#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FBXO42	54455	hgsc.bcm.edu	37	1	16579610	16579610	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:16579610C>T	ENST00000375592.3	-	8	1118	c.902G>A	c.(901-903)gGg>gAg	p.G301E		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	301										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		ACCGCCACACCCTCCGAGGAT	0.438																																					p.G301E		Atlas-SNP	.											.	FBXO42	53	.	0			c.G902A						.						66.0	59.0	61.0					1																	16579610		2203	4300	6503	SO:0001583	missense	54455	exon8			CCACACCCTCCGA	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.902G>A	chr1.hg19:g.16579610C>T	ENSP00000364742:p.Gly301Glu	173.0	0.0		316.0	16.0	NM_018994	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	ENST00000375592.3	hg19	CCDS30613.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762432	0.89932	.	.	ENSG00000037637	ENST00000375592;ENST00000456164;ENST00000444116	D;D;D	0.95821	-3.46;-3.82;-3.82	5.86	5.86	0.93980	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97574	1.0106	10	0.56958	D	0.05	-12.7863	19.1901	0.93663	0.0:1.0:0.0:0.0	.	301	Q6P3S6	FBX42_HUMAN	E	301;19;19	ENSP00000364742:G301E;ENSP00000415663:G19E;ENSP00000412416:G19E	ENSP00000364742:G301E	G	-	2	0	FBXO42	16452197	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.456000	0.73501	2.776000	0.95493	0.655000	0.94253	GGG	.	.		0.438	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
AKR7A3	22977	hgsc.bcm.edu	37	1	19612450	19612450	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:19612450C>A	ENST00000361640.4	-	3	979	c.439G>T	c.(439-441)Gcc>Tcc	p.A147S		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	147					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ACTTCCCAGGCTGCATAGTTG	0.607																																					p.A147S		Atlas-SNP	.											.	AKR7A3	30	.	0			c.G439T						.						71.0	66.0	67.0					1																	19612450		2199	4300	6499	SO:0001583	missense	22977	exon3			CCCAGGCTGCATA	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.439G>T	chr1.hg19:g.19612450C>A	ENSP00000355377:p.Ala147Ser	135.0	0.0		180.0	68.0	NM_012067	Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Missense_Mutation	SNP	ENST00000361640.4	hg19	CCDS193.1	.	.	.	.	.	.	.	.	.	.	.	2.427	-0.331643	0.05314	.	.	ENSG00000162482	ENST00000361640	T	0.04970	3.52	3.04	-6.08	0.02151	NADP-dependent oxidoreductase domain (3);	0.311843	0.35096	N	0.003451	T	0.05547	0.0146	L	0.38175	1.15	0.27070	N	0.963339	B	0.18013	0.025	B	0.38655	0.278	T	0.39210	-0.9625	10	0.25751	T	0.34	.	6.815	0.23824	0.5751:0.3173:0.0:0.1076	.	147	O95154	ARK73_HUMAN	S	147	ENSP00000355377:A147S	ENSP00000355377:A147S	A	-	1	0	AKR7A3	19485037	0.001000	0.12720	0.350000	0.25708	0.116000	0.19942	-0.119000	0.10676	-1.111000	0.02988	-1.031000	0.02408	GCC	.	.		0.607	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067	
CHRNB2	1141	hgsc.bcm.edu	37	1	154548297	154548297	+	Silent	SNP	T	T	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:154548297T>C	ENST00000368476.3	+	6	1662	c.1398T>C	c.(1396-1398)ttT>ttC	p.F466F		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	466					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	TCTGGATCTTTGTCTTTGTCT	0.567																																					p.F466F		Atlas-SNP	.											.	CHRNB2	74	.	0			c.T1398C						.						337.0	243.0	275.0					1																	154548297		2203	4300	6503	SO:0001819	synonymous_variant	1141	exon6			GATCTTTGTCTTT	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1398T>C	chr1.hg19:g.154548297T>C		61.0	0.0		120.0	33.0	NM_000748	Q9UEH9	Silent	SNP	ENST00000368476.3	hg19	CCDS1070.1																																																																																			.	.		0.567	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
AXDND1	126859	hgsc.bcm.edu	37	1	179504037	179504037	+	Missense_Mutation	SNP	G	G	C	rs200097954|rs368406759|rs6425573	byFrequency	TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:179504037G>C	ENST00000367618.3	+	25	3358	c.2971G>C	c.(2971-2973)Gaa>Caa	p.E991Q		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	991	Glu-rich.		E -> Q (in dbSNP:rs6425573).					p.E991_Q992delEQ(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agaagaagaagaacaacaaga	0.318													G|||	14	0.00279553	0.0	0.0058	5008	,	,		17137	0.002		0.004	False		,,,				2504	0.0041				p.E991Q		Atlas-SNP	.											.	AXDND1	142	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.G2971C						.						49.0	51.0	50.0					1																	179504037		2152	4286	6438	SO:0001583	missense	126859	exon25			GAAGAAGAACAAC	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2971G>C	chr1.hg19:g.179504037G>C	ENSP00000356590:p.Glu991Gln	332.0	0.0		583.0	31.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	G	9.300	1.052898	0.19907	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.19105	2.17;2.17	4.89	-6.02	0.02192	.	0.508747	0.16499	N	0.211773	T	0.08980	0.0222	N	0.24115	0.695	0.09310	N	1	B;B	0.24186	0.099;0.099	B;B	0.10450	0.003;0.005	T	0.15838	-1.0423	10	0.28530	T	0.3	-2.8152	6.1976	0.20557	0.4456:0.3814:0.173:0.0	rs6425573	875;991	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	Q	991;875;851	ENSP00000356590:E991Q;ENSP00000391716:E851Q	ENSP00000353471:E875Q	E	+	1	0	AXDND1	177770660	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.365000	0.20348	-1.164000	0.02790	-1.047000	0.02352	GAA	.	G|1.000;|0.000		0.318	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
FMN2	56776	hgsc.bcm.edu	37	1	240371477	240371477	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:240371477C>T	ENST00000319653.9	+	5	3595	c.3365C>T	c.(3364-3366)cCc>cTc	p.P1122L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1122	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCCCTCCTCCCCCTCTACCC	0.721																																					p.P1122L		Atlas-SNP	.											.	FMN2	451	.	0			c.C3365T						.						8.0	10.0	9.0					1																	240371477		2102	4124	6226	SO:0001583	missense	56776	exon5			CTCCTCCCCCTCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3365C>T	chr1.hg19:g.240371477C>T	ENSP00000318884:p.Pro1122Leu	87.0	0.0		136.0	42.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	c	10.27	1.302837	0.23736	.	.	ENSG00000155816	ENST00000319653	T	0.65549	-0.16	3.11	2.17	0.27698	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	0.226724	0.29987	U	0.010689	T	0.68256	0.2981	M	0.90369	3.11	0.80722	D	1	P	0.35714	0.517	B	0.40565	0.333	T	0.68224	-0.5465	9	.	.	.	.	9.1994	0.37249	0.0:0.8851:0.0:0.1149	.	1122	Q9NZ56	FMN2_HUMAN	L	1122	ENSP00000318884:P1122L	.	P	+	2	0	FMN2	238438100	0.882000	0.30256	0.003000	0.11579	0.007000	0.05969	4.731000	0.62022	0.639000	0.30564	0.484000	0.47621	CCC	.	.		0.721	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
CHML	1122	hgsc.bcm.edu	37	1	241798135	241798135	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:241798135C>T	ENST00000366553.1	-	1	1097	c.934G>A	c.(934-936)Gat>Aat	p.D312N	OPN3_ENST00000331838.5_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	312					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TGGTATTCATCAGGATGTTGT	0.348																																					p.D312N		Atlas-SNP	.											.	CHML	82	.	0			c.G934A						.						97.0	97.0	97.0					1																	241798135		2203	4299	6502	SO:0001583	missense	1122	exon1			ATTCATCAGGATG	X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.934G>A	chr1.hg19:g.241798135C>T	ENSP00000355511:p.Asp312Asn	109.0	0.0		197.0	78.0	NM_001821	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	hg19	CCDS31073.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.534808	0.27475	.	.	ENSG00000203668	ENST00000366553	D	0.84873	-1.91	4.96	4.05	0.47172	.	1.245710	0.05436	U	0.546919	T	0.81475	0.4830	.	.	.	0.38070	D	0.93635	B	0.06786	0.001	B	0.12156	0.007	T	0.65565	-0.6137	9	0.45353	T	0.12	-0.6382	11.5362	0.50639	0.0:0.9128:0.0:0.0872	.	312	P26374	RAE2_HUMAN	N	312	ENSP00000355511:D312N	ENSP00000355511:D312N	D	-	1	0	CHML	239864758	1.000000	0.71417	0.980000	0.43619	0.465000	0.32709	3.089000	0.50183	1.468000	0.48064	0.655000	0.94253	GAT	.	.		0.348	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821	
PSME4	23198	hgsc.bcm.edu	37	2	54163923	54163923	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr2:54163923T>A	ENST00000404125.1	-	6	792	c.737A>T	c.(736-738)cAa>cTa	p.Q246L	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	246					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGGGAGATTTTGCACTGAAAC	0.368																																					p.Q246L		Atlas-SNP	.											.	PSME4	247	.	0			c.A737T						.						112.0	120.0	117.0					2																	54163923		2203	4300	6503	SO:0001583	missense	23198	exon6			AGATTTTGCACTG	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.737A>T	chr2.hg19:g.54163923T>A	ENSP00000384211:p.Gln246Leu	469.0	0.0		646.0	249.0	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	hg19	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	13.41	2.227961	0.39399	.	.	ENSG00000068878	ENST00000404125	T	0.23147	1.92	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.22859	0.0552	L	0.42245	1.32	0.80722	D	1	B	0.29115	0.233	B	0.22601	0.04	T	0.02736	-1.1117	10	0.34782	T	0.22	.	14.9019	0.70687	0.0:0.0:0.0:1.0	.	246	Q14997	PSME4_HUMAN	L	246	ENSP00000384211:Q246L	ENSP00000374643:Q246L	Q	-	2	0	PSME4	54017427	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	7.831000	0.86748	1.931000	0.55961	0.254000	0.18369	CAA	.	.		0.368	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
RFX8	731220	hgsc.bcm.edu	37	2	102018902	102018902	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr2:102018902T>C	ENST00000376826.2	-	14	1579	c.1580A>G	c.(1579-1581)aAt>aGt	p.N527S	RFX8_ENST00000428343.1_Missense_Mutation_p.N414S			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						CCCTACCTTATTGCCCATGGC	0.547																																					p.N414S		Atlas-SNP	.											.	RFX8	16	.	0			c.A1241G						.						31.0	31.0	31.0					2																	102018902		692	1591	2283	SO:0001583	missense	731220	exon11			ACCTTATTGCCCA	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1580A>G	chr2.hg19:g.102018902T>C	ENSP00000366022:p.Asn527Ser	86.0	0.0		119.0	8.0	NM_001145664	B4DQ32	Missense_Mutation	SNP	ENST00000376826.2	hg19		.	.	.	.	.	.	.	.	.	.	T	14.76	2.632386	0.46944	.	.	ENSG00000196460	ENST00000376826;ENST00000428343	T;T	0.80123	-1.34;0.67	4.7	4.7	0.59300	.	0.430596	0.22113	N	0.064441	T	0.67757	0.2927	L	0.32530	0.975	0.80722	D	1	P;B	0.36535	0.557;0.025	B;B	0.31101	0.124;0.031	T	0.67711	-0.5600	10	0.34782	T	0.22	-5.6268	10.7183	0.46026	0.0:0.0:0.0:1.0	.	414;527	Q6ZV50-3;Q6ZV50	.;RFX8_HUMAN	S	527;414	ENSP00000366022:N527S;ENSP00000401536:N414S	ENSP00000366022:N527S	N	-	2	0	RFX8	101385334	0.992000	0.36948	0.976000	0.42696	0.939000	0.58152	0.807000	0.27140	2.102000	0.63906	0.334000	0.21626	AAT	.	.		0.547	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
ARHGEF4	50649	hgsc.bcm.edu	37	2	131785570	131785570	+	Silent	SNP	C	C	T	rs372979735		TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr2:131785570C>T	ENST00000326016.5	+	5	999	c.480C>T	c.(478-480)agC>agT	p.S160S	ARHGEF4_ENST00000409303.1_Silent_p.S160S|ARHGEF4_ENST00000355771.3_Silent_p.S89S|ARHGEF4_ENST00000392953.3_Silent_p.S160S|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Silent_p.S160S	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	160					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.S160R(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		AAGTGGGGAGCGAGGAGGACC	0.632																																					p.S160S		Atlas-SNP	.											ARHGEF4,colon,carcinoma,0,2	ARHGEF4	89	.	1	Substitution - Missense(1)	ovary(1)	c.C480T						.	C	,	1,4405	2.1+/-5.4	0,1,2202	48.0	43.0	45.0		480,480	-4.5	0.7	2		45	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ARHGEF4	NM_015320.2,NM_032995.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	160/691,160/671	131785570	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	50649	exon5			GGGGAGCGAGGAG	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.480C>T	chr2.hg19:g.131785570C>T		144.0	0.0		121.0	76.0	NM_032995	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	hg19	CCDS2165.1																																																																																			.	.		0.632	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
NCL	4691	hgsc.bcm.edu	37	2	232320222	232320222	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr2:232320222C>A	ENST00000322723.4	-	13	2186	c.1946G>T	c.(1945-1947)gGt>gTt	p.G649V	SNORA75_ENST00000384158.1_RNA|SNORD20_ENST00000384550.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	649	Arg/Gly/Phe-rich.				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		GCCACCTTCACCCTTAGGTTT	0.577																																					p.G649V		Atlas-SNP	.											.	NCL	80	.	0			c.G1946T						.						206.0	218.0	214.0					2																	232320222		2203	4300	6503	SO:0001583	missense	4691	exon13			CCTTCACCCTTAG		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.1946G>T	chr2.hg19:g.232320222C>A	ENSP00000318195:p.Gly649Val	66.0	0.0		95.0	35.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436245	0.62955	.	.	ENSG00000115053	ENST00000322723;ENST00000392033;ENST00000322732;ENST00000356936	T;T	0.74632	0.76;-0.86	5.91	4.02	0.46733	Nucleotide-binding, alpha-beta plait (1);	0.102981	0.64402	D	0.000003	T	0.74313	0.3700	M	0.75777	2.31	0.80722	D	1	P	0.34462	0.454	B	0.37780	0.258	T	0.77024	-0.2741	10	0.72032	D	0.01	-14.0143	10.6857	0.45841	0.0:0.7966:0.1322:0.0713	.	649	P19338	NUCL_HUMAN	V	649;541;421;274	ENSP00000318195:G649V;ENSP00000349410:G274V	ENSP00000318195:G649V	G	-	2	0	NCL	232028466	1.000000	0.71417	0.972000	0.41901	0.903000	0.53119	4.492000	0.60334	1.524000	0.49035	-0.151000	0.13558	GGT	.	.		0.577	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
SLC22A14	9389	hgsc.bcm.edu	37	3	38354541	38354541	+	Silent	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr3:38354541G>A	ENST00000273173.4	+	5	1087	c.996G>A	c.(994-996)gaG>gaA	p.E332E	SLC22A14_ENST00000448498.1_Silent_p.E332E	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	332					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		AGGTGAAGGAGGCCAAGCAGG	0.582																																					p.E332E		Atlas-SNP	.											.	SLC22A14	64	.	0			c.G996A						.						70.0	66.0	68.0					3																	38354541		2203	4299	6502	SO:0001819	synonymous_variant	9389	exon5			GAAGGAGGCCAAG	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.996G>A	chr3.hg19:g.38354541G>A		94.0	0.0		163.0	60.0	NM_004803	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Silent	SNP	ENST00000273173.4	hg19	CCDS2677.1																																																																																			.	.		0.582	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3	NM_004803	
CYP8B1	1582	hgsc.bcm.edu	37	3	42917206	42917206	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr3:42917206G>T	ENST00000316161.4	-	1	427	c.103C>A	c.(103-105)Ctg>Atg	p.L35M	CYP8B1_ENST00000437102.1_Missense_Mutation_p.L35M|RP11-141M3.5_ENST00000471537.1_RNA|KRBOX1_ENST00000426937.1_Intron	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	35					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CCCTTGTCCAGAGGGGGCTCC	0.582																																					p.L35M		Atlas-SNP	.											CYP8B1,middle_lobe,carcinoma,0,1	CYP8B1	59	.	0			c.C103A						.						46.0	46.0	46.0					3																	42917206		2202	4300	6502	SO:0001583	missense	1582	exon1			TGTCCAGAGGGGG	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.103C>A	chr3.hg19:g.42917206G>T	ENSP00000318867:p.Leu35Met	52.0	0.0		113.0	83.0	NM_004391	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	hg19	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322754	0.60634	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.01335	5.0;5.0	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000003	T	0.08846	0.0219	M	0.85945	2.785	0.46654	D	0.999141	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.00050	-1.2196	10	0.87932	D	0	-15.5713	11.1275	0.48328	0.0891:0.0:0.9109:0.0	.	35;35	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	M	35	ENSP00000404499:L35M;ENSP00000318867:L35M	ENSP00000318867:L35M	L	-	1	2	CYP8B1	42892210	0.998000	0.40836	1.000000	0.80357	0.915000	0.54546	2.667000	0.46808	2.553000	0.86117	0.561000	0.74099	CTG	.	.		0.582	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391	
DHX30	22907	hgsc.bcm.edu	37	3	47882619	47882619	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr3:47882619T>G	ENST00000445061.1	+	7	1026	c.619T>G	c.(619-621)Ttc>Gtc	p.F207V	DHX30_ENST00000348968.4_Missense_Mutation_p.F179V|DHX30_ENST00000457607.1_Missense_Mutation_p.F235V|DHX30_ENST00000446256.2_Missense_Mutation_p.F168V	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	207						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TGTTACCGACTTCTTGTCCAT	0.587																																					p.F207V		Atlas-SNP	.											.	DHX30	101	.	0			c.T619G						.						57.0	58.0	58.0					3																	47882619		2203	4300	6503	SO:0001583	missense	22907	exon7			ACCGACTTCTTGT	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.619T>G	chr3.hg19:g.47882619T>G	ENSP00000405620:p.Phe207Val	95.0	0.0		173.0	67.0	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	hg19	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	T	14.45	2.539589	0.45176	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03330	4.02;4.0;4.01;3.97	5.17	3.99	0.46301	.	0.256592	0.34088	N	0.004268	T	0.04003	0.0112	L	0.36672	1.1	0.33815	D	0.628325	B;B;B	0.12013	0.005;0.001;0.001	B;B;B	0.12156	0.007;0.003;0.003	T	0.12941	-1.0528	10	0.46703	T	0.11	.	10.1475	0.42774	0.0:0.0:0.168:0.832	.	207;168;235	Q7L2E3;Q7L2E3-3;Q7L2E3-2	DHX30_HUMAN;.;.	V	168;207;179;235	ENSP00000392601:F168V;ENSP00000405620:F207V;ENSP00000343442:F179V;ENSP00000394682:F235V	ENSP00000343442:F179V	F	+	1	0	DHX30	47857623	0.999000	0.42202	0.897000	0.35233	0.966000	0.64601	4.753000	0.62183	0.777000	0.33496	0.533000	0.62120	TTC	.	.		0.587	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
STAB1	23166	hgsc.bcm.edu	37	3	52535661	52535661	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr3:52535661G>C	ENST00000321725.6	+	3	299	c.223G>C	c.(223-225)Gta>Cta	p.V75L		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	75					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CAGCTACGAAGTACAGCTGGG	0.657																																					p.V75L		Atlas-SNP	.											.	STAB1	178	.	0			c.G223C						.						13.0	15.0	14.0					3																	52535661		2174	4264	6438	SO:0001583	missense	23166	exon3			TACGAAGTACAGC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.223G>C	chr3.hg19:g.52535661G>C	ENSP00000312946:p.Val75Leu	124.0	0.0		186.0	57.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	hg19	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	1.872	-0.459981	0.04508	.	.	ENSG00000010327	ENST00000321725	T	0.02787	4.16	4.72	1.69	0.24217	.	0.283555	0.27912	N	0.017360	T	0.01592	0.0051	N	0.13043	0.29	0.29746	N	0.836693	B;B	0.25169	0.084;0.119	B;B	0.24269	0.033;0.052	T	0.44406	-0.9330	10	0.13470	T	0.59	-6.2017	5.372	0.16144	0.0992:0.0:0.5353:0.3655	.	75;75	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	L	75	ENSP00000312946:V75L	ENSP00000312946:V75L	V	+	1	0	STAB1	52510701	1.000000	0.71417	0.987000	0.45799	0.587000	0.36485	2.189000	0.42621	0.387000	0.25024	0.563000	0.77884	GTA	.	.		0.657	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
HGFAC	3083	hgsc.bcm.edu	37	4	3446146	3446146	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr4:3446146G>A	ENST00000382774.3	+	6	822	c.707G>A	c.(706-708)tGg>tAg	p.W236*	HGFAC_ENST00000511533.1_Nonsense_Mutation_p.W236*	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	236	Fibronectin type-I. {ECO:0000255|PROSITE- ProRule:PRU00478}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GGCCGGACCTGGTGCGAAGGC	0.687																																					p.W236X		Atlas-SNP	.											.	HGFAC	69	.	0			c.G707A						.						10.0	12.0	12.0					4																	3446146		2171	4278	6449	SO:0001587	stop_gained	3083	exon6			GGACCTGGTGCGA	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.707G>A	chr4.hg19:g.3446146G>A	ENSP00000372224:p.Trp236*	150.0	0.0		215.0	75.0	NM_001528	Q14726|Q2M1W7|Q53X47	Nonsense_Mutation	SNP	ENST00000382774.3	hg19	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476004	0.44044	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	.	.	.	3.74	-4.02	0.04034	.	1.599760	0.03691	N	0.247004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	6.4023	0.21646	0.6164:0.1521:0.2316:0.0	.	.	.	.	X	236	.	ENSP00000372224:W236X	W	+	2	0	HGFAC	3415944	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.581000	0.05820	-0.599000	0.05798	-0.362000	0.07510	TGG	.	.		0.687	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
KIT	3815	hgsc.bcm.edu	37	4	55573355	55573355	+	Silent	SNP	A	A	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr4:55573355A>T	ENST00000288135.5	+	6	1114	c.1017A>T	c.(1015-1017)gcA>gcT	p.A339A		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	339	Ig-like C2-type 4.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATATGAAGCATTCCCCAAAC	0.343		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.A339A		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.A1017T						.						108.0	97.0	101.0					4																	55573355		2203	4300	6503	SO:0001819	synonymous_variant	3815	exon6	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TGAAGCATTCCCC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1017A>T	chr4.hg19:g.55573355A>T		237.0	0.0		347.0	141.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	ENST00000288135.5	hg19	CCDS3496.1																																																																																			.	.		0.343	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
DCHS2	54798	hgsc.bcm.edu	37	4	155411569	155411569	+	Silent	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr4:155411569G>A	ENST00000339452.1	-	1	1299	c.939C>T	c.(937-939)gcC>gcT	p.A313A	DCHS2_ENST00000443500.1_Silent_p.A313A|DCHS2_ENST00000456341.2_Silent_p.A306A	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1495	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GACAGACCTCGGCGCCCGGCT	0.731																																					p.A313A		Atlas-SNP	.											.	DCHS2	594	.	0			c.C939T						.						3.0	5.0	5.0					4																	155411569		614	1444	2058	SO:0001819	synonymous_variant	54798	exon1			GACCTCGGCGCCC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.939C>T	chr4.hg19:g.155411569G>A		32.0	0.0		52.0	21.0	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000339452.1	hg19	CCDS47150.1																																																																																			.	.		0.731	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
C5orf42	65250	hgsc.bcm.edu	37	5	37224832	37224832	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr5:37224832G>T	ENST00000508244.1	-	12	2395	c.2302C>A	c.(2302-2304)Ctc>Atc	p.L768I	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Missense_Mutation_p.L768I			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	768						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ATTCTCCAGAGAATAAGCAAT	0.328																																					p.L768I		Atlas-SNP	.											.	C5orf42	422	.	0			c.C2302A						.						155.0	127.0	135.0					5																	37224832		692	1591	2283	SO:0001583	missense	65250	exon13			TCCAGAGAATAAG		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2302C>A	chr5.hg19:g.37224832G>T	ENSP00000421690:p.Leu768Ile	123.0	0.0		137.0	15.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239270	0.58995	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.27402	1.67;1.67	5.58	4.7	0.59300	.	0.103529	0.40818	U	0.001020	T	0.50137	0.1598	M	0.73598	2.24	0.80722	D	1	D	0.65815	0.995	P	0.60415	0.874	T	0.49844	-0.8896	10	0.36615	T	0.2	-4.0837	13.4237	0.61013	0.0:0.1575:0.8425:0.0	.	768	E9PH94	.	I	768	ENSP00000421690:L768I;ENSP00000389014:L768I	ENSP00000389014:L768I	L	-	1	0	C5orf42	37260589	0.998000	0.40836	0.944000	0.38274	0.755000	0.42902	2.966000	0.49208	1.314000	0.45095	0.650000	0.86243	CTC	.	.		0.328	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
RICTOR	253260	hgsc.bcm.edu	37	5	39074458	39074458	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr5:39074458G>A	ENST00000357387.3	-	1	52	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C	RICTOR_ENST00000296782.5_Missense_Mutation_p.R8C	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TTCAGAGAGCGGCCGCGGCCG	0.697																																					p.R8C		Atlas-SNP	.											.	RICTOR	182	.	0			c.C22T						.						15.0	15.0	15.0					5																	39074458		1972	3885	5857	SO:0001583	missense	253260	exon1			GAGAGCGGCCGCG		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.22C>T	chr5.hg19:g.39074458G>A	ENSP00000349959:p.Arg8Cys	105.0	0.0		165.0	62.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	hg19	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552943	0.86127	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	T;T	0.55413	0.52;0.53	4.06	3.19	0.36642	.	0.179846	0.49916	D	0.000137	T	0.39009	0.1062	L	0.34521	1.04	0.58432	D	0.999999	B;B;D;B	0.60160	0.0;0.059;0.987;0.003	B;B;B;B	0.40741	0.001;0.005;0.339;0.001	T	0.35674	-0.9779	10	0.87932	D	0	-6.553	9.9823	0.41821	0.0972:0.0:0.9028:0.0	.	8;8;8;8	Q8N6M7;E7ETT0;Q6R327;Q6R327-3	.;.;RICTR_HUMAN;.	C	8	ENSP00000349959:R8C;ENSP00000296782:R8C	ENSP00000296782:R8C	R	-	1	0	RICTOR	39110215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.869000	0.75521	0.919000	0.36945	-0.214000	0.12660	CGC	.	.		0.697	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
PCDHA8	56140	hgsc.bcm.edu	37	5	140222700	140222700	+	Silent	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr5:140222700C>T	ENST00000531613.1	+	1	1794	c.1794C>T	c.(1792-1794)gaC>gaT	p.D598D	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.D598D|PCDHA5_ENST00000529859.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCAGTGGACGCCGACTCGG	0.687																																					p.D598D		Atlas-SNP	.											PCDHA8_ENST00000531613,NS,carcinoma,0,2	PCDHA8	366	.	0			c.C1794T						.						73.0	74.0	73.0					5																	140222700		2197	4265	6462	SO:0001819	synonymous_variant	56140	exon1			AGTGGACGCCGAC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1794C>T	chr5.hg19:g.140222700C>T		84.0	0.0		137.0	48.0	NM_031856	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	hg19	CCDS54919.1																																																																																			.	.		0.687	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
ARAP3	64411	hgsc.bcm.edu	37	5	141036195	141036195	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr5:141036195C>T	ENST00000239440.4	-	27	3730	c.3665G>A	c.(3664-3666)cGt>cAt	p.R1222H	ARAP3_ENST00000513878.1_Missense_Mutation_p.R884H|ARAP3_ENST00000508305.1_Missense_Mutation_p.R1053H|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1222					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TGGGCTCTCACGTCGGATACC	0.637																																					p.R1222H		Atlas-SNP	.											.	ARAP3	139	.	0			c.G3665A						.						25.0	25.0	25.0					5																	141036195		2203	4300	6503	SO:0001583	missense	64411	exon27			CTCTCACGTCGGA	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3665G>A	chr5.hg19:g.141036195C>T	ENSP00000239440:p.Arg1222His	114.0	0.0		209.0	67.0	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	hg19	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433504	0.83776	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.12569	2.67;2.67;2.67	5.64	5.64	0.86602	.	0.051053	0.85682	D	0.000000	T	0.32224	0.0822	L	0.47716	1.5	0.53688	D	0.99997	D;D;D	0.89917	0.99;1.0;0.996	P;D;P	0.70716	0.513;0.97;0.65	T	0.00331	-1.1811	10	0.40728	T	0.16	.	19.2624	0.93973	0.0:1.0:0.0:0.0	.	884;1053;1222	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	H	1053;1222;884	ENSP00000421826:R1053H;ENSP00000239440:R1222H;ENSP00000421468:R884H	ENSP00000239440:R1222H	R	-	2	0	ARAP3	141016379	0.938000	0.31826	0.993000	0.49108	0.970000	0.65996	5.229000	0.65316	2.662000	0.90505	0.591000	0.81541	CGT	.	.		0.637	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
OR10C1	442194	hgsc.bcm.edu	37	6	29408146	29408146	+	Silent	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr6:29408146C>T	ENST00000444197.2	+	1	1064	c.354C>T	c.(352-354)gcC>gcT	p.A118A	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CAGCCATGGCCTATGACCGCT	0.622																																					p.A118A		Atlas-SNP	.											.	OR10C1	58	.	0			c.C354T						.						67.0	71.0	70.0					6																	29408146		1510	2708	4218	SO:0001819	synonymous_variant	442194	exon1			CATGGCCTATGAC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.354C>T	chr6.hg19:g.29408146C>T		61.0	0.0		75.0	34.0	NM_013941	Q5SUN7|Q96R18	Silent	SNP	ENST00000444197.2	hg19	CCDS34364.1																																																																																			.	.		0.622	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
PTPRK	5796	hgsc.bcm.edu	37	6	128388773	128388773	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr6:128388773G>C	ENST00000368215.3	-	12	2047	c.2048C>G	c.(2047-2049)gCc>gGc	p.A683G	PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368210.3_Missense_Mutation_p.A683G|PTPRK_ENST00000368227.3_Missense_Mutation_p.A683G|PTPRK_ENST00000368226.4_Missense_Mutation_p.A683G|PTPRK_ENST00000532331.1_Missense_Mutation_p.A683G|PTPRK_ENST00000368213.5_Missense_Mutation_p.A683G|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000368207.3_Missense_Mutation_p.A683G			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	683					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A683V(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AGTGAACGGGGCAGGCTCAGG	0.537																																					p.A683G		Atlas-SNP	.											PTPRK,NS,neuroblastoma,0,1	PTPRK	330	.	1	Substitution - Missense(1)	autonomic_ganglia(1)	c.C2048G						.						105.0	102.0	103.0					6																	128388773		2203	4300	6503	SO:0001583	missense	5796	exon12			AACGGGGCAGGCT	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2048C>G	chr6.hg19:g.128388773G>C	ENSP00000357198:p.Ala683Gly	85.0	0.0		108.0	38.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	hg19		.	.	.	.	.	.	.	.	.	.	G	13.71	2.319089	0.41096	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	T;T;T;T;T;T;T	0.08546	3.1;3.09;3.09;3.1;3.09;3.1;3.08	5.73	5.73	0.89815	.	0.249500	0.41938	D	0.000790	T	0.02494	0.0076	N	0.08118	0	0.37342	D	0.91041	B;B;B;B;B;B	0.32101	0.231;0.147;0.23;0.356;0.035;0.058	B;B;B;B;B;B	0.30943	0.039;0.045;0.098;0.122;0.018;0.04	T	0.54357	-0.8306	10	0.26408	T	0.33	.	19.9002	0.96983	0.0:0.0:1.0:0.0	.	683;683;683;540;683;683	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.;.;.;.;PTPRK_HUMAN;.	G	683;683;683;683;683;683;683;540	ENSP00000357209:A683G;ENSP00000357210:A683G;ENSP00000432973:A683G;ENSP00000357196:A683G;ENSP00000357193:A683G;ENSP00000357198:A683G;ENSP00000357190:A683G	ENSP00000357190:A683G	A	-	2	0	PTPRK	128430466	0.038000	0.19896	1.000000	0.80357	0.902000	0.53008	1.492000	0.35594	2.709000	0.92574	0.655000	0.94253	GCC	.	.		0.537	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		54.0	0.0		67.0	5.0	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
PHTF2	57157	hgsc.bcm.edu	37	7	77558460	77558460	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr7:77558460G>T	ENST00000248550.7	+	11	1230	c.1154G>T	c.(1153-1155)cGc>cTc	p.R385L	PHTF2_ENST00000275575.7_Missense_Mutation_p.R347L|PHTF2_ENST00000416283.2_Missense_Mutation_p.R351L|PHTF2_ENST00000424760.1_Missense_Mutation_p.R347L|PHTF2_ENST00000307305.8_Missense_Mutation_p.R347L|PHTF2_ENST00000454592.1_3'UTR|PHTF2_ENST00000422959.2_Missense_Mutation_p.R351L			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						TGCAGCTCTCGCTGTTCAAGT	0.403																																					p.R351L		Atlas-SNP	.											.	PHTF2	104	.	0			c.G1052T						.						71.0	65.0	67.0					7																	77558460		1854	4092	5946	SO:0001583	missense	57157	exon10			GCTCTCGCTGTTC	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.1154G>T	chr7.hg19:g.77558460G>T	ENSP00000248550:p.Arg385Leu	140.0	0.0		182.0	73.0	NM_001127357	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	hg19		.	.	.	.	.	.	.	.	.	.	G	33	5.281965	0.95489	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000275575;ENST00000416283;ENST00000248550	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.73860	0.3641	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.998;0.997;1.0	D;D;D;D;D;P;D	0.87578	0.998;0.998;0.998;0.996;0.985;0.885;0.984	T	0.71672	-0.4522	9	0.48119	T	0.1	-7.9149	20.6208	0.99490	0.0:0.0:1.0:0.0	.	189;347;210;351;385;347;347	Q8WVD6;Q8N3S3-4;Q8N5I6;Q8N3S3-2;Q8N3S3;Q8N3S3-3;B3KQZ2	.;.;.;.;PHTF2_HUMAN;.;.	L	351;351;347;347;347;351;385	.	ENSP00000248550:R385L	R	+	2	0	PHTF2	77396396	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.230000	0.95299	2.882000	0.98803	0.655000	0.94253	CGC	.	.		0.403	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
WDR60	55112	hgsc.bcm.edu	37	7	158734820	158734820	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr7:158734820C>T	ENST00000407559.3	+	24	3141	c.2983C>T	c.(2983-2985)Cag>Tag	p.Q995*		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	995					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		TGTCGCCAAACAGCAGGTCTC	0.602																																					p.Q995X		Atlas-SNP	.											.	WDR60	94	.	0			c.C2983T						.						47.0	47.0	47.0					7																	158734820		1949	4145	6094	SO:0001587	stop_gained	55112	exon24			GCCAAACAGCAGG		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2983C>T	chr7.hg19:g.158734820C>T	ENSP00000384290:p.Gln995*	34.0	0.0		25.0	17.0	NM_018051	Q9NW58	Nonsense_Mutation	SNP	ENST00000407559.3	hg19	CCDS47757.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333871	0.41297	.	.	ENSG00000126870	ENST00000407559	.	.	.	5.71	5.71	0.89125	.	0.060489	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-19.591	14.4479	0.67364	0.0:0.8531:0.1469:0.0	.	.	.	.	X	995	.	ENSP00000384290:Q995X	Q	+	1	0	WDR60	158427581	0.999000	0.42202	0.035000	0.18076	0.006000	0.05464	4.334000	0.59291	2.688000	0.91661	0.655000	0.94253	CAG	.	.		0.602	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
ADAM7	8756	hgsc.bcm.edu	37	8	24339683	24339683	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr8:24339683C>T	ENST00000175238.6	+	9	817	c.734C>T	c.(733-735)aCg>aTg	p.T245M	RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Missense_Mutation_p.T245M|ADAM7_ENST00000520720.1_Missense_Mutation_p.T17M|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	245	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		ATCCATGTGACGTTGGTTGGC	0.299																																					p.T245M		Atlas-SNP	.											.	ADAM7	165	.	0			c.C734T						.						91.0	88.0	89.0					8																	24339683		2203	4299	6502	SO:0001583	missense	8756	exon9			ATGTGACGTTGGT	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.734C>T	chr8.hg19:g.24339683C>T	ENSP00000175238:p.Thr245Met	140.0	0.0		160.0	28.0	NM_003817	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	hg19	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187701	0.38609	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.63744	-0.06;-0.06;-0.06	5.63	3.59	0.41128	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.237899	0.29737	N	0.011340	T	0.65790	0.2725	L	0.45744	1.44	0.24901	N	0.992106	D;D	0.69078	0.994;0.997	P;D	0.63033	0.88;0.91	T	0.55842	-0.8077	10	0.56958	D	0.05	.	5.6793	0.17765	0.0:0.732:0.0:0.268	.	17;245	E5RK87;Q9H2U9	.;ADAM7_HUMAN	M	245;245;17;60	ENSP00000175238:T245M;ENSP00000370166:T245M;ENSP00000430400:T17M	ENSP00000175238:T245M	T	+	2	0	ADAM7	24395573	0.982000	0.34865	0.965000	0.40720	0.287000	0.27160	0.969000	0.29370	1.381000	0.46364	0.655000	0.94253	ACG	.	.		0.299	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
CPA6	57094	hgsc.bcm.edu	37	8	68536486	68536486	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr8:68536486A>T	ENST00000297770.4	-	2	332	c.117T>A	c.(115-117)ggT>ggA	p.G39G	CPA6_ENST00000518549.1_Splice_Site_p.G39G|CPA6_ENST00000297769.4_5'UTR	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	39						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TCACTTTATCACTACAAGATA	0.299																																					p.G39G		Atlas-SNP	.											.	CPA6	69	.	0			c.T117A						.						127.0	113.0	118.0					8																	68536486		2202	4298	6500	SO:0001630	splice_region_variant	57094	exon2			TTTATCACTACAA	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.117-1T>A	chr8.hg19:g.68536486A>T		81.0	0.0		105.0	34.0	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Silent	SNP	ENST00000297770.4	hg19	CCDS6200.1																																																																																			.	.		0.299	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	Silent
AARD	441376	hgsc.bcm.edu	37	8	117954908	117954908	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr8:117954908A>T	ENST00000378279.3	+	2	481	c.436A>T	c.(436-438)Agc>Tgc	p.S146C	AARD_ENST00000523536.1_3'UTR	NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	146					lung development (GO:0030324)												AGACTCCCAAAGCCCAAAAGA	0.488																																					p.S146C		Atlas-SNP	.											.	.	.	.	0			c.A436T						.						75.0	70.0	72.0					8																	117954908		2203	4300	6503	SO:0001583	missense	441376	exon2			TCCCAAAGCCCAA	AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002			33842	protein-coding gene	gene with protein product	"""Alanine and arginine-rich domain-containing protein"""		"""chromosome 8 open reading frame 85"""	C8orf85			Standard	NM_001025357		Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.436A>T	chr8.hg19:g.117954908A>T	ENSP00000367528:p.Ser146Cys	81.0	0.0		137.0	10.0	NM_001025357	A5PKU8	Missense_Mutation	SNP	ENST00000378279.3	hg19	CCDS34935.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.026479	0.54683	.	.	ENSG00000205002	ENST00000378279	T	0.32753	1.44	5.24	-0.325	0.12702	.	0.856276	0.09975	N	0.731820	T	0.35364	0.0929	L	0.32530	0.975	0.09310	N	1	D	0.76494	0.999	D	0.66847	0.947	T	0.19976	-1.0289	10	0.72032	D	0.01	0.0385	3.0078	0.06034	0.5125:0.0:0.1868:0.3007	.	146	Q4LEZ3	AARD_HUMAN	C	146	ENSP00000367528:S146C	ENSP00000367528:S146C	S	+	1	0	C8orf85	118024089	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-0.009000	0.12765	0.086000	0.17137	0.533000	0.62120	AGC	.	.		0.488	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381195.1	NM_001025357	
TRPM6	140803	hgsc.bcm.edu	37	9	77362825	77362825	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr9:77362825T>C	ENST00000360774.1	-	31	5300	c.5063A>G	c.(5062-5064)aAa>aGa	p.K1688R	TRPM6_ENST00000361255.3_Missense_Mutation_p.K1683R|TRPM6_ENST00000449912.2_Missense_Mutation_p.K1683R|TRPM6_ENST00000451710.3_Intron|TRPM6_ENST00000376864.4_Intron|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1688					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AATTGAACTTTTCAGCCTGTT	0.294																																					p.K1688R		Atlas-SNP	.											.	TRPM6	377	.	0			c.A5063G						.						71.0	77.0	75.0					9																	77362825		2202	4294	6496	SO:0001583	missense	140803	exon31			GAACTTTTCAGCC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5063A>G	chr9.hg19:g.77362825T>C	ENSP00000354006:p.Lys1688Arg	39.0	0.0		76.0	30.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	hg19	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	3.226	-0.158409	0.06544	.	.	ENSG00000119121	ENST00000360774;ENST00000449912;ENST00000361255	T;T;T	0.51071	0.72;0.72;0.72	5.48	3.63	0.41609	.	.	.	.	.	T	0.26557	0.0649	N	0.24115	0.695	0.80722	D	1	B;B;B;B;B	0.21309	0.0;0.054;0.0;0.0;0.0	B;B;B;B;B	0.16722	0.0;0.016;0.0;0.001;0.001	T	0.09952	-1.0651	9	0.02654	T	1	.	8.3054	0.32038	0.0:0.7464:0.0:0.2536	.	521;639;1688;1683;1683	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;TRPM6_HUMAN;.;.	R	1688;1683;1683	ENSP00000354006:K1688R;ENSP00000396672:K1683R;ENSP00000354962:K1683R	ENSP00000354006:K1688R	K	-	2	0	TRPM6	76552645	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	0.597000	0.24059	0.773000	0.33404	-0.462000	0.05337	AAA	.	.		0.294	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.H265H	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716																																					p.H344H		Atlas-SNP	.											.	.	.	.	0			c.T1032C						.						4.0	6.0	5.0					10																	21805720		1658	3602	5260	SO:0001819	synonymous_variant	387640	exon4			GTGGTGATGGTGG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	chr10.hg19:g.21805720A>G		28.0	0.0		62.0	5.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
GJD4	219770	hgsc.bcm.edu	37	10	35897262	35897262	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr10:35897262G>C	ENST00000321660.1	+	2	979	c.821G>C	c.(820-822)gGg>gCg	p.G274A	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	274					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GGAGGGGAGGGGGCTGGCAGC	0.706																																					p.G274A		Atlas-SNP	.											.	GJD4	38	.	0			c.G821C						.						10.0	10.0	10.0					10																	35897262		2116	4136	6252	SO:0001583	missense	219770	exon2			GGGAGGGGGCTGG	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.821G>C	chr10.hg19:g.35897262G>C	ENSP00000315070:p.Gly274Ala	49.0	0.0		56.0	19.0	NM_153368	Q8N2R7	Missense_Mutation	SNP	ENST00000321660.1	hg19	CCDS7191.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724625	0.48833	.	.	ENSG00000177291	ENST00000321660	D	0.97710	-4.5	5.49	-2.53	0.06326	.	4.715010	0.00628	N	0.000470	D	0.91690	0.7373	L	0.27053	0.805	0.09310	N	1	B	0.29909	0.261	B	0.21546	0.035	D	0.87833	0.2646	10	0.07990	T	0.79	.	0.3734	0.00383	0.3311:0.1309:0.2708:0.2673	.	274	Q96KN9	CXD4_HUMAN	A	274	ENSP00000315070:G274A	ENSP00000315070:G274A	G	+	2	0	GJD4	35937268	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.267000	0.08619	-0.108000	0.12066	-0.192000	0.12808	GGG	.	.		0.706	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047576.1	NM_153368	
A1CF	29974	hgsc.bcm.edu	37	10	52573658	52573658	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr10:52573658G>A	ENST00000373993.1	-	8	1350	c.1306C>T	c.(1306-1308)Cct>Tct	p.P436S	A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000373997.3_Missense_Mutation_p.P428S|A1CF_ENST00000374001.2_Missense_Mutation_p.P428S|A1CF_ENST00000282641.2_Missense_Mutation_p.P436S|ASAH2B_ENST00000483649.1_Intron|A1CF_ENST00000373995.3_Missense_Mutation_p.P436S|A1CF_ENST00000395495.1_Missense_Mutation_p.P381S|A1CF_ENST00000395489.2_Missense_Mutation_p.P429S			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	436					cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.P428S(1)|p.P436S(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						AATGTGACAGGATTCATTGGG	0.438																																					p.P444S		Atlas-SNP	.											A1CF,NS,carcinoma,0,1	A1CF	190	.	2	Substitution - Missense(2)	lung(2)	c.C1330T						.						151.0	153.0	152.0					10																	52573658		2203	4300	6503	SO:0001583	missense	29974	exon12			TGACAGGATTCAT	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1306C>T	chr10.hg19:g.52573658G>A	ENSP00000363105:p.Pro436Ser	117.0	0.0		154.0	52.0	NM_001198819	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	hg19	CCDS7242.1	.	.	.	.	.	.	.	.	.	.	G	9.509	1.105132	0.20632	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489	T;T;T;T;T;T;T	0.14766	2.75;2.73;2.75;2.71;2.73;2.48;2.73	5.87	4.95	0.65309	.	0.266360	0.43260	D	0.000600	T	0.15609	0.0376	L	0.47190	1.495	0.32852	D	0.506769	B;B;B;B	0.31949	0.348;0.061;0.073;0.123	B;B;B;B	0.36244	0.22;0.045;0.053;0.062	T	0.12915	-1.0529	10	0.48119	T	0.1	-7.5986	11.6903	0.51512	0.0:0.0:0.6671:0.3329	.	429;436;428;436	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	S	428;436;428;436;436;381;411;429	ENSP00000363113:P428S;ENSP00000363105:P436S;ENSP00000363109:P428S;ENSP00000363107:P436S;ENSP00000282641:P436S;ENSP00000378873:P381S;ENSP00000378868:P429S	ENSP00000282641:P436S	P	-	1	0	A1CF	52243664	1.000000	0.71417	1.000000	0.80357	0.360000	0.29518	4.058000	0.57463	1.426000	0.47256	0.655000	0.94253	CCT	.	.		0.438	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576	
PRDX3	10935	hgsc.bcm.edu	37	10	120938299	120938299	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr10:120938299C>G	ENST00000298510.2	-	1	46	c.4G>C	c.(4-6)Gcg>Ccg	p.A2P	PRDX3_ENST00000356951.3_Missense_Mutation_p.A2P	NM_006793.2	NP_006784.1	P30048	PRDX3_HUMAN	peroxiredoxin 3	2					cellular response to oxidative stress (GO:0034599)|cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|maternal placenta development (GO:0001893)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of kinase activity (GO:0033673)|peptidyl-cysteine oxidation (GO:0018171)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of mitochondrial membrane potential (GO:0051881)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	alkyl hydroperoxide reductase activity (GO:0008785)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|kinase binding (GO:0019900)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|lung(2)	3		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0245)		ACAGCAGCCGCCATCTTCAGT	0.721																																					p.A2P	Pancreas(36;562 1096 2447 42526)	Atlas-SNP	.											.	PRDX3	15	.	0			c.G4C						.						13.0	9.0	10.0					10																	120938299		2070	4069	6139	SO:0001583	missense	10935	exon1			CAGCCGCCATCTT	D49396	CCDS7611.1	10q25-q26	2010-11-24			ENSG00000165672	ENSG00000165672			9354	protein-coding gene	gene with protein product		604769	"""antioxidant protein 1"""	AOP1		7733872, 9363753	Standard	NM_006793		Approved	MER5, AOP-1, SP-22	uc001lec.3	P30048	OTTHUMG00000019146	ENST00000298510.2:c.4G>C	chr10.hg19:g.120938299C>G	ENSP00000298510:p.Ala2Pro	117.0	0.0		162.0	60.0	NM_006793	B2R7Z0|D3DRC9|E9PH29|P35690|Q0D2H1|Q13776|Q5T5V2|Q96HK4	Missense_Mutation	SNP	ENST00000298510.2	hg19	CCDS7611.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586234	0.86851	.	.	ENSG00000165672	ENST00000356951;ENST00000298510	T;T	0.18502	2.21;2.41	5.16	5.16	0.70880	.	0.268030	0.40222	N	0.001154	T	0.16811	0.0404	N	0.08118	0	0.58432	D	0.999998	P	0.48016	0.904	P	0.51866	0.682	T	0.08269	-1.0730	10	0.87932	D	0	-19.1078	15.4979	0.75669	0.0:1.0:0.0:0.0	.	2	P30048	PRDX3_HUMAN	P	2	ENSP00000349432:A2P;ENSP00000298510:A2P	ENSP00000298510:A2P	A	-	1	0	PRDX3	120928289	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	4.468000	0.60162	2.676000	0.91093	0.655000	0.94253	GCG	.	.		0.721	PRDX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050639.1	NM_006793	
GPR123	84435	hgsc.bcm.edu	37	10	134941950	134941950	+	Silent	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr10:134941950G>A	ENST00000392607.3	+	7	1054	c.618G>A	c.(616-618)ggG>ggA	p.G206G	GPR123_ENST00000607359.1_Silent_p.G925G|GPR123_ENST00000392606.2_Silent_p.G109G	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	206					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GCCACCCAGGGCGCAGGTACG	0.716																																					p.G206G		Atlas-SNP	.											.	GPR123	118	.	0			c.G618A						.						11.0	11.0	11.0					10																	134941950		2167	4247	6414	SO:0001819	synonymous_variant	84435	exon7			CCCAGGGCGCAGG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.618G>A	chr10.hg19:g.134941950G>A		70.0	0.0		113.0	47.0	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	hg19	CCDS41580.1																																																																																			.	.		0.716	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
ACP2	53	hgsc.bcm.edu	37	11	47267056	47267056	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr11:47267056G>C	ENST00000256997.3	-	5	634	c.518C>G	c.(517-519)cCa>cGa	p.P173R	ACP2_ENST00000533929.1_Missense_Mutation_p.P145R|ACP2_ENST00000529444.1_Intron|ACP2_ENST00000530453.1_Intron|ACP2_ENST00000537863.1_Intron|ACP2_ENST00000525230.1_5'Flank|ACP2_ENST00000527256.1_Missense_Mutation_p.P141R	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal	173					dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						CTGATACTCTGGTGTCTGCCG	0.587																																					p.P173R	Melanoma(90;262 1440 11488 44828 48531)	Atlas-SNP	.											.	ACP2	36	.	0			c.C518G						.						114.0	100.0	105.0					11																	47267056		2201	4298	6499	SO:0001583	missense	53	exon5			TACTCTGGTGTCT	X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.518C>G	chr11.hg19:g.47267056G>C	ENSP00000256997:p.Pro173Arg	100.0	0.0		162.0	33.0	NM_001610	E9PCI1|Q561W5|Q9BTU7	Missense_Mutation	SNP	ENST00000256997.3	hg19	CCDS7928.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123555	0.37436	.	.	ENSG00000134575	ENST00000256997;ENST00000527256;ENST00000540414;ENST00000533929	T;T;T	0.46063	0.88;0.88;0.88	5.16	5.16	0.70880	.	0.397062	0.29080	N	0.013205	T	0.50240	0.1604	M	0.82517	2.595	0.80722	D	1	P;B;B	0.35155	0.487;0.427;0.208	B;B;B	0.35770	0.181;0.21;0.195	T	0.52653	-0.8547	10	0.25751	T	0.34	.	18.6425	0.91400	0.0:0.0:1.0:0.0	.	141;145;173	B7Z7D2;E9PQY3;P11117	.;.;PPAL_HUMAN	R	173;141;163;145	ENSP00000256997:P173R;ENSP00000432205:P141R;ENSP00000432439:P145R	ENSP00000256997:P173R	P	-	2	0	ACP2	47223632	0.954000	0.32549	0.948000	0.38648	0.697000	0.40408	3.991000	0.56973	2.392000	0.81423	0.462000	0.41574	CCA	.	.		0.587	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392022.2	NM_001610	
TMEM179B	374395	hgsc.bcm.edu	37	11	62554934	62554934	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr11:62554934C>A	ENST00000333449.4	+	1	36	c.31C>A	c.(31-33)Ctt>Att	p.L11I	TMEM223_ENST00000527073.1_Intron|RP11-727F15.12_ENST00000601484.1_RNA|TMEM179B_ENST00000533861.1_Missense_Mutation_p.L11I	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	11						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						GCGCGTCGAGCTTGCGCTCTT	0.736											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L11I		Atlas-SNP	.											.	TMEM179B	13	.	0			c.C31A						.						6.0	7.0	7.0					11																	62554934		2142	4204	6346	SO:0001583	missense	374395	exon1			GTCGAGCTTGCGC	BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.31C>A	chr11.hg19:g.62554934C>A	ENSP00000333697:p.Leu11Ile	14.0	0.0	1062	35.0	12.0	NM_199337		Missense_Mutation	SNP	ENST00000333449.4	hg19	CCDS8036.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752879	0.69648	.	.	ENSG00000185475	ENST00000533861;ENST00000333449	.	.	.	4.85	2.98	0.34508	.	0.000000	0.64402	D	0.000002	T	0.47210	0.1433	M	0.64997	1.995	0.34583	D	0.714624	P	0.36633	0.562	B	0.38500	0.275	T	0.55560	-0.8122	9	0.35671	T	0.21	.	7.3187	0.26515	0.0:0.8019:0.0:0.1981	.	11	Q7Z7N9	T179B_HUMAN	I	11	.	ENSP00000333697:L11I	L	+	1	0	TMEM179B	62311510	1.000000	0.71417	0.842000	0.33263	0.723000	0.41478	2.162000	0.42367	0.657000	0.30906	0.555000	0.69702	CTT	.	.		0.736	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395362.2	NM_199337	
GRIA4	2893	hgsc.bcm.edu	37	11	105842662	105842662	+	Silent	SNP	T	T	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr11:105842662T>A	ENST00000530497.1	+	14	2316	c.2316T>A	c.(2314-2316)gtT>gtA	p.V772V	GRIA4_ENST00000533094.1_Intron|GRIA4_ENST00000525187.1_Intron|GRIA4_ENST00000393127.2_Intron|RNU6-277P_ENST00000516272.1_RNA|GRIA4_ENST00000282499.5_Silent_p.V772V			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	772					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACCTTGCCGTTTTGAAACTCA	0.378																																					p.V772V		Atlas-SNP	.											.	GRIA4	380	.	0			c.T2316A						.						89.0	87.0	88.0					11																	105842662		2201	4299	6500	SO:0001819	synonymous_variant	2893	exon15			TGCCGTTTTGAAA	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2316T>A	chr11.hg19:g.105842662T>A		143.0	0.0		205.0	78.0	NM_000829	Q86XE8	Silent	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	T	6.700	0.497864	0.12762	.	.	ENSG00000152578	ENST00000539249	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.75831	0.3903	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78560	-0.2157	5	0.62326	D	0.03	.	15.7049	0.77569	0.0:0.0:0.0:1.0	.	.	.	.	I	116	.	ENSP00000440835:F116I	F	+	1	0	GRIA4	105347872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.618000	0.46393	2.117000	0.64856	0.533000	0.62120	TTT	.	.		0.378	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
ALX1	8092	hgsc.bcm.edu	37	12	85695157	85695157	+	Silent	SNP	T	T	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr12:85695157T>C	ENST00000316824.3	+	4	1040	c.885T>C	c.(883-885)ttT>ttC	p.F295F		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	295					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		GACATGCATTTGAAACAAAGC	0.463																																					p.F295F		Atlas-SNP	.											.	ALX1	61	.	0			c.T885C						.						105.0	102.0	103.0					12																	85695157		2203	4300	6503	SO:0001819	synonymous_variant	8092	exon4			TGCATTTGAAACA	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.885T>C	chr12.hg19:g.85695157T>C		128.0	0.0		138.0	55.0	NM_006982	Q546C8|Q96FH4	Silent	SNP	ENST00000316824.3	hg19	CCDS9028.1																																																																																			.	.		0.463	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
ZNF140	7699	hgsc.bcm.edu	37	12	133682847	133682847	+	Silent	SNP	G	G	A	rs529439392		TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr12:133682847G>A	ENST00000355557.2	+	5	2267	c.984G>A	c.(982-984)ccG>ccA	p.P328P	ZNF140_ENST00000544426.1_Silent_p.P225P|ZNF140_ENST00000440550.2_3'UTR	NM_003440.2	NP_003431.2	P52738	ZN140_HUMAN	zinc finger protein 140	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.114)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CCAAAACCCCGTATGAATGTA	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		22726	0.0		0.0	False		,,,				2504	0.001				p.P328P		Atlas-SNP	.											.	ZNF140	18	.	0			c.G984A						.						121.0	113.0	116.0					12																	133682847		2203	4300	6503	SO:0001819	synonymous_variant	7699	exon5			AACCCCGTATGAA	U09368	CCDS9282.1, CCDS73550.1	12q24.33	2013-01-08	2006-06-13		ENSG00000196387	ENSG00000196387		"""Zinc fingers, C2H2-type"", ""-"""	12925	protein-coding gene	gene with protein product		604082	"""zinc finger protein 140 (clone pHZ-39)"""			7557990	Standard	XR_245353		Approved	pHZ-39	uc001ulo.3	P52738	OTTHUMG00000167942	ENST00000355557.2:c.984G>A	chr12.hg19:g.133682847G>A		115.0	0.0		154.0	78.0	NM_003440	D3DXJ3|Q05CP6|Q8IV75	Silent	SNP	ENST00000355557.2	hg19	CCDS9282.1																																																																																			.	.		0.398	ZNF140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397169.1	NM_003440	
NBEA	26960	hgsc.bcm.edu	37	13	36242504	36242505	+	Splice_Site	DNP	GG	GG	TT			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr13:36242504_36242505GG>TT	ENST00000400445.3	+	57	9132_9133	c.8598_8599GG>TT	c.(8596-8601)cgGGcc>cgTTcc	p.A2867S	NBEA_ENST00000537702.1_Splice_Site_p.A660S|NBEA_ENST00000310336.4_Splice_Site_p.A2867S|NBEA_ENST00000379922.3_Splice_Site_p.A445S|NBEA_ENST00000540320.1_Splice_Site_p.A2867S|NBEA_ENST00000379939.2_Splice_Site_p.A2864S	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2867					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTTTTCTGAAGGCCATTCTCCT	0.411																																					.|p.A2867S		Atlas-SNP	.											.	NBEA	340	.	0			c.8599-1G>T|c.G8599T						.																																			SO:0001630	splice_region_variant	26960	exon57			TCTGAAGGCCATT|CTGAAGGCCATTC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	Exception_encountered	chr13.hg19:g.36242504_36242505delinsTT		82.0|83.0	0.0		68.0|67.0	35.0|34.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Splice_Site|Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.		0.411	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	Missense_Mutation
SLC10A2	6555	hgsc.bcm.edu	37	13	103718590	103718590	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr13:103718590G>T	ENST00000245312.3	-	1	606	c.10C>A	c.(10-12)Ccg>Acg	p.P4T		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	4					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	CAGCTGTTCGGATCATTCATT	0.512																																					p.P4T		Atlas-SNP	.											.	SLC10A2	67	.	0			c.C10A						.						101.0	97.0	98.0					13																	103718590		2203	4300	6503	SO:0001583	missense	6555	exon1			TGTTCGGATCATT	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.10C>A	chr13.hg19:g.103718590G>T	ENSP00000245312:p.Pro4Thr	48.0	0.0		65.0	24.0	NM_000452	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	hg19	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.719938	0.00700	.	.	ENSG00000125255	ENST00000245312	T	0.07327	3.2	5.67	-5.84	0.02318	.	2.004560	0.01754	N	0.030138	T	0.03348	0.0097	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34279	-0.9835	10	0.22706	T	0.39	-25.5519	1.034	0.01544	0.3822:0.1138:0.284:0.2201	.	4	Q12908	NTCP2_HUMAN	T	4	ENSP00000245312:P4T	ENSP00000245312:P4T	P	-	1	0	SLC10A2	102516591	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.614000	0.24314	-1.386000	0.02098	-0.345000	0.07892	CCG	.	.		0.512	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
SEC23A	10484	hgsc.bcm.edu	37	14	39517887	39517887	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr14:39517887C>T	ENST00000307712.6	-	15	2223	c.1706G>A	c.(1705-1707)aGa>aAa	p.R569K	SEC23A_ENST00000536508.1_Missense_Mutation_p.R443K|SEC23A_ENST00000537403.1_Missense_Mutation_p.R367K|SEC23A_ENST00000545328.2_Missense_Mutation_p.R540K	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	569					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TTCTGAAAATCTGAAGGAACT	0.313																																					p.R569K		Atlas-SNP	.											.	SEC23A	73	.	0			c.G1706A						.						72.0	81.0	78.0					14																	39517887		2203	4300	6503	SO:0001583	missense	10484	exon15			GAAAATCTGAAGG	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1706G>A	chr14.hg19:g.39517887C>T	ENSP00000306881:p.Arg569Lys	89.0	0.0		99.0	37.0	NM_006364	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	hg19	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.849660	0.71603	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59	5.5	5.5	0.81552	Sec23/Sec24, helical domain (2);	0.048926	0.85682	D	0.000000	D	0.89539	0.6744	M	0.86097	2.795	0.58432	D	0.999999	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.12156	0.004;0.007;0.005	D	0.86481	0.1791	10	0.49607	T	0.09	-11.0348	12.7104	0.57086	0.0:0.9247:0.0:0.0753	.	540;443;569	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	K	367;569;443;540	ENSP00000444193:R367K;ENSP00000306881:R569K;ENSP00000437715:R443K;ENSP00000445393:R540K	ENSP00000306881:R569K	R	-	2	0	SEC23A	38587638	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.963000	0.63694	2.593000	0.87608	0.655000	0.94253	AGA	.	.		0.313	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
MIA2	117153	hgsc.bcm.edu	37	14	39716435	39716435	+	Silent	SNP	T	T	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr14:39716435T>A	ENST00000280082.3	+	4	856	c.657T>A	c.(655-657)gcT>gcA	p.A219A	RP11-407N17.3_ENST00000553728.1_Silent_p.A219A|MIA2_ENST00000556784.1_Silent_p.A218A	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	219					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		CATCTTCAGCTGTGTCTGGAG	0.423																																					p.A219A		Atlas-SNP	.											.	MIA2	82	.	0			c.T657A						.						85.0	86.0	86.0					14																	39716435		2203	4300	6503	SO:0001819	synonymous_variant	117153	exon4			TTCAGCTGTGTCT	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.657T>A	chr14.hg19:g.39716435T>A		171.0	0.0		258.0	107.0	NM_054024	A1L4H0|Q9H6C1	Silent	SNP	ENST00000280082.3	hg19	CCDS9672.1																																																																																			.	.		0.423	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024	
ZBTB25	7597	hgsc.bcm.edu	37	14	64954457	64954457	+	Silent	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr14:64954457G>A	ENST00000608382.1	-	3	683	c.492C>T	c.(490-492)gaC>gaT	p.D164D	ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000394715.1_Silent_p.D164D|ZBTB25_ENST00000555424.1_Intron	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	164					gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		ACTGGGGGTGGTCACCCTGGA	0.537																																					p.D164D		Atlas-SNP	.											.	ZBTB25	27	.	0			c.C492T						.						156.0	159.0	158.0					14																	64954457		2203	4300	6503	SO:0001819	synonymous_variant	7597	exon3			GGGGTGGTCACCC	X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.492C>T	chr14.hg19:g.64954457G>A		121.0	0.0		156.0	26.0	NM_006977	B3KUX6|Q8IYH9	Silent	SNP	ENST00000608382.1	hg19	CCDS9765.1																																																																																			.	.		0.537	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977	
DAPK2	23604	hgsc.bcm.edu	37	15	64204312	64204312	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr15:64204312A>T	ENST00000457488.1	-	10	973	c.943T>A	c.(943-945)Tgg>Agg	p.W315R	DAPK2_ENST00000261891.3_Missense_Mutation_p.W315R	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	315	Calmodulin-binding.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		CACACCTTCCACCGCCTGCGG	0.617																																					p.W315R		Atlas-SNP	.											.	DAPK2	31	.	0			c.T943A						.						55.0	45.0	48.0					15																	64204312		2203	4300	6503	SO:0001583	missense	23604	exon10			CCTTCCACCGCCT	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.943T>A	chr15.hg19:g.64204312A>T	ENSP00000408277:p.Trp315Arg	79.0	0.0		134.0	45.0	NM_014326	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	hg19	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.186806	0.78789	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.68025	-0.3;-0.3	5.15	5.15	0.70609	Protein kinase-like domain (1);	0.000000	0.56097	D	0.000034	T	0.79028	0.4377	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.81320	-0.0986	10	0.87932	D	0	.	12.3647	0.55222	1.0:0.0:0.0:0.0	.	315	Q9UIK4	DAPK2_HUMAN	R	315	ENSP00000261891:W315R;ENSP00000408277:W315R	ENSP00000261891:W315R	W	-	1	0	DAPK2	61991365	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.348000	0.79366	1.940000	0.56252	0.496000	0.49642	TGG	.	.		0.617	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
ABCC6	368	hgsc.bcm.edu	37	16	16248764	16248764	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr16:16248764T>G	ENST00000205557.7	-	28	4036	c.4007A>C	c.(4006-4008)cAc>cCc	p.H1336P		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1336	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	GCGCAGTGTGTGCAGCCCCAC	0.682																																					p.H1336P		Atlas-SNP	.											.	ABCC6	110	.	0			c.A4007C						.						31.0	28.0	29.0					16																	16248764		2197	4299	6496	SO:0001583	missense	368	exon28			AGTGTGTGCAGCC	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4007A>C	chr16.hg19:g.16248764T>G	ENSP00000205557:p.His1336Pro	99.0	0.0		189.0	53.0	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	hg19	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.272779	0.80580	.	.	ENSG00000091262	ENST00000205557;ENST00000205558	D	0.93488	-3.23	4.8	4.8	0.61643	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.49305	U	0.000149	D	0.94268	0.8159	L	0.33624	1.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95046	0.8182	10	0.87932	D	0	.	14.0557	0.64767	0.0:0.0:0.0:1.0	.	1336;1336	O95255;A8Y988	MRP6_HUMAN;.	P	1336;274	ENSP00000205557:H1336P	ENSP00000205557:H1336P	H	-	2	0	ABCC6	16156265	1.000000	0.71417	0.970000	0.41538	0.963000	0.63663	5.106000	0.64597	1.797000	0.52628	0.381000	0.24937	CAC	.	.		0.682	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
ABCC6	368	hgsc.bcm.edu	37	16	16255355	16255356	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr16:16255355_16255356CA>AC	ENST00000205557.7	-	25	3601_3602	c.3572_3573TG>GT	c.(3571-3573)gTG>gGT	p.V1191G		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1191	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CTTTGCTCAGCACAGCACACGT	0.609																																					p.V1191V|p.V1191G		Atlas-SNP	.											.	ABCC6	110	.	0			c.G3573T|c.T3572G						.																																			SO:0001583	missense	368	exon25			GCTCAGCACAGCA|CTCAGCACAGCAC	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.3572_3573delinsAC	chr16.hg19:g.16255355_16255356delinsAC	ENSP00000205557:p.Val1191Gly	127.0|128.0	0.0		275.0|274.0	136.0|134.0	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent|Missense_Mutation	SNP	ENST00000205557.7	hg19	CCDS10568.1																																																																																			.	.		0.609	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
KIFC3	3801	hgsc.bcm.edu	37	16	57790767	57790767	+	IGR	SNP	T	T	G			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr16:57790767T>G	ENST00000379655.4	-	0	3427				KATNB1_ENST00000379661.3_Missense_Mutation_p.I626S	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3						ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CTTAAGAGCATCAGCGGCCTG	0.622																																					p.I626S		Atlas-SNP	.											.	KATNB1	35	.	0			c.T1877G						.						31.0	24.0	27.0					16																	57790767		2193	4300	6493	SO:0001628	intergenic_variant	10300	exon20			AGAGCATCAGCGG	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455		chr16.hg19:g.57790767T>G		66.0	0.0		132.0	34.0	NM_005886	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	hg19	CCDS10789.2	.	.	.	.	.	.	.	.	.	.	T	21.5	4.165581	0.78339	.	.	ENSG00000140854	ENST00000379661	T	0.61980	0.06	4.97	4.97	0.65823	.	0.068463	0.64402	D	0.000013	T	0.66257	0.2771	M	0.82630	2.6	0.48135	D	0.999597	P	0.41748	0.761	B	0.39562	0.303	T	0.73968	-0.3815	10	0.87932	D	0	0.0853	13.8555	0.63524	0.0:0.0:0.0:1.0	.	626	Q9BVA0	KTNB1_HUMAN	S	626	ENSP00000368982:I626S	ENSP00000368982:I626S	I	+	2	0	KATNB1	56348268	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.896000	0.69822	1.880000	0.54463	0.459000	0.35465	ATC	.	.		0.622	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550	
HYDIN	54768	hgsc.bcm.edu	37	16	70954810	70954810	+	Missense_Mutation	SNP	G	G	A	rs367546874		TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr16:70954810G>A	ENST00000393567.2	-	46	7619	c.7469C>T	c.(7468-7470)gCg>gTg	p.A2490V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2490					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTCATGGGGCGCTTCCTCCAT	0.617																																					p.A2490V		Atlas-SNP	.											.	HYDIN	788	.	0			c.C7469T						.	G	VAL/ALA	0,4038		0,0,2019	39.0	34.0	35.0		7466	-6.6	0.0	16		35	1,8289		0,1,4144	no	missense	HYDIN	NM_032821.2	64	0,1,6163	AA,AG,GG		0.0121,0.0,0.0081	benign	2489/5121	70954810	1,12327	2019	4145	6164	SO:0001583	missense	54768	exon46			TGGGGCGCTTCCT	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7469C>T	chr16.hg19:g.70954810G>A	ENSP00000377197:p.Ala2490Val	31.0	0.0		41.0	16.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	hg19	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	4.291	0.053133	0.08291	0.0	1.21E-4	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00848	5.62	5.88	-6.59	0.01830	.	0.982876	0.08241	U	0.976108	T	0.00496	0.0016	N	0.03608	-0.345	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.48536	-0.9027	10	0.28530	T	0.3	.	8.2928	0.31967	0.2287:0.0999:0.5734:0.098	.	2489	F8WD23	.	V	2490;2489	ENSP00000377197:A2490V	ENSP00000313052:A2489V	A	-	2	0	HYDIN	69512311	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.624000	0.02038	-1.078000	0.03117	-0.199000	0.12753	GCG	.	.		0.617	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
METTL16	79066	hgsc.bcm.edu	37	17	2380980	2380980	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr17:2380980C>T	ENST00000263092.6	-	3	455	c.328G>A	c.(328-330)Ggc>Agc	p.G110S	METTL16_ENST00000571669.2_5'UTR|METTL16_ENST00000538844.1_5'UTR	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	110							methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						AATGATATACCTATGTCAATT	0.358																																					p.G110S		Atlas-SNP	.											.	METTL16	75	.	0			c.G328A						.						79.0	76.0	77.0					17																	2380980		1805	4065	5870	SO:0001630	splice_region_variant	79066	exon3			ATATACCTATGTC	AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.328+1G>A	chr17.hg19:g.2380980C>T		129.0	0.0		169.0	7.0	NM_024086	D3DTI8|Q86TE5|Q96T16|Q9BVG7	Missense_Mutation	SNP	ENST00000263092.6	hg19	CCDS42232.1	.	.	.	.	.	.	.	.	.	.	C	35	5.569941	0.96540	.	.	ENSG00000127804	ENST00000263092;ENST00000399834	T	0.47869	0.83	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.78648	0.4316	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	D	0.83610	0.0133	9	.	.	.	-7.6779	18.1573	0.89696	0.0:1.0:0.0:0.0	.	110;110	Q86W50-2;Q86W50	.;MET16_HUMAN	S	110	ENSP00000263092:G110S	.	G	-	1	0	METTL16	2327730	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.777000	0.68931	2.894000	0.99253	0.655000	0.94253	GGC	.	.		0.358	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437653.2	NM_024086	Missense_Mutation
LPO	4025	hgsc.bcm.edu	37	17	56344913	56344913	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr17:56344913G>A	ENST00000262290.4	+	12	2213	c.1897G>A	c.(1897-1899)Ggc>Agc	p.G633S	LPO_ENST00000582328.1_Missense_Mutation_p.G550S|LPO_ENST00000543544.1_Missense_Mutation_p.G574S|LPO_ENST00000421678.2_Missense_Mutation_p.G550S	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	633					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						CTGCCTCTTGGGCAAGCAGTT	0.632																																					p.G633S		Atlas-SNP	.											.	LPO	73	.	0			c.G1897A						.						48.0	50.0	49.0					17																	56344913		2203	4300	6503	SO:0001583	missense	4025	exon12			CTCTTGGGCAAGC	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1897G>A	chr17.hg19:g.56344913G>A	ENSP00000262290:p.Gly633Ser	71.0	0.0		124.0	49.0	NM_006151	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	ENST00000262290.4	hg19	CCDS32689.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655115	0.67472	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.68181	-0.31;-0.31;-0.31	4.83	4.83	0.62350	.	0.108147	0.64402	D	0.000008	T	0.76601	0.4010	L	0.58510	1.815	0.38293	D	0.942753	P;D	0.59767	0.853;0.986	P;P	0.61722	0.566;0.893	T	0.78165	-0.2310	10	0.37606	T	0.19	-24.5275	16.9436	0.86225	0.0:0.0:1.0:0.0	.	550;633	E7EMJ3;P22079	.;PERL_HUMAN	S	633;550;574;378	ENSP00000262290:G633S;ENSP00000400245:G550S;ENSP00000445344:G574S	ENSP00000262290:G633S	G	+	1	0	LPO	53699912	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.713000	0.61895	2.232000	0.73038	0.557000	0.71058	GGC	.	.		0.632	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1		
EVPL	2125	hgsc.bcm.edu	37	17	74005570	74005570	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr17:74005570T>A	ENST00000301607.3	-	22	3969	c.3716A>T	c.(3715-3717)gAg>gTg	p.E1239V	EVPL_ENST00000586740.1_Missense_Mutation_p.E1261V	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1239	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCGCAGGACCTCCAGGTCGGG	0.647																																					p.E1239V		Atlas-SNP	.											.	EVPL	155	.	0			c.A3716T						.						108.0	85.0	93.0					17																	74005570		2203	4300	6503	SO:0001583	missense	2125	exon22			AGGACCTCCAGGT	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3716A>T	chr17.hg19:g.74005570T>A	ENSP00000301607:p.Glu1239Val	36.0	0.0		79.0	9.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	hg19	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	T	5.958	0.360792	0.11296	.	.	ENSG00000167880	ENST00000301607	T	0.66460	-0.21	5.2	-3.06	0.05379	.	0.867405	0.10221	N	0.700900	T	0.45597	0.1350	N	0.24115	0.695	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.002	T	0.29427	-1.0012	10	0.49607	T	0.09	-6.6621	5.5331	0.16995	0.0693:0.1283:0.2782:0.5241	.	1261;1239	B7ZLH8;Q92817	.;EVPL_HUMAN	V	1239	ENSP00000301607:E1239V	ENSP00000301607:E1239V	E	-	2	0	EVPL	71517165	0.109000	0.22037	0.004000	0.12327	0.320000	0.28249	0.481000	0.22260	-0.451000	0.07097	0.449000	0.29647	GAG	.	.		0.647	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
TSHZ1	10194	hgsc.bcm.edu	37	18	73000060	73000060	+	Silent	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr18:73000060C>T	ENST00000580243.1	+	2	3046	c.2698C>T	c.(2698-2700)Ctg>Ttg	p.L900L	TSHZ1_ENST00000322038.5_Silent_p.L855L			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	900					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CCTTCTCATCCTGCAGGCCCA	0.607																																					p.L855L		Atlas-SNP	.											.	TSHZ1	104	.	0			c.C2563T						.						45.0	43.0	44.0					18																	73000060		2203	4300	6503	SO:0001819	synonymous_variant	10194	exon2			CTCATCCTGCAGG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2698C>T	chr18.hg19:g.73000060C>T		46.0	0.0		66.0	21.0	NM_005786	O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	hg19																																																																																				.	.		0.607	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
ZNF516	9658	hgsc.bcm.edu	37	18	74154504	74154504	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr18:74154504C>A	ENST00000443185.2	-	3	824	c.507G>T	c.(505-507)gaG>gaT	p.E169D	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGCCTTGGCCTCCCCCGGGG	0.677																																					p.E169D		Atlas-SNP	.											.	ZNF516	102	.	0			c.G507T						.						12.0	15.0	14.0					18																	74154504		2047	4159	6206	SO:0001583	missense	9658	exon3			CTTGGCCTCCCCC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.507G>T	chr18.hg19:g.74154504C>A	ENSP00000394757:p.Glu169Asp	19.0	0.0		37.0	16.0	NM_014643		Missense_Mutation	SNP	ENST00000443185.2	hg19		.	.	.	.	.	.	.	.	.	.	C	0.540	-0.853986	0.02630	.	.	ENSG00000101493	ENST00000443185	T	0.10192	2.9	4.41	0.156	0.14910	.	2.655290	0.01405	N	0.013770	T	0.05364	0.0142	.	.	.	0.09310	N	0.999993	B	0.10296	0.003	B	0.06405	0.002	T	0.30995	-0.9959	9	0.10902	T	0.67	-31.5803	4.2166	0.10537	0.258:0.3087:0.358:0.0753	.	169	Q92618	ZN516_HUMAN	D	169	ENSP00000394757:E169D	ENSP00000394757:E169D	E	-	3	2	ZNF516	72283492	0.000000	0.05858	0.004000	0.12327	0.038000	0.13279	-0.786000	0.04623	-0.088000	0.12506	0.655000	0.94253	GAG	.	.		0.677	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
HMHA1	23526	hgsc.bcm.edu	37	19	1080975	1080975	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr19:1080975G>A	ENST00000313093.2	+	17	2333	c.2102G>A	c.(2101-2103)cGt>cAt	p.R701H	HMHA1_ENST00000543365.1_Missense_Mutation_p.R584H|HMHA1_ENST00000590577.1_Missense_Mutation_p.R336H|HMHA1_ENST00000536472.1_Missense_Mutation_p.R569H|HMHA1_ENST00000590214.1_Missense_Mutation_p.R728H|HMHA1_ENST00000586866.1_Missense_Mutation_p.R705H|HMHA1_ENST00000539243.2_Missense_Mutation_p.R717H	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	701					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCGGCCCGTACTCACCGG	0.682																																					p.R717H		Atlas-SNP	.											.	HMHA1	78	.	0			c.G2150A						.						17.0	19.0	18.0					19																	1080975		2189	4290	6479	SO:0001583	missense	23526	exon17			CGGCCCGTACTCA	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2102G>A	chr19.hg19:g.1080975G>A	ENSP00000316772:p.Arg701His	121.0	0.0		203.0	48.0	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	hg19	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	g	13.68	2.309260	0.40895	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	4.19	1.79	0.24919	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.432253	0.24999	N	0.033932	T	0.79787	0.4506	L	0.28274	0.84	0.29586	N	0.848821	D;D;B;D;D	0.64830	0.994;0.986;0.283;0.986;0.977	P;P;B;P;P	0.57283	0.817;0.742;0.03;0.742;0.556	T	0.71761	-0.4495	10	0.39692	T	0.17	-4.7806	2.0599	0.03590	0.368:0.0:0.3823:0.2497	.	569;717;336;584;701	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	H	717;701;701;569;695;584	ENSP00000439601:R717H;ENSP00000316772:R701H;ENSP00000445109:R569H;ENSP00000438979:R584H	ENSP00000316772:R701H	R	+	2	0	HMHA1	1031975	0.912000	0.30974	0.056000	0.19401	0.162000	0.22319	2.156000	0.42310	0.752000	0.32923	-0.320000	0.08662	CGT	.	.		0.682	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
NOTCH3	4854	hgsc.bcm.edu	37	19	15291624	15291624	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr19:15291624A>C	ENST00000263388.2	-	19	3085	c.3010T>G	c.(3010-3012)Tgc>Ggc	p.C1004G		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1004	EGF-like 26. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGGCGGCTGCACCAATCCACC	0.617																																					p.C1004G		Atlas-SNP	.											.	NOTCH3	340	.	0			c.T3010G						.						29.0	28.0	28.0					19																	15291624		2203	4299	6502	SO:0001583	missense	4854	exon19			GGCTGCACCAATC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3010T>G	chr19.hg19:g.15291624A>C	ENSP00000263388:p.Cys1004Gly	64.0	0.0		74.0	33.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	hg19	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098801	0.56183	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.99992	-12.4	5.13	5.13	0.70059	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.34986	N	0.003536	D	0.99994	0.9999	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99989	1.3860	10	0.87932	D	0	.	13.9468	0.64089	1.0:0.0:0.0:0.0	.	955;1004	Q59FL3;Q9UM47	.;NOTC3_HUMAN	G	1004;954	ENSP00000263388:C1004G	ENSP00000263388:C1004G	C	-	1	0	NOTCH3	15152624	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	7.063000	0.76714	1.941000	0.56285	0.460000	0.39030	TGC	.	.		0.617	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
ZFP82	284406	hgsc.bcm.edu	37	19	36884752	36884752	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr19:36884752G>T	ENST00000392161.3	-	5	732	c.490C>A	c.(490-492)Cat>Aat	p.H164N	ZFP82_ENST00000392171.1_Missense_Mutation_p.H164N	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCAACAAAATGAAGTCTCTGA	0.423																																					p.H164N		Atlas-SNP	.											.	ZFP82	71	.	0			c.C490A						.						110.0	101.0	104.0					19																	36884752		2203	4300	6503	SO:0001583	missense	284406	exon5			CAAAATGAAGTCT	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.490C>A	chr19.hg19:g.36884752G>T	ENSP00000431265:p.His164Asn	121.0	0.0		145.0	47.0	NM_133466	Q8NC63|Q8TF53	Missense_Mutation	SNP	ENST00000392161.3	hg19	CCDS12493.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382627	0.25031	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	T;T	0.67345	-0.26;-0.26	3.9	2.86	0.33363	.	0.578072	0.14403	N	0.321742	T	0.71384	0.3333	M	0.92412	3.305	0.30660	N	0.754552	B	0.06786	0.001	B	0.14578	0.011	T	0.71721	-0.4507	10	0.46703	T	0.11	.	9.2543	0.37573	0.112:0.0:0.888:0.0	.	164	Q8N141	ZFP82_HUMAN	N	164	ENSP00000431265:H164N;ENSP00000446080:H164N	ENSP00000431265:H164N	H	-	1	0	ZFP82	41576592	0.999000	0.42202	0.989000	0.46669	0.909000	0.53808	3.385000	0.52485	2.196000	0.70406	0.650000	0.86243	CAT	.	.		0.423	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	NM_133466	
SARS2	54938	hgsc.bcm.edu	37	19	39421215	39421215	+	Silent	SNP	T	T	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr19:39421215T>C	ENST00000221431.6	-	1	321	c.162A>G	c.(160-162)gcA>gcG	p.A54A	SARS2_ENST00000600042.1_Silent_p.A54A|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000448145.2_Intron|MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000594171.1_5'Flank|SARS2_ENST00000430193.3_Silent_p.A54A|CTC-360G5.8_ENST00000599996.1_Intron	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	54					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCTGAGGGAGTGCGCTGTAGC	0.627											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A54A		Atlas-SNP	.											.	SARS2	33	.	0			c.A162G						.						91.0	80.0	84.0					19																	39421215		2203	4300	6503	SO:0001819	synonymous_variant	54938	exon1			AGGGAGTGCGCTG	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.162A>G	chr19.hg19:g.39421215T>C		46.0	0.0	885	80.0	30.0	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Silent	SNP	ENST00000221431.6	hg19	CCDS33017.1																																																																																			.	.		0.627	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
SAMD4B	55095	hgsc.bcm.edu	37	19	39867144	39867144	+	Silent	SNP	C	C	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr19:39867144C>T	ENST00000314471.6	+	8	2010	c.975C>T	c.(973-975)taC>taT	p.Y325Y	SAMD4B_ENST00000596368.1_Intron|SAMD4B_ENST00000598913.1_Silent_p.Y325Y	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	325	SAM.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			AGATGAGCTACGAGGAGATGA	0.557																																					p.Y325Y		Atlas-SNP	.											.	SAMD4B	48	.	0			c.C975T						.						72.0	60.0	64.0					19																	39867144		2203	4300	6503	SO:0001819	synonymous_variant	55095	exon8			GAGCTACGAGGAG		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.975C>T	chr19.hg19:g.39867144C>T		47.0	0.0		74.0	28.0	NM_018028	A5Z0M6|Q6P194	Silent	SNP	ENST00000314471.6	hg19	CCDS33020.1																																																																																			.	.		0.557	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028	
IRF2BP1	26145	hgsc.bcm.edu	37	19	46388496	46388496	+	Silent	SNP	C	C	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr19:46388496C>A	ENST00000302165.3	-	1	880	c.537G>T	c.(535-537)ctG>ctT	p.L179L		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		GTGCCAGCGTCAGGCCTCGGC	0.647																																					p.L179L		Atlas-SNP	.											.	IRF2BP1	23	.	0			c.G537T						.						29.0	36.0	34.0					19																	46388496		2199	4289	6488	SO:0001819	synonymous_variant	26145	exon1			CAGCGTCAGGCCT	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.537G>T	chr19.hg19:g.46388496C>A		35.0	0.0		62.0	28.0	NM_015649	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Silent	SNP	ENST00000302165.3	hg19	CCDS12678.1																																																																																			.	.		0.647	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
CD93	22918	hgsc.bcm.edu	37	20	23066284	23066284	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr20:23066284G>T	ENST00000246006.4	-	1	693	c.546C>A	c.(544-546)ttC>ttA	p.F182L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	182					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CTTTGAAGCTGAACTTGCACA	0.657																																					p.F182L		Atlas-SNP	.											.	CD93	84	.	0			c.C546A						.						45.0	52.0	50.0					20																	23066284		2203	4300	6503	SO:0001583	missense	22918	exon1			GAAGCTGAACTTG	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.546C>A	chr20.hg19:g.23066284G>T	ENSP00000246006:p.Phe182Leu	49.0	0.0		79.0	31.0	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	hg19	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269777	0.80469	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.40756	1.02	5.52	4.58	0.56647	C-type lectin fold (1);C-type lectin-like (1);	0.000000	0.64402	D	0.000005	T	0.64057	0.2564	M	0.80422	2.495	0.40964	D	0.984641	D	0.67145	0.996	D	0.65443	0.935	T	0.71122	-0.4684	10	0.72032	D	0.01	-44.2406	13.7324	0.62797	0.0741:0.0:0.9259:0.0	.	182	Q9NPY3	C1QR1_HUMAN	L	182	ENSP00000246006:F182L	ENSP00000246006:F182L	F	-	3	2	CD93	23014284	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.988000	0.49386	1.469000	0.48083	-0.136000	0.14681	TTC	.	.		0.657	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
ACTR5	79913	hgsc.bcm.edu	37	20	37378813	37378813	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr20:37378813C>A	ENST00000243903.4	+	2	573	c.536C>A	c.(535-537)tCg>tAg	p.S179*		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	179					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CCAAAGAACTCGATGTGCAGT	0.453																																					p.S179X		Atlas-SNP	.											.	ACTR5	44	.	0			c.C536A						.						146.0	131.0	136.0					20																	37378813		2203	4300	6503	SO:0001587	stop_gained	79913	exon2			AGAACTCGATGTG	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.536C>A	chr20.hg19:g.37378813C>A	ENSP00000243903:p.Ser179*	122.0	0.0		192.0	77.0	NM_024855	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Nonsense_Mutation	SNP	ENST00000243903.4	hg19	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859025	0.71834	.	.	ENSG00000101442	ENST00000243903	.	.	.	4.4	-0.149	0.13420	.	0.700022	0.14102	N	0.341300	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-0.2407	5.8	0.18408	0.0:0.2642:0.3542:0.3815	.	.	.	.	X	179	.	ENSP00000243903:S179X	S	+	2	0	ACTR5	36812227	0.006000	0.16342	0.004000	0.12327	0.628000	0.37860	0.416000	0.21198	0.069000	0.16605	0.467000	0.42956	TCG	.	.		0.453	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
GPR143	4935	hgsc.bcm.edu	37	X	9709456	9709456	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chrX:9709456A>C	ENST00000467482.1	-	7	953	c.807T>G	c.(805-807)taT>taG	p.Y269*	GPR143_ENST00000487206.1_5'Flank|GPR143_ENST00000380929.2_Nonsense_Mutation_p.Y289*			P51810	GP143_HUMAN	G protein-coupled receptor 143	269					calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)			endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				GCATCTCAAGATAGAATAAAA	0.353																																					p.Y269X		Atlas-SNP	.											.	GPR143	37	.	0			c.T807G						.						70.0	63.0	66.0					X																	9709456		2203	4300	6503	SO:0001587	stop_gained	4935	exon7			CTCAAGATAGAAT	Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.807T>G	chrX.hg19:g.9709456A>C	ENSP00000417161:p.Tyr269*	473.0	0.0		601.0	228.0	NM_000273	Q6NTI7	Nonsense_Mutation	SNP	ENST00000467482.1	hg19	CCDS14134.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	35|35	5.493393|5.493393	0.96339|0.96339	.|.	.|.	ENSG00000101850|ENSG00000101850	ENST00000447366|ENST00000467482;ENST00000380929	.|.	.|.	.|.	4.91|4.91	-0.52|-0.52	0.11935|0.11935	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.23649|.	0.0572|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41662|.	-0.9496|.	3|.	.|0.02654	.|T	.|1	-4.2142|-4.2142	11.9238|11.9238	0.52808|0.52808	0.1933:0.0:0.8067:0.0|0.1933:0.0:0.8067:0.0	.|.	.|.	.|.	.|.	A|X	205|269;289	.|.	.|ENSP00000370316:Y289X	S|Y	-|-	1|3	0|2	GPR143|GPR143	9669456|9669456	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	1.565000|1.565000	0.36386|0.36386	-0.142000|-0.142000	0.11354|0.11354	0.486000|0.486000	0.48141|0.48141	TCT|TAT	.	.		0.353	GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055714.2	NM_000273	
ZC3H12B	340554	hgsc.bcm.edu	37	X	64722582	64722582	+	Silent	SNP	T	T	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chrX:64722582T>A	ENST00000338957.4	+	5	2071	c.2004T>A	c.(2002-2004)acT>acA	p.T668T	ZC3H12B_ENST00000423889.3_Silent_p.T657T	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	668							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACCCATCAACTGGAACACGTT	0.592																																					p.T668T		Atlas-SNP	.											.	ZC3H12B	144	.	0			c.T2004A						.						59.0	60.0	60.0					X																	64722582		2000	4148	6148	SO:0001819	synonymous_variant	340554	exon5			ATCAACTGGAACA	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.2004T>A	chrX.hg19:g.64722582T>A		92.0	0.0		152.0	14.0	NM_001010888	B2RTQ3|E9PAJ6|Q5H9C0	Silent	SNP	ENST00000338957.4	hg19	CCDS48131.2																																																																																			.	.		0.592	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334	
ZC3H12B	340554	hgsc.bcm.edu	37	X	64722584	64722584	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chrX:64722584G>A	ENST00000338957.4	+	5	2073	c.2006G>A	c.(2005-2007)gGa>gAa	p.G669E	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.G658E	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	669							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCATCAACTGGAACACGTTCC	0.582																																					p.G669E		Atlas-SNP	.											.	ZC3H12B	144	.	0			c.G2006A						.						59.0	60.0	60.0					X																	64722584		2008	4153	6161	SO:0001583	missense	340554	exon5			CAACTGGAACACG	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.2006G>A	chrX.hg19:g.64722584G>A	ENSP00000340839:p.Gly669Glu	94.0	0.0		151.0	14.0	NM_001010888	B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	hg19	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602132	0.66445	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.25579	1.79;1.8	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.52968	-0.8504	10	0.87932	D	0	-40.2415	15.9994	0.80280	0.0:0.0:1.0:0.0	.	658	Q5HYM0	ZC12B_HUMAN	E	669;658;605	ENSP00000340839:G669E;ENSP00000408077:G658E	ENSP00000218172:G605E	G	+	2	0	ZC3H12B	64639309	1.000000	0.71417	0.939000	0.37840	0.983000	0.72400	7.341000	0.79300	2.346000	0.79739	0.506000	0.49869	GGA	.	.		0.582	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334	
MAZ	4150	hgsc.bcm.edu	37	16	29821424	29821444	+	In_Frame_Del	DEL	GCGGCAGCGGCAGCGGCGGCA	GCGGCAGCGGCAGCGGCGGCA	-	rs370462022|rs374878500|rs372208027|rs530039776|rs532656391|rs368894015|rs370548510|rs75194070|rs201662748|rs199924629	byFrequency	TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	GCGGCAGCGGCAGCGGCGGCA	GCGGCAGCGGCAGCGGCGGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr16:29821424_29821444delGCGGCAGCGGCAGCGGCGGCA	ENST00000322945.6	+	5	1471_1491	c.1306_1326delGCGGCAGCGGCAGCGGCGGCA	c.(1306-1326)gcggcagcggcagcggcggcadel	p.AAAAAAA436del	PRRT2_ENST00000567659.1_5'Flank|PRRT2_ENST00000358758.7_5'Flank|MAZ_ENST00000562337.1_In_Frame_Del_p.AAAAAAA131del|PRRT2_ENST00000300797.6_5'Flank|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000568544.1_In_Frame_Del_p.AAAAAAA37del|MAZ_ENST00000566906.2_Splice_Site_p.94_97GGSG>G|AC009133.20_ENST00000569039.1_RNA|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000563402.1_Splice_Site_p.94_99GGSGSG>G|MAZ_ENST00000219782.6_3'UTR|MAZ_ENST00000545521.1_In_Frame_Del_p.AAAAAAA413del|AC009133.14_ENST00000563806.1_RNA	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	436	Poly-Ala.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TCCAATggcggcggcagcggcagcggcggcagcggcagcag	0.665																																					p.435_442del	Colon(72;875 1167 15364 30899 37091)	Atlas-INDEL	.											.	MAZ	48	.	0			c.1305_1325del						.																																			SO:0001651	inframe_deletion	4150	exon5			.	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1306_1326delGCGGCAGCGGCAGCGGCGGCA	chr16.hg19:g.29821424_29821444delGCGGCAGCGGCAGCGGCGGCA	ENSP00000313362:p.Ala436_Ala442del	66.0	0.0		141.0	44.0	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	In_Frame_Del	DEL	ENST00000322945.6	hg19	CCDS42143.1																																																																																			.	.		0.665	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
PDCD6IP	10015	hgsc.bcm.edu	37	3	33866810	33866811	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr3:33866810_33866811insT	ENST00000307296.3	+	5	971_972	c.594_595insT	c.(595-597)tttfs	p.F199fs	PDCD6IP_ENST00000457054.2_Frame_Shift_Ins_p.F199fs			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	199	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.|Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						CTCAAGAAGTATTTTTTTTAAA	0.366																																					p.V198fs		Atlas-INDEL	.											.	PDCD6IP	62	.	0			c.594_595insT						.																																			SO:0001589	frameshift_variant	10015	exon5			.	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.602dupT	chr3.hg19:g.33866818_33866818dupT	ENSP00000307387:p.Phe199fs	107.0	0.0		174.0	11.0	NM_001256192	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Frame_Shift_Ins	INS	ENST00000307296.3	hg19	CCDS2660.1																																																																																			.	.		0.366	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
CC2D2A	57545	hgsc.bcm.edu	37	4	15517558	15517559	+	Frame_Shift_Ins	INS	-	-	G	rs201439700|rs188018643	byFrequency	TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr4:15517558_15517559insG	ENST00000503292.1	+	11	1128_1129	c.948_949insG	c.(949-951)gggfs	p.G317fs	CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000389652.5_Frame_Shift_Ins_p.G268fs|CC2D2A_ENST00000413206.1_Frame_Shift_Ins_p.G317fs|CC2D2A_ENST00000424120.1_Frame_Shift_Ins_p.G317fs	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	317					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)		p.G268R(1)|p.T267T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GCCTTTACACCGGGGTAAGACC	0.455																																					p.T316fs		Atlas-INDEL	.											CC2D2A,caecum,carcinoma,0,1	CC2D2A	158	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.948_949insG						.																																			SO:0001589	frameshift_variant	57545	exon11			.	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.952dupG	chr4.hg19:g.15517562_15517562dupG	ENSP00000421809:p.Gly317fs	106.0	0.0		146.0	53.0	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Frame_Shift_Ins	INS	ENST00000503292.1	hg19	CCDS47026.1																																																																																			.	.		0.455	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
AHDC1	27245	hgsc.bcm.edu	37	1	27878204	27878206	+	In_Frame_Del	DEL	ACT	ACT	-			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	ACT	ACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:27878204_27878206delACT	ENST00000247087.5	-	5	1017_1019	c.421_423delAGT	c.(421-423)agtdel	p.S141del	AHDC1_ENST00000374011.2_In_Frame_Del_p.S141del			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	141	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGTGTACACCACTGTGCTGCAGG	0.635																																					p.141_142del		Atlas-INDEL	.											.	AHDC1	98	.	0			c.422_424del						.																																			SO:0001651	inframe_deletion	27245	exon6			.	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.421_423delAGT	chr1.hg19:g.27878204_27878206delACT	ENSP00000247087:p.Ser141del	123.0	0.0		173.0	48.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	In_Frame_Del	DEL	ENST00000247087.5	hg19	CCDS30652.1																																																																																			.	.		0.635	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
KRTAP10-3	386682	hgsc.bcm.edu	37	21	45978509	45978509	+	Frame_Shift_Del	DEL	G	G	-	rs587665364	byFrequency	TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr21:45978509delG	ENST00000391620.1	-	1	134	c.90delC	c.(88-90)cccfs	p.P30fs	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	30	18 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						TGGCGCAGCAGGGGGGCTCAC	0.697													GGGGGG|GGGGGG|GGGGG|deletion	6	0.00119808	0.0	0.0	5008	,	,		16049	0.0		0.0	False		,,,				2504	0.0061				p.C31fs		Atlas-INDEL	.											.	KRTAP10-3	17	.	0			c.91delT						.						29.0	31.0	30.0					21																	45978509		2165	4257	6422	SO:0001589	frameshift_variant	386682	exon1			.	AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.90delC	chr21.hg19:g.45978509delG	ENSP00000375478:p.Pro30fs	39.0	0.0		79.0	29.0	NM_198696	A3KN67|Q70LJ4	Frame_Shift_Del	DEL	ENST00000391620.1	hg19	CCDS42956.1																																																																																			.	.		0.697	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1		
CAMTA1	23261	hgsc.bcm.edu	37	1	7725035	7725036	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-DD-AAE4-01A-11D-A40R-10	TCGA-DD-AAE4-10A-01D-A40U-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef673fe7-a934-4041-8258-a4af537977c6	ff5a3218-ca2c-4eac-a8cb-c88524c95f7b	g.chr1:7725035_7725036delGC	ENST00000303635.7	+	9	2635_2636	c.2428_2429delGC	c.(2428-2430)gcgfs	p.A810fs	CAMTA1_ENST00000439411.2_Frame_Shift_Del_p.A810fs	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	810					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A810V(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AGAGGACGGGGCGCGGGCCCCC	0.678			T	WWTR1	epitheliod hemangioendothelioma																																p.809_810del		Atlas-INDEL	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	1	Substitution - Missense(1)	endometrium(1)	c.2427_2428del						.																																			SO:0001589	frameshift_variant	23261	exon9			.	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2428_2429delGC	chr1.hg19:g.7725037_7725038delGC	ENSP00000306522:p.Ala810fs	104.0	0.0		149.0	48.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Frame_Shift_Del	DEL	ENST00000303635.7	hg19	CCDS30576.1																																																																																			.	.		0.678	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
