#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FBXO42	54455	hgsc.bcm.edu	37	1	16577701	16577701	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:16577701G>C	ENST00000375592.3	-	10	1834	c.1618C>G	c.(1618-1620)Cca>Gca	p.P540A		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	540										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		ACGTGAGGTGGGGTATGCACA	0.587																																					p.P540A		Atlas-SNP	.											.	FBXO42	53	.	0			c.C1618G						.						95.0	68.0	77.0					1																	16577701		2203	4300	6503	SO:0001583	missense	54455	exon10			GAGGTGGGGTATG	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1618C>G	chr1.hg19:g.16577701G>C	ENSP00000364742:p.Pro540Ala	92.0	0.0		74.0	39.0	NM_018994	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	ENST00000375592.3	hg19	CCDS30613.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.817680	0.71028	.	.	ENSG00000037637	ENST00000375592;ENST00000456164;ENST00000444116	T;T;T	0.69926	3.28;-0.44;-0.44	5.51	5.51	0.81932	.	0.050466	0.85682	D	0.000000	T	0.72277	0.3440	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.70568	-0.4836	10	0.34782	T	0.22	-11.0311	18.7669	0.91876	0.0:0.0:1.0:0.0	.	540	Q6P3S6	FBX42_HUMAN	A	540;258;258	ENSP00000364742:P540A;ENSP00000415663:P258A;ENSP00000412416:P258A	ENSP00000364742:P540A	P	-	1	0	FBXO42	16450288	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.874000	0.92363	2.763000	0.94921	0.650000	0.86243	CCA	.	.		0.587	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
RCC2	55920	hgsc.bcm.edu	37	1	17743015	17743015	+	Silent	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:17743015G>A	ENST00000375436.4	-	8	1174	c.987C>T	c.(985-987)aaC>aaT	p.N329N	AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Silent_p.N329N	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	329					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)	p.N329N(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		GTACAACCACGTTTGGTACAG	0.552																																					p.N329N		Atlas-SNP	.											RCC2,NS,carcinoma,0,1	RCC2	46	.	1	Substitution - coding silent(1)	endometrium(1)	c.C987T						.						118.0	92.0	101.0					1																	17743015		2203	4300	6503	SO:0001819	synonymous_variant	55920	exon7			AACCACGTTTGGT		CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.987C>T	chr1.hg19:g.17743015G>A		74.0	0.0		88.0	24.0	NM_001136204	Q8IVL9|Q9BSN6|Q9NPV8	Silent	SNP	ENST00000375436.4	hg19	CCDS181.1																																																																																			.	.		0.552	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	NM_018715	
KIF17	57576	hgsc.bcm.edu	37	1	21036196	21036196	+	Silent	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:21036196C>G	ENST00000247986.2	-	4	916	c.606G>C	c.(604-606)ctG>ctC	p.L202L	KIF17_ENST00000400463.3_Silent_p.L202L|KIF17_ENST00000375044.1_Silent_p.L102L			Q9P2E2	KIF17_HUMAN	kinesin family member 17	202	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCTTGTTCATCAGCGTGTAGC	0.582																																					p.L202L		Atlas-SNP	.											.	KIF17	130	.	0			c.G606C						.						180.0	115.0	137.0					1																	21036196		2203	4300	6503	SO:0001819	synonymous_variant	57576	exon4			GTTCATCAGCGTG	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.606G>C	chr1.hg19:g.21036196C>G		126.0	0.0		147.0	8.0	NM_001122819	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	hg19	CCDS213.1																																																																																			.	.		0.582	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
PDIK1L	149420	hgsc.bcm.edu	37	1	26449068	26449068	+	Nonstop_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:26449068A>G	ENST00000374271.4	+	4	1313	c.1026A>G	c.(1024-1026)tgA>tgG	p.*342W	PDIK1L_ENST00000374269.1_Nonstop_Mutation_p.*342W	NM_001243532.1|NM_001243533.1|NM_152835.4	NP_001230461.1|NP_001230462.1|NP_690048.1	Q8N165	PDK1L_HUMAN	PDLIM1 interacting kinase 1 like	0						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		GGGAAACGTGACACATATTAT	0.383																																					p.X342W		Atlas-SNP	.											.	PDIK1L	19	.	0			c.A1026G						.						51.0	52.0	52.0					1																	26449068		2203	4300	6503	SO:0001578	stop_lost	149420	exon3			AACGTGACACATA	AF411102	CCDS274.1	1p35.1	2008-02-05			ENSG00000175087	ENSG00000175087			18981	protein-coding gene	gene with protein product		610785				14631099	Standard	NM_152835		Approved	CLIK1L	uc009vsb.3	Q8N165	OTTHUMG00000007511	ENST00000374271.4:c.1026A>G	chr1.hg19:g.26449068A>G	ENSP00000363389:p.*342Trpext*24	67.0	0.0		82.0	23.0	NM_001243532	B2R777|D3DPK2|Q5T2I0|Q8NDB3	Missense_Mutation	SNP	ENST00000374271.4	hg19	CCDS274.1	.	.	.	.	.	.	.	.	.	.	A	15.67	2.903486	0.52333	.	.	ENSG00000175087	ENST00000374271;ENST00000374269	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0365	0.80635	1.0:0.0:0.0:0.0	.	.	.	.	W	342	.	.	X	+	3	0	PDIK1L	26321655	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.923000	0.92808	2.266000	0.75297	0.533000	0.62120	TGA	.	.		0.383	PDIK1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019752.1	NM_152835	
ORC1	4998	hgsc.bcm.edu	37	1	52863529	52863529	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:52863529T>A	ENST00000371568.3	-	4	448	c.230A>T	c.(229-231)gAt>gTt	p.D77V	ORC1_ENST00000371566.1_Missense_Mutation_p.D77V	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	77	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AGGAGGAGGATCAGAGTCTAG	0.483																																					p.D77V		Atlas-SNP	.											.	ORC1	79	.	0			c.A230T						.						83.0	84.0	83.0					1																	52863529		2203	4300	6503	SO:0001583	missense	4998	exon4			GGAGGATCAGAGT		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.230A>T	chr1.hg19:g.52863529T>A	ENSP00000360623:p.Asp77Val	185.0	0.0		228.0	103.0	NM_004153	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	hg19	CCDS566.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.330032	0.60743	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	D;D	0.86164	-2.08;-2.08	5.24	5.24	0.73138	Bromo adjacent homology (BAH) domain (3);	0.539341	0.21488	N	0.073721	D	0.83640	0.5298	L	0.34521	1.04	0.24694	N	0.993296	P;P	0.40731	0.525;0.728	B;B	0.42959	0.215;0.403	T	0.78952	-0.2001	10	0.62326	D	0.03	-4.548	14.3229	0.66499	0.0:0.0:0.0:1.0	.	77;77	B7Z8H0;Q13415	.;ORC1_HUMAN	V	77	ENSP00000360623:D77V;ENSP00000360621:D77V	ENSP00000360621:D77V	D	-	2	0	ORC1	52636117	0.008000	0.16893	0.144000	0.22314	0.110000	0.19582	1.774000	0.38573	1.989000	0.58080	0.377000	0.23210	GAT	.	.		0.483	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
RAVER2	55225	hgsc.bcm.edu	37	1	65278505	65278505	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:65278505A>G	ENST00000294428.3	+	10	1843	c.1765A>G	c.(1765-1767)Agt>Ggt	p.S589G	RAVER2_ENST00000371072.4_Missense_Mutation_p.S576G|RAVER2_ENST00000430964.2_Missense_Mutation_p.S128G			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	589						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						GAATTTGGCAAGTGTGTTGCC	0.353																																					p.S576G		Atlas-SNP	.											.	RAVER2	56	.	0			c.A1726G						.						128.0	116.0	120.0					1																	65278505		1830	4088	5918	SO:0001583	missense	55225	exon10			TTGGCAAGTGTGT	AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.1765A>G	chr1.hg19:g.65278505A>G	ENSP00000294428:p.Ser589Gly	85.0	0.0		74.0	35.0	NM_018211	Q6P141|Q9NPV7	Missense_Mutation	SNP	ENST00000294428.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.75	3.690788	0.68271	.	.	ENSG00000162437	ENST00000371072;ENST00000294428;ENST00000430964	T;T;T	0.80393	-1.37;-1.37;-1.37	5.49	5.49	0.81192	.	0.095343	0.64402	D	0.000001	D	0.84624	0.5513	M	0.64404	1.975	0.43088	D	0.994755	D;D	0.71674	0.997;0.998	D;D	0.80764	0.985;0.994	D	0.85604	0.1254	10	0.48119	T	0.1	-26.8996	13.8151	0.63287	1.0:0.0:0.0:0.0	.	589;576	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	G	576;589;128	ENSP00000360112:S576G;ENSP00000294428:S589G;ENSP00000408950:S128G	ENSP00000294428:S589G	S	+	1	0	RAVER2	65051093	1.000000	0.71417	0.998000	0.56505	0.665000	0.39181	5.524000	0.67105	2.068000	0.61886	0.472000	0.43445	AGT	.	.		0.353	RAVER2-201	KNOWN	basic	protein_coding	protein_coding		NM_018211	
JAK1	3716	hgsc.bcm.edu	37	1	65332551	65332551	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:65332551T>A	ENST00000342505.4	-	7	1236	c.988A>T	c.(988-990)Aat>Tat	p.N330Y		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	330	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CCACTTACATTTGGTTTATGC	0.443			Mis		ALL																																p.N330Y		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1	209	.	0			c.A988T						.						114.0	103.0	107.0					1																	65332551		2020	4181	6201	SO:0001583	missense	3716	exon7			TTACATTTGGTTT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.988A>T	chr1.hg19:g.65332551T>A	ENSP00000343204:p.Asn330Tyr	65.0	0.0		73.0	31.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.152862	0.38021	.	.	ENSG00000162434	ENST00000342505	T	0.75477	-0.94	5.59	4.45	0.53987	FERM domain (1);	.	.	.	.	T	0.41465	0.1160	N	0.19112	0.55	0.32045	N	0.597667	B	0.06786	0.001	B	0.04013	0.001	T	0.30794	-0.9966	9	0.62326	D	0.03	-6.9504	8.7874	0.34830	0.1268:0.0:0.1328:0.7404	.	330	P23458	JAK1_HUMAN	Y	330	ENSP00000343204:N330Y	ENSP00000343204:N330Y	N	-	1	0	JAK1	65105139	0.994000	0.37717	0.998000	0.56505	0.824000	0.46624	1.548000	0.36201	1.039000	0.40074	0.533000	0.62120	AAT	.	.		0.443	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
ERICH3	127254	hgsc.bcm.edu	37	1	75112352	75112352	+	Splice_Site	SNP	T	T	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:75112352T>G	ENST00000326665.5	-	3	460	c.242A>C	c.(241-243)gAg>gCg	p.E81A		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		81										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						tatttttaCCTCCATATCAAG	0.269																																					p.E81A		Atlas-SNP	.											.	C1orf173	380	.	0			c.A242C						.						20.0	19.0	19.0					1																	75112352		1859	3494	5353	SO:0001630	splice_region_variant	127254	exon3			TTTACCTCCATAT																												ENST00000326665.5:c.243+1A>C	chr1.hg19:g.75112352T>G		345.0	0.0		414.0	182.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	hg19	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.176172	0.78564	.	.	ENSG00000178965	ENST00000326665	T	0.46063	0.88	5.71	5.71	0.89125	.	.	.	.	.	T	0.55417	0.1919	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60515	-0.7248	9	0.66056	D	0.02	-20.5177	14.9681	0.71210	0.0:0.0:0.0:1.0	.	81	Q5RHP9	CA173_HUMAN	A	81	ENSP00000322609:E81A	ENSP00000322609:E81A	E	-	2	0	C1orf173	74884940	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	6.944000	0.75940	2.179000	0.69175	0.528000	0.53228	GAG	.	.		0.269	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		Missense_Mutation
MSH4	4438	hgsc.bcm.edu	37	1	76345739	76345739	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:76345739C>T	ENST00000263187.3	+	13	1786	c.1682C>T	c.(1681-1683)tCt>tTt	p.S561F		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	561					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						AAGCAGATTTCTAAAGTGAAA	0.279								Mismatch excision repair (MMR)																													p.S561F		Atlas-SNP	.											.	MSH4	147	.	0			c.C1682T						.						54.0	53.0	54.0					1																	76345739		2194	4267	6461	SO:0001583	missense	4438	exon13			AGATTTCTAAAGT	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.1682C>T	chr1.hg19:g.76345739C>T	ENSP00000263187:p.Ser561Phe	381.0	0.0		443.0	115.0	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	hg19	CCDS670.1	.	.	.	.	.	.	.	.	.	.	C	7.608	0.674107	0.14841	.	.	ENSG00000057468	ENST00000263187	D	0.90844	-2.74	5.51	5.51	0.81932	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.110333	0.64402	D	0.000011	T	0.82195	0.4984	N	0.24115	0.695	0.43508	D	0.995765	B	0.32365	0.367	B	0.33568	0.166	D	0.83865	0.0270	10	0.72032	D	0.01	0.0486	19.415	0.94690	0.0:1.0:0.0:0.0	.	561	O15457	MSH4_HUMAN	F	561	ENSP00000263187:S561F	ENSP00000263187:S561F	S	+	2	0	MSH4	76118327	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.231000	0.58639	2.600000	0.87896	0.650000	0.86243	TCT	.	.		0.279	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
SYDE2	84144	hgsc.bcm.edu	37	1	85624884	85624884	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:85624884T>A	ENST00000341460.5	-	7	3183	c.3134A>T	c.(3133-3135)cAg>cTg	p.Q1045L		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	1045					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		AGAAGACTTCTGCTCTGGGAA	0.363																																					p.Q1045L		Atlas-SNP	.											.	SYDE2	135	.	0			c.A3134T						.						68.0	66.0	67.0					1																	85624884		1812	4074	5886	SO:0001583	missense	84144	exon7			GACTTCTGCTCTG	AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.3134A>T	chr1.hg19:g.85624884T>A	ENSP00000340594:p.Gln1045Leu	94.0	0.0		117.0	55.0	NM_032184	Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	hg19	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588701	0.46110	.	.	ENSG00000097096	ENST00000341460	T	0.07908	3.15	6.17	4.99	0.66335	.	0.285087	0.32357	N	0.006202	T	0.05823	0.0152	M	0.69823	2.125	0.34799	D	0.736485	P	0.44986	0.847	B	0.36464	0.225	T	0.10064	-1.0646	10	0.66056	D	0.02	.	13.2634	0.60120	0.0:0.0:0.132:0.868	.	1045	Q5VT97	SYDE2_HUMAN	L	1045	ENSP00000340594:Q1045L	ENSP00000340594:Q1045L	Q	-	2	0	SYDE2	85397472	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.318000	0.51975	2.371000	0.80710	0.533000	0.62120	CAG	.	.		0.363	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2		
CLCA2	9635	hgsc.bcm.edu	37	1	86904629	86904629	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:86904629T>A	ENST00000370565.4	+	7	1205	c.1043T>A	c.(1042-1044)tTc>tAc	p.F348Y		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	348	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		ATTCATACCTTCGTGGGCATT	0.423																																					p.F348Y	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Atlas-SNP	.											.	CLCA2	102	.	0			c.T1043A						.						108.0	101.0	103.0					1																	86904629		2203	4300	6503	SO:0001583	missense	9635	exon7			ATACCTTCGTGGG		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1043T>A	chr1.hg19:g.86904629T>A	ENSP00000359596:p.Phe348Tyr	102.0	0.0		117.0	6.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	hg19	CCDS708.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.654340	0.29425	.	.	ENSG00000137975	ENST00000370565	T	0.66460	-0.21	5.92	2.09	0.27110	von Willebrand factor, type A (3);	0.267481	0.38492	N	0.001678	T	0.11965	0.0291	N	0.05554	-0.025	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.31696	-0.9934	10	0.02654	T	1	-8.8915	1.0996	0.01681	0.3035:0.0873:0.2301:0.3792	.	348	Q9UQC9	CLCA2_HUMAN	Y	348	ENSP00000359596:F348Y	ENSP00000359596:F348Y	F	+	2	0	CLCA2	86677217	0.397000	0.25270	0.974000	0.42286	0.741000	0.42261	0.779000	0.26746	0.482000	0.27582	0.533000	0.62120	TTC	.	.		0.423	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
INSRR	3645	hgsc.bcm.edu	37	1	156814633	156814633	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:156814633C>T	ENST00000368195.3	-	13	2836	c.2440G>A	c.(2440-2442)Gag>Aag	p.E814K	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	814					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCATCAGCCTCTCCTGCGGGA	0.587																																					p.E814K		Atlas-SNP	.											.	INSRR	309	.	0			c.G2440A						.						42.0	45.0	44.0					1																	156814633		2203	4300	6503	SO:0001583	missense	3645	exon13			CAGCCTCTCCTGC	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2440G>A	chr1.hg19:g.156814633C>T	ENSP00000357178:p.Glu814Lys	80.0	0.0		112.0	56.0	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	hg19	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	5.097	0.203551	0.09704	.	.	ENSG00000027644	ENST00000368195	T	0.52983	0.64	4.73	4.73	0.59995	.	0.000000	0.44097	D	0.000488	T	0.10680	0.0261	.	.	.	0.38663	D	0.952139	B	0.21520	0.057	B	0.17979	0.02	T	0.10064	-1.0646	9	0.02654	T	1	.	13.1984	0.59752	0.0:1.0:0.0:0.0	.	814	P14616	INSRR_HUMAN	K	814	ENSP00000357178:E814K	ENSP00000357178:E814K	E	-	1	0	INSRR	155081257	0.996000	0.38824	1.000000	0.80357	0.972000	0.66771	1.799000	0.38824	2.181000	0.69327	0.467000	0.42956	GAG	.	.		0.587	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
SLAMF7	57823	hgsc.bcm.edu	37	1	160721146	160721146	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:160721146G>C	ENST00000368043.3	+	5	818	c.781G>C	c.(781-783)Gag>Cag	p.E261Q	SLAMF7_ENST00000458104.2_Intron|SLAMF7_ENST00000444090.2_Intron|SLAMF7_ENST00000368042.3_Missense_Mutation_p.E154Q|SLAMF7_ENST00000359331.4_Intron|SLAMF7_ENST00000441662.2_Missense_Mutation_p.E130Q|SLAMF7_ENST00000458602.2_Missense_Mutation_p.E114Q	NM_001282595.1|NM_021181.3	NP_001269524.1|NP_067004.3	Q9NQ25	SLAF7_HUMAN	SLAM family member 7	261					cell adhesion (GO:0007155)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of natural killer cell activation (GO:0032814)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(4)	24	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GTACATTGAAGAGAAGAAGAG	0.478																																					p.E261Q		Atlas-SNP	.											.	SLAMF7	54	.	0			c.G781C						.						156.0	145.0	149.0					1																	160721146		2203	4300	6503	SO:0001583	missense	57823	exon5			ATTGAAGAGAAGA	AB027233	CCDS1209.1, CCDS60321.1, CCDS60322.1, CCDS60323.1, CCDS60324.1, CCDS60325.1, CCDS72956.1, CCDS72957.1	1q23.1-q24.1	2013-01-11			ENSG00000026751	ENSG00000026751		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	21394	protein-coding gene	gene with protein product		606625				11802771, 11220635	Standard	XM_005245386		Approved	CRACC, 19A, CS1, CD319	uc001fwq.3	Q9NQ25	OTTHUMG00000024008	ENST00000368043.3:c.781G>C	chr1.hg19:g.160721146G>C	ENSP00000357022:p.Glu261Gln	102.0	0.0		146.0	6.0	NM_021181	A8K3U1|B4DPU4|B4DPY3|B4DWA3|Q8N6Y8|Q8ND32|Q9NY08|Q9NY23	Missense_Mutation	SNP	ENST00000368043.3	hg19	CCDS1209.1	.	.	.	.	.	.	.	.	.	.	G	9.468	1.094882	0.20471	.	.	ENSG00000026751	ENST00000441662;ENST00000368043;ENST00000368042;ENST00000458602	T;T;T;T	0.56103	1.82;0.48;0.48;0.99	3.95	0.0437	0.14223	.	1.442040	0.04096	N	0.312094	T	0.18002	0.0432	N	0.19112	0.55	0.09310	N	1	B;P;P;P;P	0.42203	0.275;0.718;0.634;0.773;0.501	B;B;B;B;B	0.43274	0.159;0.159;0.277;0.414;0.109	T	0.07731	-1.0757	10	0.18710	T	0.47	-0.202	6.1186	0.20139	0.4498:0.0:0.5502:0.0	.	114;130;167;154;261	B4DWA3;B4DPU4;B4DW98;Q9NQ25-2;Q9NQ25	.;.;.;.;SLAF7_HUMAN	Q	130;261;154;114	ENSP00000405605:E130Q;ENSP00000357022:E261Q;ENSP00000357021:E154Q;ENSP00000409965:E114Q	ENSP00000357021:E154Q	E	+	1	0	SLAMF7	158987770	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.491000	0.22419	0.015000	0.14971	-0.142000	0.14014	GAG	.	.		0.478	SLAMF7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060464.1	NM_021181	
LAX1	54900	hgsc.bcm.edu	37	1	203743135	203743135	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr1:203743135A>G	ENST00000442561.2	+	5	913	c.523A>G	c.(523-525)Aat>Gat	p.N175D	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.N159D	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	175					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ACACTGCATCAATGTCAGAGC	0.522																																					p.N175D		Atlas-SNP	.											.	LAX1	48	.	0			c.A523G						.						102.0	93.0	96.0					1																	203743135		2203	4300	6503	SO:0001583	missense	54900	exon5			TGCATCAATGTCA	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.523A>G	chr1.hg19:g.203743135A>G	ENSP00000406970:p.Asn175Asp	105.0	0.0		174.0	60.0	NM_017773	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	hg19	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	A	16.66	3.184482	0.57800	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.48	0.356	0.16074	.	0.389572	0.24544	N	0.037617	T	0.31451	0.0797	L	0.58101	1.795	0.09310	N	1	B;B	0.25563	0.129;0.129	B;B	0.30572	0.117;0.117	T	0.16630	-1.0396	9	0.26408	T	0.33	-8.3646	1.8891	0.03244	0.4279:0.3188:0.0883:0.1651	.	159;175	B7Z744;Q8IWV1	.;LAX1_HUMAN	D	175;159	.	ENSP00000356186:N159D	N	+	1	0	LAX1	202009758	0.638000	0.27225	0.006000	0.13384	0.219000	0.24729	1.260000	0.32968	0.020000	0.15106	-0.316000	0.08728	AAT	.	.		0.522	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773	
KIDINS220	57498	hgsc.bcm.edu	37	2	8871742	8871742	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:8871742G>C	ENST00000256707.3	-	30	4605	c.4424C>G	c.(4423-4425)cCt>cGt	p.P1475R	KIDINS220_ENST00000427284.1_Missense_Mutation_p.P1456R|KIDINS220_ENST00000473731.1_Missense_Mutation_p.P1456R|KIDINS220_ENST00000418530.1_Missense_Mutation_p.P1376R	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1475					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTCAGTGATAGGATCCAGGGG	0.463																																					p.P1475R		Atlas-SNP	.											.	KIDINS220	136	.	0			c.C4424G						.						76.0	74.0	74.0					2																	8871742		1892	4104	5996	SO:0001583	missense	57498	exon30			GTGATAGGATCCA	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.4424C>G	chr2.hg19:g.8871742G>C	ENSP00000256707:p.Pro1475Arg	171.0	0.0		184.0	8.0	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	hg19	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369784	0.82573	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731	T;T;T;T	0.73681	-0.69;-0.7;-0.77;-0.7	5.92	5.92	0.95590	.	0.050955	0.85682	D	0.000000	T	0.82029	0.4948	L	0.34521	1.04	0.58432	D	0.999999	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.97110	0.962;0.964;1.0	T	0.82942	-0.0207	10	0.87932	D	0	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	1376;1475;329	Q9ULH0-2;Q9ULH0;B4DG84	.;KDIS_HUMAN;.	R	1475;1456;1376;1456	ENSP00000256707:P1475R;ENSP00000411849:P1456R;ENSP00000414923:P1376R;ENSP00000418974:P1456R	ENSP00000256707:P1475R	P	-	2	0	KIDINS220	8789193	1.000000	0.71417	0.998000	0.56505	0.901000	0.52897	7.228000	0.78079	2.804000	0.96469	0.655000	0.94253	CCT	.	.		0.463	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
DRC1	92749	hgsc.bcm.edu	37	2	26667692	26667692	+	Silent	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:26667692C>T	ENST00000288710.2	+	10	1346	c.1272C>T	c.(1270-1272)caC>caT	p.H424H	DRC1_ENST00000483675.1_3'UTR	NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	424					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											ggatcatccacacccatcatc	0.502																																					p.H424H		Atlas-SNP	.											.	CCDC164	84	.	0			c.C1272T						.						105.0	87.0	93.0					2																	26667692		2203	4300	6503	SO:0001819	synonymous_variant	92749	exon10			CATCCACACCCAT	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.1272C>T	chr2.hg19:g.26667692C>T		96.0	0.0		93.0	21.0	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Silent	SNP	ENST00000288710.2	hg19	CCDS1723.1																																																																																			.	.		0.502	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
LHCGR	3973	hgsc.bcm.edu	37	2	48915497	48915497	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:48915497A>G	ENST00000294954.7	-	11	1460	c.1439T>C	c.(1438-1440)tTa>tCa	p.L480S	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.L418S|LHCGR_ENST00000405626.1_Missense_Mutation_p.L453S|LHCGR_ENST00000403273.1_3'UTR	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	480					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.L480S(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GGCATGTCTTAATCGCAGCTT	0.443																																					p.L480S		Atlas-SNP	.											LHCGR,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	LHCGR	154	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.T1439C						.						140.0	117.0	125.0					2																	48915497		2203	4300	6503	SO:0001583	missense	3973	exon11			TGTCTTAATCGCA		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1439T>C	chr2.hg19:g.48915497A>G	ENSP00000294954:p.Leu480Ser	89.0	0.0		88.0	37.0	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	hg19	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	A	18.39	3.613301	0.66672	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.72051	-0.62;-0.62;-0.62	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.130231	0.51477	D	0.000086	D	0.86822	0.6025	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89139	0.3515	9	.	.	.	.	15.3114	0.74035	1.0:0.0:0.0:0.0	.	480	P22888	LSHR_HUMAN	S	418;480;453	ENSP00000344301:L418S;ENSP00000294954:L480S;ENSP00000386033:L453S	.	L	-	2	0	LHCGR	48769001	0.943000	0.32029	0.208000	0.23602	0.993000	0.82548	7.521000	0.81832	2.218000	0.71995	0.533000	0.62120	TTA	.	.		0.443	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
SLC20A1	6574	hgsc.bcm.edu	37	2	113404985	113404985	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:113404985T>G	ENST00000272542.3	+	3	958	c.419T>G	c.(418-420)tTc>tGc	p.F140C	AC079922.3_ENST00000457336.1_lincRNA	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	140					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						ACTATTGGTTTCTCCCTCGTG	0.428																																					p.F140C		Atlas-SNP	.											.	SLC20A1	59	.	0			c.T419G						.						199.0	204.0	202.0					2																	113404985		2203	4300	6503	SO:0001583	missense	6574	exon3			TTGGTTTCTCCCT		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.419T>G	chr2.hg19:g.113404985T>G	ENSP00000272542:p.Phe140Cys	226.0	0.0		200.0	72.0	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	hg19	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.627463	0.87560	.	.	ENSG00000144136	ENST00000272542	D	0.90900	-2.75	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.96670	0.8913	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97672	1.0167	10	0.87932	D	0	-8.6166	13.9767	0.64277	0.0:0.0:0.0:1.0	.	140	Q8WUM9	S20A1_HUMAN	C	140	ENSP00000272542:F140C	ENSP00000272542:F140C	F	+	2	0	SLC20A1	113121456	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.034000	0.64152	2.175000	0.68902	0.533000	0.62120	TTC	.	.		0.428	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
XIRP2	129446	hgsc.bcm.edu	37	2	168096409	168096409	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:168096409G>T	ENST00000409728.1	+	7	1091	c.1002G>T	c.(1000-1002)caG>caT	p.Q334H	XIRP2_ENST00000409195.1_Missense_Mutation_p.Q301H|XIRP2_ENST00000295237.9_Missense_Mutation_p.Q301H|XIRP2_ENST00000409273.1_Missense_Mutation_p.Q79H|XIRP2_ENST00000409756.2_Missense_Mutation_p.Q301H|XIRP2_ENST00000420519.1_Missense_Mutation_p.Q334H|XIRP2_ENST00000409605.1_Missense_Mutation_p.Q79H|XIRP2_ENST00000409043.1_Missense_Mutation_p.Q301H	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	126					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAAGCAGCCAGGAAATGGCAA	0.383																																					p.Q334H		Atlas-SNP	.											.	XIRP2	914	.	0			c.G1002T						.						88.0	90.0	90.0					2																	168096409		1874	4117	5991	SO:0001583	missense	129446	exon7			CAGCCAGGAAATG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1002G>T	chr2.hg19:g.168096409G>T	ENSP00000386619:p.Gln334His	644.0	0.0		389.0	23.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	hg19	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150619	0.37923	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	T;T;T;T;T;T;T;T	0.78126	-1.15;-1.15;4.15;-1.15;-1.15;4.15;4.16;-1.15	5.9	2.01	0.26516	.	0.435723	0.22988	N	0.053235	D	0.82370	0.5022	L	0.61218	1.895	0.09310	N	0.999993	D;D;D;D;D	0.67145	0.981;0.994;0.996;0.989;0.986	P;D;D;P;P	0.74674	0.635;0.984;0.929;0.859;0.742	T	0.70292	-0.4912	10	0.59425	D	0.04	-5.036	6.02	0.19625	0.5254:0.0:0.4746:0.0	.	126;301;334;126;79	A4UGR9;A4UGR9-4;A4UGR9-6;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.;.;.	H	301;334;301;301;334;301;79;79	ENSP00000386454:Q301H;ENSP00000386619:Q334H;ENSP00000386840:Q301H;ENSP00000386724:Q301H;ENSP00000415541:Q334H;ENSP00000295237:Q301H;ENSP00000387255:Q79H;ENSP00000386981:Q79H	ENSP00000295237:Q301H	Q	+	3	2	XIRP2	167804655	0.844000	0.29557	0.962000	0.40283	0.057000	0.15508	0.316000	0.19469	0.554000	0.29061	-0.157000	0.13467	CAG	.	.		0.383	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
ORMDL1	94101	hgsc.bcm.edu	37	2	190636618	190636618	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:190636618C>T	ENST00000325795.3	-	3	1123	c.337G>A	c.(337-339)Gca>Aca	p.A113T	ORMDL1_ENST00000392349.4_Missense_Mutation_p.A113T|ORMDL1_ENST00000392350.3_Missense_Mutation_p.A113T|ORMDL1_ENST00000496543.1_5'UTR			Q9P0S3	ORML1_HUMAN	ORMDL sphingolipid biosynthesis regulator 1	113					ceramide metabolic process (GO:0006672)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(1)|urinary_tract(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00177)|Epithelial(96;0.0317)|all cancers(119;0.0889)			TAGAAACTTGCCAGAAAATAT	0.328																																					p.A113T		Atlas-SNP	.											.	ORMDL1	8	.	0			c.G337A						.						56.0	57.0	56.0					2																	190636618		2203	4300	6503	SO:0001583	missense	94101	exon5			AACTTGCCAGAAA		CCDS2301.1	2q32	2014-06-16	2014-06-16		ENSG00000128699	ENSG00000128699			16036	protein-coding gene	gene with protein product		610073	"""ORM1 (S. cerevisiae)-like 1"", ""ORM1-like 1 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_016467		Approved		uc002ure.4	Q9P0S3	OTTHUMG00000132661	ENST00000325795.3:c.337G>A	chr2.hg19:g.190636618C>T	ENSP00000326869:p.Ala113Thr	94.0	0.0		111.0	52.0	NM_016467	B2R8W3|D3DPH9	Missense_Mutation	SNP	ENST00000325795.3	hg19	CCDS2301.1	.	.	.	.	.	.	.	.	.	.	C	6.906	0.536702	0.13188	.	.	ENSG00000128699	ENST00000392350;ENST00000325795;ENST00000392349	.	.	.	5.21	5.21	0.72293	.	0.052491	0.85682	D	0.000000	T	0.39145	0.1067	N	0.19112	0.55	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	T	0.21415	-1.0246	9	0.17832	T	0.49	-22.2973	10.5252	0.44943	0.0:0.8508:0.0:0.1492	.	113	Q9P0S3	ORML1_HUMAN	T	113	.	ENSP00000326869:A113T	A	-	1	0	ORMDL1	190344863	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.247000	0.51422	2.707000	0.92482	0.655000	0.94253	GCA	.	.		0.328	ORMDL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335275.1	NM_016467	
SF3B1	23451	hgsc.bcm.edu	37	2	198266800	198266800	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:198266800G>A	ENST00000335508.6	-	15	2223	c.2132C>T	c.(2131-2133)gCc>gTc	p.A711V	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	711					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTCAGCCAAGGCAGCAATGGC	0.443			Mis		myelodysplastic syndrome																																p.A711V		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	SF3B1,NS,haematopoietic_neoplasm,0,1	SF3B1	1038	.	0			c.C2132T						.						94.0	90.0	91.0					2																	198266800		2203	4300	6503	SO:0001583	missense	23451	exon15			GCCAAGGCAGCAA	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2132C>T	chr2.hg19:g.198266800G>A	ENSP00000335321:p.Ala711Val	282.0	0.0		327.0	146.0	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	37	6.028906	0.97216	.	.	ENSG00000115524	ENST00000335508	T	0.66280	-0.2	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85265	0.5657	H	0.95224	3.64	0.80722	D	1	D	0.67145	0.996	P	0.62184	0.899	D	0.88622	0.3163	10	0.87932	D	0	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	711	O75533	SF3B1_HUMAN	V	711	ENSP00000335321:A711V	ENSP00000335321:A711V	A	-	2	0	SF3B1	197975045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.857000	0.98124	0.650000	0.86243	GCC	.	.		0.443	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
HSPD1	3329	hgsc.bcm.edu	37	2	198358073	198358073	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr2:198358073C>G	ENST00000388968.3	-	7	1111	c.844G>C	c.(844-846)Gct>Cct	p.A282P	HSPD1_ENST00000345042.2_Missense_Mutation_p.A282P	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	282					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			GTACTTAGAGCTTCTCCATCA	0.368																																					p.A282P		Atlas-SNP	.											.	HSPD1	68	.	0			c.G844C						.						144.0	146.0	145.0					2																	198358073		2203	4300	6503	SO:0001583	missense	3329	exon7			TTAGAGCTTCTCC	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.844G>C	chr2.hg19:g.198358073C>G	ENSP00000373620:p.Ala282Pro	187.0	0.0		164.0	47.0	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Missense_Mutation	SNP	ENST00000388968.3	hg19	CCDS33357.1	.	.	.	.	.	.	.	.	.	.	C	34	5.396637	0.96009	.	.	ENSG00000144381	ENST00000388968;ENST00000345042;ENST00000536745	D;D	0.82433	-1.61;-1.61	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.94145	0.8122	H	0.97077	3.935	0.80722	D	1	P;P;D	0.60160	0.774;0.726;0.987	P;P;D	0.65874	0.67;0.714;0.939	D	0.95997	0.8990	10	0.87932	D	0	-14.4411	18.8471	0.92212	0.0:1.0:0.0:0.0	.	273;282;282	B7Z597;B3GQS7;P10809	.;.;CH60_HUMAN	P	282;282;138	ENSP00000373620:A282P;ENSP00000340019:A282P	ENSP00000340019:A282P	A	-	1	0	HSPD1	198066318	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.722000	0.84778	2.532000	0.85374	0.585000	0.79938	GCT	.	.		0.368	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
FANCD2	2177	hgsc.bcm.edu	37	3	10074603	10074603	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr3:10074603T>G	ENST00000419585.1	+	3	313	c.152T>G	c.(151-153)cTt>cGt	p.L51R	FANCD2_ENST00000431693.1_Missense_Mutation_p.L51R|FANCD2_ENST00000287647.3_Missense_Mutation_p.L51R|FANCD2_ENST00000383806.1_Missense_Mutation_p.L51R|FANCD2_ENST00000383807.1_Missense_Mutation_p.L51R			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	51	Interaction with FANCE.				DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TTTGTAAAGCTTCTTAAGATA	0.303			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L51R		Atlas-SNP	.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	253	.	0			c.T152G						.						80.0	84.0	83.0					3																	10074603		2202	4294	6496	SO:0001583	missense	2177	exon3	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TAAAGCTTCTTAA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.152T>G	chr3.hg19:g.10074603T>G	ENSP00000398754:p.Leu51Arg	223.0	0.0		259.0	16.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	hg19	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.330040	0.60743	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585;ENST00000431693	T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28	6.15	6.15	0.99193	.	0.107332	0.64402	D	0.000003	T	0.74222	0.3688	M	0.70595	2.14	0.40036	D	0.975598	D;D;D	0.89917	0.999;1.0;1.0	D;D;P	0.68943	0.961;0.961;0.906	T	0.77643	-0.2511	10	0.72032	D	0.01	.	14.7406	0.69451	0.0:0.0:0.0:1.0	.	51;51;51	Q9BXW9-2;Q9BXW9;Q9BXW9-4	.;FACD2_HUMAN;.	R	51	ENSP00000287647:L51R;ENSP00000373318:L51R;ENSP00000373317:L51R;ENSP00000398754:L51R;ENSP00000399354:L51R	ENSP00000287647:L51R	L	+	2	0	FANCD2	10049603	1.000000	0.71417	0.989000	0.46669	0.291000	0.27294	4.995000	0.63908	2.363000	0.80096	0.523000	0.50628	CTT	.	.		0.303	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
STAB1	23166	hgsc.bcm.edu	37	3	52553292	52553292	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr3:52553292C>T	ENST00000321725.6	+	49	5123	c.5047C>T	c.(5047-5049)Ctc>Ttc	p.L1683F		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1683	FAS1 5. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CAGCATATACCTCAATGACTT	0.642																																					p.L1683F		Atlas-SNP	.											.	STAB1	178	.	0			c.C5047T						.						107.0	115.0	112.0					3																	52553292		2203	4300	6503	SO:0001583	missense	23166	exon49			ATATACCTCAATG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5047C>T	chr3.hg19:g.52553292C>T	ENSP00000312946:p.Leu1683Phe	89.0	0.0		96.0	9.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	hg19	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781729	0.70222	.	.	ENSG00000010327	ENST00000321725	D	0.91180	-2.8	5.5	-10.4	0.00318	FAS1 domain (5);	0.332572	0.29707	N	0.011411	D	0.85982	0.5824	L	0.54863	1.705	0.22292	N	0.999229	P	0.49307	0.922	P	0.46850	0.529	D	0.83852	0.0263	10	0.72032	D	0.01	.	12.7463	0.57283	0.135:0.7407:0.057:0.0673	.	1683	Q9NY15	STAB1_HUMAN	F	1683	ENSP00000312946:L1683F	ENSP00000312946:L1683F	L	+	1	0	STAB1	52528332	0.000000	0.05858	0.010000	0.14722	0.828000	0.46876	-1.043000	0.03535	-2.086000	0.00863	-1.028000	0.02416	CTC	.	.		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
TOMM70A	9868	hgsc.bcm.edu	37	3	100086936	100086936	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr3:100086936T>C	ENST00000284320.5	-	11	2073	c.1625A>G	c.(1624-1626)aAt>aGt	p.N542S		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	542					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						ATCACATTTATTGTCAATTTC	0.358																																					p.N542S		Atlas-SNP	.											.	TOMM70A	65	.	0			c.A1625G						.						119.0	113.0	115.0					3																	100086936		2203	4300	6503	SO:0001583	missense	9868	exon11			CATTTATTGTCAA	AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1625A>G	chr3.hg19:g.100086936T>C	ENSP00000284320:p.Asn542Ser	100.0	0.0		90.0	25.0	NM_014820	D3DN48	Missense_Mutation	SNP	ENST00000284320.5	hg19	CCDS33807.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.740810	0.49151	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	T	0.52057	0.68	5.88	5.88	0.94601	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.27419	0.0673	N	0.02916	-0.46	0.80722	D	1	B	0.23735	0.09	B	0.23150	0.044	T	0.12041	-1.0563	10	0.37606	T	0.19	-22.2088	16.2879	0.82732	0.0:0.0:0.0:1.0	.	542	O94826	TOM70_HUMAN	S	542;435	ENSP00000284320:N542S	ENSP00000284320:N542S	N	-	2	0	TOMM70A	101569626	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.974000	0.70465	2.242000	0.73789	0.533000	0.62120	AAT	.	.		0.358	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2		
CD80	941	hgsc.bcm.edu	37	3	119263535	119263535	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr3:119263535C>T	ENST00000264246.3	-	3	642	c.280G>A	c.(280-282)Gat>Aat	p.D94N	CD80_ENST00000383669.3_Missense_Mutation_p.D94N|CD80_ENST00000383668.3_Missense_Mutation_p.D94N|CD80_ENST00000478182.1_Missense_Mutation_p.D94N	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	94	Ig-like V-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	TTAGTGATATCAAAGATGGTC	0.453																																					p.D94N	Melanoma(132;135 1764 1806 5833 14593)	Atlas-SNP	.											.	CD80	35	.	0			c.G280A						.						156.0	148.0	151.0					3																	119263535		2203	4300	6503	SO:0001583	missense	941	exon3			TGATATCAAAGAT		CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.280G>A	chr3.hg19:g.119263535C>T	ENSP00000264246:p.Asp94Asn	122.0	0.0		146.0	8.0	NM_005191	Q5DTA9|Q5DTB0	Missense_Mutation	SNP	ENST00000264246.3	hg19	CCDS2989.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269963	0.59540	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669;ENST00000383668	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.13	3.29	0.37713	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.899101	0.09455	N	0.799881	T	0.71693	0.3370	M	0.79805	2.47	0.09310	N	1	P;P;P;P	0.47762	0.875;0.9;0.9;0.9	P;P;P;P	0.52514	0.58;0.701;0.701;0.701	T	0.58951	-0.7545	10	0.66056	D	0.02	-12.7963	6.0456	0.19758	0.1868:0.718:0.0:0.0953	.	94;94;94;94	Q5DTA9;Q5DTB0;A0N0P2;P33681	.;.;.;CD80_HUMAN	N	94	ENSP00000264246:D94N;ENSP00000418364:D94N;ENSP00000373165:D94N;ENSP00000373164:D94N	ENSP00000264246:D94N	D	-	1	0	CD80	120746225	0.032000	0.19561	0.019000	0.16419	0.044000	0.14063	0.564000	0.23563	0.703000	0.31848	0.650000	0.86243	GAT	.	.		0.453	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355196.1	NM_005191	
SMC4	10051	hgsc.bcm.edu	37	3	160148414	160148414	+	Silent	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr3:160148414C>G	ENST00000357388.3	+	19	3274	c.2823C>G	c.(2821-2823)gtC>gtG	p.V941V	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000360111.2_Silent_p.V941V|SMC4_ENST00000462787.1_Silent_p.V941V|SMC4_ENST00000469762.1_Silent_p.V916V|SMC4_ENST00000344722.5_Silent_p.V941V	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	941					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAGACTCTGTCTTGCGTACAG	0.378																																					p.V941V		Atlas-SNP	.											.	SMC4	135	.	0			c.C2823G						.						79.0	82.0	81.0					3																	160148414		2203	4300	6503	SO:0001819	synonymous_variant	10051	exon18			CTCTGTCTTGCGT	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2823C>G	chr3.hg19:g.160148414C>G		258.0	0.0		278.0	107.0	NM_005496	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Silent	SNP	ENST00000357388.3	hg19	CCDS3189.1																																																																																			.	.		0.378	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
CSN1S1	1446	hgsc.bcm.edu	37	4	70804905	70804905	+	Silent	SNP	C	C	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr4:70804905C>A	ENST00000246891.4	+	10	304	c.255C>A	c.(253-255)tcC>tcA	p.S85S	CSN1S1_ENST00000507772.1_Silent_p.S85S|CSN1S1_ENST00000507763.1_Silent_p.S84S|CSN1S1_ENST00000444405.3_Silent_p.S84S|CSN1S1_ENST00000505782.1_Silent_p.S77S	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	85						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						AGATGGAATCCAGCATCAGTT	0.318																																					p.S85S		Atlas-SNP	.											.	CSN1S1	20	.	0			c.C255A						.						87.0	86.0	86.0					4																	70804905		1798	4063	5861	SO:0001819	synonymous_variant	1446	exon10			GGAATCCAGCATC	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.255C>A	chr4.hg19:g.70804905C>A		185.0	0.0		141.0	32.0	NM_001890	A1A510|A1A511|E9PB60|Q4PNR5	Silent	SNP	ENST00000246891.4	hg19	CCDS47067.1																																																																																			.	.		0.318	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1		
PPEF2	5470	hgsc.bcm.edu	37	4	76805789	76805789	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr4:76805789T>C	ENST00000286719.7	-	8	1060	c.704A>G	c.(703-705)cAt>cGt	p.H235R		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	235	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TCTGTTAAGATGGAACTCTTT	0.388																																					p.H235R	NSCLC(105;1359 1603 15961 44567 47947)	Atlas-SNP	.											.	PPEF2	108	.	0			c.A704G						.						180.0	182.0	181.0					4																	76805789		2203	4300	6503	SO:0001583	missense	5470	exon8			TTAAGATGGAACT	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.704A>G	chr4.hg19:g.76805789T>C	ENSP00000286719:p.His235Arg	94.0	0.0		63.0	34.0	NM_006239	O14831	Missense_Mutation	SNP	ENST00000286719.7	hg19	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	T	15.40	2.821816	0.50633	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	D	0.85258	-1.96	4.84	3.65	0.41850	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	0.095854	0.64402	N	0.000001	D	0.83376	0.5241	M	0.76574	2.34	0.47819	D	0.999527	B;B	0.23058	0.079;0.028	B;B	0.26202	0.067;0.026	T	0.80051	-0.1544	10	0.59425	D	0.04	-15.3668	8.7177	0.34421	0.0:0.0901:0.0:0.9099	.	235;235	O14830-2;O14830	.;PPE2_HUMAN	R	235	ENSP00000286719:H235R	ENSP00000286719:H235R	H	-	2	0	PPEF2	77024813	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.511000	0.67024	0.873000	0.35799	0.533000	0.62120	CAT	.	.		0.388	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	
SPOCK3	50859	hgsc.bcm.edu	37	4	167658664	167658664	+	Silent	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr4:167658664A>G	ENST00000357154.3	-	11	1232	c.1095T>C	c.(1093-1095)taT>taC	p.Y365Y	SPOCK3_ENST00000541637.1_Silent_p.Y267Y|SPOCK3_ENST00000535728.1_Silent_p.Y233Y|SPOCK3_ENST00000511269.1_Silent_p.Y362Y|SPOCK3_ENST00000541354.1_Silent_p.Y245Y|SPOCK3_ENST00000512681.1_Silent_p.Y267Y|SPOCK3_ENST00000510741.1_Silent_p.Y322Y|SPOCK3_ENST00000511531.1_Silent_p.Y365Y|SPOCK3_ENST00000504953.1_Silent_p.Y362Y|SPOCK3_ENST00000421836.2_Silent_p.Y314Y|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Silent_p.Y362Y|SPOCK3_ENST00000502330.1_Silent_p.Y365Y|SPOCK3_ENST00000534949.1_Silent_p.Y269Y|SPOCK3_ENST00000506886.1_Silent_p.Y365Y	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	365	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		CTTCATTTCCATATCTGTCAA	0.403																																					p.Y365Y		Atlas-SNP	.											.	SPOCK3	90	.	0			c.T1095C						.						291.0	263.0	273.0					4																	167658664		2203	4300	6503	SO:0001819	synonymous_variant	50859	exon11			ATTTCCATATCTG	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.1095T>C	chr4.hg19:g.167658664A>G		60.0	0.0		34.0	14.0	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Silent	SNP	ENST00000357154.3	hg19	CCDS54817.1																																																																																			.	.		0.403	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
MIER3	166968	hgsc.bcm.edu	37	5	56226567	56226567	+	Silent	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:56226567T>C	ENST00000381199.3	-	9	763	c.753A>G	c.(751-753)ttA>ttG	p.L251L	MIER3_ENST00000381226.3_Silent_p.L256L|MIER3_ENST00000381213.3_Silent_p.L251L|CTD-2310F14.1_ENST00000606813.1_RNA|MIER3_ENST00000409421.1_Silent_p.L188L			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	251	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		GAAGTTCATATAATGCCTGGG	0.338																																					p.L251L		Atlas-SNP	.											.	MIER3	33	.	0			c.A753G						.						158.0	149.0	152.0					5																	56226567		2203	4300	6503	SO:0001819	synonymous_variant	166968	exon9			TTCATATAATGCC	BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.753A>G	chr5.hg19:g.56226567T>C		55.0	0.0		66.0	33.0	NM_152622	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Silent	SNP	ENST00000381199.3	hg19																																																																																				.	.		0.338	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000132523.2	NM_152622	
MAST4	375449	hgsc.bcm.edu	37	5	66391445	66391445	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:66391445C>G	ENST00000403625.2	+	7	1149	c.854C>G	c.(853-855)tCg>tGg	p.S285W	MAST4_ENST00000490016.2_Missense_Mutation_p.S96W|MAST4_ENST00000405643.1_Missense_Mutation_p.S106W|MAST4_ENST00000261569.7_Missense_Mutation_p.S91W|MAST4_ENST00000404260.3_Missense_Mutation_p.S288W|MAST4_ENST00000403666.1_Missense_Mutation_p.S96W	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	288						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CGCCGCTGGTCGTTGGCTTCT	0.473																																					p.S285W		Atlas-SNP	.											.	MAST4	218	.	0			c.C854G						.						81.0	87.0	85.0					5																	66391445		1975	4165	6140	SO:0001583	missense	375449	exon7			GCTGGTCGTTGGC	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.854C>G	chr5.hg19:g.66391445C>G	ENSP00000385727:p.Ser285Trp	91.0	0.0		97.0	27.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732024	0.89390	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92	6.04	6.04	0.98038	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.50627	U	0.000113	T	0.75148	0.3810	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	T	0.79820	-0.1642	10	0.87932	D	0	-11.1109	20.5948	0.99439	0.0:1.0:0.0:0.0	.	106;288;91;96;96	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	W	288;285;96;96;106;106;91;91;91	ENSP00000385048:S288W;ENSP00000385727:S285W;ENSP00000421739:S96W;ENSP00000384313:S96W;ENSP00000384099:S106W;ENSP00000261569:S91W;ENSP00000392478:S91W	ENSP00000261569:S91W	S	+	2	0	MAST4	66427201	1.000000	0.71417	0.970000	0.41538	0.930000	0.56654	7.487000	0.81328	2.873000	0.98535	0.563000	0.77884	TCG	.	.		0.473	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
F2RL1	2150	hgsc.bcm.edu	37	5	76129080	76129080	+	Silent	SNP	C	C	T	rs535468564		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:76129080C>T	ENST00000296677.4	+	2	854	c.648C>T	c.(646-648)atC>atT	p.I216I		NM_005242.4	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	216					blood coagulation (GO:0007596)|chemokine (C-C motif) ligand 2 secretion (GO:0035926)|chemokine secretion (GO:0090195)|defense response to virus (GO:0051607)|establishment of endothelial barrier (GO:0061028)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|interleukin-1 beta secretion (GO:0050702)|interleukin-10 secretion (GO:0072608)|leukocyte migration (GO:0050900)|leukocyte proliferation (GO:0070661)|mature dendritic cell differentiation (GO:0097029)|negative regulation of chemokine secretion (GO:0090198)|negative regulation of JNK cascade (GO:0046329)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neutrophil activation (GO:0042119)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of cell migration (GO:0030335)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of eosinophil degranulation (GO:0043311)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of neutrophil mediated killing of gram-negative bacterium (GO:0070963)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of blood coagulation (GO:0030193)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of JNK cascade (GO:0046328)|T cell activation involved in immune response (GO:0002286)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	13		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		AGCAGACCATCTTCATTCCTG	0.498																																					p.I216I		Atlas-SNP	.											.	F2RL1	46	.	0			c.C648T						.						128.0	112.0	117.0					5																	76129080		2203	4300	6503	SO:0001819	synonymous_variant	2150	exon2			GACCATCTTCATT	BC018130	CCDS4033.1	5q13	2012-08-08			ENSG00000164251	ENSG00000164251		"""GPCR / Class A : Protease activated receptors"""	3538	protein-coding gene	gene with protein product	"""proteinase-activated receptor-2"""	600933		GPR11		7937743, 7556175	Standard	NM_005242		Approved	PAR2	uc003keo.3	P55085	OTTHUMG00000102118	ENST00000296677.4:c.648C>T	chr5.hg19:g.76129080C>T		113.0	0.0		105.0	42.0	NM_005242	Q13317|Q13346|Q53XJ8	Silent	SNP	ENST00000296677.4	hg19	CCDS4033.1																																																																																			.	.		0.498	F2RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219957.2		
RASGRF2	5924	hgsc.bcm.edu	37	5	80513290	80513290	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:80513290A>C	ENST00000265080.4	+	25	3617	c.3550A>C	c.(3550-3552)Atg>Ctg	p.M1184L	CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000503483.2_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1184	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CAAAATGAGAATGGTAGGTAT	0.353																																					p.M1184L		Atlas-SNP	.											.	RASGRF2	165	.	0			c.A3550C						.						102.0	104.0	104.0					5																	80513290		2203	4300	6503	SO:0001583	missense	5924	exon25			ATGAGAATGGTAG	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3550A>C	chr5.hg19:g.80513290A>C	ENSP00000265080:p.Met1184Leu	96.0	0.0		80.0	25.0	NM_006909	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	hg19	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598716	0.87055	.	.	ENSG00000113319	ENST00000265080	T	0.29397	1.57	6.03	6.03	0.97812	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.29684	0.0741	L	0.45470	1.425	0.58432	D	0.999999	B	0.31655	0.334	B	0.27262	0.078	T	0.03374	-1.1043	10	0.44086	T	0.13	.	16.2196	0.82251	1.0:0.0:0.0:0.0	.	1184	O14827	RGRF2_HUMAN	L	1184	ENSP00000265080:M1184L	ENSP00000265080:M1184L	M	+	1	0	RASGRF2	80549046	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.339000	0.96797	2.308000	0.77769	0.533000	0.62120	ATG	.	.		0.353	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
ARRDC3	57561	hgsc.bcm.edu	37	5	90670042	90670042	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:90670042C>T	ENST00000265138.3	-	6	1188	c.922G>A	c.(922-924)Gtc>Atc	p.V308I	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	308					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		GTACCGATGACAAGTGGCAAA	0.373																																					p.V308I		Atlas-SNP	.											.	ARRDC3	56	.	0			c.G922A						.						153.0	148.0	150.0					5																	90670042		2203	4300	6503	SO:0001583	missense	57561	exon6			CGATGACAAGTGG	AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.922G>A	chr5.hg19:g.90670042C>T	ENSP00000265138:p.Val308Ile	276.0	0.0		259.0	76.0	NM_020801	A8K6T8|Q9P2H1	Missense_Mutation	SNP	ENST00000265138.3	hg19	CCDS34202.1	.	.	.	.	.	.	.	.	.	.	C	35	5.551442	0.96501	.	.	ENSG00000113369	ENST00000265138	T	0.06528	3.29	6.02	6.02	0.97574	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.24198	0.0586	L	0.58428	1.81	0.80722	D	1	D	0.63046	0.992	D	0.77004	0.989	T	0.00010	-1.2456	10	0.40728	T	0.16	-26.8126	20.5373	0.99239	0.0:1.0:0.0:0.0	.	308	Q96B67	ARRD3_HUMAN	I	308	ENSP00000265138:V308I	ENSP00000265138:V308I	V	-	1	0	ARRDC3	90705798	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.857000	0.98124	0.650000	0.86243	GTC	.	.		0.373	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369763.2	NM_020801	
MYOT	9499	hgsc.bcm.edu	37	5	137221803	137221803	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:137221803A>G	ENST00000239926.4	+	8	1465	c.1091A>G	c.(1090-1092)gAt>gGt	p.D364G	MYOT_ENST00000421631.2_Missense_Mutation_p.D180G|RP11-381K20.2_ENST00000508281.2_RNA|MYOT_ENST00000515645.1_Missense_Mutation_p.D249G|RP11-381K20.2_ENST00000514616.1_RNA	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	364	Ig-like C2-type 2.|Necessary for interaction with ACTA1.|Necessary for interaction with FLNC.				muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)			cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTAGAGGGAGATTCAGTGAAA	0.333																																					p.D364G		Atlas-SNP	.											.	MYOT	50	.	0			c.A1091G						.						74.0	80.0	78.0					5																	137221803		2203	4300	6503	SO:0001583	missense	9499	exon8			AGGGAGATTCAGT	AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.1091A>G	chr5.hg19:g.137221803A>G	ENSP00000239926:p.Asp364Gly	443.0	0.0		586.0	244.0	NM_006790	A0A4R6|B4DT79	Missense_Mutation	SNP	ENST00000239926.4	hg19	CCDS4194.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.391477	0.62066	.	.	ENSG00000120729	ENST00000239926;ENST00000421631;ENST00000515645	T;T;T	0.42900	0.96;0.96;0.96	5.0	5.0	0.66597	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.640625	0.14933	N	0.289971	T	0.40145	0.1105	N	0.25647	0.755	0.45239	D	0.998243	P	0.44044	0.825	P	0.46362	0.514	T	0.32929	-0.9888	10	0.56958	D	0.05	.	14.9908	0.71387	1.0:0.0:0.0:0.0	.	364	Q9UBF9	MYOTI_HUMAN	G	364;180;249	ENSP00000239926:D364G;ENSP00000391185:D180G;ENSP00000426281:D249G	ENSP00000239926:D364G	D	+	2	0	MYOT	137249702	1.000000	0.71417	0.899000	0.35326	0.870000	0.49936	4.638000	0.61353	2.007000	0.58848	0.482000	0.46254	GAT	.	.		0.333	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251219.2	NM_006790	
GNPDA1	10007	hgsc.bcm.edu	37	5	141385881	141385881	+	Silent	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:141385881T>C	ENST00000508177.1	-	3	995	c.237A>G	c.(235-237)cgA>cgG	p.R79R	GNPDA1_ENST00000503794.1_Silent_p.R79R|GNPDA1_ENST00000513454.1_Silent_p.R79R|GNPDA1_ENST00000311337.6_Silent_p.R79R|GNPDA1_ENST00000500692.2_Silent_p.R79R|GNPDA1_ENST00000542860.1_Intron|GNPDA1_ENST00000458112.2_Silent_p.R45R			P46926	GNPI1_HUMAN	glucosamine-6-phosphate deaminase 1	79					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucosamine catabolic process (GO:0006043)|N-acetylglucosamine metabolic process (GO:0006044)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			central_nervous_system(1)|lung(1)|skin(3)|stomach(1)	6		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGGTGGTCTCGAGGAAGGC	0.542																																					p.R79R		Atlas-SNP	.											.	GNPDA1	16	.	0			c.A237G						.						155.0	141.0	145.0					5																	141385881		2203	4300	6503	SO:0001819	synonymous_variant	10007	exon4			GTGGTCTCGAGGA	AF048826	CCDS4272.1	5q21	2008-02-05	2003-10-17	2003-10-22	ENSG00000113552	ENSG00000113552	3.5.99.6		4417	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate deaminase"", ""oscillin"""	601798	"""glucosamine-6-phosphate isomerase"""	GNPI		9714720, 9438414	Standard	NM_005471		Approved	GNPDA, HLN, GPI, KIAA0060	uc010jgh.3	P46926	OTTHUMG00000129657	ENST00000508177.1:c.237A>G	chr5.hg19:g.141385881T>C		56.0	0.0		84.0	43.0	NM_005471	B7Z3X4|D3DQE7	Silent	SNP	ENST00000508177.1	hg19	CCDS4272.1																																																																																			.	.		0.542	GNPDA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370631.1	NM_005471	
DSP	1832	hgsc.bcm.edu	37	6	7583810	7583810	+	Silent	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr6:7583810A>G	ENST00000379802.3	+	24	6656	c.6315A>G	c.(6313-6315)gtA>gtG	p.V2105V	DSP_ENST00000418664.2_Silent_p.V1506V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2105	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCAAGACAGTATCTGTTTCAG	0.458																																					p.V2105V		Atlas-SNP	.											.	DSP	306	.	0			c.A6315G						.						97.0	104.0	101.0					6																	7583810		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon24			GACAGTATCTGTT	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6315A>G	chr6.hg19:g.7583810A>G		98.0	0.0		139.0	9.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.		0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
HIST1H2AG	8969	hgsc.bcm.edu	37	6	27100855	27100855	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr6:27100855C>G	ENST00000359193.2	+	1	24	c.5C>G	c.(4-6)tCt>tGt	p.S2C	HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000541790.1_5'Flank|HIST1H2BJ_ENST00000339812.2_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	2						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						CTCGCTATGTCTGGACGTGGC	0.577																																					p.S2C		Atlas-SNP	.											.	HIST1H2AG	37	.	0			c.C5G						.						41.0	47.0	45.0					6																	27100855		2198	4299	6497	SO:0001583	missense	8969	exon1			CTATGTCTGGACG	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.5C>G	chr6.hg19:g.27100855C>G	ENSP00000352119:p.Ser2Cys	89.0	0.0		113.0	74.0	NM_021064	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	hg19	CCDS4619.1	.	.	.	.	.	.	.	.	.	.	C	5.514	0.279826	0.10458	.	.	ENSG00000196787	ENST00000359193	D	0.92965	-3.14	4.08	4.08	0.47627	Histone-fold (2);	0.000000	0.39834	N	0.001245	D	0.82421	0.5033	.	.	.	0.23865	N	0.996624	B	0.33583	0.418	B	0.28553	0.091	T	0.79909	-0.1604	9	0.87932	D	0	.	14.6102	0.68510	0.0:1.0:0.0:0.0	.	2	P0C0S8	H2A1_HUMAN	C	2	ENSP00000352119:S2C	ENSP00000352119:S2C	S	+	2	0	HIST1H2AG	27208834	0.979000	0.34478	1.000000	0.80357	0.167000	0.22549	2.541000	0.45735	2.217000	0.71921	0.655000	0.94253	TCT	.	.		0.577	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
ANKS1A	23294	hgsc.bcm.edu	37	6	34935067	34935067	+	Silent	SNP	C	C	A	rs147758055	byFrequency	TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr6:34935067C>A	ENST00000360359.3	+	2	387	c.249C>A	c.(247-249)ccC>ccA	p.P83P	ANKS1A_ENST00000535627.1_Silent_p.P83P	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	83					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GCTACACACCCCTGCACCATG	0.458																																					p.P83P		Atlas-SNP	.											.	ANKS1A	123	.	0			c.C249A						.						239.0	204.0	216.0					6																	34935067		2203	4300	6503	SO:0001819	synonymous_variant	23294	exon2			CACACCCCTGCAC	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.249C>A	chr6.hg19:g.34935067C>A		65.0	0.0		130.0	7.0	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	ENST00000360359.3	hg19	CCDS4798.1																																																																																			.	C|0.998;G|0.002		0.458	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
TINAG	27283	hgsc.bcm.edu	37	6	54219431	54219431	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr6:54219431C>T	ENST00000259782.4	+	9	1343	c.1247C>T	c.(1246-1248)aCt>aTt	p.T416I		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	416					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GTCAAACTCACTGGGTAAGGC	0.323																																					p.T416I		Atlas-SNP	.											.	TINAG	102	.	0			c.C1247T						.						46.0	46.0	46.0					6																	54219431		2200	4296	6496	SO:0001583	missense	27283	exon9			AACTCACTGGGTA	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1247C>T	chr6.hg19:g.54219431C>T	ENSP00000259782:p.Thr416Ile	300.0	0.0		385.0	196.0	NM_014464	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	hg19	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	C	0.978	-0.697870	0.03279	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	D	0.82433	-1.61	5.54	4.63	0.57726	Peptidase C1A, papain C-terminal (2);	0.769005	0.12491	N	0.464255	T	0.49098	0.1537	N	0.05012	-0.13	0.80722	D	1	B	0.24043	0.096	B	0.28385	0.089	T	0.41070	-0.9529	10	0.11794	T	0.64	.	11.5766	0.50864	0.0:0.9072:0.0:0.0928	.	416	Q9UJW2	TINAG_HUMAN	I	275;416;95	ENSP00000259782:T416I	ENSP00000259782:T416I	T	+	2	0	TINAG	54327390	1.000000	0.71417	0.995000	0.50966	0.368000	0.29767	2.746000	0.47467	1.379000	0.46325	-0.345000	0.07892	ACT	.	.		0.323	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
SNAP91	9892	hgsc.bcm.edu	37	6	84269885	84269885	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr6:84269885C>T	ENST00000439399.2	-	28	2885	c.2569G>A	c.(2569-2571)Gtc>Atc	p.V857I	SNAP91_ENST00000428679.2_Missense_Mutation_p.V857I|SNAP91_ENST00000369694.2_Missense_Mutation_p.V857I|SNAP91_ENST00000437520.1_Missense_Mutation_p.V550I|SNAP91_ENST00000521743.1_Missense_Mutation_p.V857I|SNAP91_ENST00000195649.6_Missense_Mutation_p.V852I|SNAP91_ENST00000520302.1_Missense_Mutation_p.V827I|SNAP91_ENST00000520213.1_Missense_Mutation_p.V550I|SNAP91_ENST00000521485.1_Missense_Mutation_p.V852I	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	857	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GCAAACATGACCGGCTGCTGA	0.547																																					p.V857I		Atlas-SNP	.											.	SNAP91	199	.	0			c.G2569A						.						70.0	71.0	70.0					6																	84269885		1978	4160	6138	SO:0001583	missense	9892	exon27			ACATGACCGGCTG	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2569G>A	chr6.hg19:g.84269885C>T	ENSP00000400459:p.Val857Ile	216.0	0.0		172.0	93.0	NM_001242792	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291387	0.59976	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448	T;T;T;T;T;T;T;T;T;T	0.25250	2.38;2.39;2.39;2.38;2.39;2.41;2.39;2.39;2.41;1.81	5.75	5.75	0.90469	.	0.167400	0.50627	D	0.000102	T	0.30665	0.0772	L	0.52573	1.65	0.20196	N	0.999926	B;P;P;P;P	0.50156	0.363;0.902;0.932;0.932;0.932	B;D;P;P;P	0.64595	0.138;0.927;0.891;0.891;0.891	T	0.10200	-1.0640	10	0.62326	D	0.03	-14.8755	12.2765	0.54739	0.0:0.9232:0.0:0.0768	.	733;550;827;857;855	B7Z2N2;O60641-3;E5RI02;O60641;E1P549	.;.;.;AP180_HUMAN;.	I	852;857;857;852;857;550;827;857;550;198	ENSP00000429776:V852I;ENSP00000358708:V857I;ENSP00000400459:V857I;ENSP00000195649:V852I;ENSP00000412492:V857I;ENSP00000413277:V550I;ENSP00000428511:V827I;ENSP00000428215:V857I;ENSP00000428026:V550I;ENSP00000430255:V198I	ENSP00000195649:V852I	V	-	1	0	SNAP91	84326604	0.999000	0.42202	0.964000	0.40570	0.805000	0.45488	4.222000	0.58580	2.719000	0.93026	0.655000	0.94253	GTC	.	.		0.547	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SDK1	221935	hgsc.bcm.edu	37	7	4153005	4153005	+	Silent	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:4153005C>G	ENST00000404826.2	+	24	3658	c.3519C>G	c.(3517-3519)ccC>ccG	p.P1173P	SDK1_ENST00000389531.3_Silent_p.P1173P	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1173					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGGCCCCACCCGACGTGGCTC	0.607																																					p.P1173P		Atlas-SNP	.											.	SDK1	361	.	0			c.C3519G						.						118.0	126.0	123.0					7																	4153005		2203	4300	6503	SO:0001819	synonymous_variant	221935	exon24			CCCACCCGACGTG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3519C>G	chr7.hg19:g.4153005C>G		30.0	0.0		55.0	15.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	hg19	CCDS34590.1																																																																																			.	.		0.607	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
OCM	654231	hgsc.bcm.edu	37	7	5923521	5923521	+	Splice_Site	SNP	G	G	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:5923521G>T	ENST00000242104.5	+	3	287	c.195G>T	c.(193-195)aaG>aaT	p.K65N	OCM_ENST00000416608.1_Splice_Site_p.K65N	NM_001097622.1	NP_001091091.1	P0CE72	ONCO_HUMAN	oncomodulin	65	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(2)	6		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		TATCCTGTAGGTTTTTCCTCC	0.428																																					p.K65N		Atlas-SNP	.											.	OCM	13	.	0			c.G195T						.						39.0	39.0	39.0					7																	5923521		2203	4300	6503	SO:0001630	splice_region_variant	654231	exon3			CTGTAGGTTTTTC	BC069468	CCDS43548.1	7p22.1	2013-01-10						"""EF-hand domain containing"""	8105	protein-coding gene	gene with protein product	"""oncomodulin 1"""	164795				1559707, 8354278	Standard	NM_001097622		Approved	OCM1	uc003spe.4	P0CE72		ENST00000242104.5:c.195-1G>T	chr7.hg19:g.5923521G>T		143.0	0.0		159.0	62.0	NM_001097622	B9EJH7|P32930|Q6ISI5|Q75MW0	Missense_Mutation	SNP	ENST00000242104.5	hg19	CCDS43548.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831328	0.71258	.	.	ENSG00000122543	ENST00000416608;ENST00000242104	T;T	0.72725	-0.68;-0.68	4.21	4.21	0.49690	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	M	0.87758	2.905	0.47621	D	0.999471	D	0.57257	0.979	P	0.55222	0.771	D	0.85881	0.1422	9	.	.	.	.	15.5278	0.75925	0.0:0.0:1.0:0.0	.	65	P0CE72	ONCO_HUMAN	N	65	ENSP00000401365:K65N;ENSP00000242104:K65N	.	K	+	3	2	OCM	5890047	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.145000	0.50623	2.065000	0.61736	0.502000	0.49764	AAG	.	.		0.428	OCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340372.1	NM_001097622	Missense_Mutation
C1GALT1	56913	hgsc.bcm.edu	37	7	7278123	7278123	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:7278123A>G	ENST00000223122.3	+	2	520	c.458A>G	c.(457-459)tAt>tGt	p.Y153C	C1GALT1_ENST00000402468.3_Missense_Mutation_p.Y153C|C1GALT1_ENST00000436587.2_Missense_Mutation_p.Y153C			Q9NS00	C1GLT_HUMAN	core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1	153					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|kidney development (GO:0001822)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity (GO:0016263)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(3)|prostate(1)|urinary_tract(1)	7				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		GCTTTTCAGTATGTTCATGAA	0.348																																					p.Y153C		Atlas-SNP	.											.	C1GALT1	24	.	0			c.A458G						.						68.0	69.0	69.0					7																	7278123		2203	4299	6502	SO:0001583	missense	56913	exon3			TTCAGTATGTTCA	AF155582	CCDS5355.1	7p21.3	2014-06-24	2014-06-24		ENSG00000106392	ENSG00000106392	2.4.1.122	"""Beta 3-glycosyltransferases"""	24337	protein-coding gene	gene with protein product	"""core 1 beta3-Gal-T"""	610555				10580128, 11677243	Standard	NM_020156		Approved	C1GALT, T-synthase	uc003srb.3	Q9NS00	OTTHUMG00000151912	ENST00000223122.3:c.458A>G	chr7.hg19:g.7278123A>G	ENSP00000223122:p.Tyr153Cys	200.0	0.0		224.0	98.0	NM_020156	Q96QH4|Q9BTU1	Missense_Mutation	SNP	ENST00000223122.3	hg19	CCDS5355.1	.	.	.	.	.	.	.	.	.	.	A	17.49	3.401907	0.62288	.	.	ENSG00000106392	ENST00000436587;ENST00000223122;ENST00000402468	T;T;T	0.62941	-0.01;-0.01;-0.01	5.42	5.42	0.78866	.	0.113557	0.64402	D	0.000008	T	0.81475	0.4830	H	0.95224	3.64	0.58432	D	0.999999	P;P	0.35908	0.471;0.527	P;P	0.48552	0.5;0.581	D	0.84725	0.0742	9	.	.	.	-14.7763	15.7732	0.78187	1.0:0.0:0.0:0.0	.	153;153	Q9NS00-2;Q9NS00	.;C1GLT_HUMAN	C	153	ENSP00000389176:Y153C;ENSP00000223122:Y153C;ENSP00000384550:Y153C	.	Y	+	2	0	C1GALT1	7244648	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.339000	0.96797	2.193000	0.70182	0.528000	0.53228	TAT	.	.		0.348	C1GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324379.2	NM_020156	
PPP1R9A	55607	hgsc.bcm.edu	37	7	94897973	94897973	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:94897973A>G	ENST00000433881.1	+	12	3243	c.2711A>G	c.(2710-2712)tAt>tGt	p.Y904C	PPP1R9A_ENST00000289495.5_Missense_Mutation_p.Y904C|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.Y904C|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.Y926C|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.Y904C|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.Y904C			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	904	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			ACAAGACTGTATGATAGTGTT	0.493										HNSCC(28;0.073)																											p.Y926C		Atlas-SNP	.											.	PPP1R9A	264	.	0			c.A2777G						.						107.0	91.0	97.0					7																	94897973		2203	4300	6503	SO:0001583	missense	55607	exon13			GACTGTATGATAG	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.2711A>G	chr7.hg19:g.94897973A>G	ENSP00000398870:p.Tyr904Cys	118.0	0.0		133.0	50.0	NM_001166160	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	hg19	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	A	7.782	0.709635	0.15239	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.15017	2.49;2.5;2.46;2.5;2.46;2.46	5.58	4.44	0.53790	.	0.361985	0.26553	N	0.023730	T	0.06690	0.0171	N	0.02011	-0.69	0.35225	D	0.776395	B;B;B;B;B	0.23490	0.003;0.044;0.086;0.028;0.016	B;B;B;B;B	0.23419	0.005;0.025;0.046;0.014;0.006	T	0.19192	-1.0313	10	0.39692	T	0.17	.	8.7217	0.34445	0.8551:0.0:0.1449:0.0	.	904;904;926;904;904	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	C	926;904;904;904;904;904	ENSP00000405514:Y926C;ENSP00000344524:Y904C;ENSP00000411342:Y904C;ENSP00000398870:Y904C;ENSP00000289495:Y904C;ENSP00000402893:Y904C	ENSP00000289495:Y904C	Y	+	2	0	PPP1R9A	94735909	1.000000	0.71417	0.999000	0.59377	0.017000	0.09413	5.223000	0.65283	1.070000	0.40811	0.533000	0.62120	TAT	.	.		0.493	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
MCM7	4176	hgsc.bcm.edu	37	7	99695366	99695366	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:99695366C>G	ENST00000303887.5	-	9	1633	c.988G>C	c.(988-990)Gag>Cag	p.E330Q	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Missense_Mutation_p.E154Q	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	330					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TAGAAATCCTCCTCTGTAGAG	0.493																																					p.E330Q		Atlas-SNP	.											.	MCM7	136	.	0			c.G988C						.						164.0	163.0	163.0					7																	99695366		2203	4300	6503	SO:0001583	missense	4176	exon9			AATCCTCCTCTGT		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.988G>C	chr7.hg19:g.99695366C>G	ENSP00000307288:p.Glu330Gln	60.0	0.0		94.0	54.0	NM_005916	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	hg19	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847375	0.32606	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	T;T	0.06849	3.25;3.25	4.88	4.88	0.63580	.	0.056300	0.64402	D	0.000001	T	0.13543	0.0328	L	0.56124	1.755	0.80722	D	1	B	0.25235	0.121	B	0.35971	0.215	T	0.05419	-1.0886	10	0.34782	T	0.22	-18.9757	15.5729	0.76354	0.0:1.0:0.0:0.0	.	330	P33993	MCM7_HUMAN	Q	330;267;223;154	ENSP00000307288:E330Q;ENSP00000346171:E154Q	ENSP00000307288:E330Q	E	-	1	0	MCM7	99533302	1.000000	0.71417	1.000000	0.80357	0.058000	0.15608	3.759000	0.55227	2.548000	0.85928	0.655000	0.94253	GAG	.	.		0.493	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
C7orf43	55262	hgsc.bcm.edu	37	7	99755553	99755553	+	Silent	SNP	C	C	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:99755553C>A	ENST00000316937.3	-	2	605	c.420G>T	c.(418-420)gtG>gtT	p.V140V	C7orf43_ENST00000498638.1_5'Flank|MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000457641.1_5'UTR|C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000394035.2_5'Flank	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	140										breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCGGTTCCTCCACAGGCAGCT	0.562																																					p.V140V		Atlas-SNP	.											.	C7orf43	28	.	0			c.G420T						.						58.0	54.0	55.0					7																	99755553		2203	4300	6503	SO:0001819	synonymous_variant	55262	exon2			TTCCTCCACAGGC		CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.420G>T	chr7.hg19:g.99755553C>A		122.0	0.0		120.0	57.0	NM_018275	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Silent	SNP	ENST00000316937.3	hg19	CCDS5687.1	.	.	.	.	.	.	.	.	.	.	C	9.711	1.156988	0.21454	.	.	ENSG00000146826	ENST00000456769	.	.	.	5.66	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.5687	7.4627	0.27304	0.1646:0.7513:0.0:0.0841	.	.	.	.	X	46	.	.	G	-	1	0	C7orf43	99593489	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.226000	0.42963	1.397000	0.46682	0.462000	0.41574	GGA	.	.		0.562	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
CNTNAP2	26047	hgsc.bcm.edu	37	7	146536812	146536812	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:146536812G>A	ENST00000361727.3	+	3	734	c.218G>A	c.(217-219)gGa>gAa	p.G73E		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	73	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGTGCTGGGGGATGGTCTCCA	0.428										HNSCC(39;0.1)																											p.G73E		Atlas-SNP	.											.	CNTNAP2	392	.	0			c.G218A						.						73.0	64.0	67.0					7																	146536812		2203	4300	6503	SO:0001583	missense	26047	exon3			CTGGGGGATGGTC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.218G>A	chr7.hg19:g.146536812G>A	ENSP00000354778:p.Gly73Glu	75.0	0.0		103.0	53.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	hg19	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922169	0.92319	.	.	ENSG00000174469	ENST00000361727	D	0.97480	-4.4	5.83	5.83	0.93111	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.53938	D	0.000046	D	0.98918	0.9633	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99537	1.0962	10	0.87932	D	0	.	18.6885	0.91574	0.0:0.0:1.0:0.0	.	73	Q9UHC6	CNTP2_HUMAN	E	73	ENSP00000354778:G73E	ENSP00000354778:G73E	G	+	2	0	CNTNAP2	146167745	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	9.869000	0.99810	2.760000	0.94817	0.650000	0.86243	GGA	.	.		0.428	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
PTPRN2	5799	hgsc.bcm.edu	37	7	158109583	158109583	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr7:158109583A>T	ENST00000389418.4	-	3	214	c.205T>A	c.(205-207)Ttt>Att	p.F69I	PTPRN2_ENST00000389413.3_Missense_Mutation_p.F69I|PTPRN2_ENST00000409483.1_Intron|PTPRN2_ENST00000404321.2_Missense_Mutation_p.F92I|PTPRN2_ENST00000389416.4_Missense_Mutation_p.F52I	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	69					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TAGCGGTAAAAGTCCATTGCC	0.597																																					p.F69I		Atlas-SNP	.											.	PTPRN2	243	.	0			c.T205A						.						76.0	65.0	69.0					7																	158109583		2202	4300	6502	SO:0001583	missense	5799	exon3			GGTAAAAGTCCAT	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.205T>A	chr7.hg19:g.158109583A>T	ENSP00000374069:p.Phe69Ile	71.0	0.0		101.0	17.0	NM_130843	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	hg19	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.380117	0.01204	.	.	ENSG00000155093	ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T	0.02737	4.22;4.22;4.22;4.18	4.82	-9.64	0.00541	.	.	.	.	.	T	0.01287	0.0042	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.48990	-0.8985	9	0.18710	T	0.47	.	8.5094	0.33208	0.2125:0.5318:0.0:0.2556	.	92;69;52;69	Q92932-3;Q92932-2;E9PC57;Q92932	.;.;.;PTPR2_HUMAN	I	69;52;69;92	ENSP00000374064:F69I;ENSP00000374067:F52I;ENSP00000374069:F69I;ENSP00000385464:F92I	ENSP00000374064:F69I	F	-	1	0	PTPRN2	157802344	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	-0.175000	0.09825	-2.043000	0.00913	-1.670000	0.00746	TTT	.	.		0.597	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
ADAM18	8749	hgsc.bcm.edu	37	8	39564320	39564320	+	Silent	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr8:39564320T>C	ENST00000265707.5	+	18	1959	c.1914T>C	c.(1912-1914)aaT>aaC	p.N638N	ADAM18_ENST00000541111.1_Silent_p.N52N|ADAM18_ENST00000379866.1_Silent_p.N614N|ADAM18_ENST00000523755.1_3'UTR	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	638	EGF-like.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TATGTAATAATTTTGGTAATT	0.333																																					p.N638N		Atlas-SNP	.											.	ADAM18	169	.	0			c.T1914C						.						97.0	97.0	97.0					8																	39564320		2203	4300	6503	SO:0001819	synonymous_variant	8749	exon18			TAATAATTTTGGT	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1914T>C	chr8.hg19:g.39564320T>C		103.0	0.0		68.0	20.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	ENST00000265707.5	hg19	CCDS6113.1																																																																																			.	.		0.333	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
ADCY8	114	hgsc.bcm.edu	37	8	131833593	131833593	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr8:131833593G>A	ENST00000286355.5	-	13	4841	c.2749C>T	c.(2749-2751)Cag>Tag	p.Q917*	ADCY8_ENST00000377928.3_Nonsense_Mutation_p.Q786*	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	917					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATTACCTGCTGTCCATGGTAG	0.448										HNSCC(32;0.087)																											p.Q917X		Atlas-SNP	.											.	ADCY8	291	.	0			c.C2749T						.						104.0	80.0	88.0					8																	131833593		2203	4300	6503	SO:0001587	stop_gained	114	exon13			CCTGCTGTCCATG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2749C>T	chr8.hg19:g.131833593G>A	ENSP00000286355:p.Gln917*	103.0	0.0		100.0	50.0	NM_001115		Nonsense_Mutation	SNP	ENST00000286355.5	hg19	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	55	24.036052	0.99958	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	.	.	.	5.92	5.92	0.95590	.	0.055436	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.4903	0.87701	0.0:0.0:1.0:0.0	.	.	.	.	X	917;786	.	ENSP00000286355:Q917X	Q	-	1	0	ADCY8	131902775	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.315000	0.96313	2.822000	0.97130	0.650000	0.86243	CAG	.	.		0.448	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	43.0	1.0		41.0	8.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
TUBB8	347688	hgsc.bcm.edu	37	10	95177	95177	+	Start_Codon_SNP	SNP	A	A	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr10:95177A>C	ENST00000309812.4	-	1	64	c.2T>G	c.(1-3)aTg>aGg	p.M1R	TUBB8_ENST00000332708.5_Start_Codon_SNP_p.M1R|TUBB8_ENST00000413237.3_Intron|TUBB8_ENST00000447903.2_Intron	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	1					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GATCTCCCTCATGGCCAAGGC	0.672																																					p.M1R	Pancreas(192;2041 3010 9013 18103)	Atlas-SNP	.											.	TUBB8	62	.	0			c.T2G						.						18.0	16.0	17.0					10																	95177		2199	4294	6493	SO:0001582	initiator_codon_variant	347688	exon1			TCCCTCATGGCCA	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.2T>G	chr10.hg19:g.95177A>C	ENSP00000311042:p.Met1Arg	123.0	0.0		174.0	72.0	NM_177987	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	hg19	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	A	9.960	1.222478	0.22457	.	.	ENSG00000173876	ENST00000440680;ENST00000328974;ENST00000309812;ENST00000332708	T;T	0.71579	-0.58;-0.58	0.109	0.109	0.14578	Tubulin/FtsZ, GTPase domain (2);	0.000000	0.64402	U	0.000001	T	0.67571	0.2907	.	.	.	0.80722	D	1	P;P	0.52170	0.86;0.951	P;P	0.49597	0.599;0.616	T	0.65018	-0.6270	9	0.87932	D	0	.	4.6217	0.12455	0.9996:0.0:4.0E-4:0.0	.	1;1	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	R	1	ENSP00000311042:M1R;ENSP00000371071:M1R	ENSP00000311042:M1R	M	-	2	0	RP11-631M21.2	85177	1.000000	0.71417	0.023000	0.16930	0.024000	0.10985	5.356000	0.66052	0.156000	0.19299	0.155000	0.16302	ATG	.	.		0.672	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	Missense_Mutation
CUBN	8029	hgsc.bcm.edu	37	10	17147481	17147481	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr10:17147481T>A	ENST00000377833.4	-	11	1270	c.1205A>T	c.(1204-1206)cAc>cTc	p.H402L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	402	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAGACAGGGGTGACTTAGGCA	0.438																																					p.H402L		Atlas-SNP	.											.	CUBN	515	.	0			c.A1205T						.						166.0	147.0	153.0					10																	17147481		2203	4300	6503	SO:0001583	missense	8029	exon11			CAGGGGTGACTTA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1205A>T	chr10.hg19:g.17147481T>A	ENSP00000367064:p.His402Leu	98.0	0.0		100.0	16.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.685444	0.29872	.	.	ENSG00000107611	ENST00000377833	D	0.91945	-2.94	5.5	-0.839	0.10759	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.544198	0.15554	N	0.256275	D	0.82765	0.5108	L	0.27975	0.815	0.80722	D	1	P	0.35226	0.491	B	0.25614	0.062	T	0.72616	-0.4239	10	0.72032	D	0.01	.	9.8631	0.41127	0.0:0.3395:0.0:0.6605	.	402	O60494	CUBN_HUMAN	L	402	ENSP00000367064:H402L	ENSP00000367064:H402L	H	-	2	0	CUBN	17187487	0.993000	0.37304	0.071000	0.20095	0.388000	0.30384	0.627000	0.24506	-0.400000	0.07656	0.482000	0.46254	CAC	.	.		0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ZSWIM8	23053	hgsc.bcm.edu	37	10	75558879	75558879	+	Silent	SNP	T	T	C	rs35762168		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr10:75558879T>C	ENST00000605216.1	+	21	4498	c.4281T>C	c.(4279-4281)acT>acC	p.T1427T	ZSWIM8_ENST00000604524.1_Intron|ZSWIM8_ENST00000603114.1_Silent_p.T1394T|ZSWIM8_ENST00000604729.1_Silent_p.T1432T|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000398706.2_Silent_p.T1432T|RP11-574K11.31_ENST00000603027.1_Intron	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1427							zinc ion binding (GO:0008270)										ATGAGCAAACTGCAGGTGGCT	0.597																																					p.T1432T		Atlas-SNP	.											.	.	.	.	0			c.T4296C						.						62.0	68.0	66.0					10																	75558879		2018	4174	6192	SO:0001819	synonymous_variant	23053	exon21			GCAAACTGCAGGT	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.4281T>C	chr10.hg19:g.75558879T>C		131.0	0.0		121.0	54.0	NM_015037	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Silent	SNP	ENST00000605216.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.261|8.261	0.811139|0.811139	0.16537|0.16537	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000433366|ENST00000412198	.|.	.|.	.|.	5.59|5.59	2.91|2.91	0.33838|0.33838	.|.	.|.	.|.	.|.	.|.	T|T	0.47116|0.47116	0.1428|0.1428	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36016|0.36016	-0.9765|-0.9765	4|4	.|.	.|.	.|.	-4.6427|-4.6427	3.9776|3.9776	0.09481|0.09481	0.4765:0.0:0.1504:0.373|0.4765:0.0:0.1504:0.373	.|.	.|.	.|.	.|.	R|P	1143|702	.|.	.|.	C|L	+|+	1|2	0|0	KIAA0913|KIAA0913	75228885|75228885	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.729000|0.729000	0.26028|0.26028	0.945000|0.945000	0.37605|0.37605	-0.339000|-0.339000	0.08088|0.08088	TGC|CTG	.	.		0.597	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
DLG5	9231	hgsc.bcm.edu	37	10	79581096	79581096	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr10:79581096C>A	ENST00000372391.2	-	15	3151	c.3146G>T	c.(3145-3147)aGc>aTc	p.S1049I	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Intron	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1049	Pro-rich.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GGGCAGGGCGCTCGGGGGACT	0.637																																					p.S1049I		Atlas-SNP	.											.	DLG5	154	.	0			c.G3146T						.						20.0	23.0	22.0					10																	79581096		2198	4283	6481	SO:0001583	missense	9231	exon15			AGGGCGCTCGGGG	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3146G>T	chr10.hg19:g.79581096C>A	ENSP00000361467:p.Ser1049Ile	42.0	0.0		62.0	9.0	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	hg19	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	C	5.211	0.224455	0.09863	.	.	ENSG00000151208	ENST00000372391;ENST00000372392	T	0.04406	3.63	5.87	2.69	0.31865	.	0.528240	0.16043	N	0.232354	T	0.05593	0.0147	L	0.44542	1.39	0.09310	N	0.999999	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.29822	-0.9999	10	0.62326	D	0.03	.	9.6128	0.39674	0.128:0.3243:0.5478:0.0	.	939;1049	Q8TDM6-4;Q8TDM6	.;DLG5_HUMAN	I	1049;598	ENSP00000361467:S1049I	ENSP00000361467:S1049I	S	-	2	0	DLG5	79251102	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	1.010000	0.29898	0.335000	0.23614	0.655000	0.94253	AGC	.	.		0.637	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
CALHM1	255022	hgsc.bcm.edu	37	10	105215375	105215375	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr10:105215375T>A	ENST00000329905.5	-	2	821	c.685A>T	c.(685-687)Aag>Tag	p.K229*	RP11-225H22.4_ENST00000411906.1_RNA|CALHM2_ENST00000393235.1_5'Flank	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	229					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						TCGAAGAGCTTGCGCTCGATG	0.592																																					p.K229X		Atlas-SNP	.											.	CALHM1	33	.	0			c.A685T						.						81.0	67.0	72.0					10																	105215375		2203	4300	6503	SO:0001587	stop_gained	255022	exon2			AGAGCTTGCGCTC	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.685A>T	chr10.hg19:g.105215375T>A	ENSP00000329926:p.Lys229*	86.0	0.0		91.0	35.0	NM_001001412	Q5W091	Nonsense_Mutation	SNP	ENST00000329905.5	hg19	CCDS7550.1	.	.	.	.	.	.	.	.	.	.	T	37	6.213133	0.97380	.	.	ENSG00000185933	ENST00000329905	.	.	.	5.43	5.43	0.79202	.	0.100065	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.1553	15.4612	0.75359	0.0:0.0:0.0:1.0	.	.	.	.	X	229	.	ENSP00000329926:K229X	K	-	1	0	CALHM1	105205365	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.539000	0.82063	2.054000	0.61138	0.379000	0.24179	AAG	.	.		0.592	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412	
FANCF	2188	hgsc.bcm.edu	37	11	22646708	22646708	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:22646708G>A	ENST00000327470.3	-	1	679	c.649C>T	c.(649-651)Cgg>Tgg	p.R217W	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	217					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						TCTTGGGGCCGACGAGACAAA	0.592			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R217W		Atlas-SNP	.	yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	.	FANCF	24	.	0			c.C649T						.						57.0	66.0	63.0					11																	22646708		2203	4300	6503	SO:0001583	missense	2188	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GGGGCCGACGAGA		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.649C>T	chr11.hg19:g.22646708G>A	ENSP00000330875:p.Arg217Trp	60.0	0.0	757	72.0	21.0	NM_022725	Q52LM0	Missense_Mutation	SNP	ENST00000327470.3	hg19	CCDS7857.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.176960	0.38413	.	.	ENSG00000183161	ENST00000327470	T	0.33654	1.4	4.88	-3.52	0.04682	.	0.914236	0.09103	U	0.848160	T	0.37348	0.1000	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	P	0.60886	0.88	T	0.47611	-0.9104	10	0.66056	D	0.02	.	11.9193	0.52783	0.0:0.4936:0.3135:0.1929	.	217	Q9NPI8	FANCF_HUMAN	W	217	ENSP00000330875:R217W	ENSP00000330875:R217W	R	-	1	2	FANCF	22603284	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-0.481000	0.06552	-0.409000	0.07553	0.561000	0.74099	CGG	.	.		0.592	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725	
CD44	960	hgsc.bcm.edu	37	11	35232954	35232954	+	Missense_Mutation	SNP	A	A	G	rs373762543		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:35232954A>G	ENST00000428726.2	+	14	1891	c.1768A>G	c.(1768-1770)Act>Gct	p.T590A	CD44_ENST00000433892.2_Missense_Mutation_p.T341A|CD44_ENST00000415148.2_Missense_Mutation_p.T547A|CD44_ENST00000526669.2_Intron|CD44_ENST00000360158.4_Intron|RP1-68D18.4_ENST00000528869.1_RNA|RP1-68D18.2_ENST00000510619.2_RNA|CD44_ENST00000263398.6_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000449691.2_Missense_Mutation_p.T547A|CD44_ENST00000278386.6_Intron|CD44_ENST00000433354.2_Missense_Mutation_p.T562A|CD44_ENST00000434472.2_Missense_Mutation_p.T277A|CD44_ENST00000437706.2_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	590	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	TACTGCAGTTACTGTTGGAGA	0.398																																					p.T590A		Atlas-SNP	.											.	CD44	48	.	0			c.A1768G						.						219.0	201.0	207.0					11																	35232954		2202	4298	6500	SO:0001583	missense	960	exon14			GCAGTTACTGTTG	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1768A>G	chr11.hg19:g.35232954A>G	ENSP00000398632:p.Thr590Ala	165.0	0.0		173.0	44.0	NM_000610	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Missense_Mutation	SNP	ENST00000428726.2	hg19	CCDS7897.1	.	.	.	.	.	.	.	.	.	.	A	7.923	0.738910	0.15642	.	.	ENSG00000026508	ENST00000415148;ENST00000433354;ENST00000449691;ENST00000428726;ENST00000433892;ENST00000434472;ENST00000526000	T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82	5.65	1.96	0.26148	.	0.769234	0.12088	N	0.500731	T	0.24084	0.0583	M	0.64997	1.995	0.19300	N	0.99998	B;B;B;B	0.14805	0.011;0.005;0.004;0.002	B;B;B;B	0.17722	0.019;0.009;0.004;0.003	T	0.28713	-1.0035	10	0.46703	T	0.11	-13.7741	4.7447	0.13031	0.6696:0.161:0.1694:0.0	.	277;341;547;590	P16070-11;P16070-10;P16070-4;P16070	.;.;.;CD44_HUMAN	A	547;562;547;590;341;277;224	ENSP00000389830:T547A;ENSP00000414567:T562A;ENSP00000391008:T547A;ENSP00000398632:T590A;ENSP00000392331:T341A;ENSP00000404447:T277A;ENSP00000434465:T224A	ENSP00000389830:T547A	T	+	1	0	CD44	35189530	0.453000	0.25721	0.015000	0.15790	0.012000	0.07955	0.772000	0.26647	0.075000	0.16796	0.533000	0.62120	ACT	.	.		0.398	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610	
LRRC4C	57689	hgsc.bcm.edu	37	11	40137179	40137179	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:40137179C>A	ENST00000278198.2	-	2	2627	c.664G>T	c.(664-666)Gat>Tat	p.D222Y	LRRC4C_ENST00000527150.1_Missense_Mutation_p.D222Y|LRRC4C_ENST00000530763.1_Missense_Mutation_p.D222Y|LRRC4C_ENST00000528697.1_Missense_Mutation_p.D222Y			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	222					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.D222Y(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TCCAGCTCATCTAGTTTTATG	0.468																																					p.D222Y		Atlas-SNP	.											LRRC4C,NS,carcinoma,0,1	LRRC4C	190	.	1	Substitution - Missense(1)	lung(1)	c.G664T						.						83.0	82.0	82.0					11																	40137179		2203	4300	6503	SO:0001583	missense	57689	exon7			GCTCATCTAGTTT	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.664G>T	chr11.hg19:g.40137179C>A	ENSP00000278198:p.Asp222Tyr	121.0	1.0		142.0	60.0	NM_001258419	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	hg19	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287319	0.59867	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.04360	3.64;3.64;3.64;3.64	5.44	5.44	0.79542	.	0.049235	0.85682	D	0.000000	T	0.09555	0.0235	N	0.16266	0.395	0.80722	D	1	D	0.69078	0.997	P	0.57425	0.82	T	0.19418	-1.0306	10	0.87932	D	0	.	18.2645	0.90048	0.0:1.0:0.0:0.0	.	222	Q9HCJ2	LRC4C_HUMAN	Y	222	ENSP00000278198:D222Y;ENSP00000436976:D222Y;ENSP00000437132:D222Y;ENSP00000434761:D222Y	ENSP00000278198:D222Y	D	-	1	0	LRRC4C	40093755	1.000000	0.71417	0.993000	0.49108	0.925000	0.55904	7.818000	0.86416	2.561000	0.86390	0.650000	0.86243	GAT	.	.		0.468	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
SDHAF2	54949	hgsc.bcm.edu	37	11	61205156	61205156	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:61205156A>C	ENST00000543265.1	+	2	99	c.96A>C	c.(94-96)agA>agC	p.R32S	SDHAF2_ENST00000537782.1_Missense_Mutation_p.R32S|SDHAF2_ENST00000301761.2_Missense_Mutation_p.R32S|SDHAF2_ENST00000534878.1_Missense_Mutation_p.R32S|RP11-286N22.8_ENST00000544880.1_3'UTR|RP11-286N22.8_ENST00000543044.1_Missense_Mutation_p.R20S|SDHAF2_ENST00000542074.1_Intron					succinate dehydrogenase complex assembly factor 2											large_intestine(3)|lung(4)|ovary(2)	9						CATCATTCAGACGCTTCTACA	0.438																																					p.R32S		Atlas-SNP	.											.	SDHAF2	26	.	0			c.A96C						.						194.0	191.0	192.0					11																	61205156		2202	4299	6501	SO:0001583	missense	54949	exon2			ATTCAGACGCTTC	AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000543265.1:c.96A>C	chr11.hg19:g.61205156A>C	ENSP00000443660:p.Arg32Ser	100.0	0.0		112.0	55.0	NM_017841		Missense_Mutation	SNP	ENST00000543265.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.473	1.096020	0.20552	.	.	ENSG00000256591;ENSG00000167985;ENSG00000167985	ENST00000541135;ENST00000301761;ENST00000543265	T;T;T	0.77750	-1.12;-1.07;-1.02	5.91	1.01	0.19927	.	0.451244	0.26620	N	0.023369	T	0.62696	0.2449	L	0.39898	1.24	0.20638	N	0.99987	B	0.06786	0.001	B	0.06405	0.002	T	0.44003	-0.9356	10	0.22109	T	0.4	-4.6152	6.227	0.20714	0.4059:0.4421:0.152:0.0	.	32	Q9NX18	SDHF2_HUMAN	S	32	ENSP00000443130:R32S;ENSP00000301761:R32S;ENSP00000443660:R32S	ENSP00000440939:R32S	R	+	3	2	SDHAF2;RP11-286N22.8	60961732	0.244000	0.23889	0.272000	0.24630	0.364000	0.29643	0.120000	0.15647	-0.072000	0.12864	0.533000	0.62120	AGA	.	.		0.438	SDHAF2-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398484.1	NM_017841	
MMP1	4312	hgsc.bcm.edu	37	11	102661252	102661252	+	Splice_Site	SNP	C	C	T	rs181629882		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:102661252C>T	ENST00000315274.6	-	10	1368	c.1301G>A	c.(1300-1302)gGa>gAa	p.G434E	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	434					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G434E(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	ATAGAAAAATCCTAGAAACAA	0.323																																					p.G434E		Atlas-SNP	.											MMP1,NS,carcinoma,0,1	MMP1	74	.	1	Substitution - Missense(1)	lung(1)	c.G1301A						.						68.0	65.0	66.0					11																	102661252		2203	4296	6499	SO:0001630	splice_region_variant	4312	exon10			AAAAATCCTAGAA	X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.1301-1G>A	chr11.hg19:g.102661252C>T		102.0	0.0		127.0	54.0	NM_002421	P08156	Missense_Mutation	SNP	ENST00000315274.6	hg19	CCDS8322.1	.	.	.	.	.	.	.	.	.	.	c	17.82	3.483506	0.63962	.	.	ENSG00000196611	ENST00000315274	T	0.03553	3.89	6.17	1.59	0.23543	Hemopexin/matrixin (2);	0.563488	0.17181	N	0.183896	T	0.08582	0.0213	M	0.86953	2.85	0.47778	D	0.999513	B	0.28378	0.209	B	0.35510	0.204	T	0.02104	-1.1213	10	0.62326	D	0.03	.	6.1893	0.20516	0.128:0.6335:0.0:0.2385	.	434	P03956	MMP1_HUMAN	E	434	ENSP00000322788:G434E	ENSP00000322788:G434E	G	-	2	0	MMP1	102166462	0.310000	0.24527	0.911000	0.35937	0.983000	0.72400	0.565000	0.23578	0.659000	0.30945	0.655000	0.94253	GGA	.	C|1.000;A|0.000		0.323	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109632.1	NM_002421	Missense_Mutation
BUD13	84811	hgsc.bcm.edu	37	11	116633446	116633446	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:116633446T>C	ENST00000260210.4	-	4	882	c.859A>G	c.(859-861)Agt>Ggt	p.S287G	BUD13_ENST00000375445.3_Intron	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)	287					mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		GCTTTACCACTTTTGGTTCTG	0.493																																					p.S287G		Atlas-SNP	.											.	BUD13	41	.	0			c.A859G						.						118.0	124.0	122.0					11																	116633446		2201	4296	6497	SO:0001583	missense	84811	exon4			TACCACTTTTGGT	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136	ENST00000260210.4:c.859A>G	chr11.hg19:g.116633446T>C	ENSP00000260210:p.Ser287Gly	124.0	0.0		122.0	53.0	NM_032725	A8K0S0|Q96LS7	Missense_Mutation	SNP	ENST00000260210.4	hg19	CCDS8374.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.144402	0.37825	.	.	ENSG00000137656	ENST00000260210	T	0.18174	2.23	3.95	3.95	0.45737	.	0.240159	0.36002	N	0.002848	T	0.19967	0.0480	M	0.76002	2.32	0.36576	D	0.873282	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.17107	-1.0380	10	0.87932	D	0	-10.0641	7.8676	0.29545	0.0:0.0988:0.0:0.9012	.	287;287	A8K4Z6;Q9BRD0	.;BUD13_HUMAN	G	287	ENSP00000260210:S287G	ENSP00000260210:S287G	S	-	1	0	BUD13	116138656	0.934000	0.31675	1.000000	0.80357	0.248000	0.25809	1.811000	0.38942	2.017000	0.59298	0.533000	0.62120	AGT	.	.		0.493	BUD13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000104864.1	NM_032725	
ETS1	2113	hgsc.bcm.edu	37	11	128332286	128332286	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:128332286C>G	ENST00000319397.6	-	8	1605	c.1296G>C	c.(1294-1296)atG>atC	p.M432I	ETS1_ENST00000526145.2_Missense_Mutation_p.M345I|ETS1_ENST00000345075.4_Missense_Mutation_p.M345I|ETS1_ENST00000535549.1_Missense_Mutation_p.M216I|ETS1_ENST00000531611.1_3'UTR|ETS1_ENST00000392668.4_Missense_Mutation_p.M476I	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	432					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		TGACGTCCAGCATGGCGTGCA	0.577																																					p.M476I		Atlas-SNP	.											.	ETS1	123	.	0			c.G1428C						.						99.0	85.0	90.0					11																	128332286		2201	4297	6498	SO:0001583	missense	2113	exon10			GTCCAGCATGGCG		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.1296G>C	chr11.hg19:g.128332286C>G	ENSP00000324578:p.Met432Ile	114.0	0.0		134.0	64.0	NM_001143820	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000319397.6	hg19	CCDS8475.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276038	0.80580	.	.	ENSG00000134954	ENST00000345075;ENST00000535549;ENST00000392668;ENST00000319397;ENST00000526145	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59	5.96	5.96	0.96718	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.24661	0.0598	L	0.41573	1.285	0.80722	D	1	B;B;D	0.55605	0.005;0.006;0.972	B;B;P	0.54026	0.003;0.009;0.74	T	0.00070	-1.2134	10	0.33940	T	0.23	.	20.4082	0.99013	0.0:1.0:0.0:0.0	.	432;216;476	P14921;F5GYX9;Q6N087	ETS1_HUMAN;.;.	I	345;216;476;432;345	ENSP00000340485:M345I;ENSP00000441430:M216I;ENSP00000376436:M476I;ENSP00000324578:M432I;ENSP00000433500:M345I	ENSP00000324578:M432I	M	-	3	0	ETS1	127837496	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.441000	0.80485	2.814000	0.96858	0.655000	0.94253	ATG	.	.		0.577	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238	
KIF21A	55605	hgsc.bcm.edu	37	12	39726081	39726081	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr12:39726081T>C	ENST00000361418.5	-	21	3001	c.2986A>G	c.(2986-2988)Atc>Gtc	p.I996V	KIF21A_ENST00000395670.3_Missense_Mutation_p.I996V|KIF21A_ENST00000361961.3_Missense_Mutation_p.I983V|KIF21A_ENST00000541463.2_Missense_Mutation_p.I960V|KIF21A_ENST00000544797.2_Missense_Mutation_p.I983V			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	996					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				ATGTAATCGATATTAGCAGTC	0.353																																					p.I996V		Atlas-SNP	.											.	KIF21A	238	.	0			c.A2986G						.						204.0	184.0	191.0					12																	39726081		2203	4300	6503	SO:0001583	missense	55605	exon21			AATCGATATTAGC	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2986A>G	chr12.hg19:g.39726081T>C	ENSP00000354878:p.Ile996Val	100.0	0.0		106.0	8.0	NM_001173464	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	hg19	CCDS53776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.93|14.93	2.682080|2.682080	0.47991|0.47991	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000552961|ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463;ENST00000551066	.|D;D;D;D;D;D;D	.|0.86694	.|-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	5.8|5.8	5.8|5.8	0.92144|0.92144	.|Prefoldin (1);	0.000000|0.000000	0.64402|0.64402	D|D	0.000014|0.000014	D|D	0.91932|0.91932	0.7445|0.7445	L|L	0.56769|0.56769	1.78|1.78	0.58432|0.58432	D|D	0.999994|0.999994	.|B;P;B;B;B;P	.|0.51791	.|0.003;0.948;0.029;0.003;0.008;0.645	.|B;D;B;B;B;P	.|0.67103	.|0.011;0.949;0.032;0.011;0.034;0.58	D|D	0.92560|0.92560	0.6057|0.6057	6|10	.|0.72032	.|D	.|0.01	.|.	16.1506|16.1506	0.81618|0.81618	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|983;960;996;983;996;50	.|F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8	.|.;.;KI21A_HUMAN;.;.;.	M|V	343|983;996;996;50;44;983;996;960;17	.|ENSP00000354851:I983V;ENSP00000379029:I996V;ENSP00000448792:I44V;ENSP00000445606:I983V;ENSP00000354878:I996V;ENSP00000438075:I960V;ENSP00000447070:I17V	.|ENSP00000344501:I996V	I|I	-|-	3|1	3|0	KIF21A|KIF21A	38012348|38012348	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.448000|0.448000	0.32197|0.32197	7.880000|7.880000	0.87243|0.87243	2.206000|2.206000	0.71126|0.71126	0.528000|0.528000	0.53228|0.53228	ATA|ATC	.	.		0.353	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
SCAF11	9169	hgsc.bcm.edu	37	12	46320992	46320992	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr12:46320992T>G	ENST00000369367.3	-	11	2725	c.2492A>C	c.(2491-2493)cAa>cCa	p.Q831P	SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Missense_Mutation_p.Q516P|SCAF11_ENST00000419565.2_Missense_Mutation_p.Q831P|SCAF11_ENST00000549162.1_Missense_Mutation_p.Q639P	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	831					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						AGATGGTGATTGAGACTTCCT	0.473																																					p.Q831P		Atlas-SNP	.											.	SCAF11	145	.	0			c.A2492C						.						112.0	113.0	113.0					12																	46320992		2203	4300	6503	SO:0001583	missense	9169	exon11			GGTGATTGAGACT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2492A>C	chr12.hg19:g.46320992T>G	ENSP00000358374:p.Gln831Pro	69.0	0.0		73.0	5.0	NM_004719	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	hg19	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	T	9.710	1.156925	0.21454	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.47528	1.45;2.18;1.45;2.18;0.84	5.93	-11.9	0.00025	.	1.797880	0.02620	N	0.103170	T	0.34861	0.0912	L	0.52573	1.65	0.20307	N	0.999917	B;P	0.52842	0.002;0.956	B;B	0.41619	0.004;0.361	T	0.56817	-0.7916	10	0.72032	D	0.01	6.9181	6.2382	0.20774	0.0747:0.0872:0.2255:0.6126	.	639;831	F8VXG7;Q99590	.;SCAFB_HUMAN	P	516;831;639;831;771	ENSP00000449812:Q516P;ENSP00000358374:Q831P;ENSP00000448864:Q639P;ENSP00000413036:Q831P;ENSP00000446746:Q771P	ENSP00000358374:Q831P	Q	-	2	0	SCAF11	44607259	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	-2.310000	0.01129	-2.583000	0.00461	-0.290000	0.09829	CAA	.	.		0.473	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
LLPH	84298	hgsc.bcm.edu	37	12	66522717	66522717	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr12:66522717T>C	ENST00000266604.2	-	2	240	c.170A>G	c.(169-171)cAt>cGt	p.H57R	TMBIM4_ENST00000539652.1_3'UTR|LLPH_ENST00000446587.2_Missense_Mutation_p.H57R|RP11-745O10.2_ENST00000510317.2_RNA|TMBIM4_ENST00000556010.1_3'UTR	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	57	Lys-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						CTCTTGGCAATGTTTGGGTTT	0.378																																					p.H57R		Atlas-SNP	.											.	LLPH	25	.	0			c.A170G						.						124.0	117.0	119.0					12																	66522717		2203	4298	6501	SO:0001583	missense	84298	exon2			TGGCAATGTTTGG	AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.170A>G	chr12.hg19:g.66522717T>C	ENSP00000266604:p.His57Arg	301.0	0.0		313.0	91.0	NM_032338	Q3B766	Missense_Mutation	SNP	ENST00000266604.2	hg19	CCDS8974.1	.	.	.	.	.	.	.	.	.	.	T	4.211	0.037931	0.08148	.	.	ENSG00000139233	ENST00000266604;ENST00000446587	.	.	.	4.0	1.53	0.23141	.	0.905533	0.09721	N	0.764480	T	0.13970	0.0338	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31586	-0.9938	8	.	.	.	-21.1146	4.1527	0.10245	0.0:0.1126:0.2082:0.6792	.	57	Q9BRT6	LLPH_HUMAN	R	57	.	.	H	-	2	0	LLPH	64808984	0.157000	0.22836	0.003000	0.11579	0.441000	0.31987	0.523000	0.22925	0.190000	0.20209	0.260000	0.18958	CAT	.	.		0.378	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401752.1	NM_032338	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72004331	72004331	+	Silent	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr12:72004331T>C	ENST00000378743.3	-	35	6205	c.5847A>G	c.(5845-5847)gaA>gaG	p.E1949E		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1949					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CTTCTGATGCTTCAAACAAGA	0.378																																					p.E1949E		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.A5847G						.						106.0	96.0	100.0					12																	72004331		1872	4097	5969	SO:0001819	synonymous_variant	196441	exon35			TGATGCTTCAAAC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.5847A>G	chr12.hg19:g.72004331T>C		82.0	0.0		87.0	20.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	hg19	CCDS41813.1																																																																																			.	.		0.378	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
ACIN1	22985	hgsc.bcm.edu	37	14	23532224	23532224	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr14:23532224T>C	ENST00000262710.1	-	14	3298	c.2971A>G	c.(2971-2973)Att>Gtt	p.I991V	ACIN1_ENST00000555053.1_Missense_Mutation_p.I978V|ACIN1_ENST00000605057.1_Missense_Mutation_p.I933V|ACIN1_ENST00000457657.1_Missense_Mutation_p.I951V|ACIN1_ENST00000338631.6_Missense_Mutation_p.I264V|ACIN1_ENST00000397341.3_Missense_Mutation_p.I233V|ACIN1_ENST00000357481.2_Missense_Mutation_p.I233V|ACIN1_ENST00000557515.1_Missense_Mutation_p.I232V	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	991					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TCAATGGTAATGGAAACTCCG	0.473																																					p.I991V		Atlas-SNP	.											.	ACIN1	147	.	0			c.A2971G						.						180.0	166.0	171.0					14																	23532224		2203	4300	6503	SO:0001583	missense	22985	exon14			TGGTAATGGAAAC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2971A>G	chr14.hg19:g.23532224T>C	ENSP00000262710:p.Ile991Val	109.0	0.0		141.0	47.0	NM_014977	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	hg19	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.303292	0.40795	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T	0.18174	3.46;3.46;2.24;2.26;3.46;2.23	5.5	5.5	0.81552	.	0.000000	0.41605	D	0.000849	T	0.14313	0.0346	L	0.35341	1.055	0.46437	D	0.999041	B;B;B;B;B	0.32526	0.323;0.217;0.374;0.234;0.234	B;B;B;B;B	0.39119	0.192;0.094;0.291;0.061;0.061	T	0.13442	-1.0509	10	0.13470	T	0.59	-8.1994	9.2121	0.37324	0.0:0.0809:0.0:0.9191	.	978;991;951;264;233	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	V	232;264;233;991;951;233;978	ENSP00000345541:I264V;ENSP00000350073:I233V;ENSP00000262710:I991V;ENSP00000405677:I951V;ENSP00000380502:I233V;ENSP00000451328:I978V	ENSP00000262710:I991V	I	-	1	0	ACIN1	22602064	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.195000	0.42677	2.308000	0.77769	0.533000	0.62120	ATT	.	.		0.473	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
FSCB	84075	hgsc.bcm.edu	37	14	44974177	44974177	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr14:44974177G>T	ENST00000340446.4	-	1	2305	c.2014C>A	c.(2014-2016)Cct>Act	p.P672T	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	672	Ala-rich.			P -> PPPAEEAPSEVQP (in Ref. 1; CAB66709/ CAI45927/CAI45935). {ECO:0000305}.		sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GCTGGTGGAGGCTGAACTTCA	0.617																																					p.P672T		Atlas-SNP	.											.	FSCB	173	.	0			c.C2014A						.						16.0	19.0	18.0					14																	44974177		2194	4294	6488	SO:0001583	missense	84075	exon1			GTGGAGGCTGAAC	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2014C>A	chr14.hg19:g.44974177G>T	ENSP00000344579:p.Pro672Thr	74.0	0.0		67.0	14.0	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	hg19	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.488197	0.26686	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.13420	2.59	3.29	-6.51	0.01878	.	.	.	.	.	T	0.07999	0.0200	L	0.48642	1.525	0.09310	N	1	B	0.24823	0.112	B	0.20767	0.031	T	0.39014	-0.9634	9	0.15066	T	0.55	0.1574	3.1445	0.06467	0.5689:0.1174:0.1956:0.118	.	672	Q5H9T9	FSCB_HUMAN	T	672;565	ENSP00000344579:P672T	ENSP00000344579:P672T	P	-	1	0	FSCB	44043927	0.000000	0.05858	0.000000	0.03702	0.319000	0.28217	-1.716000	0.01878	-1.602000	0.01599	-0.450000	0.05554	CCT	.	.		0.617	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
SLC38A6	145389	hgsc.bcm.edu	37	14	61446462	61446462	+	5'Flank	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr14:61446462C>T	ENST00000267488.4	+	0	0				SLC38A6_ENST00000456840.2_5'Flank|TRMT5_ENST00000261249.6_Missense_Mutation_p.G52S|RP11-193F5.1_ENST00000553946.1_RNA|SLC38A6_ENST00000354886.2_5'Flank	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TTTCTTTGACCCAATAAGAAA	0.413																																					p.G52S		Atlas-SNP	.											.	TRMT5	44	.	0			c.G154A						.						112.0	111.0	111.0					14																	61446462		2203	4300	6503	SO:0001631	upstream_gene_variant	57570	exon2			TTTGACCCAATAA	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335		chr14.hg19:g.61446462C>T	Exception_encountered	97.0	0.0		78.0	16.0	NM_020810	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000267488.4	hg19	CCDS9751.1	.	.	.	.	.	.	.	.	.	.	C	4.349	0.064159	0.08388	.	.	ENSG00000126814	ENST00000261249;ENST00000553903;ENST00000555420	T	0.20738	2.05	4.59	-0.592	0.11671	.	1.008970	0.07936	N	0.978328	T	0.07279	0.0184	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36939	-0.9727	10	0.02654	T	1	-25.6944	6.2232	0.20693	0.1215:0.5925:0.0:0.286	.	52	Q32P41	TRM5_HUMAN	S	52;80;79	ENSP00000261249:G52S	ENSP00000261249:G52S	G	-	1	0	TRMT5	60516215	0.000000	0.05858	0.015000	0.15790	0.022000	0.10575	0.725000	0.25970	-0.004000	0.14419	-0.136000	0.14681	GGT	.	.		0.413	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276957.1		
CEP152	22995	hgsc.bcm.edu	37	15	49031451	49031451	+	Silent	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr15:49031451A>G	ENST00000380950.2	-	27	4315	c.4128T>C	c.(4126-4128)gtT>gtC	p.V1376V	CEP152_ENST00000399334.3_Silent_p.V1320V	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1376					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTGATTTTTTAACTGCAATCA	0.338																																					p.V1376V		Atlas-SNP	.											.	CEP152	145	.	0			c.T4128C						.						72.0	66.0	68.0					15																	49031451		1837	4076	5913	SO:0001819	synonymous_variant	22995	exon27			TTTTTTAACTGCA	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4128T>C	chr15.hg19:g.49031451A>G		67.0	0.0		71.0	29.0	NM_001194998	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	hg19	CCDS58361.1																																																																																			.	.		0.338	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
MESP2	145873	hgsc.bcm.edu	37	15	90320448	90320448	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr15:90320448C>T	ENST00000341735.3	+	1	860	c.860C>T	c.(859-861)cCc>cTc	p.P287L	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	287					mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			TCCCCAGAGCCCCGGAACCCA	0.647																																					p.P287L		Atlas-SNP	.											.	MESP2	20	.	0			c.C860T						.						13.0	15.0	14.0					15																	90320448		1881	4094	5975	SO:0001583	missense	145873	exon1			CAGAGCCCCGGAA		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.860C>T	chr15.hg19:g.90320448C>T	ENSP00000342392:p.Pro287Leu	97.0	0.0		95.0	4.0	NM_001039958	Q7RTU2	Missense_Mutation	SNP	ENST00000341735.3	hg19	CCDS42078.1	.	.	.	.	.	.	.	.	.	.	C	9.598	1.127958	0.20959	.	.	ENSG00000188095	ENST00000341735	D	0.88896	-2.44	4.35	3.43	0.39272	.	.	.	.	.	D	0.90031	0.6887	L	0.53249	1.67	0.09310	N	0.999998	D	0.59357	0.985	P	0.55055	0.767	T	0.81516	-0.0897	9	0.87932	D	0	-10.4457	9.4535	0.38741	0.2117:0.7883:0.0:0.0	.	287	Q0VG99	MESP2_HUMAN	L	287	ENSP00000342392:P287L	ENSP00000342392:P287L	P	+	2	0	MESP2	88121452	0.001000	0.12720	0.014000	0.15608	0.200000	0.23975	0.666000	0.25097	1.036000	0.39998	0.462000	0.41574	CCC	.	.		0.647	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
MEF2A	4205	hgsc.bcm.edu	37	15	100185917	100185917	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr15:100185917A>G	ENST00000557785.1	+	4	555	c.206A>G	c.(205-207)tAt>tGt	p.Y69C	MEF2A_ENST00000558856.1_Intron|MEF2A_ENST00000557942.1_Missense_Mutation_p.Y69C|MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000354410.5_Missense_Mutation_p.Y69C|MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000338042.6_Missense_Mutation_p.Y69C|MEF2A_ENST00000453228.2_Missense_Mutation_p.Y69C	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	69					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			CTTCTCAAGTATACAGAATAT	0.348																																					p.Y69C		Atlas-SNP	.											.	MEF2A	138	.	0			c.A206G						.						84.0	78.0	80.0					15																	100185917		1885	4112	5997	SO:0001583	missense	4205	exon3			TCAAGTATACAGA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.206A>G	chr15.hg19:g.100185917A>G	ENSP00000453441:p.Tyr69Cys	186.0	0.0		200.0	83.0	NM_001130926	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	hg19	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.422650	0.83559	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042	D;D;D	0.85861	-2.04;-2.04;-2.04	5.19	5.19	0.71726	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	D	0.91788	0.7402	M	0.75264	2.295	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.995;0.986;0.998;0.999	D	0.92844	0.6291	10	0.87932	D	0	-12.6218	15.0324	0.71717	1.0:0.0:0.0:0.0	.	69;69;69;69	Q02078;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.	C	69	ENSP00000404110:Y69C;ENSP00000346389:Y69C;ENSP00000337202:Y69C	ENSP00000337202:Y69C	Y	+	2	0	MEF2A	98003440	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.339000	0.96797	1.951000	0.56629	0.482000	0.46254	TAT	.	.		0.348	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
WDR90	197335	hgsc.bcm.edu	37	16	712038	712038	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr16:712038G>T	ENST00000293879.4	+	32	4012	c.4012G>T	c.(4012-4014)Gag>Tag	p.E1338*	WDR90_ENST00000549091.1_Nonsense_Mutation_p.E1338*			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1338										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CTTGTCCTGGGAGGCGGATGA	0.652																																					p.E1338X		Atlas-SNP	.											.	WDR90	107	.	0			c.G4012T						.						37.0	43.0	41.0					16																	712038		2086	4200	6286	SO:0001587	stop_gained	197335	exon32			TCCTGGGAGGCGG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4012G>T	chr16.hg19:g.712038G>T	ENSP00000293879:p.Glu1338*	34.0	0.0		39.0	15.0	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Nonsense_Mutation	SNP	ENST00000293879.4	hg19	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	G	42	9.483677	0.99184	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	.	.	.	5.18	4.16	0.48862	.	0.070578	0.53938	U	0.000044	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	14.2624	0.66094	0.0:0.1496:0.8504:0.0	.	.	.	.	X	1338	.	ENSP00000293879:E1338X	E	+	1	0	WDR90	652039	1.000000	0.71417	0.994000	0.49952	0.324000	0.28378	5.027000	0.64109	2.413000	0.81919	0.561000	0.74099	GAG	.	.		0.652	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
PDXDC1	23042	hgsc.bcm.edu	37	16	15125629	15125629	+	Silent	SNP	A	A	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr16:15125629A>T	ENST00000396410.4	+	17	1534	c.1437A>T	c.(1435-1437)gtA>gtT	p.V479V	PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000450288.2_Silent_p.V451V|PDXDC1_ENST00000447912.2_Silent_p.V388V|PDXDC1_ENST00000569715.1_Silent_p.V452V|PDXDC1_ENST00000563679.1_Silent_p.V497V|PDXDC1_ENST00000325823.7_Silent_p.V464V	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	479					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATCAGCTCGTAGCCTGCATAG	0.502																																					p.V479V		Atlas-SNP	.											.	PDXDC1	59	.	0			c.A1437T						.						116.0	102.0	107.0					16																	15125629		2197	4300	6497	SO:0001819	synonymous_variant	23042	exon17			GCTCGTAGCCTGC	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1437A>T	chr16.hg19:g.15125629A>T		97.0	0.0		116.0	12.0	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	hg19	CCDS32393.1																																																																																			.	.		0.502	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
ERN2	10595	hgsc.bcm.edu	37	16	23713784	23713784	+	Silent	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr16:23713784T>C	ENST00000457008.2	-	10	1046	c.1008A>G	c.(1006-1008)cgA>cgG	p.R336R	ERN2_ENST00000256797.4_Silent_p.R384R					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		GTGAGCCCTCTCGCTCTCCTG	0.597																																					p.R384R		Atlas-SNP	.											.	ERN2	131	.	0			c.A1152G						.						112.0	117.0	116.0					16																	23713784		2197	4300	6497	SO:0001819	synonymous_variant	10595	exon10			GCCCTCTCGCTCT	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1008A>G	chr16.hg19:g.23713784T>C		40.0	0.0		40.0	6.0	NM_033266		Silent	SNP	ENST00000457008.2	hg19																																																																																				.	.		0.597	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
PMFBP1	83449	hgsc.bcm.edu	37	16	72170637	72170637	+	Missense_Mutation	SNP	C	C	T	rs144745394		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr16:72170637C>T	ENST00000237353.10	-	8	1261	c.1000G>A	c.(1000-1002)Gtg>Atg	p.V334M	PMFBP1_ENST00000355636.6_Missense_Mutation_p.V189M|PMFBP1_ENST00000537465.1_Missense_Mutation_p.V334M	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	334						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TCTAGTTCCACGCGCAGATCC	0.552																																					p.V334M		Atlas-SNP	.											.	PMFBP1	101	.	0			c.G1000A						.	T	MET/VAL,MET/VAL	1,4395	825.2+/-416.5	0,1,2197	100.0	82.0	88.0		565,1000	1.2	0.9	16	dbSNP_134	88	0,8600		0,0,4300	no	missense,missense	PMFBP1	NM_001160213.1,NM_031293.2	21,21	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	189/883,334/1008	72170637	1,12995	2198	4300	6498	SO:0001583	missense	83449	exon8			GTTCCACGCGCAG	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1000G>A	chr16.hg19:g.72170637C>T	ENSP00000237353:p.Val334Met	90.0	0.0		88.0	25.0	NM_031293	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	hg19	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	T	4.876	0.162874	0.09287	2.27E-4	0.0	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.11712	2.75;2.75;2.75	4.85	1.22	0.21188	.	0.527792	0.15935	N	0.237496	T	0.03178	0.0093	N	0.02247	-0.625	0.09310	N	1	B;B;B	0.16396	0.017;0.005;0.017	B;B;B	0.09377	0.004;0.002;0.004	T	0.39522	-0.9610	10	0.44086	T	0.13	-1.2124	0.4596	0.00514	0.2727:0.1617:0.1408:0.4247	.	334;334;334	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	M	334;334;189	ENSP00000443817:V334M;ENSP00000237353:V334M;ENSP00000347854:V189M	ENSP00000237353:V334M	V	-	1	0	PMFBP1	70728138	0.978000	0.34361	0.918000	0.36340	0.619000	0.37552	0.116000	0.15561	-0.395000	0.07715	-1.326000	0.01283	GTG	.	C|1.000;T|0.000		0.552	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
TP53	7157	hgsc.bcm.edu	37	17	7579369	7579369	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:7579369G>C	ENST00000269305.4	-	4	507	c.318C>G	c.(316-318)agC>agG	p.S106R	TP53_ENST00000420246.2_Missense_Mutation_p.S106R|TP53_ENST00000455263.2_Missense_Mutation_p.S106R|TP53_ENST00000359597.4_Missense_Mutation_p.S106R|TP53_ENST00000445888.2_Missense_Mutation_p.S106R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.S106R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	106	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		S -> G (in a sporadic cancer; somatic mutation).|S -> R (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.S106R(3)|p.V73fs*9(1)|p.S106_Y107delSY(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAAACCGTAGCTGCCCTGGT	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S106R	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000413465,colon,carcinoma,-2,6	TP53	33396	.	27	Deletion - Frameshift(12)|Whole gene deletion(8)|Substitution - Missense(3)|Complex - deletion inframe(2)|Deletion - In frame(2)	upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|ovary(3)|breast(3)|central_nervous_system(2)|lung(2)|liver(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	c.C318G	GRCh37	CM013441	TP53	M		.						58.0	57.0	57.0					17																	7579369		2203	4300	6503	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACCGTAGCTGCCC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.318C>G	chr17.hg19:g.7579369G>C	ENSP00000269305:p.Ser106Arg	221.0	0.0		109.0	79.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	9.949	1.219579	0.22373	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.75	2.77	0.32553	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	1.175280	0.05775	N	0.607434	D	0.99133	0.9701	L	0.38175	1.15	0.28839	N	0.896688	B;P;B;B;B;B;B	0.34615	0.305;0.459;0.042;0.005;0.086;0.029;0.313	B;B;B;B;B;B;B	0.43103	0.107;0.408;0.117;0.007;0.186;0.186;0.061	D	0.99992	1.4503	10	0.40728	T	0.16	-0.4975	9.0942	0.36629	0.1857:0.0:0.8143:0.0	.	67;106;106;106;106;106;106	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	106	ENSP00000410739:S106R;ENSP00000352610:S106R;ENSP00000269305:S106R;ENSP00000398846:S106R;ENSP00000391127:S106R;ENSP00000391478:S106R;ENSP00000424104:S106R;ENSP00000426252:S106R	ENSP00000269305:S106R	S	-	3	2	TP53	7520094	0.247000	0.23920	0.636000	0.29352	0.532000	0.34746	0.437000	0.21543	1.364000	0.46038	0.655000	0.94253	AGC	.	.		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NF1	4763	hgsc.bcm.edu	37	17	29654655	29654655	+	Missense_Mutation	SNP	A	A	G	rs559910904	byFrequency	TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:29654655A>G	ENST00000358273.4	+	38	5790	c.5407A>G	c.(5407-5409)Att>Gtt	p.I1803V	NF1_ENST00000356175.3_Missense_Mutation_p.I1782V|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1803	Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CACCTTAACCATTGCAAACCA	0.463			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			A|||	2	0.000399361	0.0	0.0	5008	,	,		17323	0.0		0.0	False		,,,				2504	0.002				p.I1803V		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.A5407G						.						137.0	129.0	132.0					17																	29654655		2203	4300	6503	SO:0001583	missense	4763	exon38	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TTAACCATTGCAA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5407A>G	chr17.hg19:g.29654655A>G	ENSP00000351015:p.Ile1803Val	164.0	0.0		104.0	55.0	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	A	15.76	2.930032	0.52759	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.85258	-1.96;-1.96;-1.96	5.99	5.99	0.97316	Armadillo-type fold (1);	0.053328	0.85682	D	0.000000	D	0.83069	0.5174	L	0.54323	1.7	0.80722	D	1	B;B;B	0.12013	0.001;0.005;0.003	B;B;B	0.20184	0.004;0.028;0.023	T	0.78262	-0.2272	10	0.38643	T	0.18	.	15.7142	0.77655	1.0:0.0:0.0:0.0	.	832;1782;1803	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	V	1803;1782;1448	ENSP00000351015:I1803V;ENSP00000348498:I1782V;ENSP00000389907:I1448V	ENSP00000348498:I1782V	I	+	1	0	NF1	26678781	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.923000	0.92808	2.295000	0.77249	0.524000	0.50904	ATT	.	.		0.463	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
KRT40	125115	hgsc.bcm.edu	37	17	39140078	39140078	+	Splice_Site	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:39140078C>T	ENST00000398486.2	-	3	608		c.e3+1		KRT40_ENST00000377755.4_Splice_Site	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40							intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				AGGACACAGACCTTTTGTTGG	0.458																																					.		Atlas-SNP	.											.	KRT40	27	.	0			c.447+1G>A						.						154.0	145.0	148.0					17																	39140078		2082	4228	6310	SO:0001630	splice_region_variant	125115	exon4			CACAGACCTTTTG	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.447+1G>A	chr17.hg19:g.39140078C>T		69.0	0.0		74.0	5.0	NM_182497	Q6IFU5	Splice_Site	SNP	ENST00000398486.2	hg19	CCDS42320.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928726	0.34002	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4557	0.75311	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT40	36393604	1.000000	0.71417	0.998000	0.56505	0.226000	0.24999	7.242000	0.78210	2.634000	0.89283	0.591000	0.81541	.	.	.		0.458	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	Intron
ATXN7L3	56970	hgsc.bcm.edu	37	17	42275081	42275081	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:42275081T>C	ENST00000454077.2	-	2	68	c.69A>G	c.(67-69)atA>atG	p.I23M	ATXN7L3_ENST00000389384.4_Missense_Mutation_p.I23M|ATXN7L3_ENST00000593073.1_Intron|CTB-175E5.7_ENST00000586560.1_RNA	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGTCCGCGTATATCTCCTGAG	0.562																																					p.I23M		Atlas-SNP	.											.	ATXN7L3	31	.	0			c.A69G						.						103.0	102.0	103.0					17																	42275081		1993	4161	6154	SO:0001583	missense	56970	exon2			CGCGTATATCTCC	AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.69A>G	chr17.hg19:g.42275081T>C	ENSP00000397259:p.Ile23Met	76.0	0.0		155.0	58.0	NM_020218		Missense_Mutation	SNP	ENST00000454077.2	hg19	CCDS45697.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481561	0.26598	.	.	ENSG00000087152	ENST00000454077;ENST00000389384	.	.	.	4.47	-3.01	0.05463	.	0.071871	0.56097	U	0.000033	T	0.48409	0.1498	L	0.53249	1.67	0.32499	N	0.539157	P;D	0.57571	0.93;0.98	P;P	0.58331	0.564;0.837	T	0.56232	-0.8013	9	0.72032	D	0.01	.	5.1777	0.15143	0.5195:0.0:0.2576:0.2228	.	23;23	Q14CW9;Q14CW9-2	AT7L3_HUMAN;.	M	23	.	ENSP00000374035:I23M	I	-	3	3	ATXN7L3	39630607	0.935000	0.31712	0.500000	0.27589	0.031000	0.12232	-0.044000	0.12023	-0.221000	0.09973	-0.333000	0.08304	ATA	.	.		0.562	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457724.1		
NPEPPS	9520	hgsc.bcm.edu	37	17	45682765	45682765	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:45682765A>C	ENST00000322157.4	+	17	2179	c.1942A>C	c.(1942-1944)Aat>Cat	p.N648H	NPEPPS_ENST00000544660.1_Missense_Mutation_p.N568H|RP11-580I16.2_ENST00000582066.1_RNA|NPEPPS_ENST00000530173.1_Missense_Mutation_p.N644H|RP11-580I16.2_ENST00000582389.1_RNA	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	648					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GAATGAGCCCAATTATACTGT	0.433																																					p.N648H		Atlas-SNP	.											.	NPEPPS	59	.	0			c.A1942C						.						85.0	77.0	79.0					17																	45682765		1851	4094	5945	SO:0001583	missense	9520	exon17			GAGCCCAATTATA	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1942A>C	chr17.hg19:g.45682765A>C	ENSP00000320324:p.Asn648His	140.0	0.0		130.0	59.0	NM_006310	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	hg19	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.836761	0.91117	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000544660	T;T;T	0.05382	3.45;3.45;3.45	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.23330	0.0564	M	0.62266	1.93	0.80722	D	1	D;P;P	0.89917	1.0;0.799;0.949	D;P;P	0.74674	0.984;0.665;0.665	T	0.00071	-1.2132	10	0.51188	T	0.08	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	644;331;648	E9PLK3;B7Z1H4;P55786	.;.;PSA_HUMAN	H	644;648;568	ENSP00000433287:N644H;ENSP00000320324:N648H;ENSP00000442461:N568H	ENSP00000320324:N648H	N	+	1	0	NPEPPS	43037764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.367000	0.80283	0.528000	0.53228	AAT	.	.		0.433	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
FAM117A	81558	hgsc.bcm.edu	37	17	47797246	47797246	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:47797246G>C	ENST00000240364.2	-	5	663	c.584C>G	c.(583-585)cCc>cGc	p.P195R	FAM117A_ENST00000513602.1_5'UTR|RP11-613C6.2_ENST00000512720.1_RNA|FAM117A_ENST00000514018.1_5'UTR	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	195										haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						GGGGAAGCTGGGAGGGGACGC	0.572																																					p.P195R		Atlas-SNP	.											.	FAM117A	45	.	0			c.C584G						.						39.0	42.0	41.0					17																	47797246		2203	4300	6503	SO:0001583	missense	81558	exon5			AAGCTGGGAGGGG	BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.584C>G	chr17.hg19:g.47797246G>C	ENSP00000240364:p.Pro195Arg	17.0	0.0		20.0	12.0	NM_030802	B7Z7Q3	Missense_Mutation	SNP	ENST00000240364.2	hg19	CCDS11553.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.794226	0.70452	.	.	ENSG00000121104	ENST00000240364;ENST00000511743;ENST00000506156	.	.	.	5.27	5.27	0.74061	.	0.171334	0.40144	N	0.001165	T	0.66479	0.2793	L	0.43152	1.355	0.80722	D	1	D	0.71674	0.998	D	0.69142	0.962	T	0.57780	-0.7752	9	0.15066	T	0.55	-10.6021	16.8994	0.86109	0.0:0.0:1.0:0.0	.	195	Q9C073	F117A_HUMAN	R	195;85;163	.	ENSP00000240364:P195R	P	-	2	0	FAM117A	45152245	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.957000	0.56730	2.764000	0.94973	0.556000	0.70494	CCC	.	.		0.572	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365736.1	NM_030802	
ABCC3	8714	hgsc.bcm.edu	37	17	48746768	48746768	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:48746768A>G	ENST00000285238.8	+	17	2200	c.2120A>G	c.(2119-2121)gAa>gGa	p.E707G		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	707	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	ACTCTTCAGGAAAACGTGCTT	0.602																																					p.E707G		Atlas-SNP	.											.	ABCC3	138	.	0			c.A2120G						.						93.0	87.0	89.0					17																	48746768		2203	4300	6503	SO:0001583	missense	8714	exon17			TTCAGGAAAACGT	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.2120A>G	chr17.hg19:g.48746768A>G	ENSP00000285238:p.Glu707Gly	99.0	0.0		107.0	6.0	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	hg19	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825576	0.71143	.	.	ENSG00000108846	ENST00000285238	D	0.95272	-3.66	4.36	4.36	0.52297	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.121261	0.52532	D	0.000064	D	0.95478	0.8531	M	0.89214	3.015	0.53688	D	0.999979	P	0.47409	0.895	P	0.45343	0.477	D	0.96228	0.9166	10	0.87932	D	0	-14.8594	14.0203	0.64550	1.0:0.0:0.0:0.0	.	707	O15438	MRP3_HUMAN	G	707	ENSP00000285238:E707G	ENSP00000285238:E707G	E	+	2	0	ABCC3	46101767	1.000000	0.71417	0.997000	0.53966	0.588000	0.36517	9.139000	0.94554	1.972000	0.57404	0.260000	0.18958	GAA	.	.		0.602	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
DNAI2	64446	hgsc.bcm.edu	37	17	72285824	72285824	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr17:72285824T>A	ENST00000311014.6	+	5	626	c.559T>A	c.(559-561)Ttt>Att	p.F187I	DNAI2_ENST00000446837.2_Missense_Mutation_p.F187I|DNAI2_ENST00000307504.5_Missense_Mutation_p.F44I|DNAI2_ENST00000579490.1_Missense_Mutation_p.F244I|DNAI2_ENST00000582036.1_Missense_Mutation_p.F187I			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	187					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CTGCTTGGATTTTCAGCGGGC	0.627									Kartagener syndrome																												p.F187I		Atlas-SNP	.											.	DNAI2	102	.	0			c.T559A						.						69.0	67.0	68.0					17																	72285824		2203	4300	6503	SO:0001583	missense	64446	exon5	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TTGGATTTTCAGC	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.559T>A	chr17.hg19:g.72285824T>A	ENSP00000308312:p.Phe187Ile	96.0	0.0		104.0	43.0	NM_001172810	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	hg19	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567727	0.86439	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.19250	2.16;2.16;2.16	5.01	3.93	0.45458	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.49081	0.1536	M	0.87900	2.915	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.53070	-0.8490	10	0.87932	D	0	-15.0622	10.4697	0.44629	0.0:0.0771:0.0:0.9229	.	187	Q9GZS0	DNAI2_HUMAN	I	187;44;187	ENSP00000308312:F187I;ENSP00000302929:F44I;ENSP00000400252:F187I	ENSP00000302929:F44I	F	+	1	0	DNAI2	69797419	1.000000	0.71417	0.603000	0.28903	0.955000	0.61496	7.275000	0.78548	0.769000	0.33313	0.260000	0.18958	TTT	.	.		0.627	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036	
RNF126	55658	hgsc.bcm.edu	37	19	651657	651657	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:651657T>A	ENST00000292363.5	-	4	552	c.397A>T	c.(397-399)Acg>Tcg	p.T133S		NM_194460.2	NP_919442.1			ring finger protein 126											lung(1)	1		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCGCGTGGTGAGGCGG	0.771																																					p.T133S		Atlas-SNP	.											.	RNF126	15	.	0			c.A397T						.						4.0	5.0	5.0					19																	651657		1648	3353	5001	SO:0001583	missense	55658	exon4			GCCGCGTGGTGAG	BC025374	CCDS12039.1	19p13.3	2013-01-09				ENSG00000070423		"""RING-type (C3HC4) zinc fingers"""	21151	protein-coding gene	gene with protein product		615177					Standard	NM_194460		Approved	FLJ20552	uc010drs.3	Q9BV68		ENST00000292363.5:c.397A>T	chr19.hg19:g.651657T>A	ENSP00000292363:p.Thr133Ser	72.0	0.0		72.0	32.0	NM_194460		Missense_Mutation	SNP	ENST00000292363.5	hg19	CCDS12039.1	.	.	.	.	.	.	.	.	.	.	t	2.200	-0.383196	0.04966	.	.	ENSG00000070423	ENST00000292363;ENST00000340092	T	0.13657	2.57	4.42	2.23	0.28157	.	0.419028	0.24377	N	0.039060	T	0.06462	0.0166	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42292	-0.9460	10	0.08837	T	0.75	.	5.6165	0.17434	0.0:0.6451:0.1626:0.1923	.	133	Q9BV68-2	.	S	133	ENSP00000292363:T133S	ENSP00000292363:T133S	T	-	1	0	RNF126	602657	0.054000	0.20591	0.009000	0.14445	0.982000	0.71751	0.336000	0.19823	0.376000	0.24707	-0.464000	0.05259	ACG	.	.		0.771	RNF126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452104.2	NM_017876	
MUC16	94025	hgsc.bcm.edu	37	19	9057497	9057497	+	Silent	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:9057497G>A	ENST00000397910.4	-	3	30152	c.29949C>T	c.(29947-29949)acC>acT	p.T9983T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9985	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTTGAGTGGGTCCTTGCCA	0.458																																					p.T9983T		Atlas-SNP	.											.	MUC16	4315	.	0			c.C29949T						.						182.0	178.0	179.0					19																	9057497		1948	4143	6091	SO:0001819	synonymous_variant	94025	exon3			TGAGTGGGTCCTT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29949C>T	chr19.hg19:g.9057497G>A		122.0	0.0		170.0	68.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF799	90576	hgsc.bcm.edu	37	19	12502155	12502155	+	Missense_Mutation	SNP	T	T	G	rs201335235		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:12502155T>G	ENST00000430385.3	-	4	1257	c.1057A>C	c.(1057-1059)Aaa>Caa	p.K353Q	ZNF799_ENST00000419318.1_Missense_Mutation_p.K321Q|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TCATGACTTTTCAGTGAACTA	0.413																																					p.K353Q		Atlas-SNP	.											.	ZNF799	111	.	0			c.A1057C						.						160.0	156.0	157.0					19																	12502155		2203	4300	6503	SO:0001583	missense	90576	exon4			GACTTTTCAGTGA	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1057A>C	chr19.hg19:g.12502155T>G	ENSP00000411084:p.Lys353Gln	60.0	0.0		82.0	8.0	NM_001080821		Missense_Mutation	SNP	ENST00000430385.3	hg19	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.323810	0.01309	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.04406	3.63;3.63	1.31	-1.61	0.08399	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.12527	0.23	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49041	-0.8980	9	0.14252	T	0.57	.	6.8386	0.23951	0.0:0.0:0.2963:0.7037	.	353	Q96GE5	ZN799_HUMAN	Q	321;353	ENSP00000415278:K321Q;ENSP00000411084:K353Q	ENSP00000415278:K321Q	K	-	1	0	ZNF799	12363155	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.687000	0.05156	-0.936000	0.03723	-1.919000	0.00516	AAA	.	.		0.413	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
PRKACA	5566	hgsc.bcm.edu	37	19	14208652	14208652	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:14208652T>C	ENST00000308677.4	-	6	666	c.470A>G	c.(469-471)tAt>tGt	p.Y157C	PRKACA_ENST00000589994.1_Missense_Mutation_p.Y149C|PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000350356.3_5'UTR	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						CGAGTGCAGATACTCAAAGGT	0.587																																					p.Y157C		Atlas-SNP	.											.	PRKACA	65	.	0			c.A470G						.						87.0	85.0	85.0					19																	14208652		2203	4300	6503	SO:0001583	missense	5566	exon6			TGCAGATACTCAA		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.470A>G	chr19.hg19:g.14208652T>C	ENSP00000309591:p.Tyr157Cys	128.0	0.0		173.0	46.0	NM_002730	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	ENST00000308677.4	hg19	CCDS12304.1	.	.	.	.	.	.	.	.	.	.	T	19.67	3.871272	0.72065	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.75260	-0.92	4.76	4.76	0.60689	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39985	N	0.001215	D	0.86016	0.5832	M	0.84219	2.685	0.49213	D	0.999769	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.87946	0.2720	10	0.87932	D	0	.	12.2331	0.54499	0.0:0.0:0.0:1.0	.	99;140;157;149	B7Z708;Q15136;P17612;P17612-2	.;.;KAPCA_HUMAN;.	C	157;149;157;99	ENSP00000309591:Y157C	ENSP00000309591:Y157C	Y	-	2	0	PRKACA	14069652	1.000000	0.71417	0.965000	0.40720	0.850000	0.48378	7.867000	0.87062	1.780000	0.52325	0.472000	0.43445	TAT	.	.		0.587	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459004.1	NM_002730	
MAP1S	55201	hgsc.bcm.edu	37	19	17837405	17837405	+	Silent	SNP	C	C	T	rs374141963		TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:17837405C>T	ENST00000324096.4	+	5	1363	c.1212C>T	c.(1210-1212)ggC>ggT	p.G404G	MAP1S_ENST00000544059.2_Silent_p.G378G|MAP1S_ENST00000597681.1_Intron|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	404	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CCTCCGCCGGCGCCGAGCGCA	0.731													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12383	0.0		0.0	False		,,,				2504	0.0				p.G404G		Atlas-SNP	.											.	MAP1S	74	.	0			c.C1212T						.	C		2,4144		0,2,2071	6.0	6.0	6.0		1212	-2.9	0.0	19		6	0,8122		0,0,4061	no	coding-synonymous	MAP1S	NM_018174.4		0,2,6132	TT,TC,CC		0.0,0.0482,0.0163		404/1060	17837405	2,12266	2073	4061	6134	SO:0001819	synonymous_variant	55201	exon5			CGCCGGCGCCGAG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1212C>T	chr19.hg19:g.17837405C>T		75.0	0.0		70.0	16.0	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	hg19	CCDS32954.1																																																																																			.	.		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ZNF99	7652	hgsc.bcm.edu	37	19	22952081	22952081	+	Nonsense_Mutation	SNP	C	C	A	rs149345966	byFrequency	TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:22952081C>A	ENST00000596209.1	-	2	139	c.49G>T	c.(49-51)Gag>Tag	p.E17*	ZNF99_ENST00000397104.3_Nonsense_Mutation_p.E38*	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CATTGCCACTCCTCCAGAGCG	0.403																																					p.E17X		Atlas-SNP	.											.	ZNF99	273	.	0			c.G49T						.						79.0	85.0	83.0					19																	22952081		2198	4300	6498	SO:0001587	stop_gained	7652	exon2			GCCACTCCTCCAG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.49G>T	chr19.hg19:g.22952081C>A	ENSP00000472969:p.Glu17*	219.0	0.0		261.0	96.0	NM_001080409	M0R335	Nonsense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	c	14.42	2.529080	0.44969	.	.	ENSG00000213973	ENST00000397104	.	.	.	1.05	1.05	0.20165	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.3627	0.16098	0.0:1.0:0.0:0.0	.	.	.	.	X	38	.	ENSP00000380293:E38X	E	-	1	0	ZNF99	22743921	0.948000	0.32251	0.094000	0.20943	0.091000	0.18340	2.310000	0.43708	0.482000	0.27582	0.485000	0.47835	GAG	.	C|0.995;T|0.005		0.403	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
LRFN1	57622	hgsc.bcm.edu	37	19	39805143	39805143	+	Silent	SNP	G	G	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:39805143G>A	ENST00000248668.4	-	1	833	c.834C>T	c.(832-834)ccC>ccT	p.P278P	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	278	LRRCT.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			TGAGGTGTTCGGGCGTGGCGC	0.692																																					p.P278P		Atlas-SNP	.											.	LRFN1	59	.	0			c.C834T						.						25.0	32.0	30.0					19																	39805143		2186	4285	6471	SO:0001819	synonymous_variant	57622	exon1			GTGTTCGGGCGTG	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.834C>T	chr19.hg19:g.39805143G>A		82.0	0.0		87.0	43.0	NM_020862	Q8TBS9	Silent	SNP	ENST00000248668.4	hg19	CCDS46071.1																																																																																			.	.		0.692	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862	
MYBPC2	4606	hgsc.bcm.edu	37	19	50958529	50958529	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:50958529A>G	ENST00000357701.5	+	19	2230	c.2179A>G	c.(2179-2181)Aac>Gac	p.N727D		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	727	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GCCCAGCATGAACACCAAGCC	0.507																																					p.N727D		Atlas-SNP	.											.	MYBPC2	103	.	0			c.A2179G						.						163.0	162.0	162.0					19																	50958529		2041	4190	6231	SO:0001583	missense	4606	exon19			AGCATGAACACCA		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2179A>G	chr19.hg19:g.50958529A>G	ENSP00000350332:p.Asn727Asp	97.0	0.0		101.0	33.0	NM_004533	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	hg19	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	a	13.30	2.196586	0.38806	.	.	ENSG00000086967	ENST00000357701	T	0.53640	0.61	4.27	3.25	0.37280	Fibronectin, type III (2);Immunoglobulin-like fold (1);	2.187960	0.03455	U	0.211213	T	0.51058	0.1652	M	0.69823	2.125	0.30689	N	0.751504	B	0.23540	0.087	B	0.25759	0.063	T	0.39683	-0.9602	10	0.36615	T	0.2	.	8.2545	0.31746	0.8224:0.0:0.0:0.1776	.	727	Q14324	MYPC2_HUMAN	D	727	ENSP00000350332:N727D	ENSP00000350332:N727D	N	+	1	0	MYBPC2	55650341	0.028000	0.19301	0.992000	0.48379	0.915000	0.54546	0.732000	0.26072	0.624000	0.30286	-0.557000	0.04193	AAC	.	.		0.507	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
SSC5D	284297	hgsc.bcm.edu	37	19	56028598	56028598	+	Silent	SNP	G	G	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr19:56028598G>T	ENST00000389623.6	+	14	2978	c.2955G>T	c.(2953-2955)ccG>ccT	p.P985P		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	985	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CAGGTTCCCCGAGGAAACCGT	0.741																																					p.P985P		Atlas-SNP	.											.	SSC5D	65	.	0			c.G2955T						.						2.0	4.0	3.0					19																	56028598		544	1363	1907	SO:0001819	synonymous_variant	284297	exon14			TTCCCCGAGGAAA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2955G>T	chr19.hg19:g.56028598G>T		52.0	0.0		51.0	18.0	NM_001144950	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	hg19	CCDS46196.1																																																																																			.	.		0.741	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
XRN2	22803	hgsc.bcm.edu	37	20	21329027	21329027	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr20:21329027A>T	ENST00000377191.3	+	19	1917	c.1822A>T	c.(1822-1824)Aat>Tat	p.N608Y	XRN2_ENST00000430571.2_Missense_Mutation_p.N532Y|XRN2_ENST00000539513.1_Missense_Mutation_p.N554Y	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	608					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TGCAAGTGGTAATTTTCTACC	0.363																																					p.N608Y		Atlas-SNP	.											.	XRN2	90	.	0			c.A1822T						.						107.0	113.0	111.0					20																	21329027		2203	4300	6503	SO:0001583	missense	22803	exon19			AGTGGTAATTTTC	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1822A>T	chr20.hg19:g.21329027A>T	ENSP00000366396:p.Asn608Tyr	83.0	0.0		93.0	26.0	NM_012255	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	hg19	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.546687	0.86022	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.74842	-0.88;-0.88;-0.88	5.7	5.7	0.88788	.	0.040148	0.85682	D	0.000000	T	0.78162	0.4240	L	0.55834	1.745	0.80722	D	1	D	0.60575	0.988	P	0.51615	0.675	T	0.79303	-0.1859	10	0.49607	T	0.09	-12.3154	15.9504	0.79830	1.0:0.0:0.0:0.0	.	608	Q9H0D6	XRN2_HUMAN	Y	608;532;554	ENSP00000366396:N608Y;ENSP00000413548:N532Y;ENSP00000441113:N554Y	ENSP00000366396:N608Y	N	+	1	0	XRN2	21277027	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.735000	0.91549	2.163000	0.67991	0.482000	0.46254	AAT	.	.		0.363	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
MPPED1	758	hgsc.bcm.edu	37	22	43898542	43898542	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr22:43898542C>T	ENST00000417669.2	+	6	1211	c.767C>T	c.(766-768)cCc>cTc	p.P256L	MPPED1_ENST00000538182.1_Missense_Mutation_p.P289L|MPPED1_ENST00000439548.1_Missense_Mutation_p.P98L|MPPED1_ENST00000542779.1_Missense_Mutation_p.P256L|MPPED1_ENST00000443721.1_Missense_Mutation_p.P256L|MPPED1_ENST00000414469.2_Missense_Mutation_p.P150L			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	256							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				GACTGGGTCCCCAAGAAGATG	0.632																																					p.P256L		Atlas-SNP	.											.	MPPED1	59	.	0			c.C767T						.						63.0	76.0	72.0					22																	43898542		2181	4292	6473	SO:0001583	missense	758	exon6			GGGTCCCCAAGAA	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.767C>T	chr22.hg19:g.43898542C>T	ENSP00000388137:p.Pro256Leu	46.0	0.0		85.0	34.0	NM_001044370	A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	ENST00000417669.2	hg19	CCDS46723.1	.	.	.	.	.	.	.	.	.	.	C	6.713	0.500199	0.12762	.	.	ENSG00000186732	ENST00000417669;ENST00000443721;ENST00000545165;ENST00000414469;ENST00000439548;ENST00000542779;ENST00000538182	T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16	4.27	4.27	0.50696	Metallophosphoesterase domain (1);	.	.	.	.	T	0.32645	0.0836	L	0.35487	1.065	0.80722	D	1	P;P	0.50443	0.935;0.817	P;B	0.46917	0.531;0.291	T	0.04855	-1.0922	9	0.10902	T	0.67	.	17.1345	0.86735	0.0:1.0:0.0:0.0	.	289;256	B7Z2S9;O15442	.;MPPD1_HUMAN	L	256;256;234;150;98;256;289	ENSP00000388137:P256L;ENSP00000400686:P256L;ENSP00000388245:P150L;ENSP00000390379:P98L;ENSP00000444532:P256L;ENSP00000438335:P289L	ENSP00000388245:P150L	P	+	2	0	MPPED1	42229871	1.000000	0.71417	1.000000	0.80357	0.055000	0.15305	7.090000	0.76916	2.126000	0.65437	0.399000	0.26434	CCC	.	.		0.632	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370	
AKAP17A	8227	hgsc.bcm.edu	37	X	1720179	1720179	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chrX:1720179G>C	ENST00000313871.3	+	5	1976	c.1780G>C	c.(1780-1782)Ggg>Cgg	p.G594R		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	594	Arg-rich.				B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						CACCGGAGACGGGCTTGCTGA	0.701																																					p.G594R		Atlas-SNP	.											.	AKAP17A	46	.	0			c.G1780C						.						25.0	33.0	31.0					X																	1720179		2201	4292	6493	SO:0001583	missense	8227	exon5			GGAGACGGGCTTG	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1780G>C	chrX.hg19:g.1720179G>C	ENSP00000324827:p.Gly594Arg	54.0	0.0		73.0	26.0	NM_005088	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	ENST00000313871.3	hg19	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	g	0.064	-1.216320	0.01542	.	.	ENSG00000197976	ENST00000313871	T	0.13089	2.62	1.41	0.269	0.15631	.	0.695830	0.10406	N	0.678588	T	0.15435	0.0372	.	.	.	0.09310	N	1	P	0.51449	0.945	P	0.54706	0.759	T	0.27331	-1.0077	9	0.16420	T	0.52	.	5.8575	0.18728	0.4609:0.0:0.5391:0.0	.	594	Q02040	AK17A_HUMAN	R	594	ENSP00000324827:G594R	ENSP00000324827:G594R	G	+	1	0	AKAP17A	1680179	0.013000	0.17824	0.008000	0.14137	0.007000	0.05969	1.090000	0.30902	0.367000	0.24454	0.367000	0.22151	GGG	.	G|1.000;A|0.000		0.701	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
SYN1	6853	hgsc.bcm.edu	37	X	47479089	47479089	+	Silent	SNP	A	A	G			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chrX:47479089A>G	ENST00000295987.7	-	1	163	c.39T>C	c.(37-39)ttT>ttC	p.F13F	SYN1_ENST00000340666.4_Silent_p.F13F	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	13	A.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						GATTGGCCATAAAGTTGCTGT	0.706																																					p.F13F		Atlas-SNP	.											.	SYN1	84	.	0			c.T39C						.						9.0	7.0	7.0					X																	47479089		2078	4063	6141	SO:0001819	synonymous_variant	6853	exon1			GGCCATAAAGTTG		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.39T>C	chrX.hg19:g.47479089A>G		649.0	0.0		722.0	85.0	NM_006950	B1AJQ1|O75825|Q5H9A9	Silent	SNP	ENST00000295987.7	hg19	CCDS14280.1																																																																																			.	.		0.706	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	
ARMCX3	51566	hgsc.bcm.edu	37	X	100880299	100880299	+	Silent	SNP	C	C	T			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chrX:100880299C>T	ENST00000341189.4	+	5	1196	c.330C>T	c.(328-330)tcC>tcT	p.S110S	ARMCX3-AS1_ENST00000454228.1_RNA|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3_ENST00000471229.2_Silent_p.S110S|ARMCX3_ENST00000537169.1_Silent_p.S110S	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	110					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						AACGGGCTTCCCCCAATTCAG	0.532																																					p.S110S		Atlas-SNP	.											.	ARMCX3	33	.	0			c.C330T						.						57.0	52.0	54.0					X																	100880299		2202	4299	6501	SO:0001819	synonymous_variant	51566	exon5			GGCTTCCCCCAAT	AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.330C>T	chrX.hg19:g.100880299C>T		83.0	0.0		82.0	42.0	NM_016607	Q53HC6|Q7LCF5|Q9NPE4	Silent	SNP	ENST00000341189.4	hg19	CCDS14489.1																																																																																			.	.		0.532	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607	
DDX3Y	8653	hgsc.bcm.edu	37	Y	15029320	15029320	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chrY:15029320G>C	ENST00000336079.3	+	16	1875	c.1769G>C	c.(1768-1770)aGa>aCa	p.R590T	DDX3Y_ENST00000360160.4_Missense_Mutation_p.R590T	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked	590						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						TACAGTAATAGATTCAGTGGA	0.428																																					p.R590T		Atlas-SNP	.											.	DDX3Y	13	.	0			c.G1769C						.						97.0	89.0	91.0					Y																	15029320		618	1977	2595	SO:0001583	missense	8653	exon16			GTAATAGATTCAG	AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.1769G>C	chrY.hg19:g.15029320G>C	ENSP00000336725:p.Arg590Thr	91.0	0.0		129.0	76.0	NM_004660	B4DK29|B4DXX7|Q8IYV7	Missense_Mutation	SNP	ENST00000336079.3	hg19	CCDS14782.1																																																																																			.	.		0.428	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088407.1	NM_004660	
RASGRF2	5924	hgsc.bcm.edu	37	5	80513281	80513281	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr5:80513281delA	ENST00000265080.4	+	25	3608	c.3541delA	c.(3541-3543)aaafs	p.K1181fs	CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000503483.2_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1181	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CAATTTCTCCAAAATGAGAAT	0.378																																					p.S1180fs		Atlas-INDEL	.											.	RASGRF2	165	.	0			c.3540delC						.						108.0	111.0	110.0					5																	80513281		2203	4300	6503	SO:0001589	frameshift_variant	5924	exon25			.	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3541delA	chr5.hg19:g.80513281delA	ENSP00000265080:p.Lys1181fs	105.0	0.0		82.0	25.0	NM_006909	B9EG89|Q9UK56	Frame_Shift_Del	DEL	ENST00000265080.4	hg19	CCDS4052.1																																																																																			.	.		0.378	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
TMEM128	85013	hgsc.bcm.edu	37	4	4248013	4248014	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr4:4248013_4248014insA	ENST00000382753.4	-	2	163_164	c.154_155insT	c.(154-156)tctfs	p.S52fs	TMEM128_ENST00000540397.1_Frame_Shift_Ins_p.S52fs|TMEM128_ENST00000254742.2_Frame_Shift_Ins_p.S28fs|TMEM128_ENST00000538516.1_Frame_Shift_Ins_p.S52fs			Q5BJH2	TM128_HUMAN	transmembrane protein 128	52						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		CCAGAATCCAGAATGGATATTA	0.342																																					p.S28fs		Atlas-INDEL	.											.	TMEM128	12	.	0			c.83_84insT						.																																			SO:0001589	frameshift_variant	85013	exon2			.	BC007729	CCDS3373.1, CCDS75099.1	4p16.3	2008-02-05			ENSG00000132406	ENSG00000132406			28201	protein-coding gene	gene with protein product							Standard	XM_005248034		Approved	MGC13159	uc003ghq.1	Q5BJH2	OTTHUMG00000125475	ENST00000382753.4:c.155dupT	chr4.hg19:g.4248015_4248015dupA	ENSP00000372201:p.Ser52fs	171.0	0.0		128.0	48.0	NM_032927	B4DHS7|D3DVS3|Q5H9U6|Q96I94	Frame_Shift_Ins	INS	ENST00000382753.4	hg19																																																																																				.	.		0.342	TMEM128-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000246798.2	NM_032927	
FANCF	2188	hgsc.bcm.edu	37	11	22647195	22647195	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADV-01A-11D-A38X-10	TCGA-DD-AADV-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4a967238-8845-4088-bf2c-df021fad1a5e	7fedcbf5-4417-4700-b02a-a4d71e5e7e33	g.chr11:22647195delA	ENST00000327470.3	-	1	192	c.162delT	c.(160-162)attfs	p.I54fs	AC103801.2_ENST00000428556.2_3'UTR	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	54					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						GAGCCGTGCGAATGGGGCCAT	0.692			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R55fs		Atlas-INDEL	.	yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	.	FANCF	24	.	0			c.163delC						.						23.0	27.0	26.0					11																	22647195		2203	4298	6501	SO:0001589	frameshift_variant	2188	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	.		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.162delT	chr11.hg19:g.22647195delA	ENSP00000330875:p.Ile54fs	161.0	0.0		150.0	40.0	NM_022725	Q52LM0	Frame_Shift_Del	DEL	ENST00000327470.3	hg19	CCDS7857.1																																																																																			.	.		0.692	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725	
