3397	exon2			TTGTGTCGCTGAA		CCDS13185.1, CCDS13186.1	20q11	2013-05-21			ENSG00000125968	ENSG00000125968		"""Basic helix-loop-helix proteins"""	5360	protein-coding gene	gene with protein product	"""DNA-binding protein inhibitor ID-1"""	600349				8294468	Standard	NM_002165		Approved	dJ857M17.1.2, bHLHb24	uc002wwg.2	P41134	OTTHUMG00000032181	ENST00000376112.3:c.463C>A	chr20.hg19:g.30193892C>A	ENSP00000365280:p.Arg155Ser	35.0	0.0		66.0	18.0	NM_002165	A8K537|E1P5L4|O00651|O00652|Q16371|Q16377|Q5TE66|Q5TE67|Q969Z7|Q9H0Z5|Q9H109	Missense_Mutation	SNP	ENST00000376112.3	hg19	CCDS13185.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436165	0.62955	.	.	ENSG00000125968	ENST00000376112	T	0.61510	0.1	4.76	3.81	0.43845	.	0.317846	0.34777	N	0.003699	T	0.47619	0.1455	L	0.36672	1.1	0.80722	D	1	D	0.54207	0.965	B	0.44085	0.44	T	0.51092	-0.8749	10	0.87932	D	0	.	8.9282	0.35655	0.0:0.8993:0.0:0.1007	.	155	P41134	ID1_HUMAN	S	155	ENSP00000365280:R155S	ENSP00000365280:R155S	R	+	1	0	ID1	29657553	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	1.291000	0.33330	1.232000	0.43678	-0.300000	0.09419	CGC	.	.		0.652	ID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078550.1	NM_002165	
PLCG1	5335	hgsc.bcm.edu	37	20	39802780	39802780	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr20:39802780T>G	ENST00000373271.1	+	31	4064	c.3659T>G	c.(3658-3660)cTc>cGc	p.L1220R	PLCG1_ENST00000608689.1_3'UTR|PLCG1_ENST00000244007.3_Missense_Mutation_p.L1221R|PLCG1_ENST00000373272.2_Missense_Mutation_p.L1221R	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1220					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				AATGGTGACCTCAGTCCCTTC	0.607																																					p.L1221R		Atlas-SNP	.											.	PLCG1	111	.	0			c.T3662G						.						74.0	78.0	76.0					20																	39802780		2203	4300	6503	SO:0001583	missense	5335	exon31			GTGACCTCAGTCC	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3659T>G	chr20.hg19:g.39802780T>G	ENSP00000362368:p.Leu1220Arg	39.0	0.0		64.0	29.0	NM_002660	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	hg19	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.454676	0.26161	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.54279	0.58;0.58;0.58	5.43	5.43	0.79202	.	0.779744	0.12162	N	0.493913	T	0.41766	0.1173	L	0.34521	1.04	0.21386	N	0.999706	B;B;B	0.21905	0.062;0.01;0.01	B;B;B	0.23150	0.044;0.014;0.014	T	0.33803	-0.9854	10	0.72032	D	0.01	.	6.7109	0.23276	0.1359:0.0741:0.0:0.79	.	1221;1220;1221	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	R	1221;1220;1221	ENSP00000244007:L1221R;ENSP00000362368:L1220R;ENSP00000362369:L1221R	ENSP00000244007:L1221R	L	+	2	0	PLCG1	39236194	0.826000	0.29277	0.998000	0.56505	0.749000	0.42624	2.265000	0.43311	2.062000	0.61559	0.374000	0.22700	CTC	.	.		0.607	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811	
TPTE	7179	hgsc.bcm.edu	37	21	10933910	10933910	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:10933910A>C	ENST00000361285.4	-	17	1298	c.969T>G	c.(967-969)aaT>aaG	p.N323K	TPTE_ENST00000342420.5_Missense_Mutation_p.N285K|TPTE_ENST00000298232.7_Missense_Mutation_p.N305K|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	323	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCATCCACTCATTTACTTCCT	0.328																																					p.N323K		Atlas-SNP	.											.	TPTE	513	.	0			c.T969G						.						252.0	252.0	252.0					21																	10933910		2203	4297	6500	SO:0001583	missense	7179	exon17			CCACTCATTTACT	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.969T>G	chr21.hg19:g.10933910A>C	ENSP00000355208:p.Asn323Lys	946.0	0.0		1005.0	73.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	hg19	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	0.326	-0.958985	0.02267	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	T;T;T	0.26810	1.71;1.71;1.71	2.07	-0.561	0.11785	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.562019	0.18308	U	0.145211	T	0.07863	0.0197	N	0.04203	-0.255	0.22017	N	0.999416	B;B;B	0.11235	0.001;0.001;0.004	B;B;B	0.20577	0.006;0.01;0.03	T	0.31888	-0.9927	10	0.09843	T	0.71	-0.6319	2.6663	0.05053	0.6197:0.0:0.1522:0.2282	.	285;305;323	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	K	305;323;285	ENSP00000298232:N305K;ENSP00000355208:N323K;ENSP00000344441:N285K	ENSP00000298232:N305K	N	-	3	2	TPTE	9955781	0.000000	0.05858	0.006000	0.13384	0.576000	0.36127	-0.656000	0.05342	-0.125000	0.11703	0.163000	0.16589	AAT	.	.		0.328	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
TMPRSS15	5651	hgsc.bcm.edu	37	21	19715849	19715849	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:19715849T>A	ENST00000284885.3	-	12	1435	c.1402A>T	c.(1402-1404)Acc>Tcc	p.T468S		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	468	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCATTTAGGGTTACTTGTCCA	0.284																																					p.T468S		Atlas-SNP	.											.	TMPRSS15	189	.	0			c.A1402T						.						79.0	66.0	71.0					21																	19715849		2200	4292	6492	SO:0001583	missense	5651	exon12			TTAGGGTTACTTG		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1402A>T	chr21.hg19:g.19715849T>A	ENSP00000284885:p.Thr468Ser	182.0	0.0		228.0	77.0	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	hg19	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.180688	0.78677	.	.	ENSG00000154646	ENST00000284885	T	0.02236	4.38	5.18	5.18	0.71444	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.08980	0.0222	L	0.49256	1.55	0.45594	D	0.998538	D	0.89917	1.0	D	0.97110	1.0	T	0.21484	-1.0244	9	.	.	.	.	14.497	0.67694	0.0:0.0:0.0:1.0	.	468	P98073	ENTK_HUMAN	S	468	ENSP00000284885:T468S	.	T	-	1	0	TMPRSS15	18637720	1.000000	0.71417	0.981000	0.43875	0.983000	0.72400	6.029000	0.70895	2.089000	0.63090	0.455000	0.32223	ACC	.	.		0.284	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
NCAM2	4685	hgsc.bcm.edu	37	21	22906918	22906918	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:22906918T>A	ENST00000400546.1	+	17	2592	c.2343T>A	c.(2341-2343)aaT>aaA	p.N781K	NCAM2_ENST00000284894.7_Missense_Mutation_p.N639K	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	781					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GAGTTACTAATCACGAAGATG	0.398																																					p.N781K		Atlas-SNP	.											.	NCAM2	220	.	0			c.T2343A						.						119.0	112.0	115.0					21																	22906918		1897	4118	6015	SO:0001583	missense	4685	exon17			TACTAATCACGAA		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2343T>A	chr21.hg19:g.22906918T>A	ENSP00000383392:p.Asn781Lys	147.0	0.0		127.0	52.0	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	hg19	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.798143	0.50208	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.51574	0.7;0.7	5.49	-0.0574	0.13801	.	0.146598	0.64402	D	0.000016	T	0.39358	0.1075	L	0.54323	1.7	0.80722	D	1	B;B	0.24186	0.099;0.043	B;B	0.22601	0.04;0.016	T	0.30563	-0.9974	10	0.87932	D	0	-28.0276	9.6475	0.39877	0.0:0.4699:0.0:0.5301	.	639;781	B7Z5K2;O15394	.;NCAM2_HUMAN	K	781;639	ENSP00000383392:N781K;ENSP00000284894:N639K	ENSP00000284894:N639K	N	+	3	2	NCAM2	21828789	0.987000	0.35691	0.998000	0.56505	0.955000	0.61496	0.139000	0.16036	-0.014000	0.14175	0.377000	0.23210	AAT	.	.		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
HUNK	30811	hgsc.bcm.edu	37	21	33370991	33370991	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:33370991A>T	ENST00000270112.2	+	11	1999	c.1639A>T	c.(1639-1641)Atc>Ttc	p.I547F		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	547					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						AAGCACTGGCATCCCCCACAA	0.607																																					p.I547F		Atlas-SNP	.											.	HUNK	74	.	0			c.A1639T						.						89.0	69.0	76.0					21																	33370991		2203	4300	6503	SO:0001583	missense	30811	exon11			ACTGGCATCCCCC	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1639A>T	chr21.hg19:g.33370991A>T	ENSP00000270112:p.Ile547Phe	96.0	0.0		83.0	27.0	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	hg19	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	A	2.561	-0.301881	0.05495	.	.	ENSG00000142149	ENST00000270112	T	0.69685	-0.42	4.55	-7.31	0.01441	.	1.441670	0.04140	N	0.319368	T	0.42585	0.1209	N	0.19112	0.55	0.09310	N	1	B	0.24823	0.112	B	0.19148	0.024	T	0.31752	-0.9932	10	0.10111	T	0.7	-0.6533	7.6784	0.28499	0.3063:0.4238:0.27:0.0	.	547	P57058	HUNK_HUMAN	F	547	ENSP00000270112:I547F	ENSP00000270112:I547F	I	+	1	0	HUNK	32292862	0.000000	0.05858	0.000000	0.03702	0.172000	0.22775	-0.872000	0.04219	-1.703000	0.01409	0.402000	0.26972	ATC	.	.		0.607	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
DYRK1A	1859	hgsc.bcm.edu	37	21	38850602	38850602	+	Splice_Site	SNP	G	G	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:38850602G>C	ENST00000398960.2	+	3	402	c.327G>C	c.(325-327)gaG>gaC	p.E109D	DYRK1A_ENST00000451934.1_Splice_Site_p.E109D|DYRK1A_ENST00000339659.4_Splice_Site_p.E100D|DYRK1A_ENST00000398956.2_Splice_Site_p.E109D|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000338785.3_Splice_Site_p.E109D|DYRK1A_ENST00000321219.8_Splice_Site_p.E109D	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	109					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ATATTAATGAGGTAAGACTTG	0.373																																					p.E109D	Melanoma(114;464 1602 31203 43785 45765)	Atlas-SNP	.											.	DYRK1A	85	.	0			c.G327C						.						79.0	79.0	79.0					21																	38850602		2203	4300	6503	SO:0001630	splice_region_variant	1859	exon3			TAATGAGGTAAGA	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.327+1G>C	chr21.hg19:g.38850602G>C		94.0	0.0		71.0	13.0	NM_001396	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	hg19	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881521	0.91740	.	.	ENSG00000157540	ENST00000338785;ENST00000426672;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	T;T;T;T;T;T;T	0.59638	0.36;0.42;0.25;0.38;0.36;0.26;0.37	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.75903	0.3913	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.67145	0.974;0.974;0.996;0.995;0.974	D;D;D;D;D	0.67725	0.953;0.953;0.913;0.946;0.953	T	0.76748	-0.2845	10	0.62326	D	0.03	.	19.8326	0.96642	0.0:0.0:1.0:0.0	.	109;109;109;100;109	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	D	109;109;100;109;109;109;109	ENSP00000342690:E109D;ENSP00000412269:E109D;ENSP00000340373:E100D;ENSP00000319032:E109D;ENSP00000416089:E109D;ENSP00000381932:E109D;ENSP00000381929:E109D	ENSP00000319032:E109D	E	+	3	2	DYRK1A	37772472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.805000	0.99149	2.686000	0.91538	0.591000	0.81541	GAG	.	.		0.373	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396	Missense_Mutation
HSF2BP	11077	hgsc.bcm.edu	37	21	45076519	45076519	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:45076519G>A	ENST00000291560.2	-	3	467	c.136C>T	c.(136-138)Cta>Tta	p.L46L	RRP1B_ENST00000340648.4_5'Flank|HSF2BP_ENST00000542962.1_Intron	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	46					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		TCCCCATTTAGTATTCTGGGT	0.398																																					p.L46L		Atlas-SNP	.											.	HSF2BP	28	.	0			c.C136T						.						140.0	137.0	138.0					21																	45076519		2203	4300	6503	SO:0001819	synonymous_variant	11077	exon3			CATTTAGTATTCT	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.136C>T	chr21.hg19:g.45076519G>A		102.0	0.0		86.0	29.0	NM_007031	B4DX36	Silent	SNP	ENST00000291560.2	hg19	CCDS13697.1																																																																																			.	.		0.398	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195620.1	NM_007031	
KRTAP10-9	386676	hgsc.bcm.edu	37	21	46047944	46047944	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:46047944T>A	ENST00000397911.3	+	1	905	c.856T>A	c.(856-858)Tca>Aca	p.S286T	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	286						keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CAGCTTCTCCTCAGGCCAGAA	0.701																																					p.S286T		Atlas-SNP	.											.	KRTAP10-9	24	.	0			c.T856A						.						54.0	68.0	63.0					21																	46047944		2173	4280	6453	SO:0001583	missense	386676	exon1			TTCTCCTCAGGCC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.856T>A	chr21.hg19:g.46047944T>A	ENSP00000381009:p.Ser286Thr	55.0	0.0		50.0	9.0	NM_198690	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	hg19	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	t	5.656	0.305714	0.10733	.	.	ENSG00000221837	ENST00000397911	T	0.00776	5.71	2.43	2.43	0.29744	.	.	.	.	.	T	0.02571	0.0078	M	0.66939	2.045	0.09310	N	1	D	0.53885	0.963	D	0.67231	0.95	T	0.44574	-0.9319	8	.	.	.	.	4.5739	0.12223	0.0:0.1709:0.0:0.8291	.	286	P60411	KR109_HUMAN	T	286	ENSP00000381009:S286T	.	S	+	1	0	KRTAP10-9	44872372	0.009000	0.17119	0.018000	0.16275	0.018000	0.09664	0.803000	0.27083	1.049000	0.40321	0.460000	0.39030	TCA	.	.		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1		
SPATC1L	84221	hgsc.bcm.edu	37	21	47602716	47602716	+	Silent	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:47602716G>A	ENST00000291672.5	-	2	1076	c.15C>T	c.(13-15)ggC>ggT	p.G5G	AP001468.58_ENST00000415026.1_RNA|SPATC1L_ENST00000330205.6_Intron	NM_001142854.1	NP_001136326.1	Q9H0A9	SPC1L_HUMAN	spermatogenesis and centriole associated 1-like	5																	TCATCAGCTCGCCGCCTTCAG	0.662																																					p.G5G		Atlas-SNP	.											.	.	.	.	0			c.C15T						.						7.0	8.0	8.0					21																	47602716		684	1581	2265	SO:0001819	synonymous_variant	84221	exon2			CAGCTCGCCGCCT	BC009497	CCDS13732.1, CCDS46653.1	21q22.3	2013-01-21	2012-11-12	2012-11-12	ENSG00000160284	ENSG00000160284			1298	protein-coding gene	gene with protein product	"""speriolin-like protein"""	612412	"""chromosome 21 open reading frame 56"""	C21orf56			Standard	NM_032261		Approved		uc011afu.2	Q9H0A9	OTTHUMG00000090487	ENST00000291672.5:c.15C>T	chr21.hg19:g.47602716G>A		71.0	0.0		48.0	8.0	NM_001142854	B4E323|Q52LS9|Q6FIH5|Q6P0L3|Q9NSE5	Silent	SNP	ENST00000291672.5	hg19	CCDS46653.1																																																																																			.	.		0.662	SPATC1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376654.1	NM_032261	
GAB4	128954	hgsc.bcm.edu	37	22	17472883	17472883	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr22:17472883T>C	ENST00000400588.1	-	2	465	c.358A>G	c.(358-360)Atg>Gtg	p.M120V	GAB4_ENST00000523144.1_5'UTR	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	120	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				ATGTCAAACATATAGCCCTTC	0.502																																					p.M120V		Atlas-SNP	.											.	GAB4	95	.	0			c.A358G						.						258.0	268.0	264.0					22																	17472883		2202	4300	6502	SO:0001583	missense	128954	exon2			CAAACATATAGCC	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.358A>G	chr22.hg19:g.17472883T>C	ENSP00000383431:p.Met120Val	112.0	0.0		110.0	19.0	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	hg19	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.447366	0.00178	.	.	ENSG00000215568	ENST00000400588	T	0.10763	2.84	1.81	0.667	0.17907	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.263614	0.31347	N	0.007801	T	0.02230	0.0069	N	0.01096	-1.015	0.29239	N	0.872775	B	0.11235	0.004	B	0.09377	0.004	T	0.41342	-0.9514	10	0.08381	T	0.77	.	4.0272	0.09693	0.0:0.4447:0.0:0.5553	.	120	Q2WGN9	GAB4_HUMAN	V	120	ENSP00000383431:M120V	ENSP00000383431:M120V	M	-	1	0	GAB4	15852883	1.000000	0.71417	0.546000	0.28166	0.123000	0.20343	2.693000	0.47027	0.206000	0.20587	0.482000	0.46254	ATG	.	.		0.502	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
PES1	23481	hgsc.bcm.edu	37	22	30977601	30977601	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr22:30977601C>G	ENST00000405677.1	-	9	1187	c.244G>C	c.(244-246)Gcc>Ccc	p.A82P	PES1_ENST00000354694.7_Missense_Mutation_p.A221P|PES1_ENST00000402281.1_Missense_Mutation_p.A82P|PES1_ENST00000335214.6_Missense_Mutation_p.A221P|PES1_ENST00000402284.3_Missense_Mutation_p.A204P	NM_001282328.1	NP_001269257.1			pescadillo ribosomal biogenesis factor 1											breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						GTGAAGGTGGCCATGACCCTG	0.587																																					p.A221P		Atlas-SNP	.											.	PES1	55	.	0			c.G661C						.						101.0	71.0	81.0					22																	30977601		2203	4300	6503	SO:0001583	missense	23481	exon7			AGGTGGCCATGAC	U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000405677.1:c.244G>C	chr22.hg19:g.30977601C>G	ENSP00000385654:p.Ala82Pro	75.0	0.0		82.0	16.0	NM_014303		Missense_Mutation	SNP	ENST00000405677.1	hg19		.	.	.	.	.	.	.	.	.	.	C	30	5.049898	0.93740	.	.	ENSG00000100029	ENST00000354694;ENST00000402281;ENST00000405677;ENST00000402284;ENST00000335214	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.62109	0.2401	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.64830	0.991;0.994;0.993;0.991	P;D;P;P	0.63597	0.876;0.916;0.801;0.876	T	0.64968	-0.6282	10	0.56958	D	0.05	-27.1835	16.3155	0.82918	0.0:1.0:0.0:0.0	.	221;204;221;221	B2RDF2;B5MCF9;O00541-2;O00541	.;.;.;PESC_HUMAN	P	221;82;82;204;221	ENSP00000346725:A221P;ENSP00000384366:A82P;ENSP00000385654:A82P;ENSP00000384252:A204P;ENSP00000334612:A221P	ENSP00000334612:A221P	A	-	1	0	PES1	29307601	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.132000	0.77251	2.388000	0.81334	0.655000	0.94253	GCC	.	.		0.587	PES1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000321189.2	NM_014303	
TAB3	257397	hgsc.bcm.edu	37	X	30871043	30871043	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chrX:30871043T>C	ENST00000378933.1	-	4	1739	c.1562A>G	c.(1561-1563)cAt>cGt	p.H521R	TAB3_ENST00000378932.2_Missense_Mutation_p.H521R|TAB3_ENST00000288422.2_Missense_Mutation_p.H521R|TAB3_ENST00000378930.3_Missense_Mutation_p.H521R|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378928.1_5'Flank	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	521					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						TGCTCGTTGATGTAACAGCAA	0.408																																					p.H521R	Pancreas(164;1598 1985 29022 43301 49529)	Atlas-SNP	.											.	TAB3	82	.	0			c.A1562G						.						152.0	100.0	118.0					X																	30871043		2202	4300	6502	SO:0001583	missense	257397	exon7			CGTTGATGTAACA	AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.1562A>G	chrX.hg19:g.30871043T>C	ENSP00000368215:p.His521Arg	17.0	0.0		15.0	8.0	NM_152787	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	hg19	CCDS14226.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.366911	0.82463	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.22	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.87962	0.6310	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.78314	0.986;0.991	D	0.89192	0.3551	10	0.87932	D	0	-5.6731	14.8121	0.70003	0.0:0.0:0.0:1.0	.	521;521	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	R	521	ENSP00000368215:H521R;ENSP00000368212:H521R;ENSP00000288422:H521R;ENSP00000368214:H521R	ENSP00000288422:H521R	H	-	2	0	TAB3	30780964	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.635000	0.83286	1.947000	0.56498	0.412000	0.27726	CAT	.	.		0.408	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056173.1	NM_152787	
CHM	1121	hgsc.bcm.edu	37	X	85218702	85218702	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chrX:85218702C>A	ENST00000357749.2	-	5	699	c.670G>T	c.(670-672)Ggc>Tgc	p.G224C	CHM_ENST00000467744.2_Intron|CHM_ENST00000537751.1_Missense_Mutation_p.G76C	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	224					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				AATCTCCTGCCTTCTTTAATA	0.338																																					p.G224C		Atlas-SNP	.											.	CHM	57	.	0			c.G670T						.						61.0	51.0	54.0					X																	85218702		2203	4300	6503	SO:0001583	missense	1121	exon5			TCCTGCCTTCTTT	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.670G>T	chrX.hg19:g.85218702C>A	ENSP00000350386:p.Gly224Cys	33.0	0.0		31.0	12.0	NM_000390	A1L4D2|O43732	Missense_Mutation	SNP	ENST00000357749.2	hg19	CCDS14454.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925129	0.52759	.	.	ENSG00000188419	ENST00000357749;ENST00000537751	D;D	0.86432	-2.12;-2.12	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.93926	0.8056	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94960	0.8107	10	0.66056	D	0.02	-7.4156	16.7714	0.85538	0.0:1.0:0.0:0.0	.	224	P24386	RAE1_HUMAN	C	224;76	ENSP00000350386:G224C;ENSP00000441728:G76C	ENSP00000350386:G224C	G	-	1	0	CHM	85105358	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	6.561000	0.73955	1.962000	0.57031	0.284000	0.19432	GGC	.	.		0.338	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057396.3	NM_000390	
CETN2	1069	hgsc.bcm.edu	37	X	151997125	151997125	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chrX:151997125C>T	ENST00000370277.3	-	4	451	c.385G>A	c.(385-387)Gtg>Atg	p.V129M	NSDHL_ENST00000370274.3_5'Flank|NSDHL_ENST00000440023.1_5'Flank|CETN2_ENST00000493482.1_5'UTR	NM_004344.1	NP_004335.1	P41208	CETN2_HUMAN	centrin, EF-hand protein, 2	129	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)|regulation of cytokinesis (GO:0032465)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|intracellular (GO:0005622)|photoreceptor connecting cilium (GO:0032391)|XPC complex (GO:0071942)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(1)|lung(4)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTTGGCCACGCGTTTCAGA	0.423								Direct reversal of damage;Nucleotide excision repair (NER)																													p.V129M		Atlas-SNP	.											.	CETN2	23	.	0			c.G385A						.						136.0	118.0	124.0					X																	151997125		2203	4300	6503	SO:0001583	missense	1069	exon4			TGGCCACGCGTTT	X72964	CCDS14716.1	Xq28	2013-01-10			ENSG00000147400	ENSG00000147400		"""EF-hand domain containing"""	1867	protein-coding gene	gene with protein product		300006		CALT		7713520, 8597638	Standard	NM_004344		Approved	CEN2	uc004fgq.3	P41208	OTTHUMG00000024246	ENST00000370277.3:c.385G>A	chrX.hg19:g.151997125C>T	ENSP00000359300:p.Val129Met	105.0	0.0		107.0	36.0	NM_004344	B2R4T4|Q53XW1	Missense_Mutation	SNP	ENST00000370277.3	hg19	CCDS14716.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479132	0.84747	.	.	ENSG00000147400	ENST00000370277	T	0.77877	-1.13	6.17	5.31	0.75309	EF-hand-like domain (1);	1.744950	0.03434	N	0.208355	D	0.84745	0.5540	M	0.66506	2.035	0.80722	D	1	P	0.49090	0.919	P	0.50659	0.647	T	0.69371	-0.5163	10	0.87932	D	0	.	11.9876	0.53157	0.0:0.9156:0.0:0.0844	.	129	P41208	CETN2_HUMAN	M	129	ENSP00000359300:V129M	ENSP00000359300:V129M	V	-	1	0	CETN2	151747781	1.000000	0.71417	0.715000	0.30552	0.952000	0.60782	7.664000	0.83830	1.348000	0.45733	0.600000	0.82982	GTG	.	.		0.423	CETN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061197.1	NM_004344	
MT-ND1	4535	hgsc.bcm.edu	37	M	3427	3427	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chrM:3427G>A	ENST00000361390.2	+	1	121	c.121G>A	c.(121-123)Ggc>Agc	p.G41S	MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TN_ENST00000387400.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	41					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCAACGTTGTAGGCCCCTACG	0.483																																					p.G41S		Atlas-SNP	.											.	.	.	.	0			c.G121A						.																																			SO:0001583	missense	10625	exon1			GTTGTAGGCCCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.121G>A	chrM.hg19:g.3427G>A	ENSP00000354687:p.Gly41Ser	35.0	0.0		21.0	21.0	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.		0.483	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
SIK2	23235	hgsc.bcm.edu	37	11	111591239	111591239	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:111591239delC	ENST00000304987.3	+	11	1706	c.1533delC	c.(1531-1533)gacfs	p.D511fs	SIK2_ENST00000533868.1_3'UTR	NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	511					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						CCTCCCTTGACAGTGTGGACT	0.443																																					p.D511fs		Atlas-INDEL	.											.	SIK2	89	.	0			c.1532delA						.						100.0	102.0	101.0					11																	111591239		2201	4297	6498	SO:0001589	frameshift_variant	23235	exon11			.	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1533delC	chr11.hg19:g.111591239delC	ENSP00000305976:p.Asp511fs	108.0	0.0		56.0	11.0	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Frame_Shift_Del	DEL	ENST00000304987.3	hg19	CCDS8347.1																																																																																			.	.		0.443	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
KIAA2026	158358	hgsc.bcm.edu	37	9	5968486	5968487	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr9:5968486_5968487insT	ENST00000399933.3	-	3	1743_1744	c.1744_1745insA	c.(1744-1746)actfs	p.T582fs	KIAA2026_ENST00000381461.2_Frame_Shift_Ins_p.T582fs	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	582										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACAACAATCAGTTTTTTTAATT	0.356																																					p.T582fs		Atlas-INDEL	.											.	KIAA2026	231	.	0			c.1745_1746insA						.																																			SO:0001589	frameshift_variant	158358	exon3			.	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1745dupA	chr9.hg19:g.5968493_5968493dupT	ENSP00000382815:p.Thr582fs	57.0	0.0		62.0	22.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Frame_Shift_Ins	INS	ENST00000399933.3	hg19																																																																																				.	.		0.356	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
AXIN1	8312	hgsc.bcm.edu	37	16	348025	348025	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr16:348025delG	ENST00000262320.3	-	6	1852	c.1481delC	c.(1480-1482)ccgfs	p.P494fs	AXIN1_ENST00000481769.1_5'UTR|AXIN1_ENST00000354866.3_Frame_Shift_Del_p.P494fs	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	494	Interaction with CTNNB1. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCCACTGTCCGGGGAGCGATG	0.687																																					p.P494fs		Atlas-INDEL	.											.	AXIN1	290	.	0			c.1482delG						.						26.0	22.0	23.0					16																	348025		2196	4291	6487	SO:0001589	frameshift_variant	8312	exon6			.	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1481delC	chr16.hg19:g.348025delG	ENSP00000262320:p.Pro494fs	35.0	0.0		31.0	14.0	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Del	DEL	ENST00000262320.3	hg19	CCDS10405.1																																																																																			.	.		0.687	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
KRTAP25-1	100131902	hgsc.bcm.edu	37	21	31661779	31661780	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr21:31661779_31661780insA	ENST00000416044.1	-	1	52_53	c.29_30insT	c.(28-30)ttcfs	p.F10fs		NM_001128598.1	NP_001122070.1	Q3LHN0	KR251_HUMAN	keratin associated protein 25-1	10						intermediate filament (GO:0005882)				breast(1)	1						GGCAACTACTGAAAAAAAAGCC	0.421																																					p.F10fs		Atlas-INDEL	.											.,1	KRTAP25-1	13	.	0			c.30_31insT						.																																			SO:0001589	frameshift_variant	100131902	exon1			.		CCDS46640.1	21q22.1	2010-10-18	2008-02-26	2008-04-22	ENSG00000232263	ENSG00000232263		"""Keratin associated proteins"""	34003	protein-coding gene	gene with protein product							Standard	NM_001128598		Approved	KAP25.1	uc010glr.1	Q3LHN0	OTTHUMG00000125482	ENST00000416044.1:c.30dupT	chr21.hg19:g.31661787_31661787dupA	ENSP00000398619:p.Phe10fs	127.0	0.0		109.0	17.0	NM_001128598		Frame_Shift_Ins	INS	ENST00000416044.1	hg19	CCDS46640.1																																																																																			.	.		0.421	KRTAP25-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246805.1	NM_001128598	
ZCCHC2	54877	hgsc.bcm.edu	37	18	60217605	60217618	+	Frame_Shift_Del	DEL	ACTTTTGACAAGAC	ACTTTTGACAAGAC	-	rs200012607		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	ACTTTTGACAAGAC	ACTTTTGACAAGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr18:60217605_60217618delACTTTTGACAAGAC	ENST00000269499.5	+	5	1643_1656	c.1225_1238delACTTTTGACAAGAC	c.(1225-1239)acttttgacaagaccfs	p.TFDKT409fs	ZCCHC2_ENST00000586834.1_Frame_Shift_Del_p.TFDKT88fs	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	409						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GTCTTCAGAGACTTTTGACAAGACCATCTTAAGA	0.407																																					p.408_413del		Atlas-INDEL	.											.	ZCCHC2	64	.	0			c.1224_1237del						.																																			SO:0001589	frameshift_variant	54877	exon5			.	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.1225_1238delACTTTTGACAAGAC	chr18.hg19:g.60217605_60217618delACTTTTGACAAGAC	ENSP00000269499:p.Thr409fs	117.0	0.0		72.0	12.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Frame_Shift_Del	DEL	ENST00000269499.5	hg19	CCDS45880.1																																																																																			.	.		0.407	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
MAML2	84441	hgsc.bcm.edu	37	11	95712390	95712391	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr11:95712390_95712391delAC	ENST00000524717.1	-	5	4476_4477	c.3192_3193delGT	c.(3190-3195)cagtcafs	p.QS1064fs		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	1064					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CCTGTTCCTGACTGATTCAAAT	0.495			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.1065_1065del		Atlas-INDEL	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94	.	0			c.3193_3194del						.																																			SO:0001589	frameshift_variant	84441	exon5			.	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.3192_3193delGT	chr11.hg19:g.95712390_95712391delAC	ENSP00000434552:p.Gln1064fs	64.0	0.0		65.0	17.0	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Frame_Shift_Del	DEL	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.		0.495	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
RYR3	6263	hgsc.bcm.edu	37	15	33835899	33835902	+	Frame_Shift_Del	DEL	GAAT	GAAT	-	rs538703172	byFrequency	TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	GAAT	GAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr15:33835899_33835902delGAAT	ENST00000389232.4	+	8	793_796	c.723_726delGAAT	c.(721-726)cagaatfs	p.QN241fs	RYR3_ENST00000415757.3_Frame_Shift_Del_p.QN241fs	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	241	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.Q241H(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTACAGACCAGAATGATTCCCAGC	0.392																																					p.241_242del		Atlas-INDEL	.											.	RYR3	760	.	1	Substitution - Missense(1)	lung(1)	c.722_725del						.																																			SO:0001589	frameshift_variant	6263	exon8			.		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.723_726delGAAT	chr15.hg19:g.33835899_33835902delGAAT	ENSP00000373884:p.Gln241fs	114.0	0.0		92.0	25.0	NM_001243996	O15175|Q15412	Frame_Shift_Del	DEL	ENST00000389232.4	hg19	CCDS45210.1																																																																																			.	.		0.392	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SETD2	29072	hgsc.bcm.edu	37	3	47161750	47161751	+	Frame_Shift_Ins	INS	-	-	CCATT			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr3:47161750_47161751insCCATT	ENST00000409792.3	-	3	4417_4418	c.4375_4376insAATGG	c.(4375-4377)cgafs	p.R1459fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1459					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTCCTTCCATCGCTGTGGGTCC	0.446			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.R1459fs		Atlas-INDEL	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.4376_4377insAATGG						.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4375_4376insAATGG	chr3.hg19:g.47161750_47161751insCCATT	ENSP00000386759:p.Arg1459fs	88.0	0.0		81.0	18.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.		0.446	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
GP1BA	2811	hgsc.bcm.edu	37	17	4837179	4837190	+	In_Frame_Del	DEL	CCTCAGAGCCCG	CCTCAGAGCCCG	-	rs187469311		TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	CCTCAGAGCCCG	CCTCAGAGCCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr17:4837179_4837190delCCTCAGAGCCCG	ENST00000329125.5	+	2	1355_1366	c.1280_1291delCCTCAGAGCCCG	c.(1279-1293)acctcagagcccgcc>acc	p.SEPA428del		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	428	Pro/Thr-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						ccggagcccacctcagagcccgcccccagccc	0.736																																					p.427_430del		Atlas-INDEL	.											.	GP1BA	53	.	0			c.1279_1290del						.																																			SO:0001651	inframe_deletion	2811	exon2			.		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1280_1291delCCTCAGAGCCCG	chr17.hg19:g.4837179_4837190delCCTCAGAGCCCG	ENSP00000329380:p.Ser428_Ala431del	36.0	0.0		42.0	15.0	NM_000173	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	In_Frame_Del	DEL	ENST00000329125.5	hg19	CCDS54068.1																																																																																			.	.		0.736	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1		
PNN	5411	hgsc.bcm.edu	37	14	39650465	39650470	+	In_Frame_Del	DEL	CAGGAG	CAGGAG	-			TCGA-DD-AADO-01A-11D-A40R-10	TCGA-DD-AADO-10A-01D-A40U-10	CAGGAG	CAGGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0a3f5ccf-b8ce-4d56-af78-c4f04b7119f1	5ca67e3d-63d5-48e4-85b6-e7df2f4497ed	g.chr14:39650465_39650470delCAGGAG	ENST00000216832.4	+	9	1619_1624	c.1552_1557delCAGGAG	c.(1552-1557)caggagdel	p.QE518del	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	518	Gln-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		CCAAGTTACTCAGGAGCAAGGGCATT	0.49																																					p.517_519del		Atlas-INDEL	.											.	PNN	67	.	0			c.1551_1556del						.																																			SO:0001651	inframe_deletion	5411	exon9			.	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.1552_1557delCAGGAG	chr14.hg19:g.39650465_39650470delCAGGAG	ENSP00000216832:p.Gln518_Glu519del	113.0	0.0		105.0	21.0	NM_002687	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	In_Frame_Del	DEL	ENST00000216832.4	hg19	CCDS9671.1																																																																																			.	.		0.490	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687	
