#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PADI3	51702	hgsc.bcm.edu	37	1	17586227	17586227	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:17586227C>G	ENST00000375460.3	+	2	287	c.247C>G	c.(247-249)Ccc>Gcc	p.P83A		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	83					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CATGAACTCCCCCAGCAATGA	0.597																																					p.P83A		Atlas-SNP	.											.	PADI3	81	.	0			c.C247G						.						71.0	56.0	61.0					1																	17586227		2203	4300	6503	SO:0001583	missense	51702	exon2			AACTCCCCCAGCA	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.247C>G	chr1.hg19:g.17586227C>G	ENSP00000364609:p.Pro83Ala	150.0	0.0		77.0	7.0	NM_016233	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	hg19	CCDS179.1	.	.	.	.	.	.	.	.	.	.	C	6.456	0.452311	0.12283	.	.	ENSG00000142619	ENST00000375460	T	0.09073	3.02	5.2	5.2	0.72013	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.134229	0.51477	D	0.000094	T	0.06826	0.0174	L	0.28274	0.84	0.31970	N	0.607346	P	0.43788	0.817	P	0.44673	0.457	T	0.01679	-1.1297	10	0.05436	T	0.98	-28.0261	11.4191	0.49971	0.18:0.82:0.0:0.0	.	83	Q9ULW8	PADI3_HUMAN	A	83	ENSP00000364609:P83A	ENSP00000364609:P83A	P	+	1	0	PADI3	17458814	0.991000	0.36638	0.998000	0.56505	0.990000	0.78478	3.854000	0.55949	2.421000	0.82119	0.563000	0.77884	CCC	.	.		0.597	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
COL8A2	1296	hgsc.bcm.edu	37	1	36563771	36563771	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:36563771C>T	ENST00000397799.1	-	4	1735	c.1511G>A	c.(1510-1512)gGg>gAg	p.G504E	COL8A2_ENST00000481785.1_Missense_Mutation_p.G439E|COL8A2_ENST00000303143.4_Missense_Mutation_p.G504E			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	504	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCCGTGGGCCCAGCCGTGCC	0.766																																					p.G504E		Atlas-SNP	.											.	COL8A2	41	.	0			c.G1511A						.						2.0	2.0	2.0					1																	36563771		1406	3161	4567	SO:0001583	missense	1296	exon2			GTGGGCCCAGCCG	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.1511G>A	chr1.hg19:g.36563771C>T	ENSP00000380901:p.Gly504Glu	58.0	0.0		53.0	22.0	NM_005202	Q5JV31|Q8TEJ5	Missense_Mutation	SNP	ENST00000397799.1	hg19	CCDS403.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167659	0.57476	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785	D;D;D	0.99532	-6.1;-6.1;-6.1	4.08	4.08	0.47627	.	0.000000	0.85682	D	0.000000	D	0.99725	0.9893	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97044	0.9759	10	0.87932	D	0	.	16.824	0.85926	0.0:1.0:0.0:0.0	.	504	P25067	CO8A2_HUMAN	E	504;504;439	ENSP00000305913:G504E;ENSP00000380901:G504E;ENSP00000436433:G439E	ENSP00000305913:G504E	G	-	2	0	COL8A2	36336358	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.561000	0.82288	2.279000	0.76181	0.462000	0.41574	GGG	.	.		0.766	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
NEGR1	257194	hgsc.bcm.edu	37	1	71873213	71873213	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:71873213A>T	ENST00000357731.5	-	7	1220	c.981T>A	c.(979-981)gaT>gaA	p.D327E	ZRANB2-AS2_ENST00000587066.1_RNA|ZRANB2-AS2_ENST00000585415.1_RNA|ZRANB2-AS2_ENST00000586006.1_RNA|ZRANB2-AS2_ENST00000608579.1_RNA|ZRANB2-AS2_ENST00000585499.1_RNA|ZRANB2-AS2_ENST00000590186.1_RNA|ZRANB2-AS2_ENST00000430605.1_RNA|ZRANB2-AS2_ENST00000587306.1_RNA|NEGR1_ENST00000306821.3_Missense_Mutation_p.D199E|NEGR1_ENST00000434200.1_Missense_Mutation_p.D281E	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	327					feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AGAAAAGAACATCAGCGCTCC	0.403																																					p.D327E		Atlas-SNP	.											.	NEGR1	60	.	0			c.T981A						.						85.0	84.0	84.0					1																	71873213		2203	4299	6502	SO:0001583	missense	257194	exon7			AAGAACATCAGCG	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.981T>A	chr1.hg19:g.71873213A>T	ENSP00000350364:p.Asp327Glu	564.0	0.0		470.0	42.0	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	hg19	CCDS661.1	.	.	.	.	.	.	.	.	.	.	A	3.241	-0.155261	0.06544	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.70986	0.75;0.89;-0.53	5.85	-9.14	0.00701	.	0.387563	0.26995	N	0.021454	T	0.10294	0.0252	N	0.08118	0	0.20074	N	0.999933	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47837	-0.9086	10	0.02654	T	1	-0.4235	0.8647	0.01201	0.3544:0.1566:0.1173:0.3717	.	281;327	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	E	327;199;281	ENSP00000350364:D327E;ENSP00000305938:D199E;ENSP00000413294:D281E	ENSP00000305938:D199E	D	-	3	2	NEGR1	71645801	0.008000	0.16893	0.013000	0.15412	0.986000	0.74619	-0.492000	0.06467	-1.294000	0.02360	0.533000	0.62120	GAT	.	.		0.403	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
NBPF10	100132406	hgsc.bcm.edu	37	1	145367777	145367777	+	Missense_Mutation	SNP	G	G	T	rs200743139		TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:145367777G>T	ENST00000342960.5	+	83	10408	c.10373G>T	c.(10372-10374)aGg>aTg	p.R3458M	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		gaaagaagaaggggaagaaaa	0.428																																					p.R3458M		Atlas-SNP	.											NBPF10,NS,carcinoma,0,1	NBPF10	221	.	0			c.G10373T						.																																			SO:0001583	missense	100132406	exon83			GAAGAAGGGGAAG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10373G>T	chr1.hg19:g.145367777G>T	ENSP00000345684:p.Arg3458Met	1.0	0.0		6.0	5.0	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	hg19	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	10.39	1.335798	0.24253	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.05258	3.47	.	.	.	.	.	.	.	.	T	0.03651	0.0104	L	0.51422	1.61	0.09310	N	1	.	.	.	.	.	.	T	0.38351	-0.9665	4	0.87932	D	0	.	.	.	.	.	.	.	.	M	578;3458	ENSP00000345684:R3458M	ENSP00000345684:R3458M	R	+	2	0	NBPF10	144079134	.	.	.	.	.	.	.	.	.	.	.	.	AGG	.	.		0.428	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
KPRP	448834	hgsc.bcm.edu	37	1	152733003	152733003	+	Silent	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:152733003C>T	ENST00000606109.1	+	1	967	c.939C>T	c.(937-939)ccC>ccT	p.P313P	KPRP_ENST00000368773.1_Silent_p.P313P			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	313	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCGCCGCCCCATTTCAAGCT	0.592																																					p.P313P		Atlas-SNP	.											.	KPRP	152	.	0			c.C939T						.						48.0	47.0	48.0					1																	152733003		2203	4300	6503	SO:0001819	synonymous_variant	448834	exon2			CCGCCCCATTTCA	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.939C>T	chr1.hg19:g.152733003C>T		63.0	0.0		131.0	25.0	NM_001025231		Silent	SNP	ENST00000606109.1	hg19	CCDS30862.1																																																																																			.	.		0.592	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
ATP8B2	57198	hgsc.bcm.edu	37	1	154310110	154310110	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:154310110G>T	ENST00000368487.3	+	12	1311	c.1124G>T	c.(1123-1125)aGt>aTt	p.S375I	ATP8B2_ENST00000368489.3_Intron|ATP8B2_ENST00000426445.1_Intron|ATP8B2_ENST00000341822.2_Intron|RNU7-57P_ENST00000459540.1_RNA	NM_001005855.1	NP_001005855.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	418					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCTTGAGAAGTAACGAGAAG	0.438																																					p.S375I		Atlas-SNP	.											.	ATP8B2	158	.	0			c.G1124T						.						97.0	101.0	99.0					1																	154310110		2203	4300	6503	SO:0001583	missense	57198	exon12			TGAGAAGTAACGA	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368487.3:c.1124G>T	chr1.hg19:g.154310110G>T	ENSP00000357472:p.Ser375Ile	133.0	0.0		373.0	78.0	NM_001005855	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368487.3	hg19	CCDS41405.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604660	0.46423	.	.	ENSG00000143515	ENST00000368487	T	0.04317	3.65	5.17	0.808	0.18719	.	.	.	.	.	T	0.01905	0.0060	.	.	.	0.09310	N	1	P	0.41848	0.763	B	0.41988	0.372	T	0.45026	-0.9289	8	0.56958	D	0.05	.	7.7606	0.28951	0.3748:0.0:0.6252:0.0	.	375	P98198-4	.	I	375	ENSP00000357472:S375I	ENSP00000357472:S375I	S	+	2	0	ATP8B2	152576734	0.000000	0.05858	0.003000	0.11579	0.039000	0.13416	-0.036000	0.12185	0.261000	0.21753	0.655000	0.94253	AGT	.	.		0.438	ATP8B2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087903.2	NM_020452	
CDK18	5129	hgsc.bcm.edu	37	1	205495307	205495307	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:205495307G>A	ENST00000360066.2	+	6	872	c.571G>A	c.(571-573)Gtg>Atg	p.V191M	CDK18_ENST00000506784.1_Splice_Site_p.V221M|CDK18_ENST00000429964.2_Splice_Site_p.V191M|CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						CATCCGAGAGGGTACAGCATC	0.627																																					p.V221M	Pancreas(180;489 2072 28461 40831 44265)	Atlas-SNP	.											.	CDK18	75	.	0			c.G661A						.						43.0	39.0	40.0					1																	205495307		2202	4300	6502	SO:0001630	splice_region_variant	5129	exon6			CGAGAGGGTACAG	X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.571+1G>A	chr1.hg19:g.205495307G>A		160.0	0.0		331.0	25.0	NM_212503	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Missense_Mutation	SNP	ENST00000360066.2	hg19	CCDS44300.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762777	0.89932	.	.	ENSG00000117266	ENST00000429964;ENST00000506784;ENST00000360066;ENST00000478560;ENST00000419301	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	4.63	4.63	0.57726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79118	0.4392	L	0.60957	1.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.993	T	0.81881	-0.0729	10	0.87932	D	0	-14.1556	16.0754	0.80965	0.0:0.0:1.0:0.0	.	153;189;221;191	Q59G02;Q07002;Q07002-3;Q07002-2	.;CDK18_HUMAN;.;.	M	191;221;191;102;221	ENSP00000399082:V191M;ENSP00000423665:V221M;ENSP00000353176:V191M;ENSP00000423408:V102M;ENSP00000391324:V221M	ENSP00000353176:V191M	V	+	1	0	CDK18	203761930	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.980000	0.88113	2.123000	0.65237	0.561000	0.74099	GTG	.	.		0.627	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090407.2	NM_002596	Missense_Mutation
TMEM206	55248	hgsc.bcm.edu	37	1	212558750	212558750	+	Missense_Mutation	SNP	C	C	T	rs369443875		TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr1:212558750C>T	ENST00000261455.4	-	4	498	c.361G>A	c.(361-363)Ggt>Agt	p.G121S	TMEM206_ENST00000471937.1_5'UTR|TMEM206_ENST00000535273.1_Missense_Mutation_p.G182S	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	121						cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.G121C(1)		breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TGGGCCTGACCGGGGTACAAG	0.532																																					p.G182S		Atlas-SNP	.											.	TMEM206	41	.	1	Substitution - Missense(1)	kidney(1)	c.G544A						.	C	SER/GLY,SER/GLY	0,4406		0,0,2203	89.0	83.0	85.0		544,361	5.4	0.7	1		85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TMEM206	NM_001198862.1,NM_018252.2	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	182/412,121/351	212558750	1,13005	2203	4300	6503	SO:0001583	missense	55248	exon5			CCTGACCGGGGTA	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.361G>A	chr1.hg19:g.212558750C>T	ENSP00000261455:p.Gly121Ser	126.0	0.0		199.0	17.0	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	hg19	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	C	33	5.205822	0.95033	0.0	1.16E-4	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.72637	0.3485	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75531	-0.3285	9	0.87932	D	0	-25.2915	19.2273	0.93822	0.0:1.0:0.0:0.0	.	182;121	B7Z4D6;Q9H813	.;TM206_HUMAN	S	121;182	.	ENSP00000261455:G121S	G	-	1	0	TMEM206	210625373	1.000000	0.71417	0.667000	0.29798	0.761000	0.43186	6.922000	0.75811	2.531000	0.85337	0.655000	0.94253	GGT	.	.		0.532	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
MBD5	55777	hgsc.bcm.edu	37	2	149240972	149240972	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr2:149240972C>G	ENST00000407073.1	+	10	3809	c.2812C>G	c.(2812-2814)Cta>Gta	p.L938V	MBD5_ENST00000404807.1_Missense_Mutation_p.L938V	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	938					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		AAACCAGAATCTATTAAATAT	0.458																																					p.L938V		Atlas-SNP	.											.	MBD5	164	.	0			c.C2812G						.						130.0	135.0	133.0					2																	149240972		2203	4300	6503	SO:0001583	missense	55777	exon10			CAGAATCTATTAA	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2812C>G	chr2.hg19:g.149240972C>G	ENSP00000386049:p.Leu938Val	65.0	0.0		64.0	21.0	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	hg19	CCDS33302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.52|14.52	2.559832|2.559832	0.45590|0.45590	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000416015|ENST00000407073;ENST00000404807	.|T;T	.|0.62941	.|-0.01;0.76	5.95|5.95	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.47093	.|D	.|0.000243	T|T	0.49167|0.49167	0.1541|0.1541	N|N	0.19112|0.19112	0.55|0.55	0.35829|0.35829	D|D	0.825199|0.825199	.|B	.|0.19817	.|0.039	.|B	.|0.20384	.|0.029	T|T	0.56456|0.56456	-0.7976|-0.7976	5|10	.|0.66056	.|D	.|0.02	-6.4653|-6.4653	14.1266|14.1266	0.65225|0.65225	0.2735:0.7265:0.0:0.0|0.2735:0.7265:0.0:0.0	.|.	.|938	.|Q9P267	.|MBD5_HUMAN	M|V	677|938	.|ENSP00000386049:L938V;ENSP00000384672:L938V	.|ENSP00000384672:L938V	I|L	+|+	3|1	3|2	MBD5|MBD5	148957442|148957442	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.139000|2.139000	0.42149|0.42149	1.495000|1.495000	0.48549|0.48549	0.563000|0.563000	0.77884|0.77884	ATC|CTA	.	.		0.458	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
UBE2K	3093	hgsc.bcm.edu	37	4	39780035	39780035	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr4:39780035A>G	ENST00000261427.5	+	7	868	c.584A>G	c.(583-585)gAa>gGa	p.E195G	UBE2K_ENST00000295963.6_Missense_Mutation_p.E134G|UBE2K_ENST00000503368.1_Missense_Mutation_p.E144G|UBE2K_ENST00000445950.2_Missense_Mutation_p.E152G|UBE2K_ENST00000438068.2_3'UTR	NM_001111112.1|NM_005339.4	NP_001104582.1|NP_005330.1	P61086	UBE2K_HUMAN	ubiquitin-conjugating enzyme E2K	195	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein K48-linked ubiquitination (GO:0070936)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)			large_intestine(1)|lung(1)|ovary(2)	4						ACTGCAACAGAATTGCTTCTG	0.408																																					p.E195G	NSCLC(101;689 1592 16105 29682 31745)	Atlas-SNP	.											.	UBE2K	16	.	0			c.A584G						.						138.0	131.0	133.0					4																	39780035		2203	4300	6503	SO:0001583	missense	3093	exon7			CAACAGAATTGCT	U58522	CCDS33976.1, CCDS47043.1, CCDS47044.1	4p14	2011-05-19	2011-05-19	2007-12-04	ENSG00000078140	ENSG00000078140		"""Ubiquitin-conjugating enzymes E2"""	4914	protein-coding gene	gene with protein product		602846	"""huntingtin interacting protein 2"", ""ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)"""	HIP2		8702625, 17873885	Standard	NM_005339		Approved	HYPG, UBC1	uc003guu.4	P61086	OTTHUMG00000160543	ENST00000261427.5:c.584A>G	chr4.hg19:g.39780035A>G	ENSP00000261427:p.Glu195Gly	54.0	0.0		62.0	26.0	NM_005339	A6NJC1|A8K5Y9|B2RDF8|C9JGP1|O54806|P27924|Q16721|Q9CVV9|Q9Y2D3	Missense_Mutation	SNP	ENST00000261427.5	hg19	CCDS33976.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.229955	0.79688	.	.	ENSG00000078140	ENST00000261427;ENST00000295963;ENST00000503368;ENST00000445950	T;T;T;T	0.56611	1.59;1.59;1.59;0.45	5.57	5.57	0.84162	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.68430	0.3000	L	0.56199	1.76	0.80722	D	1	D;D;P;P	0.62365	0.991;0.959;0.954;0.851	D;P;P;P	0.74023	0.982;0.75;0.837;0.775	T	0.71009	-0.4716	10	0.72032	D	0.01	-13.4433	16.0169	0.80445	1.0:0.0:0.0:0.0	.	134;195;144;152	B4DIZ2;P61086;P61086-2;C9JGP1	.;UBE2K_HUMAN;.;.	G	195;134;144;152	ENSP00000261427:E195G;ENSP00000295963:E134G;ENSP00000421203:E144G;ENSP00000390483:E152G	ENSP00000261427:E195G	E	+	2	0	UBE2K	39456430	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.283000	0.95860	2.233000	0.73108	0.482000	0.46254	GAA	.	.		0.408	UBE2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361061.1	NM_005339	
ANK2	287	hgsc.bcm.edu	37	4	114278698	114278698	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr4:114278698G>T	ENST00000357077.4	+	38	8977	c.8924G>T	c.(8923-8925)aGc>aTc	p.S2975I	ANK2_ENST00000264366.6_Missense_Mutation_p.S2942I|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2975					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTAGTGGCAAGCTCCTCTAGT	0.413																																					p.S2975I		Atlas-SNP	.											.	ANK2	576	.	0			c.G8924T						.						153.0	152.0	152.0					4																	114278698		2203	4300	6503	SO:0001583	missense	287	exon38			TGGCAAGCTCCTC	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8924G>T	chr4.hg19:g.114278698G>T	ENSP00000349588:p.Ser2975Ile	153.0	0.0		135.0	69.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506893	0.44558	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.70631	-0.5;-0.5	5.58	0.566	0.17317	.	0.637131	0.15035	N	0.284210	T	0.64349	0.2590	L	0.59436	1.845	0.09310	N	1	P;P	0.49559	0.8;0.925	B;P	0.44990	0.276;0.466	T	0.55412	-0.8145	9	.	.	.	.	6.0031	0.19531	0.2739:0.2459:0.4802:0.0	.	2942;2975	Q01484;Q01484-4	ANK2_HUMAN;.	I	2975;2942	ENSP00000349588:S2975I;ENSP00000264366:S2942I	.	S	+	2	0	ANK2	114498147	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.213000	0.17521	0.028000	0.15324	-0.910000	0.02820	AGC	.	.		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FGA	2243	hgsc.bcm.edu	37	4	155506805	155506805	+	Silent	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr4:155506805T>C	ENST00000302053.3	-	5	1854	c.1776A>G	c.(1774-1776)ggA>ggG	p.G592G	FGA_ENST00000403106.3_Silent_p.G592G	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	592					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	ATGTGGAGTCTCCTCTGTTGT	0.443																																					p.G592G	NSCLC(143;340 1922 20892 22370 48145)	Atlas-SNP	.											.	FGA	179	.	0			c.A1776G						.						135.0	130.0	131.0					4																	155506805		2203	4300	6503	SO:0001819	synonymous_variant	2243	exon5			GGAGTCTCCTCTG		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1776A>G	chr4.hg19:g.155506805T>C		92.0	0.0		42.0	28.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Silent	SNP	ENST00000302053.3	hg19	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	T	5.825	0.336432	0.11013	.	.	ENSG00000171560	ENST00000457487	.	.	.	5.31	1.64	0.23874	.	.	.	.	.	T	0.36936	0.0985	.	.	.	0.32951	D	0.51975	.	.	.	.	.	.	T	0.44205	-0.9343	4	.	.	.	.	4.0332	0.09717	0.148:0.2208:0.0:0.6311	.	.	.	.	G	234	.	.	E	-	2	0	FGA	155726255	0.987000	0.35691	0.008000	0.14137	0.013000	0.08279	0.057000	0.14279	0.510000	0.28216	0.533000	0.62120	GAG	.	.		0.443	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
LIFR	3977	hgsc.bcm.edu	37	5	38523562	38523562	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr5:38523562T>C	ENST00000263409.4	-	5	682	c.520A>G	c.(520-522)Att>Gtt	p.I174V	LIFR_ENST00000453190.2_Missense_Mutation_p.I174V|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	174					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AGAACTTTAATTTCCCAGATA	0.333			T	PLAG1	salivary adenoma																																p.I174V	Melanoma(13;4 730 6426 9861 34751)	Atlas-SNP	.		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	LIFR	348	.	0			c.A520G						.						88.0	96.0	93.0					5																	38523562		2203	4300	6503	SO:0001583	missense	3977	exon5			CTTTAATTTCCCA	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.520A>G	chr5.hg19:g.38523562T>C	ENSP00000263409:p.Ile174Val	593.0	0.0		615.0	272.0	NM_002310	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	hg19	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	T	12.85	2.060901	0.36373	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.26957	1.7;1.7	5.53	3.1	0.35709	Immunoglobulin-like fold (1);	0.333098	0.34906	N	0.003599	T	0.19644	0.0472	L	0.43152	1.355	0.36696	D	0.879867	B	0.09022	0.002	B	0.10450	0.005	T	0.09335	-1.0679	10	0.45353	T	0.12	-20.6729	6.6947	0.23193	0.0:0.1853:0.0:0.8147	.	174	P42702	LIFR_HUMAN	V	174	ENSP00000263409:I174V;ENSP00000398368:I174V	ENSP00000263409:I174V	I	-	1	0	LIFR	38559319	0.993000	0.37304	0.820000	0.32676	0.948000	0.59901	0.250000	0.18235	0.876000	0.35872	0.533000	0.62120	ATT	.	.		0.333	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
FAM196B	100131897	hgsc.bcm.edu	37	5	169309963	169309963	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr5:169309963G>T	ENST00000377365.3	-	2	2321	c.940C>A	c.(940-942)Caa>Aaa	p.Q314K	DOCK2_ENST00000540750.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000256935.8_Intron|DOCK2_ENST00000520908.1_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	314										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						TGGGAGCCTTGTGAGGGGGAA	0.512																																					p.Q314K		Atlas-SNP	.											.	FAM196B	28	.	0			c.C940A						.						98.0	90.0	92.0					5																	169309963		692	1591	2283	SO:0001583	missense	100131897	exon2			AGCCTTGTGAGGG		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.940C>A	chr5.hg19:g.169309963G>T	ENSP00000366582:p.Gln314Lys	79.0	0.0		74.0	32.0	NM_001129891		Missense_Mutation	SNP	ENST00000377365.3	hg19	CCDS47336.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.922822	0.00498	.	.	ENSG00000204767	ENST00000377365	T	0.40756	1.02	5.09	4.21	0.49690	.	0.624717	0.16920	N	0.194104	T	0.22551	0.0544	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.13407	0.009	T	0.17349	-1.0372	10	0.27785	T	0.31	-2.6374	9.7872	0.40684	0.2148:0.0:0.7852:0.0	.	314	A6NMK8	F196B_HUMAN	K	314	ENSP00000366582:Q314K	ENSP00000366582:Q314K	Q	-	1	0	FAM196B	169242541	0.048000	0.20356	0.001000	0.08648	0.102000	0.19082	2.666000	0.46799	0.673000	0.31224	-0.797000	0.03246	CAA	.	.		0.512	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371629.1	NM_001129891	
HIST1H3A	8350	hgsc.bcm.edu	37	6	26021005	26021005	+	Silent	SNP	G	G	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr6:26021005G>C	ENST00000357647.3	+	1	288	c.288G>C	c.(286-288)gcG>gcC	p.A96A	HIST1H1A_ENST00000244573.3_5'Flank|HIST1H4A_ENST00000359907.3_5'Flank	NM_003529.2	NP_003520.1	P68431	H31_HUMAN	histone cluster 1, H3a	96					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|lung(3)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						TGCAGGAGGCGTGCGAGGCCT	0.582																																					p.A96A		Atlas-SNP	.											.	HIST1H3A	14	.	0			c.G288C						.						46.0	47.0	47.0					6																	26021005		2203	4300	6503	SO:0001819	synonymous_variant	8350	exon1			GGAGGCGTGCGAG	Z46261	CCDS4570.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000198366	ENSG00000275714		"""Histones / Replication-dependent"""	4766	protein-coding gene	gene with protein product		602810	"""H3 histone family, member A"", ""histone 1, H3a"""	H3FA		9119399, 12408966	Standard	NM_003529		Approved	H3/A	uc003nfp.1	P68431	OTTHUMG00000014418	ENST00000357647.3:c.288G>C	chr6.hg19:g.26021005G>C		145.0	0.0		126.0	41.0	NM_003529	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000357647.3	hg19	CCDS4570.1																																																																																			.	.		0.582	HIST1H3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040080.1	NM_003529	
C6orf15	29113	hgsc.bcm.edu	37	6	31079471	31079471	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr6:31079471C>T	ENST00000259870.3	-	2	668	c.665G>A	c.(664-666)gGc>gAc	p.G222D		NM_014070.2	NP_054789.2	Q6UXA7	CF015_HUMAN	chromosome 6 open reading frame 15	222	Gly-rich.				extracellular matrix organization (GO:0030198)	interstitial matrix (GO:0005614)	heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|stomach(1)	17						AGTCCCAGGGCCTCCACCTCC	0.577																																					p.G222D		Atlas-SNP	.											.	C6orf15	29	.	0			c.G665A						.						35.0	35.0	35.0					6																	31079471		1720	3330	5050	SO:0001583	missense	29113	exon2			CCAGGGCCTCCAC	AB031481	CCDS4693.1	6p21	2011-12-12			ENSG00000204542	ENSG00000204542			13927	protein-coding gene	gene with protein product		611401					Standard	NM_014070		Approved	STG	uc003nsk.1	Q6UXA7	OTTHUMG00000031111	ENST00000259870.3:c.665G>A	chr6.hg19:g.31079471C>T	ENSP00000259870:p.Gly222Asp	87.0	0.0		99.0	10.0	NM_014070	B0S7V8|Q0EFA6|Q2L6G7|Q5SQ81|Q86Z05|Q9UIG3	Missense_Mutation	SNP	ENST00000259870.3	hg19	CCDS4693.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082517	0.76528	.	.	ENSG00000204542	ENST00000259870	T	0.09817	2.94	4.4	4.4	0.53042	.	0.577244	0.15647	N	0.251585	T	0.20455	0.0492	M	0.67953	2.075	0.33144	D	0.544789	D	0.71674	0.998	D	0.67548	0.952	T	0.01048	-1.1469	10	0.87932	D	0	0.2134	14.4911	0.67651	0.0:1.0:0.0:0.0	.	222	Q6UXA7	CF015_HUMAN	D	222	ENSP00000259870:G222D	ENSP00000259870:G222D	G	-	2	0	C6orf15	31187450	0.000000	0.05858	0.993000	0.49108	0.978000	0.69477	0.323000	0.19593	2.266000	0.75297	0.643000	0.83706	GGC	.	.		0.577	C6orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076184.2	NM_014070	
TCP11	6954	hgsc.bcm.edu	37	6	35088734	35088734	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr6:35088734T>C	ENST00000512012.1	-	5	823	c.667A>G	c.(667-669)Att>Gtt	p.I223V	TCP11_ENST00000444780.2_Missense_Mutation_p.I231V|TCP11_ENST00000244645.3_Missense_Mutation_p.I161V|TCP11_ENST00000412155.2_Missense_Mutation_p.I185V|TCP11_ENST00000311875.5_Missense_Mutation_p.I236V|TCP11_ENST00000373979.2_Missense_Mutation_p.I161V|TCP11_ENST00000418521.2_Missense_Mutation_p.I160V|TCP11_ENST00000373974.4_Missense_Mutation_p.I190V			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	223					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						TCATACTGAATGGAATGTTCC	0.488																																					p.I236V		Atlas-SNP	.											.	TCP11	94	.	0			c.A706G						.						259.0	261.0	260.0					6																	35088734		2203	4300	6503	SO:0001583	missense	6954	exon6			ACTGAATGGAATG		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.667A>G	chr6.hg19:g.35088734T>C	ENSP00000425995:p.Ile223Val	211.0	0.0		246.0	101.0	NM_001093728	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.561|0.561	-0.845408|-0.845408	0.02671|0.02671	.|.	.|.	ENSG00000124678|ENSG00000124678	ENST00000502480|ENST00000373979;ENST00000412155;ENST00000244645;ENST00000373977;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012;ENST00000486638	.|T;T;T;T;T;T;T;T;T	.|0.05855	.|3.38;3.38;3.38;3.38;3.38;3.38;3.38;3.38;3.38	4.32|4.32	0.415|0.415	0.16411|0.16411	.|.	.|0.238433	.|0.35235	.|N	.|0.003357	T|T	0.00608|0.00608	0.0020|0.0020	N|N	0.03209|0.03209	-0.39|-0.39	0.27488|0.27488	N|N	0.952382|0.952382	.|B;B;B;B;B;B	.|0.19935	.|0.005;0.005;0.01;0.04;0.01;0.001	.|B;B;B;B;B;B	.|0.23275	.|0.018;0.018;0.026;0.045;0.026;0.011	T|T	0.44590|0.44590	-0.9318|-0.9318	5|10	.|0.02654	.|T	.|1	.|.	8.5665|8.5665	0.33543|0.33543	0.0:0.5085:0.0:0.4915|0.0:0.5085:0.0:0.4915	.|.	.|190;185;231;296;223;161	.|B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.|.;.;.;.;TCP11_HUMAN;.	R|V	30|161;185;161;185;236;231;190;160;223;82	.|ENSP00000363091:I161V;ENSP00000402816:I185V;ENSP00000244645:I161V;ENSP00000308708:I236V;ENSP00000404479:I231V;ENSP00000363085:I190V;ENSP00000415320:I160V;ENSP00000425995:I223V;ENSP00000421103:I82V	.|ENSP00000244645:I161V	H|I	-|-	2|1	0|0	TCP11|TCP11	35196712|35196712	0.937000|0.937000	0.31787|0.31787	0.995000|0.995000	0.50966|0.50966	0.767000|0.767000	0.43475|0.43475	0.595000|0.595000	0.24029|0.24029	-0.004000|-0.004000	0.14419|0.14419	-0.371000|-0.371000	0.07208|0.07208	CAT|ATT	.	.		0.488	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728	
SMPD2	6610	hgsc.bcm.edu	37	6	109764480	109764480	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr6:109764480G>T	ENST00000258052.3	+	9	1099	c.740G>T	c.(739-741)gGg>gTg	p.G247V	PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	247					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		GCAGTTTCTGGGTTTTACATC	0.512																																					p.G247V		Atlas-SNP	.											.	SMPD2	25	.	0			c.G740T						.						89.0	98.0	95.0					6																	109764480		2203	4300	6503	SO:0001583	missense	6610	exon9			TTTCTGGGTTTTA	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.740G>T	chr6.hg19:g.109764480G>T	ENSP00000258052:p.Gly247Val	98.0	0.0		81.0	11.0	NM_003080	Q5TED1|Q9BWR3	Missense_Mutation	SNP	ENST00000258052.3	hg19	CCDS5075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.76|13.76	2.333130|2.333130	0.41297|0.41297	.|.	.|.	ENSG00000135587|ENSG00000135587	ENST00000458487|ENST00000258052	T|T	0.33216|0.29142	1.42|1.58	5.95|5.95	4.15|4.15	0.48705|0.48705	.|Endonuclease/exonuclease/phosphatase (2);	0.458485|0.458485	0.26738|0.26738	N|N	0.022743|0.022743	T|T	0.17789|0.17789	0.0427|0.0427	N|N	0.16903|0.16903	0.455|0.455	0.53688|0.53688	D|D	0.999975|0.999975	.|D	.|0.55385	.|0.971	.|P	.|0.60012	.|0.867	T|T	0.03493|0.03493	-1.1031|-1.1031	8|10	0.56958|0.25751	D|T	0.05|0.34	-14.1198|-14.1198	8.5917|8.5917	0.33690|0.33690	0.1718:0.0:0.8282:0.0|0.1718:0.0:0.8282:0.0	.|.	.|247	.|O60906	.|NSMA_HUMAN	C|V	144|247	ENSP00000399731:G144C|ENSP00000258052:G247V	ENSP00000399731:G144C|ENSP00000258052:G247V	G|G	+|+	1|2	0|0	SMPD2|SMPD2	109871173|109871173	0.953000|0.953000	0.32496|0.32496	0.823000|0.823000	0.32752|0.32752	0.734000|0.734000	0.41952|0.41952	2.828000|2.828000	0.48120|0.48120	1.495000|1.495000	0.48549|0.48549	0.655000|0.655000	0.94253|0.94253	GGT|GGG	.	.		0.512	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
ANLN	54443	hgsc.bcm.edu	37	7	36461497	36461497	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr7:36461497C>T	ENST00000265748.2	+	13	2416	c.2195C>T	c.(2194-2196)aCa>aTa	p.T732I	ANLN_ENST00000396068.2_Missense_Mutation_p.T695I	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	732	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						ATGCAACAGACAGTGATCTAT	0.338																																					p.T732I		Atlas-SNP	.											.	ANLN	101	.	0			c.C2195T						.						83.0	83.0	83.0					7																	36461497		2203	4300	6503	SO:0001583	missense	54443	exon13			AACAGACAGTGAT	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2195C>T	chr7.hg19:g.36461497C>T	ENSP00000265748:p.Thr732Ile	267.0	0.0		267.0	29.0	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	hg19	CCDS5447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.2|28.2	4.900246|4.900246	0.92035|0.92035	.|.	.|.	ENSG00000011426|ENSG00000011426	ENST00000446635|ENST00000265748;ENST00000396068	.|T;T	.|0.15256	.|2.44;2.5	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.42314	.|0.1197	L|L	0.58428|0.58428	1.81|1.81	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.999;0.988;0.996;0.991	.|T	.|0.12192	.|-1.0557	.|10	.|0.87932	.|D	.|0	-23.6929|-23.6929	20.0313|20.0313	0.97540|0.97540	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|609;694;695;732	.|B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.|.;.;.;ANLN_HUMAN	X|I	86|732;695	.|ENSP00000265748:T732I;ENSP00000379380:T695I	.|ENSP00000265748:T732I	Q|T	+|+	1|2	0|0	ANLN|ANLN	36428022|36428022	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.989000|0.989000	0.77384|0.77384	4.896000|4.896000	0.63222|0.63222	2.746000|2.746000	0.94184|0.94184	0.655000|0.655000	0.94253|0.94253	CAG|ACA	.	.		0.338	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
MLXIPL	51085	hgsc.bcm.edu	37	7	73008624	73008624	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr7:73008624G>C	ENST00000313375.3	-	16	2467	c.2420C>G	c.(2419-2421)tCt>tGt	p.S807C	MLXIPL_ENST00000395189.1_Missense_Mutation_p.S714C|MLXIPL_ENST00000429400.2_Missense_Mutation_p.S788C|MLXIPL_ENST00000414749.2_Missense_Mutation_p.S805C|MLXIPL_ENST00000434326.1_Missense_Mutation_p.S713C|MLXIPL_ENST00000354613.1_Missense_Mutation_p.S786C	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	807					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGCGGGCAGAGAGCAGTACTG	0.632																																					p.S807C		Atlas-SNP	.											.	MLXIPL	54	.	0			c.C2420G						.						83.0	75.0	77.0					7																	73008624		2203	4300	6503	SO:0001583	missense	51085	exon16			GGCAGAGAGCAGT	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.2420C>G	chr7.hg19:g.73008624G>C	ENSP00000320886:p.Ser807Cys	32.0	0.0		40.0	13.0	NM_032951	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	hg19	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409768	0.83340	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326	T;T;T;T;T;T	0.35236	2.08;2.11;2.06;2.12;1.44;1.32	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000001	T	0.59998	0.2235	M	0.74467	2.265	0.46586	D	0.999112	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.975;0.97;0.987;0.991;0.996	T	0.65220	-0.6221	10	0.87932	D	0	-38.0824	14.8039	0.69938	0.0:0.0:1.0:0.0	.	714;807;788;805;786	Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;MLXPL_HUMAN;.;.;.	C	805;788;807;786;714;713	ENSP00000412330:S805C;ENSP00000406296:S788C;ENSP00000320886:S807C;ENSP00000346629:S786C;ENSP00000378616:S714C;ENSP00000392636:S713C	ENSP00000320886:S807C	S	-	2	0	MLXIPL	72646560	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.620000	0.98373	2.345000	0.79718	0.561000	0.74099	TCT	.	.		0.632	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
MCM7	4176	hgsc.bcm.edu	37	7	99693609	99693609	+	Silent	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr7:99693609G>T	ENST00000303887.5	-	11	2028	c.1383C>A	c.(1381-1383)gtC>gtA	p.V461V	MIR93_ENST00000385024.1_RNA|MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Silent_p.V285V|MIR25_ENST00000384816.1_RNA|MIR106B_ENST00000385301.1_RNA	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	461	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCTGCTCCATGACCTCGTGGA	0.627																																					p.V461V		Atlas-SNP	.											.	MCM7	136	.	0			c.C1383A						.						96.0	78.0	84.0					7																	99693609		2203	4300	6503	SO:0001819	synonymous_variant	4176	exon11			CTCCATGACCTCG		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1383C>A	chr7.hg19:g.99693609G>T		52.0	0.0		82.0	8.0	NM_005916	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Silent	SNP	ENST00000303887.5	hg19	CCDS5683.1																																																																																			.	.		0.627	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
ARFGEF1	10565	hgsc.bcm.edu	37	8	68179424	68179424	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr8:68179424C>G	ENST00000262215.3	-	12	2103	c.1714G>C	c.(1714-1716)Gac>Cac	p.D572H	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.D26H	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	572	HUS; DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GCATTTAAGTCACAGTCATAG	0.338																																					p.D572H		Atlas-SNP	.											.	ARFGEF1	196	.	0			c.G1714C						.						73.0	73.0	73.0					8																	68179424		2202	4293	6495	SO:0001583	missense	10565	exon12			TTAAGTCACAGTC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1714G>C	chr8.hg19:g.68179424C>G	ENSP00000262215:p.Asp572His	100.0	0.0		90.0	9.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	hg19	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.355273	0.82243	.	.	ENSG00000066777	ENST00000520381;ENST00000262215	T;T	0.65732	0.69;-0.17	5.64	5.64	0.86602	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79986	0.4541	M	0.92649	3.33	0.80722	D	1	P;P	0.50066	0.931;0.529	P;B	0.50825	0.651;0.443	D	0.84718	0.0738	10	0.66056	D	0.02	.	19.7032	0.96063	0.0:1.0:0.0:0.0	.	572;26	Q9Y6D6;E5RIF2	BIG1_HUMAN;.	H	26;572	ENSP00000428429:D26H;ENSP00000262215:D572H	ENSP00000262215:D572H	D	-	1	0	ARFGEF1	68341978	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.743000	0.85020	2.663000	0.90544	0.650000	0.86243	GAC	.	.		0.338	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ZFHX4	79776	hgsc.bcm.edu	37	8	77617394	77617394	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr8:77617394T>G	ENST00000521891.2	+	2	1519	c.1071T>G	c.(1069-1071)gaT>gaG	p.D357E	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D357E|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D357E|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D357E|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAGGACCCGATCCAACCTTCC	0.453										HNSCC(33;0.089)																											p.D357E		Atlas-SNP	.											.	ZFHX4	878	.	0			c.T1071G						.						99.0	91.0	94.0					8																	77617394		1831	4093	5924	SO:0001583	missense	79776	exon2			ACCCGATCCAACC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1071T>G	chr8.hg19:g.77617394T>G	ENSP00000430497:p.Asp357Glu	70.0	0.0		75.0	34.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	T	11.45	1.643876	0.29246	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53640	0.61;0.66;0.62;0.62	5.53	-1.45	0.08828	.	0.000000	0.45867	U	0.000329	T	0.50565	0.1623	L	0.36672	1.1	0.49798	D	0.999826	D;D;D;D	0.67145	0.994;0.996;0.996;0.98	D;D;D;P	0.77557	0.978;0.99;0.99;0.668	T	0.37641	-0.9697	10	0.30854	T	0.27	.	10.3143	0.43727	0.0:0.3704:0.0:0.6296	.	357;357;357;357	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	E	357	ENSP00000430497:D357E;ENSP00000399605:D357E;ENSP00000050961:D357E;ENSP00000430848:D357E	ENSP00000050961:D357E	D	+	3	2	ZFHX4	77779949	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	1.366000	0.34193	-0.367000	0.08052	0.533000	0.62120	GAT	.	.		0.453	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
VPS13B	157680	hgsc.bcm.edu	37	8	100832349	100832349	+	Splice_Site	SNP	A	A	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr8:100832349A>T	ENST00000358544.2	+	49	9179	c.9068A>T	c.(9067-9069)cAg>cTg	p.Q3023L	VPS13B_ENST00000357162.2_Splice_Site_p.Q2998L|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3023					protein transport (GO:0015031)			p.Q3023R(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTAATTTTCAGGTACTATAA	0.328																																					p.Q3023L	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											VPS13B,NS,carcinoma,0,1	VPS13B	811	.	1	Substitution - Missense(1)	prostate(1)	c.A9068T						.						57.0	63.0	61.0					8																	100832349		2202	4298	6500	SO:0001630	splice_region_variant	157680	exon49			ATTTTCAGGTACT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9069+1A>T	chr8.hg19:g.100832349A>T		79.0	0.0		63.0	4.0	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.564282	0.65651	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.77877	-1.13;-1.13	5.92	5.92	0.95590	.	0.198278	0.43747	D	0.000537	T	0.67211	0.2869	L	0.27053	0.805	0.80722	D	1	P;P	0.41848	0.763;0.454	B;B	0.35971	0.215;0.073	T	0.72587	-0.4248	10	0.66056	D	0.02	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	2998;3023	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	L	2998;3023	ENSP00000349685:Q2998L;ENSP00000351346:Q3023L	ENSP00000349685:Q2998L	Q	+	2	0	VPS13B	100901525	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.945000	0.70226	2.270000	0.75569	0.459000	0.35465	CAG	.	.		0.328	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	Missense_Mutation
IFNA8	3445	hgsc.bcm.edu	37	9	21409229	21409229	+	Silent	SNP	A	A	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr9:21409229A>T	ENST00000380205.1	+	1	84	c.54A>T	c.(52-54)tcA>tcT	p.S18S		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	18					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		GCTACAAGTCATTCAGCTCTC	0.502																																					p.S18S		Atlas-SNP	.											.	IFNA8	19	.	0			c.A54T						.						150.0	143.0	146.0					9																	21409229		2203	4300	6503	SO:0001819	synonymous_variant	3445	exon1			CAAGTCATTCAGC		CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.54A>T	chr9.hg19:g.21409229A>T		49.0	0.0		75.0	29.0	NM_002170	P01565|P09236|Q5VWV7|Q5VYQ3	Silent	SNP	ENST00000380205.1	hg19	CCDS6507.1																																																																																			.	.		0.502	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051906.1	NM_002170	
RFK	55312	hgsc.bcm.edu	37	9	79009045	79009045	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr9:79009045C>T	ENST00000376736.1	-	1	376	c.43G>A	c.(43-45)Ggc>Agc	p.G15S	RFK_ENST00000479197.1_5'UTR	NM_018339.5	NP_060809.3	Q969G6	RIFK_HUMAN	riboflavin kinase	15					apoptotic process (GO:0006915)|FMN biosynthetic process (GO:0009398)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|reactive oxygen species metabolic process (GO:0072593)|riboflavin biosynthetic process (GO:0009231)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|riboflavin kinase activity (GO:0008531)			pancreas(1)|prostate(1)|urinary_tract(1)	3					Riboflavin(DB00140)	CGGCCGAAGCCCCGCACCACT	0.721																																					p.G15S		Atlas-SNP	.											.	RFK	13	.	0			c.G43A						.						10.0	11.0	11.0					9																	79009045		2182	4248	6430	SO:0001583	missense	55312	exon1			CGAAGCCCCGCAC	AK002011	CCDS35044.1, CCDS35044.2	9q21.31	2010-11-16			ENSG00000135002	ENSG00000135002			30324	protein-coding gene	gene with protein product		613010				14580199	Standard	NM_018339		Approved	FLJ11149, RIFK	uc004akd.2	Q969G6	OTTHUMG00000020040	ENST00000376736.1:c.43G>A	chr9.hg19:g.79009045C>T	ENSP00000365926:p.Gly15Ser	127.0	0.0		139.0	56.0	NM_018339	Q5JSG9|Q9NUT7	Missense_Mutation	SNP	ENST00000376736.1	hg19	CCDS35044.2	.	.	.	.	.	.	.	.	.	.	c	36	5.675328	0.96764	.	.	ENSG00000135002	ENST00000376736;ENST00000257452;ENST00000490113	.	.	.	4.17	4.17	0.49024	Riboflavin kinase domain (1);Riboflavin kinase domain, bacterial/eukaryotic (3);	0.000000	0.85682	D	0.000000	D	0.90239	0.6948	H	0.98407	4.225	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.77557	0.99;0.987	D	0.94511	0.7718	9	0.87932	D	0	-6.3925	16.8446	0.85977	0.0:1.0:0.0:0.0	.	22;15	B2RDZ2;Q969G6	.;RIFK_HUMAN	S	15;22;2	.	ENSP00000257452:G22S	G	-	1	0	RFK	78198865	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.554000	0.73923	2.044000	0.60594	0.479000	0.44913	GGC	.	.		0.721	RFK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052720.1	NM_018339	
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	43.0	1.0		62.0	3.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
SPATA31C2	645961	hgsc.bcm.edu	37	9	90748542	90748542	+	IGR	SNP	G	G	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr9:90748542G>A								U6 (135292 upstream) : U3 (240641 downstream)																							CTGCCTCTGGGCCTCCCCCTC	0.592																																					p.P78S		Atlas-SNP	.											.	.	.	.	0			c.C232T						.						82.0	81.0	82.0					9																	90748542		692	1591	2283	SO:0001628	intergenic_variant	645961	exon2			CTCTGGGCCTCCC																													chr9.hg19:g.90748542G>A		353.0	0.0		412.0	58.0	NM_001166137		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.592								
SKIDA1	387640	hgsc.bcm.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000444772.3_Silent_p.H265H|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716																																					p.H344H		Atlas-SNP	.											.	.	.	.	0			c.T1032C						.						4.0	6.0	5.0					10																	21805720		1658	3602	5260	SO:0001819	synonymous_variant	387640	exon4			GTGGTGATGGTGG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	chr10.hg19:g.21805720A>G		55.0	0.0		96.0	4.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
ATRNL1	26033	hgsc.bcm.edu	37	10	117075120	117075120	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr10:117075120C>T	ENST00000355044.3	+	18	3037	c.2911C>T	c.(2911-2913)Cat>Tat	p.H971Y	ATRNL1_ENST00000423111.2_Missense_Mutation_p.H68Y|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	971	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AGGAAGAGGACATTGCATTGA	0.453																																					p.H971Y		Atlas-SNP	.											.	ATRNL1	219	.	0			c.C2911T						.						153.0	133.0	140.0					10																	117075120		2203	4300	6503	SO:0001583	missense	26033	exon18			AGAGGACATTGCA	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2911C>T	chr10.hg19:g.117075120C>T	ENSP00000347152:p.His971Tyr	89.0	0.0		87.0	38.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	hg19	CCDS7592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.368|1.368	-0.586994|-0.586994	0.03827|0.03827	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;T|.	0.17528|.	2.27;2.27|.	5.34|5.34	3.41|3.41	0.39046|0.39046	.|.	0.455833|.	0.26627|.	N|.	0.023334|.	T|T	0.29620|0.29620	0.0739|0.0739	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.03969|0.03969	-1.0988|-1.0988	10|5	0.14656|.	T|.	0.56|.	-5.1853|-5.1853	5.5388|5.5388	0.17026|0.17026	0.1564:0.6718:0.0:0.1718|0.1564:0.6718:0.0:0.1718	.|.	68;971|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	Y|I	971;68|100	ENSP00000347152:H971Y;ENSP00000409624:H68Y|.	ENSP00000347152:H971Y|.	H|T	+|+	1|2	0|0	ATRNL1|ATRNL1	117065110|117065110	0.231000|0.231000	0.23751|0.23751	0.990000|0.990000	0.47175|0.47175	0.845000|0.845000	0.48019|0.48019	0.892000|0.892000	0.28322|0.28322	0.576000|0.576000	0.29452|0.29452	0.455000|0.455000	0.32223|0.32223	CAT|ACA	.	.		0.453	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
HMX3	340784	hgsc.bcm.edu	37	10	124895890	124895890	+	Silent	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr10:124895890C>T	ENST00000357878.5	+	1	413	c.324C>T	c.(322-324)caC>caT	p.H108H		NM_001105574.1	NP_001099044.1	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	108					brain development (GO:0007420)|cell differentiation (GO:0030154)|embryo implantation (GO:0007566)|inner ear morphogenesis (GO:0042472)|maternal process involved in female pregnancy (GO:0060135)|neuromuscular process controlling balance (GO:0050885)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(4)	4		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		TGCCCGCGCACTACCTGGAGC	0.697																																					p.H108H		Atlas-SNP	.											.	HMX3	24	.	0			c.C324T						.						11.0	15.0	14.0					10																	124895890		1964	4128	6092	SO:0001819	synonymous_variant	340784	exon1			CGCGCACTACCTG		CCDS41575.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188620	ENSG00000188620		"""Homeoboxes / ANTP class : NKL subclass"""	5019	protein-coding gene	gene with protein product		613380	"""homeo box (H6 family) 3"""				Standard	NM_001105574		Approved	NKX5-1	uc010quc.2	A6NHT5	OTTHUMG00000019199	ENST00000357878.5:c.324C>T	chr10.hg19:g.124895890C>T		106.0	0.0		143.0	58.0	NM_001105574	A8MU06	Silent	SNP	ENST00000357878.5	hg19	CCDS41575.1																																																																																			.	.		0.697	HMX3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050842.4	XM_291716	
SLC35C1	55343	hgsc.bcm.edu	37	11	45832352	45832352	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr11:45832352G>C	ENST00000314134.3	+	2	1957	c.561G>C	c.(559-561)caG>caC	p.Q187H	CTD-2210P24.6_ENST00000534128.1_lincRNA|SLC35C1_ENST00000442528.2_Missense_Mutation_p.Q174H|SLC35C1_ENST00000456334.1_Missense_Mutation_p.Q174H	NM_018389.4	NP_060859.4	Q96A29	FUCT1_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C1	187					carbohydrate transport (GO:0008643)|lipid glycosylation (GO:0030259)|negative regulation of Notch signaling pathway (GO:0045746)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				GBM - Glioblastoma multiforme(35;0.227)		GTGTGGACCAGGAGGGGGCAG	0.632																																					p.Q187H		Atlas-SNP	.											.	SLC35C1	23	.	0			c.G561C						.						41.0	44.0	43.0					11																	45832352		2203	4299	6502	SO:0001583	missense	55343	exon2			GGACCAGGAGGGG		CCDS7914.1, CCDS44575.1	11p11.2	2014-09-17	2013-07-17			ENSG00000181830		"""Solute carriers"""	20197	protein-coding gene	gene with protein product		605881	"""solute carrier family 35, member C1"""			11326279, 11326280	Standard	NM_018389		Approved	FUCT1, FLJ11320	uc010rgm.2	Q96A29		ENST00000314134.3:c.561G>C	chr11.hg19:g.45832352G>C	ENSP00000313318:p.Gln187His	50.0	0.0		47.0	4.0	NM_018389	B2RDB2|Q9BV76|Q9NUJ8	Missense_Mutation	SNP	ENST00000314134.3	hg19	CCDS7914.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630484	0.67015	.	.	ENSG00000181830	ENST00000442528;ENST00000456334;ENST00000530670;ENST00000314134;ENST00000540685	T;T;T	0.64803	-0.11;-0.11;-0.12	6.08	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.78175	0.4242	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.79200	-0.1901	10	0.49607	T	0.09	-19.4468	11.4901	0.50377	0.2008:0.0:0.7992:0.0	.	187	Q96A29	FUCT1_HUMAN	H	174;174;108;187;187	ENSP00000412408:Q174H;ENSP00000399779:Q174H;ENSP00000313318:Q187H	ENSP00000313318:Q187H	Q	+	3	2	SLC35C1	45788928	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.600000	0.46240	0.865000	0.35603	0.655000	0.94253	CAG	.	.		0.632	SLC35C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390139.1	NM_018389	
OR5L1	219437	hgsc.bcm.edu	37	11	55579749	55579749	+	Silent	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr11:55579749T>C	ENST00000333973.2	+	1	896	c.807T>C	c.(805-807)gaT>gaC	p.D269D		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				ATAGTGGAGATGCTGACAAAG	0.473																																					p.D269D		Atlas-SNP	.											.	OR5L1	145	.	0			c.T807C						.						95.0	84.0	88.0					11																	55579749		2200	4296	6496	SO:0001819	synonymous_variant	219437	exon1			TGGAGATGCTGAC	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.807T>C	chr11.hg19:g.55579749T>C		104.0	0.0		109.0	12.0	NM_001004738	B2RNK6|Q6IFD0	Silent	SNP	ENST00000333973.2	hg19	CCDS31509.1																																																																																			.	.		0.473	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
CATSPER1	117144	hgsc.bcm.edu	37	11	65789252	65789252	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr11:65789252A>G	ENST00000312106.5	-	3	1665	c.1528T>C	c.(1528-1530)Ttc>Ctc	p.F510L		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	510					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TTGTTCCAGAAGTCAAAGAAG	0.587																																					p.F510L		Atlas-SNP	.											.	CATSPER1	101	.	0			c.T1528C						.						123.0	112.0	116.0					11																	65789252		2201	4296	6497	SO:0001583	missense	117144	exon3			TCCAGAAGTCAAA	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1528T>C	chr11.hg19:g.65789252A>G	ENSP00000309052:p.Phe510Leu	155.0	0.0		204.0	19.0	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	hg19	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.133183	0.37630	.	.	ENSG00000175294	ENST00000312106	D	0.98234	-4.81	4.58	-4.99	0.03010	Ion transport (1);	1.380240	0.05245	N	0.512954	D	0.92753	0.7696	N	0.11023	0.085	0.09310	N	1	B	0.25955	0.138	B	0.33196	0.159	D	0.87664	0.2536	10	0.40728	T	0.16	-3.075	1.2359	0.01953	0.3118:0.2732:0.2807:0.1343	.	510	Q8NEC5	CTSR1_HUMAN	L	510	ENSP00000309052:F510L	ENSP00000309052:F510L	F	-	1	0	CATSPER1	65545828	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.208000	0.03005	-0.699000	0.05077	0.247000	0.18012	TTC	.	.		0.587	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
RNF169	254225	hgsc.bcm.edu	37	11	74547698	74547698	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr11:74547698A>G	ENST00000299563.4	+	6	2063	c.2050A>G	c.(2050-2052)Agg>Ggg	p.R684G		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	684					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CGACAATGAGAGGCGGACTGT	0.542																																					p.R684G		Atlas-SNP	.											.	RNF169	36	.	0			c.A2050G						.						75.0	77.0	77.0					11																	74547698		1964	4145	6109	SO:0001583	missense	254225	exon6			AATGAGAGGCGGA	AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.2050A>G	chr11.hg19:g.74547698A>G	ENSP00000299563:p.Arg684Gly	56.0	0.0		68.0	5.0	NM_001098638	Q6N015	Missense_Mutation	SNP	ENST00000299563.4	hg19	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790260	0.31685	.	.	ENSG00000166439	ENST00000299563	T	0.48522	0.81	5.53	1.54	0.23209	.	0.273555	0.36815	N	0.002399	T	0.39118	0.1066	M	0.65975	2.015	0.80722	D	1	P	0.39782	0.688	B	0.28849	0.095	T	0.39313	-0.9620	10	0.48119	T	0.1	-3.7219	11.7531	0.51859	0.5342:0.4658:0.0:0.0	.	684	Q8NCN4	RN169_HUMAN	G	684	ENSP00000299563:R684G	ENSP00000299563:R684G	R	+	1	2	RNF169	74225346	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	2.012000	0.40932	0.438000	0.26450	0.533000	0.62120	AGG	.	.		0.542	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384741.1	XM_495886	
OR10G4	390264	hgsc.bcm.edu	37	11	123886338	123886338	+	Silent	SNP	A	A	T	rs539322343		TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr11:123886338A>T	ENST00000320891.4	+	1	57	c.57A>T	c.(55-57)ccA>ccT	p.P19P		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CCCATGCCCCAGGGCTGGACG	0.567																																					p.P19P		Atlas-SNP	.											.	OR10G4	77	.	0			c.A57T						.						151.0	105.0	121.0					11																	123886338		2202	4298	6500	SO:0001819	synonymous_variant	390264	exon1			TGCCCCAGGGCTG	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.57A>T	chr11.hg19:g.123886338A>T		156.0	0.0		232.0	21.0	NM_001004462	Q6IEW0	Silent	SNP	ENST00000320891.4	hg19	CCDS31702.1																																																																																			.	.		0.567	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
KRT83	3889	hgsc.bcm.edu	37	12	52710776	52710776	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr12:52710776T>A	ENST00000293670.3	-	5	844	c.782A>T	c.(781-783)gAc>gTc	p.D261V		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	261	Linker 12.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CACGGAGGTGTCTGAGATGTG	0.537																																					p.D261V	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	Atlas-SNP	.											.	KRT83	64	.	0			c.A782T						.						145.0	127.0	133.0					12																	52710776		2203	4300	6503	SO:0001583	missense	3889	exon5			GAGGTGTCTGAGA	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.782A>T	chr12.hg19:g.52710776T>A	ENSP00000293670:p.Asp261Val	66.0	0.0		82.0	32.0	NM_002282	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	hg19	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.255186	0.80135	.	.	ENSG00000170523	ENST00000293670	T	0.80304	-1.36	3.9	3.9	0.45041	Filament (1);	0.000000	0.43747	U	0.000539	D	0.89427	0.6712	M	0.86651	2.83	0.80722	D	1	D	0.58620	0.983	D	0.65323	0.934	D	0.91217	0.5003	10	0.87932	D	0	.	13.0274	0.58823	0.0:0.0:0.0:1.0	.	261	P78385	KRT83_HUMAN	V	261	ENSP00000293670:D261V	ENSP00000293670:D261V	D	-	2	0	KRT83	50997043	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.904000	0.87408	1.544000	0.49359	0.459000	0.35465	GAC	.	.		0.537	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
AGAP2	116986	hgsc.bcm.edu	37	12	58131312	58131312	+	Missense_Mutation	SNP	C	C	T	rs561812307		TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr12:58131312C>T	ENST00000547588.1	-	1	717	c.718G>A	c.(718-720)Gcc>Acc	p.A240T	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	240					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						gcggcggcggcggtggcggcg	0.706																																					p.A240T		Atlas-SNP	.											AGAP2_ENST00000547588,NS,carcinoma,0,1	AGAP2	167	.	0			c.G718A						.						4.0	6.0	5.0					12																	58131312		1428	3301	4729	SO:0001583	missense	116986	exon1			CGGCGGCGGTGGC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.718G>A	chr12.hg19:g.58131312C>T	ENSP00000449241:p.Ala240Thr	80.0	0.0		75.0	4.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	hg19	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.24|10.24	1.294811|1.294811	0.23564|0.23564	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000547588|ENST00000328568	T|.	0.39997|.	1.05|.	3.81|3.81	-1.14|-1.14	0.09741|0.09741	.|.	1.354790|.	0.05448|.	N|.	0.548952|.	T|T	0.10508|0.10508	0.0257|0.0257	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.009;0.005|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.24548|0.24548	-1.0157|-1.0157	10|5	0.56958|.	D|.	0.05|.	.|.	0.5619|0.5619	0.00680|0.00680	0.1874:0.3561:0.184:0.2724|0.1874:0.3561:0.184:0.2724	.|.	240;240|.	F8VVT9;Q99490|.	.;AGAP2_HUMAN|.	T|H	240|103	ENSP00000449241:A240T|.	ENSP00000449241:A240T|.	A|R	-|-	1|2	0|0	AGAP2|AGAP2	56417579|56417579	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	0.086000|0.086000	0.14935|0.14935	-0.555000|-0.555000	0.06142|0.06142	0.455000|0.455000	0.32223|0.32223	GCC|CGC	.	.		0.706	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
MSRB3	253827	hgsc.bcm.edu	37	12	65672604	65672604	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr12:65672604T>C	ENST00000355192.3	+	1	182	c.56T>C	c.(55-57)cTc>cCc	p.L19P	MSRB3_ENST00000540804.1_Missense_Mutation_p.L19P|MSRB3_ENST00000535664.1_5'UTR|MSRB3_ENST00000308259.5_5'UTR|RP11-305O6.3_ENST00000545709.1_RNA|MSRB3_ENST00000538725.1_3'UTR	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	19					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		tccctctgcctctgcctctgc	0.731																																					p.L19P		Atlas-SNP	.											.	MSRB3	80	.	0			c.T56C						.						19.0	18.0	18.0					12																	65672604		2166	4244	6410	SO:0001583	missense	253827	exon1			TCTGCCTCTGCCT	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.56T>C	chr12.hg19:g.65672604T>C	ENSP00000347324:p.Leu19Pro	148.0	0.0		160.0	14.0	NM_198080	B4DR19|B7ZAQ0|Q6UXS2	Missense_Mutation	SNP	ENST00000355192.3	hg19	CCDS8973.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.817614	0.90790	.	.	ENSG00000174099	ENST00000355192;ENST00000540804	T;T	0.67345	-0.23;-0.26	3.83	3.83	0.44106	.	7741.500000	0.00166	N	0.000000	T	0.54695	0.1874	N	0.08118	0	0.80722	D	1	P	0.36959	0.575	B	0.42214	0.38	T	0.43180	-0.9407	9	.	.	.	.	9.0152	0.36166	0.0:0.0:0.0:1.0	.	19	Q8IXL7	MSRB3_HUMAN	P	19	ENSP00000347324:L19P;ENSP00000437623:L19P	.	L	+	2	0	MSRB3	63958871	0.637000	0.27216	0.960000	0.40013	0.836000	0.47400	1.097000	0.30988	1.371000	0.46172	0.164000	0.16699	CTC	.	.		0.731	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080	
HSPH1	10808	hgsc.bcm.edu	37	13	31724104	31724104	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr13:31724104C>A	ENST00000320027.5	-	8	1468	c.1124G>T	c.(1123-1125)gGa>gTa	p.G375V	HSPH1_ENST00000380406.5_Missense_Mutation_p.G334V|HSPH1_ENST00000380405.4_Missense_Mutation_p.G375V|HSPH1_ENST00000445273.2_Missense_Mutation_p.G377V|HSPH1_ENST00000429785.2_Missense_Mutation_p.G194V	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	375					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TAATGCACATCCTCTGGCTAC	0.428																																					p.G375V		Atlas-SNP	.											.	HSPH1	65	.	0			c.G1124T						.						110.0	104.0	106.0					13																	31724104		2203	4300	6503	SO:0001583	missense	10808	exon8			GCACATCCTCTGG	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.1124G>T	chr13.hg19:g.31724104C>A	ENSP00000318687:p.Gly375Val	118.0	0.0		68.0	56.0	NM_006644	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	hg19	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939361	0.73557	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000429785;ENST00000438061	D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.96194	0.8759	H	0.96805	3.885	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97154	0.9833	10	0.87932	D	0	-26.0178	19.7842	0.96430	0.0:1.0:0.0:0.0	.	194;334;377;375;375	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	V	375;375;334;377;194;426	ENSP00000318687:G375V;ENSP00000369768:G375V;ENSP00000369769:G334V;ENSP00000396090:G377V;ENSP00000388778:G194V	ENSP00000318687:G375V	G	-	2	0	HSPH1	30622104	1.000000	0.71417	0.919000	0.36401	0.546000	0.35178	7.487000	0.81328	2.676000	0.91093	0.591000	0.81541	GGA	.	.		0.428	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1		
MYCBP2	23077	hgsc.bcm.edu	37	13	77842001	77842001	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr13:77842001C>A	ENST00000544440.2	-	8	1235	c.1218G>T	c.(1216-1218)gaG>gaT	p.E406D	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Missense_Mutation_p.E444D|MYCBP2_ENST00000357337.6_Missense_Mutation_p.E406D					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TACCATCTTGCTCCAGTGTTT	0.343																																					p.E444D		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.G1332T						.						155.0	137.0	143.0					13																	77842001		2203	4300	6503	SO:0001583	missense	23077	exon8			ATCTTGCTCCAGT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1218G>T	chr13.hg19:g.77842001C>A	ENSP00000444596:p.Glu406Asp	100.0	0.0		191.0	72.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	C	13.26	2.185356	0.38609	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.48201	0.82;0.82;0.82	5.79	-1.8	0.07907	.	0.064478	0.64402	D	0.000012	T	0.33323	0.0859	L	0.36672	1.1	0.40880	D	0.983982	B	0.06786	0.001	B	0.08055	0.003	T	0.12142	-1.0559	10	0.24483	T	0.36	.	13.6375	0.62230	0.0:0.4937:0.0:0.5063	.	406	O75592	MYCB2_HUMAN	D	406;444;406	ENSP00000349892:E406D;ENSP00000384288:E444D;ENSP00000444596:E406D	ENSP00000349892:E406D	E	-	3	2	MYCBP2	76740002	0.882000	0.30256	0.941000	0.38009	0.992000	0.81027	-0.017000	0.12590	-0.534000	0.06315	-0.469000	0.05056	GAG	.	.		0.343	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
TP53	7157	hgsc.bcm.edu	37	17	7578402	7578402	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr17:7578402G>C	ENST00000269305.4	-	5	717	c.528C>G	c.(526-528)tgC>tgG	p.C176W	TP53_ENST00000413465.2_Missense_Mutation_p.C176W|TP53_ENST00000359597.4_Missense_Mutation_p.C176W|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.C176W|TP53_ENST00000420246.2_Missense_Mutation_p.C176W|TP53_ENST00000445888.2_Missense_Mutation_p.C176W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176*(12)|p.C176W(11)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178fs*69(3)|p.R175_E180delRCPHHE(3)|p.C83*(2)|p.V173fs*59(2)|p.C44*(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176F(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.P177fs*4(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGGTGGGGGCAGCGCCTCA	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C176W	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,-1,1	TP53	33396	.	75	Deletion - Frameshift(21)|Substitution - Nonsense(16)|Deletion - In frame(13)|Substitution - Missense(12)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(2)	breast(15)|large_intestine(12)|upper_aerodigestive_tract(8)|lung(8)|oesophagus(8)|haematopoietic_and_lymphoid_tissue(5)|ovary(4)|bone(4)|stomach(2)|central_nervous_system(2)|liver(2)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|skin(1)|pancreas(1)	c.C528G						.						48.0	48.0	48.0					17																	7578402		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GTGGGGGCAGCGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.528C>G	chr17.hg19:g.7578402G>C	ENSP00000269305:p.Cys176Trp	132.0	1.0		72.0	8.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640435	0.67244	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	-1.32	0.09201	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;1.0;0.999;0.998	D	0.94683	0.7867	10	0.87932	D	0	-18.1821	6.7443	0.23453	0.3734:0.1173:0.5093:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	W	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176W;ENSP00000352610:C176W;ENSP00000269305:C176W;ENSP00000398846:C176W;ENSP00000391127:C176W;ENSP00000391478:C176W;ENSP00000425104:C44W;ENSP00000423862:C83W	ENSP00000269305:C176W	C	-	3	2	TP53	7519127	1.000000	0.71417	0.991000	0.47740	0.860000	0.49131	0.743000	0.26231	-0.094000	0.12374	-0.126000	0.14955	TGC	.	.		0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ARHGAP44	9912	hgsc.bcm.edu	37	17	12883408	12883408	+	Silent	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr17:12883408T>C	ENST00000379672.5	+	19	2097	c.1797T>C	c.(1795-1797)tcT>tcC	p.S599S	ARHGAP44_ENST00000262444.9_Silent_p.S599S|ARHGAP44_ENST00000578087.1_3'UTR|ARHGAP44_ENST00000340825.3_Silent_p.S593S	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	599					exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						CTCCAGGCTCTGCACAGAAAG	0.587																																					p.S599S		Atlas-SNP	.											.	ARHGAP44	55	.	0			c.T1797C						.						33.0	37.0	36.0					17																	12883408		1931	4149	6080	SO:0001819	synonymous_variant	9912	exon19			AGGCTCTGCACAG		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.1797T>C	chr17.hg19:g.12883408T>C		149.0	0.0		116.0	40.0	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Silent	SNP	ENST00000379672.5	hg19	CCDS45616.1																																																																																			.	.		0.587	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
ATAD5	79915	hgsc.bcm.edu	37	17	29159374	29159374	+	Silent	SNP	G	G	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr17:29159374G>A	ENST00000321990.4	+	1	387	c.9G>A	c.(7-9)ggG>ggA	p.G3G	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	3					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GTATGGTGGGGGTCCTGGCCA	0.642																																					p.G3G		Atlas-SNP	.											.	ATAD5	150	.	0			c.G9A						.						64.0	71.0	69.0					17																	29159374		2203	4300	6503	SO:0001819	synonymous_variant	79915	exon1			GGTGGGGGTCCTG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.9G>A	chr17.hg19:g.29159374G>A		52.0	0.0		76.0	24.0	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Silent	SNP	ENST00000321990.4	hg19	CCDS11260.1																																																																																			.	.		0.642	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
LRRC37A3	374819	hgsc.bcm.edu	37	17	62856309	62856309	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr17:62856309G>T	ENST00000584306.1	-	11	4485	c.3955C>A	c.(3955-3957)Ccc>Acc	p.P1319T	LRRC37A3_ENST00000400877.3_Missense_Mutation_p.P357T|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.P437T|LRRC37A3_ENST00000334962.5_Missense_Mutation_p.P296T|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.P1319T	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1319						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TTGACCTTGGGTGTTCTGTGG	0.428																																					p.P1319T		Atlas-SNP	.											.	LRRC37A3	75	.	0			c.C3955A						.						202.0	211.0	208.0					17																	62856309		2203	4298	6501	SO:0001583	missense	374819	exon11			CCTTGGGTGTTCT	AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.3955C>A	chr17.hg19:g.62856309G>T	ENSP00000464535:p.Pro1319Thr	82.0	0.0		191.0	49.0	NM_199340	Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	ENST00000584306.1	hg19	CCDS32708.1	.	.	.	.	.	.	.	.	.	.	.	7.591	0.670751	0.14776	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T	0.59224	1.44;1.43;0.28	2.1	1.07	0.20283	.	.	.	.	.	T	0.55878	0.1948	L	0.52573	1.65	0.09310	N	1	D;P	0.54964	0.969;0.759	P;B	0.52159	0.691;0.143	T	0.44174	-0.9345	9	0.46703	T	0.11	.	4.8767	0.13660	0.1959:0.0:0.8041:0.0	.	437;1319	B4DG20;O60309	.;L37A3_HUMAN	T	400;357;296;1319	ENSP00000383674:P357T;ENSP00000335617:P296T;ENSP00000325713:P1319T	ENSP00000325713:P1319T	P	-	1	0	LRRC37A3	60286771	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.546000	0.23284	0.211000	0.20683	0.184000	0.17185	CCC	.	.		0.428	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445377.1	NM_199340	
CD7	924	hgsc.bcm.edu	37	17	80275365	80275365	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr17:80275365C>G	ENST00000312648.3	-	1	113	c.7G>C	c.(7-9)Ggg>Cgg	p.G3R	CD7_ENST00000583376.1_5'UTR|CD7_ENST00000578509.1_5'UTR|CD7_ENST00000584284.1_Missense_Mutation_p.G3R	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	3					homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			CTCGGAGGCCCGGCCATGTTC	0.687																																					p.G3R	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											.	CD7	25	.	0			c.G7C						.						11.0	13.0	12.0					17																	80275365		2118	4205	6323	SO:0001583	missense	924	exon1			GAGGCCCGGCCAT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.7G>C	chr17.hg19:g.80275365C>G	ENSP00000312027:p.Gly3Arg	182.0	0.0		317.0	18.0	NM_006137		Missense_Mutation	SNP	ENST00000312648.3	hg19	CCDS11807.1	.	.	.	.	.	.	.	.	.	.	C	4.181	0.032231	0.08101	.	.	ENSG00000173762	ENST00000312648	T	0.26067	1.76	1.98	-3.95	0.04118	.	.	.	.	.	T	0.13670	0.0331	N	0.22421	0.69	0.20196	N	0.999923	B;B;B	0.17667	0.004;0.023;0.023	B;B;B	0.06405	0.001;0.002;0.001	T	0.23226	-1.0194	9	0.49607	T	0.09	-0.0154	5.7535	0.18160	0.0:0.2446:0.5846:0.1708	.	3;3;3	B4DNW9;Q29VG3;P09564	.;.;CD7_HUMAN	R	3	ENSP00000312027:G3R	ENSP00000312027:G3R	G	-	1	0	CD7	77868654	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-3.653000	0.00402	-0.993000	0.03467	-0.802000	0.03209	GGG	.	.		0.687	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
TTC39C	125488	hgsc.bcm.edu	37	18	21644129	21644129	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr18:21644129G>A	ENST00000317571.3	+	2	429	c.193G>A	c.(193-195)Gga>Aga	p.G65R	TTC39C_ENST00000578150.1_3'UTR|TTC39C_ENST00000304621.6_Missense_Mutation_p.G4R	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	65										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						AATGAGTTTTGGAGCCAGCTT	0.313																																					p.G65R		Atlas-SNP	.											.	TTC39C	83	.	0			c.G193A						.						155.0	157.0	156.0					18																	21644129		2203	4300	6503	SO:0001583	missense	125488	exon2			AGTTTTGGAGCCA	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.193G>A	chr18.hg19:g.21644129G>A	ENSP00000323645:p.Gly65Arg	92.0	0.0		73.0	38.0	NM_001135993	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Missense_Mutation	SNP	ENST00000317571.3	hg19	CCDS45839.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044878	0.93685	.	.	ENSG00000168234	ENST00000304621;ENST00000317571	T;T	0.54866	0.55;0.55	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.75561	0.3866	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77403	-0.2601	10	0.56958	D	0.05	-3.4008	19.3708	0.94484	0.0:0.0:1.0:0.0	.	65	Q8N584	TT39C_HUMAN	R	4;65	ENSP00000306598:G4R;ENSP00000323645:G65R	ENSP00000306598:G4R	G	+	1	0	TTC39C	19898127	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.368000	0.97152	2.580000	0.87095	0.650000	0.86243	GGA	.	.		0.313	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1	NM_153211	
WDR7	23335	hgsc.bcm.edu	37	18	54426112	54426112	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr18:54426112A>G	ENST00000254442.3	+	16	2987	c.2776A>G	c.(2776-2778)Acc>Gcc	p.T926A	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.T926A	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	926					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TAGACCAAGCACCCCAGACCT	0.318																																					p.T926A		Atlas-SNP	.											.	WDR7	166	.	0			c.A2776G						.						63.0	66.0	65.0					18																	54426112		2203	4300	6503	SO:0001583	missense	23335	exon16			CCAAGCACCCCAG	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2776A>G	chr18.hg19:g.54426112A>G	ENSP00000254442:p.Thr926Ala	81.0	0.0		70.0	10.0	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	hg19	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	A	13.89	2.370610	0.42003	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.66815	-0.22;-0.23	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.45438	0.1342	N	0.11427	0.14	0.47659	D	0.999489	B;B	0.26363	0.143;0.147	B;B	0.22152	0.028;0.038	T	0.44221	-0.9342	10	0.23891	T	0.37	.	11.3973	0.49849	0.865:0.0:0.0:0.135	.	926;926	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	A	926;926;251;926	ENSP00000254442:T926A;ENSP00000350187:T926A	ENSP00000254442:T926A	T	+	1	0	WDR7	52577110	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.485000	0.66850	2.326000	0.78906	0.533000	0.62120	ACC	.	.		0.318	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
ZNF781	163115	hgsc.bcm.edu	37	19	38160324	38160324	+	Silent	SNP	C	C	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr19:38160324C>A	ENST00000590008.1	-	5	1578	c.726G>T	c.(724-726)ctG>ctT	p.L242L	ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000593040.1_5'Flank|ZNF781_ENST00000358582.4_Silent_p.L242L			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						CTATTAAAATCAGAAACACAA	0.353																																					p.L242L		Atlas-SNP	.											.	ZNF781	66	.	0			c.G726T						.						59.0	63.0	61.0					19																	38160324		2203	4300	6503	SO:0001819	synonymous_variant	163115	exon4			TAAAATCAGAAAC	AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.726G>T	chr19.hg19:g.38160324C>A		55.0	0.0		72.0	41.0	NM_152605	Q2VPJ8	Silent	SNP	ENST00000590008.1	hg19	CCDS12507.1																																																																																			.	.		0.353	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605	
YIF1B	90522	hgsc.bcm.edu	37	19	38798281	38798281	+	Silent	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr19:38798281G>T	ENST00000339413.6	-	6	696	c.651C>A	c.(649-651)ctC>ctA	p.L217L	YIF1B_ENST00000591755.1_Silent_p.L214L|YIF1B_ENST00000329420.8_Silent_p.L202L|YIF1B_ENST00000592246.1_Silent_p.L151L|YIF1B_ENST00000592694.1_Silent_p.L186L|YIF1B_ENST00000392124.3_Silent_p.L186L|YIF1B_ENST00000587361.1_5'Flank|YIF1B_ENST00000591784.1_Silent_p.L186L|YIF1B_ENST00000337679.8_Silent_p.L214L	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	217						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CGATGGTGGTGAGGTCGGTGT	0.632																																					p.L217L		Atlas-SNP	.											.	YIF1B	47	.	0			c.C651A						.						96.0	86.0	89.0					19																	38798281		2203	4300	6503	SO:0001819	synonymous_variant	90522	exon6			GGTGGTGAGGTCG	AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.651C>A	chr19.hg19:g.38798281G>T		144.0	0.0		142.0	7.0	NM_001039672	H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Silent	SNP	ENST00000339413.6	hg19	CCDS33010.1																																																																																			.	.		0.632	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460511.1	NM_033557	
SLC8A2	6543	hgsc.bcm.edu	37	19	47951333	47951333	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr19:47951333C>T	ENST00000236877.6	-	4	1891	c.1496G>A	c.(1495-1497)gGc>gAc	p.G499D	SLC8A2_ENST00000539381.1_Intron|SLC8A2_ENST00000542837.1_Missense_Mutation_p.G255D|SLC8A2_ENST00000601757.1_5'Flank	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	499					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GGGCCGCCCGCCGCCGTCCGG	0.682																																					p.G499D		Atlas-SNP	.											.	SLC8A2	77	.	0			c.G1496A						.						11.0	12.0	12.0					19																	47951333		2162	4213	6375	SO:0001583	missense	6543	exon4			CGCCCGCCGCCGT	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.1496G>A	chr19.hg19:g.47951333C>T	ENSP00000236877:p.Gly499Asp	96.0	0.0		117.0	44.0	NM_015063	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	hg19	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768777	0.31320	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000542837	T;T	0.37752	1.32;1.18	4.05	4.05	0.47172	.	0.384236	0.23427	N	0.048300	T	0.21881	0.0527	L	0.34521	1.04	0.80722	D	1	B;B	0.30763	0.294;0.038	B;B	0.22152	0.038;0.016	T	0.06698	-1.0812	10	0.34782	T	0.22	.	5.9322	0.19144	0.0:0.6986:0.1968:0.1045	.	327;499	E9PGS7;Q9UPR5	.;NAC2_HUMAN	D	327;499;255	ENSP00000236877:G499D;ENSP00000437536:G255D	ENSP00000236877:G499D	G	-	2	0	SLC8A2	52643145	0.000000	0.05858	1.000000	0.80357	0.317000	0.28152	0.416000	0.21198	2.259000	0.74868	0.561000	0.74099	GGC	.	.		0.682	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
RRBP1	6238	hgsc.bcm.edu	37	20	17640636	17640636	+	Missense_Mutation	SNP	C	C	A	rs141391805		TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr20:17640636C>A	ENST00000377813.1	-	3	820	c.517G>T	c.(517-519)Gct>Tct	p.A173S	RRBP1_ENST00000246043.4_Missense_Mutation_p.A173S|RRBP1_ENST00000377807.2_Missense_Mutation_p.A173S|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000360807.4_Missense_Mutation_p.A173S			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	173					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TCCTTGGGAGCAGTTTCCAAG	0.547																																					p.A173S		Atlas-SNP	.											.	RRBP1	157	.	0			c.G517T						.						61.0	50.0	54.0					20																	17640636		2203	4300	6503	SO:0001583	missense	6238	exon2			TGGGAGCAGTTTC	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.517G>T	chr20.hg19:g.17640636C>A	ENSP00000367044:p.Ala173Ser	70.0	0.0		77.0	29.0	NM_004587	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	hg19		.	.	.	.	.	.	.	.	.	.	C	4.214	0.038548	0.08148	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000398782	T;T;T;T	0.48836	0.8;1.87;0.8;1.87	4.73	-0.274	0.12910	.	0.524045	0.14343	N	0.325611	T	0.26955	0.0660	L	0.36672	1.1	0.25708	N	0.985518	B	0.15473	0.013	B	0.09377	0.004	T	0.17379	-1.0371	10	0.13853	T	0.58	-1.0574	1.5506	0.02574	0.3093:0.3157:0.2281:0.1469	.	173	Q9P2E9-3	.	S	173	ENSP00000354045:A173S;ENSP00000367044:A173S;ENSP00000367038:A173S;ENSP00000246043:A173S	ENSP00000246043:A173S	A	-	1	0	RRBP1	17588636	0.388000	0.25197	0.005000	0.12908	0.034000	0.12701	0.973000	0.29422	-0.217000	0.10033	-0.311000	0.09066	GCT	.	C|1.000;T|0.000		0.547	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
N6AMT1	29104	hgsc.bcm.edu	37	21	30257545	30257545	+	Silent	SNP	G	G	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr21:30257545G>T	ENST00000303775.5	-	1	148	c.123C>A	c.(121-123)gcC>gcA	p.A41A	N6AMT1_ENST00000351429.3_Silent_p.A41A	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	41					positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						CTGCCAGTTCGGCAGCCGCTG	0.672																																					p.A41A		Atlas-SNP	.											.	N6AMT1	31	.	0			c.C123A						.						45.0	59.0	54.0					21																	30257545		2195	4276	6471	SO:0001819	synonymous_variant	29104	exon1			CAGTTCGGCAGCC	AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.123C>A	chr21.hg19:g.30257545G>T		191.0	0.0		226.0	15.0	NM_182749	Q96F73	Silent	SNP	ENST00000303775.5	hg19	CCDS33526.1																																																																																			.	.		0.672	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171738.1	NM_013240	
HUWE1	10075	hgsc.bcm.edu	37	X	53603872	53603872	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chrX:53603872C>T	ENST00000342160.3	-	43	6329	c.5872G>A	c.(5872-5874)Gct>Act	p.A1958T	HUWE1_ENST00000262854.6_Missense_Mutation_p.A1958T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1958					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCCTCTGGAGCATGGTATGCA	0.507																																					p.A1958T		Atlas-SNP	.											.	HUWE1	724	.	0			c.G5872A						.						85.0	65.0	72.0					X																	53603872		2203	4300	6503	SO:0001583	missense	10075	exon44			CTGGAGCATGGTA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5872G>A	chrX.hg19:g.53603872C>T	ENSP00000340648:p.Ala1958Thr	85.0	0.0		85.0	70.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.8|22.8	4.330857|4.330857	0.81690|0.81690	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.37584|.	1.19;1.19|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55257|0.55257	0.1909|0.1909	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.993;0.996|.	D;D|.	0.79784|.	0.971;0.993|.	T|T	0.50215|0.50215	-0.8854|-0.8854	10|5	0.02654|.	T|.	1|.	.|.	17.9896|17.9896	0.89164|0.89164	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1958;1958|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	T|Y	1958|991	ENSP00000340648:A1958T;ENSP00000262854:A1958T|.	ENSP00000262854:A1958T|.	A|C	-|-	1|2	0|0	HUWE1|HUWE1	53620597|53620597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.435000|7.435000	0.80391|0.80391	2.524000|2.524000	0.85096|0.85096	0.600000|0.600000	0.82982|0.82982	GCT|TGC	.	.		0.507	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
RGAG1	57529	hgsc.bcm.edu	37	X	109697300	109697300	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chrX:109697300T>C	ENST00000465301.2	+	3	3701	c.3455T>C	c.(3454-3456)tTa>tCa	p.L1152S	RGAG1_ENST00000540313.1_Missense_Mutation_p.L1152S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1152										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TGCTACCTCTTAGAAGAGCAG	0.522																																					p.L1152S		Atlas-SNP	.											.	RGAG1	168	.	0			c.T3455C						.						110.0	102.0	105.0					X																	109697300		2203	4300	6503	SO:0001583	missense	57529	exon3			ACCTCTTAGAAGA	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3455T>C	chrX.hg19:g.109697300T>C	ENSP00000419786:p.Leu1152Ser	178.0	0.0		258.0	21.0	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	hg19	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.824757	0.50739	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.60548	0.18;0.18	4.26	4.26	0.50523	.	0.000000	0.31554	N	0.007452	T	0.60766	0.2294	L	0.29908	0.895	0.32317	N	0.562871	D	0.89917	1.0	D	0.87578	0.998	T	0.64993	-0.6276	9	.	.	.	-11.8684	8.7451	0.34580	0.0:0.0:0.0:1.0	.	1152	Q8NET4	RGAG1_HUMAN	S	1152;1152;713	ENSP00000419786:L1152S;ENSP00000441452:L1152S	.	L	+	2	0	RGAG1	109583956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.552000	0.53705	1.885000	0.54596	0.486000	0.48141	TTA	.	.		0.522	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
MT-ND5	4540	hgsc.bcm.edu	37	M	13333	13333	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chrM:13333G>A	ENST00000361567.2	+	1	997	c.997G>A	c.(997-999)Gcc>Acc	p.A333T	MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	333					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCTGTACCCACGCCTTCTTCA	0.418																																					p.A333T		Atlas-SNP	.											.	.	.	.	0			c.G997A						.																																			SO:0001583	missense	0	exon1			ACCCACGCCTTCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.997G>A	chrM.hg19:g.13333G>A	ENSP00000354813:p.Ala333Thr	18.0	0.0		29.0	29.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.418	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-ND6	4541	hgsc.bcm.edu	37	M	14603	14603	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chrM:14603G>A	ENST00000361681.2	-	1	70	c.71C>T	c.(70-72)tCt>tTt	p.S24F	MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	24					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CATAAATAGGAGAAGGCTTAG	0.403																																					p.S24F		Atlas-SNP	.											.	.	.	.	0			c.C71T						.																																			SO:0001583	missense	0	exon1			ATAGGAGAAGGCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.71C>T	chrM.hg19:g.14603G>A	ENSP00000354665:p.Ser24Phe	149.0	0.0		197.0	181.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.403	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
TULP4	56995	hgsc.bcm.edu	37	6	158922879	158922890	+	In_Frame_Del	DEL	GACAGCTGTAGG	GACAGCTGTAGG	-	rs377659848		TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	GACAGCTGTAGG	GACAGCTGTAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr6:158922879_158922890delGACAGCTGTAGG	ENST00000367097.3	+	13	3541_3552	c.2184_2195delGACAGCTGTAGG	c.(2182-2196)acgacagctgtaggg>acg	p.TAVG729del	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	729					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CCAACCAGACGACAGCTGTAGGGACAGCAGAA	0.575																																					p.728_732del		Atlas-INDEL	.											TULP4,NS,carcinoma,0,1	TULP4	137	.	0			c.2183_2194del						.																																			SO:0001651	inframe_deletion	56995	exon13			.		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2184_2195delGACAGCTGTAGG	chr6.hg19:g.158922879_158922890delGACAGCTGTAGG	ENSP00000356064:p.Thr729_Gly732del	105.0	0.0		97.0	27.0	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	In_Frame_Del	DEL	ENST00000367097.3	hg19	CCDS34561.1																																																																																			.	.		0.575	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
ZFHX4	79776	hgsc.bcm.edu	37	8	77763751	77763752	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr8:77763751_77763752insAA	ENST00000521891.2	+	10	5042_5043	c.4594_4595insAA	c.(4594-4596)gaafs	p.E1532fs	ZFHX4_ENST00000050961.6_Frame_Shift_Ins_p.E1487fs|ZFHX4_ENST00000518282.1_Frame_Shift_Ins_p.E1506fs|ZFHX4_ENST00000455469.2_Frame_Shift_Ins_p.E1487fs	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTTTACGATGGAAAAATTCCTT	0.406										HNSCC(33;0.089)																											p.E1532fs		Atlas-INDEL	.											.	ZFHX4	878	.	0			c.4594_4595insAA						.																																			SO:0001589	frameshift_variant	79776	exon10			.		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4597_4598dupAA	chr8.hg19:g.77763754_77763755dupAA	ENSP00000430497:p.Glu1532fs	176.0	0.0		167.0	18.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Frame_Shift_Ins	INS	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.		0.406	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
RB1	5925	hgsc.bcm.edu	37	13	48878060	48878103	+	Frame_Shift_Del	DEL	AACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	AACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	-	rs564137727|rs587778638|rs564059250|rs530961288|rs572454921|rs148980395|rs587778852|rs528218090	byFrequency	TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	AACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	AACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr13:48878060_48878103delAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	ENST00000267163.4	+	1	150_193	c.12_55delAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	c.(10-57)aaaaccccccgaaaaacggccgccaccgccgccgctgccgccgcggaafs	p.TPRKTAATAAAAAAE5fs	LINC00441_ENST00000433480.2_lincRNA	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	5					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.A14A(1)|p.?(1)|p.A16fs*3(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGCCGCCCAAAACCCCCCGAAAAACGgccgccaccgccgccgctgccgccgcggaacccccggc	0.762		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.4_18del		Atlas-INDEL	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	18	Whole gene deletion(15)|Unknown(1)|Substitution - coding silent(1)|Deletion - Frameshift(1)	bone(10)|eye(2)|breast(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	c.11_54del	GRCh37	CD067560|CD071388|CI030631|CX034947	RB1	D|I|X		.																																			SO:0001589	frameshift_variant	5925	exon1	Familial Cancer Database		.	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.12_55delAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	chr13.hg19:g.48878060_48878103delAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGG	ENSP00000267163:p.Thr5fs	977.0	0.0		429.0	235.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	hg19	CCDS31973.1																																																																																			.	.		0.762	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
SERPINE2	5270	hgsc.bcm.edu	37	2	224847396	224847399	+	Splice_Site	DEL	TACT	TACT	-			TCGA-DD-AADW-01A-11D-A38X-10	TCGA-DD-AADW-10A-01D-A38X-10	TACT	TACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	40648214-724a-4710-b3d8-5ec9cd6d5fe9	d1383588-3279-4d21-b931-75e2df11adc8	g.chr2:224847396_224847399delTACT	ENST00000258405.4	-	6	1226_1228	c.984_986delAGTA	c.(982-987)acagta>aca	p.V329fs	SERPINE2_ENST00000447280.2_Splice_Site_p.V341fs|SERPINE2_ENST00000409840.3_Splice_Site_p.V329fs|SERPINE2_ENST00000409304.1_Splice_Site_p.V329fs	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	329					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AATTGAACATACTTGTTATTTTTG	0.353																																					.		Atlas-INDEL	.											.	SERPINE2	103	.	0			.						.																																			SO:0001630	splice_region_variant	5270	.			.	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.985+1AGTA>-	chr2.hg19:g.224847396_224847399delTACT		79.0	0.0		92.0	14.0	.	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Splice_Site	DEL	ENST00000258405.4	hg19	CCDS2460.1																																																																																			.	.		0.353	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	Frame_Shift_Del
