#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC2A5	6518	hgsc.bcm.edu	37	1	9098489	9098489	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:9098489C>T	ENST00000377424.4	-	10	1354		c.e10+1		SLC2A5_ENST00000535586.1_Splice_Site|SLC2A5_ENST00000536305.1_Splice_Site	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5						carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGTACGTACTGGGCCCGAG	0.577																																					.		Atlas-SNP	.											.	SLC2A5	77	.	0			c.1174+1G>A						.						111.0	99.0	103.0					1																	9098489		2203	4299	6502	SO:0001630	splice_region_variant	6518	exon11			TACGTACTGGGCC	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1174+1G>A	chr1.hg19:g.9098489C>T		70.0	0.0		65.0	20.0	NM_003039	Q14770|Q5T977|Q8IVB3	Splice_Site	SNP	ENST00000377424.4	hg19	CCDS99.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258234	0.39896	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1758	0.86841	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC2A5	9021076	1.000000	0.71417	0.999000	0.59377	0.088000	0.18126	7.410000	0.80065	2.396000	0.81511	0.655000	0.94253	.	.	.		0.577	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	Intron
LRRC38	126755	hgsc.bcm.edu	37	1	13839858	13839858	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:13839858G>A	ENST00000376085.3	-	1	685	c.231C>T	c.(229-231)atC>atT	p.I77I	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	77					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CGCCGTAGAAGATGAAGAAGT	0.657																																					p.I77I		Atlas-SNP	.											.	LRRC38	12	.	0			c.C231T						.																																			SO:0001819	synonymous_variant	126755	exon1			GTAGAAGATGAAG	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.231C>T	chr1.hg19:g.13839858G>A		150.0	0.0		135.0	40.0	NM_001010847	Q96B32	Silent	SNP	ENST00000376085.3	hg19	CCDS53269.1																																																																																			.	.		0.657	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
ARID1A	8289	hgsc.bcm.edu	37	1	27101213	27101213	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:27101213C>T	ENST00000324856.7	+	18	4866	c.4495C>T	c.(4495-4497)Cag>Tag	p.Q1499*	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q1116*|ARID1A_ENST00000457599.2_Intron	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1499					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CACCATGTGGCAGGGGCGTAA	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q1499X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.C4495T						.						70.0	73.0	72.0					1																	27101213		2203	4300	6503	SO:0001587	stop_gained	8289	exon18			ATGTGGCAGGGGC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4495C>T	chr1.hg19:g.27101213C>T	ENSP00000320485:p.Gln1499*	68.0	0.0		97.0	5.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	10.678996|10.678996	0.99448|0.99448	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000374152	.|.	.|.	.|.	5.54|5.54	4.61|4.61	0.57282|0.57282	.|.	.|0.051740	.|0.85682	.|D	.|0.000000	T|.	0.65954|.	0.2741|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.61594|.	-0.7031|.	4|.	.|0.20519	.|T	.|0.43	-6.4368|-6.4368	16.3406|16.3406	0.83081|0.83081	0.0:0.8679:0.1321:0.0|0.0:0.8679:0.1321:0.0	.|.	.|.	.|.	.|.	V|X	395|1499;1116	.|.	.|ENSP00000320485:Q1499X	A|Q	+|+	2|1	0|0	ARID1A|ARID1A	26973800|26973800	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.228000|7.228000	0.78079|0.78079	1.541000|1.541000	0.49316|0.49316	0.650000|0.650000	0.86243|0.86243	GCA|CAG	.	.		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
RAB42	115273	hgsc.bcm.edu	37	1	28920207	28920207	+	5'UTR	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:28920207T>A	ENST00000373826.3	+	0	202				TAF12_ENST00000471683.1_Intron|RAB42_ENST00000465518.1_3'UTR	NM_152304.1	NP_689517.1	Q8N4Z0	RAB42_HUMAN	RAB42, member RAS oncogene family						small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCCCCAGGTGCATCACCAG	0.572																																					p.C79S		Atlas-SNP	.											.	RAB42	10	.	0			c.T235A						.																																			SO:0001623	5_prime_UTR_variant	115273	exon2			CCCAGGTGCATCA	BC033175	CCDS325.1	1p35.3	2014-02-12	2006-04-28		ENSG00000188060	ENSG00000188060		"""RAB, member RAS oncogene"""	28702	protein-coding gene	gene with protein product			"""RAB42, member RAS homolog family"""				Standard	NM_152304		Approved	MGC45806	uc001bqv.3	Q8N4Z0	OTTHUMG00000003656	ENST00000373826.3:c.-105T>A	chr1.hg19:g.28920207T>A		34.0	0.0		38.0	10.0	NM_001193532	B2R5G2	Missense_Mutation	SNP	ENST00000373826.3	hg19	CCDS325.1																																																																																			.	.		0.572	RAB42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010371.1	NM_152304	
SNRNP40	9410	hgsc.bcm.edu	37	1	31766196	31766196	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:31766196C>A	ENST00000263694.4	-	2	160		c.e2-1		SNRNP40_ENST00000446633.2_Splice_Site	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						TTGGAGGTCCCTAAACAAAAG	0.488																																					.		Atlas-SNP	.											.	SNRNP40	18	.	0			c.142-1G>T						.						63.0	53.0	56.0					1																	31766196		2203	4300	6503	SO:0001630	splice_region_variant	9410	exon3			AGGTCCCTAAACA	AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.142-1G>T	chr1.hg19:g.31766196C>A		81.0	0.0		102.0	22.0	NM_004814	B4DQJ1|O75938|O95320	Splice_Site	SNP	ENST00000263694.4	hg19	CCDS340.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408012	0.83340	.	.	ENSG00000060688	ENST00000263694;ENST00000446633	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0483	0.93030	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNRNP40	31538783	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.709000	0.84645	2.495000	0.84180	0.655000	0.94253	.	.	.		0.488	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010657.1	NM_004814	Intron
GNL2	29889	hgsc.bcm.edu	37	1	38061409	38061409	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:38061409C>T	ENST00000373062.3	-	1	113	c.15G>A	c.(13-15)aaG>aaA	p.K5K		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	5					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				GTCCTTTGTACTTGGGCTTCA	0.582																																					p.K5K		Atlas-SNP	.											.	GNL2	58	.	0			c.G15A						.						135.0	105.0	116.0					1																	38061409		2203	4300	6503	SO:0001819	synonymous_variant	29889	exon1			TTTGTACTTGGGC	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.15G>A	chr1.hg19:g.38061409C>T		73.0	0.0		61.0	13.0	NM_013285	Q9BWN7	Silent	SNP	ENST00000373062.3	hg19	CCDS421.1																																																																																			.	.		0.582	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
TOE1	114034	hgsc.bcm.edu	37	1	45809148	45809148	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:45809148G>A	ENST00000372090.5	+	8	1890	c.1307G>A	c.(1306-1308)gGa>gAa	p.G436E	TOE1_ENST00000539779.1_Missense_Mutation_p.G356E|TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000486676.1_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	436						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					CCTGGGGATGGATTGCACCGG	0.557																																					p.G436E		Atlas-SNP	.											.	TOE1	27	.	0			c.G1307A						.						89.0	82.0	84.0					1																	45809148		2203	4300	6503	SO:0001583	missense	114034	exon8			GGGATGGATTGCA		CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.1307G>A	chr1.hg19:g.45809148G>A	ENSP00000361162:p.Gly436Glu	59.0	0.0		88.0	28.0	NM_025077	B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	ENST00000372090.5	hg19	CCDS521.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772275	0.90108	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.22539	1.95;1.95	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.50377	0.1612	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.41484	-0.9506	10	0.87932	D	0	-13.2037	20.8794	0.99867	0.0:0.0:1.0:0.0	.	356;436	B4DEM6;Q96GM8	.;TOE1_HUMAN	E	436;356	ENSP00000361162:G436E;ENSP00000438900:G356E	ENSP00000361162:G436E	G	+	2	0	TOE1	45581735	0.984000	0.35163	0.968000	0.41197	0.981000	0.71138	2.009000	0.40903	2.941000	0.99782	0.655000	0.94253	GGA	.	.		0.557	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077	
MAST2	23139	hgsc.bcm.edu	37	1	46497890	46497890	+	Silent	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:46497890A>T	ENST00000361297.2	+	25	3511	c.3228A>T	c.(3226-3228)ccA>ccT	p.P1076P	MAST2_ENST00000372009.2_Silent_p.P1006P	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CCATGTCCCCACATTCTCAGT	0.607																																					p.P1076P		Atlas-SNP	.											.	MAST2	136	.	0			c.A3228T						.						80.0	87.0	85.0					1																	46497890		2032	4191	6223	SO:0001819	synonymous_variant	23139	exon25			GTCCCCACATTCT	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3228A>T	chr1.hg19:g.46497890A>T		58.0	0.0		77.0	25.0	NM_015112		Silent	SNP	ENST00000361297.2	hg19	CCDS41326.1																																																																																			.	.		0.607	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
NRD1	4898	hgsc.bcm.edu	37	1	52281991	52281991	+	Silent	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:52281991T>G	ENST00000354831.7	-	13	1825	c.1636A>C	c.(1636-1638)Agg>Cgg	p.R546R	NRD1_ENST00000352171.7_Silent_p.R478R|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000544028.1_Silent_p.R346R|NRD1_ENST00000539524.1_Silent_p.R414R	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	477					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TGCTTTTTCCTAAGGAAAGAA	0.308																																					p.R546R		Atlas-SNP	.											.	NRD1	89	.	0			c.A1636C						.						57.0	62.0	60.0					1																	52281991		2203	4296	6499	SO:0001819	synonymous_variant	4898	exon13			TTTTCCTAAGGAA	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1636A>C	chr1.hg19:g.52281991T>G		236.0	0.0		428.0	118.0	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Silent	SNP	ENST00000354831.7	hg19	CCDS559.1																																																																																			.	.		0.308	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
MYSM1	114803	hgsc.bcm.edu	37	1	59158557	59158557	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:59158557A>G	ENST00000472487.1	-	3	233	c.194T>C	c.(193-195)aTt>aCt	p.I65T		NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	65					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					CATTTTCTCAATAACAGCTCT	0.308																																					p.I65T		Atlas-SNP	.											.	MYSM1	50	.	0			c.T194C						.						201.0	200.0	200.0					1																	59158557		1826	4084	5910	SO:0001583	missense	114803	exon3			TTCTCAATAACAG	AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.194T>C	chr1.hg19:g.59158557A>G	ENSP00000418734:p.Ile65Thr	35.0	0.0		66.0	18.0	NM_001085487	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	ENST00000472487.1	hg19	CCDS41343.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.288396	0.80803	.	.	ENSG00000162601	ENST00000472487	T	0.36157	1.27	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	L	0.34521	1.04	0.58432	D	0.999995	D	0.76494	0.999	D	0.80764	0.994	T	0.51387	-0.8712	10	0.87932	D	0	-14.118	14.345	0.66654	1.0:0.0:0.0:0.0	.	65	Q5VVJ2	MYSM1_HUMAN	T	65	ENSP00000418734:I65T	ENSP00000418734:I65T	I	-	2	0	MYSM1	58931145	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.772000	0.85439	2.254000	0.74563	0.460000	0.39030	ATT	.	.		0.308	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481	
DOCK7	85440	hgsc.bcm.edu	37	1	62941590	62941590	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:62941590C>T	ENST00000340370.5	-	45	5673	c.5656G>A	c.(5656-5658)Gag>Aag	p.E1886K	DOCK7_ENST00000489185.1_5'UTR|DOCK7_ENST00000251157.5_Missense_Mutation_p.E1906K	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1917	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AAGTATGGCTCCACATAGGTA	0.353																																					p.E1906K		Atlas-SNP	.											.	DOCK7	184	.	0			c.G5716A						.						139.0	139.0	139.0					1																	62941590		2203	4300	6503	SO:0001583	missense	85440	exon45			ATGGCTCCACATA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5656G>A	chr1.hg19:g.62941590C>T	ENSP00000340742:p.Glu1886Lys	27.0	0.0		64.0	16.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	hg19	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.712779|5.712779	0.96830|0.96830	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441|ENST00000454575	T;T|.	0.15718|.	2.41;2.4|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75722|0.75722	0.3888|0.3888	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.998;1.0;0.998;0.999;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.996;0.999;0.997;0.996;0.999;0.997|.	T|T	0.72966|0.72966	-0.4131|-0.4131	10|5	0.72032|.	D|.	0.01|.	.|.	19.8965|19.8965	0.96963|0.96963	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1917;1906;1886;1875;1877;1908|.	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6|.	DOCK7_HUMAN;.;.;.;.;.|.	K|E	1917;1906;1886;647|1079	ENSP00000251157:E1906K;ENSP00000340742:E1886K|.	ENSP00000251157:E1906K|.	E|G	-|-	1|2	0|0	DOCK7|DOCK7	62714178|62714178	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.717000|2.717000	0.92951|0.92951	0.655000|0.655000	0.94253|0.94253	GAG|GGA	.	.		0.353	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77334301	77334301	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:77334301A>G	ENST00000477717.1	+	2	370	c.135A>G	c.(133-135)caA>caG	p.Q45Q	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	45	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						agcagcagcaacagcagcagc	0.716																																					p.Q45Q		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.A135G						.						11.0	12.0	12.0					1																	77334301		2032	3963	5995	SO:0001819	synonymous_variant	81849	exon2			GCAGCAACAGCAG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.135A>G	chr1.hg19:g.77334301A>G		131.0	0.0		98.0	4.0	NM_030965	B1AK82	Silent	SNP	ENST00000477717.1	hg19	CCDS673.1																																																																																			.	.		0.716	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
WDR63	126820	hgsc.bcm.edu	37	1	85551546	85551546	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:85551546A>G	ENST00000294664.6	+	7	753	c.573A>G	c.(571-573)gaA>gaG	p.E191E	WDR63_ENST00000370596.1_Silent_p.E191E|WDR63_ENST00000326813.8_Silent_p.E191E	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	191										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		AACGAAGTGAATTTGGTGCAC	0.358																																					p.E191E		Atlas-SNP	.											.	WDR63	91	.	0			c.A573G						.						109.0	100.0	103.0					1																	85551546		2203	4300	6503	SO:0001819	synonymous_variant	126820	exon7			AAGTGAATTTGGT		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.573A>G	chr1.hg19:g.85551546A>G		147.0	0.0		265.0	82.0	NM_145172	A8K988|Q96L72|Q96NU4	Silent	SNP	ENST00000294664.6	hg19	CCDS702.1																																																																																			.	.		0.358	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172	
CSF1	1435	hgsc.bcm.edu	37	1	110464543	110464543	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:110464543G>T	ENST00000329608.6	+	5	862	c.471G>T	c.(469-471)aaG>aaT	p.K157N	CSF1_ENST00000344188.5_Missense_Mutation_p.K157N|CSF1_ENST00000526001.1_3'UTR|CSF1_ENST00000369801.1_Missense_Mutation_p.K157N|CSF1_ENST00000369802.3_Missense_Mutation_p.K157N|CSF1_ENST00000420111.2_Missense_Mutation_p.K157N	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	157					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		ATGAAACAAAGAATCTCCTTG	0.483																																					p.K157N		Atlas-SNP	.											.	CSF1	40	.	0			c.G471T						.						97.0	98.0	98.0					1																	110464543		2203	4300	6503	SO:0001583	missense	1435	exon5			AACAAAGAATCTC	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.471G>T	chr1.hg19:g.110464543G>T	ENSP00000327513:p.Lys157Asn	211.0	0.0		242.0	67.0	NM_172210	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	hg19	CCDS816.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.272149	0.40194	.	.	ENSG00000184371	ENST00000344188;ENST00000329608;ENST00000488198;ENST00000369802;ENST00000420111;ENST00000369801	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	5.03	3.17	0.36434	Four-helical cytokine-like, core (1);	0.341890	0.26304	N	0.025147	T	0.23727	0.0574	M	0.74258	2.255	0.33043	D	0.531732	P;D;D	0.89917	0.918;1.0;1.0	B;D;D	0.91635	0.294;0.999;0.999	T	0.06844	-1.0804	9	.	.	.	.	7.6321	0.28245	0.1962:0.0:0.8038:0.0	.	157;157;157	P09603-3;P09603;P09603-2	.;CSF1_HUMAN;.	N	157;157;116;157;157;157	ENSP00000342718:K157N;ENSP00000327513:K157N;ENSP00000433837:K116N;ENSP00000358817:K157N;ENSP00000407317:K157N;ENSP00000358816:K157N	.	K	+	3	2	CSF1	110266066	0.992000	0.36948	1.000000	0.80357	0.505000	0.33919	0.207000	0.17395	0.530000	0.28619	0.491000	0.48974	AAG	.	.		0.483	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757	
LRIF1	55791	hgsc.bcm.edu	37	1	111492489	111492489	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:111492489T>G	ENST00000369763.4	-	3	2243	c.1853A>C	c.(1852-1854)gAa>gCa	p.E618A	LRIF1_ENST00000485275.2_Missense_Mutation_p.E82A|RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_Missense_Mutation_p.E82A	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	618					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						TCTCTCTCCTTCCTTCACCAT	0.363																																					p.E618A		Atlas-SNP	.											.	LRIF1	65	.	0			c.A1853C						.						187.0	197.0	193.0					1																	111492489		2203	4300	6503	SO:0001583	missense	55791	exon3			TCTCCTTCCTTCA	AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1853A>C	chr1.hg19:g.111492489T>G	ENSP00000358778:p.Glu618Ala	47.0	0.0		79.0	21.0	NM_018372	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	hg19	CCDS30800.1	.	.	.	.	.	.	.	.	.	.	T	6.070	0.381285	0.11466	.	.	ENSG00000121931	ENST00000369763;ENST00000494675;ENST00000485275	T;T;T	0.34072	1.78;1.38;1.38	5.39	1.39	0.22231	.	0.299368	0.30781	N	0.008893	T	0.19604	0.0471	M	0.66939	2.045	0.09310	N	1	P;B	0.44139	0.827;0.004	B;B	0.41510	0.359;0.005	T	0.06058	-1.0848	10	0.51188	T	0.08	-2.3355	10.3971	0.44207	0.0:0.0:0.5072:0.4928	.	82;618	Q5T3J3-2;Q5T3J3	.;LRIF1_HUMAN	A	618;82;82	ENSP00000358778:E618A;ENSP00000435259:E82A;ENSP00000432290:E82A	ENSP00000358778:E618A	E	-	2	0	LRIF1	111294012	0.005000	0.15991	0.289000	0.24876	0.110000	0.19582	0.147000	0.16202	0.311000	0.23014	-0.461000	0.05368	GAA	.	.		0.363	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372	
NRAS	4893	hgsc.bcm.edu	37	1	115256463	115256463	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:115256463G>C	ENST00000369535.4	-	3	501	c.248C>G	c.(247-249)gCc>gGc	p.A83G		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	83					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTATTGATGGCAAATACACA	0.418		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.A83G		Atlas-SNP	.		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	.	NRAS	3766	.	0			c.C248G						.						171.0	149.0	157.0					1																	115256463		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TTGATGGCAAATA	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.248C>G	chr1.hg19:g.115256463G>C	ENSP00000358548:p.Ala83Gly	64.0	0.0		84.0	28.0	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	hg19	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609816	0.87258	.	.	ENSG00000213281	ENST00000369535	T	0.70516	-0.49	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000034	T	0.74199	0.3685	M	0.77712	2.385	0.80722	D	1	B	0.28820	0.224	B	0.41946	0.371	T	0.76940	-0.2773	10	0.87932	D	0	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	83	P01111	RASN_HUMAN	G	83	ENSP00000358548:A83G	ENSP00000358548:A83G	A	-	2	0	NRAS	115057986	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.554000	0.98121	2.624000	0.88883	0.655000	0.94253	GCC	.	.		0.418	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
NBPF10	100132406	hgsc.bcm.edu	37	1	145304497	145304497	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:145304497A>C	ENST00000369339.3	+	7	870	c.617A>C	c.(616-618)gAa>gCa	p.E206A	NBPF10_ENST00000369338.1_Missense_Mutation_p.E206A|NBPF10_ENST00000342960.5_Missense_Mutation_p.E477A|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	477	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TCACTGGAGGAATGTGCCATC	0.458																																					p.E477A		Atlas-SNP	.											.	NBPF10	221	.	0			c.A1430C						.																																			SO:0001583	missense	100132406	exon10			TGGAGGAATGTGC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.617A>C	chr1.hg19:g.145304497A>C	ENSP00000358345:p.Glu206Ala	68.0	0.0		125.0	19.0	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	hg19		.	.	.	.	.	.	.	.	.	.	.	11.26	1.587733	0.28268	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.08984	3.03;3.03	0.811	0.811	0.18739	.	.	.	.	.	T	0.04634	0.0126	L	0.28192	0.835	0.09310	N	1	P;P;P;P	0.51240	0.892;0.747;0.943;0.876	P;P;P;B	0.59288	0.777;0.77;0.855;0.443	T	0.33548	-0.9864	9	0.66056	D	0.02	.	3.9352	0.09302	1.0:0.0:0.0:0.0	.	152;442;408;206	Q4VC10;Q3BBV7;Q5U227;A8MQ30	.;.;.;.	A	402;206;206;477	ENSP00000358344:E206A;ENSP00000345684:E477A	ENSP00000345684:E477A	E	+	2	0	NBPF10	144015854	0.003000	0.15002	0.002000	0.10522	0.085000	0.17905	0.337000	0.19841	0.607000	0.29982	0.234000	0.17832	GAA	.	.		0.458	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
SLC27A3	11000	hgsc.bcm.edu	37	1	153747926	153747926	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:153747926T>C	ENST00000368661.3	+	1	159	c.94T>C	c.(94-96)Ttt>Ctt	p.F32L	SLC27A3_ENST00000271857.2_Missense_Mutation_p.F113L|SLC27A3_ENST00000484014.1_Splice_Site	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	32					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATCAGGGATGTTTGCGAGCGG	0.642																																					p.F32L		Atlas-SNP	.											.	SLC27A3	42	.	0			c.T94C						.						71.0	77.0	75.0					1																	153747926		2203	4300	6503	SO:0001583	missense	11000	exon1			GGGATGTTTGCGA	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.94T>C	chr1.hg19:g.153747926T>C	ENSP00000357650:p.Phe32Leu	51.0	0.0		42.0	13.0	NM_024330	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	hg19	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	T	8.121	0.780939	0.16120	.	.	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.59502	0.26;0.42	2.91	0.494	0.16884	.	.	.	.	.	T	0.12390	0.0301	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	9	0.35671	T	0.21	2.2899	3.2634	0.06856	0.0:0.1433:0.2938:0.5629	.	32	Q5K4L6	S27A3_HUMAN	L	113;32	ENSP00000271857:F113L;ENSP00000357650:F32L	ENSP00000271857:F113L	F	+	1	0	SLC27A3	152014550	0.140000	0.22579	0.002000	0.10522	0.004000	0.04260	0.354000	0.20146	0.082000	0.17018	0.379000	0.24179	TTT	.	.		0.642	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
FAM189B	10712	hgsc.bcm.edu	37	1	155220590	155220590	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:155220590C>T	ENST00000361361.2	-	9	1496	c.987G>A	c.(985-987)ctG>ctA	p.L329L	FAM189B_ENST00000472550.1_5'UTR|FAM189B_ENST00000368368.3_Silent_p.L311L|FAM189B_ENST00000350210.2_Silent_p.L233L	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	329						integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						CTGACAGCACCAGAGACCCGC	0.672											OREG0013858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L329L		Atlas-SNP	.											.	FAM189B	51	.	0			c.G987A						.						10.0	12.0	11.0					1																	155220590		2178	4249	6427	SO:0001819	synonymous_variant	10712	exon9			CAGCACCAGAGAC	AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.987G>A	chr1.hg19:g.155220590C>T		63.0	0.0	1769	75.0	30.0	NM_006589	B1AVS5|Q8IXL3|Q9BR66	Silent	SNP	ENST00000361361.2	hg19	CCDS1103.1																																																																																			.	.		0.672	FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087224.1	NM_006589	
PKLR	5313	hgsc.bcm.edu	37	1	155269945	155269945	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:155269945A>C	ENST00000342741.4	-	2	265	c.227T>G	c.(226-228)cTg>cGg	p.L76R	PKLR_ENST00000392414.3_Missense_Mutation_p.L45R	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	76					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)	p.L76K(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GTCAATGTCCAGTAGGCAGAG	0.602																																					p.L76R		Atlas-SNP	.											.,1	PKLR	70	.	1	Substitution - Missense(1)	lung(1)	c.T227G						.						63.0	63.0	63.0					1																	155269945		2203	4300	6503	SO:0001583	missense	5313	exon2			ATGTCCAGTAGGC	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.227T>G	chr1.hg19:g.155269945A>C	ENSP00000339933:p.Leu76Arg	85.0	0.0		156.0	36.0	NM_000298	O75758|P11973	Missense_Mutation	SNP	ENST00000342741.4	hg19	CCDS1109.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.135307	0.77662	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99818	-6.92;-6.92	4.17	4.17	0.49024	Pyruvate/Phosphoenolpyruvate kinase (1);	0.000000	0.64402	D	0.000003	D	0.99622	0.9862	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97510	1.0066	10	0.87932	D	0	-16.18	11.1939	0.48700	1.0:0.0:0.0:0.0	.	76;67	P30613;B1AVT1	KPYR_HUMAN;.	R	101;45;76;12	ENSP00000376214:L45R;ENSP00000339933:L76R	ENSP00000271946:L12R	L	-	2	0	PKLR	153536569	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	8.980000	0.93460	1.737000	0.51674	0.472000	0.43445	CTG	.	.		0.602	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298	
PMF1	11243	hgsc.bcm.edu	37	1	156195414	156195414	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:156195414A>G	ENST00000368273.4	+	2	238	c.228A>G	c.(226-228)aaA>aaG	p.K76K	PMF1-BGLAP_ENST00000320139.5_Intron|PMF1_ENST00000565805.1_Intron|PMF1_ENST00000368279.3_Intron|PMF1-BGLAP_ENST00000490491.1_Intron|PMF1_ENST00000567140.1_Intron|PMF1-BGLAP_ENST00000368276.4_Intron|PMF1_ENST00000368277.3_Intron	NM_001199654.1	NP_001186583.1			polyamine-modulated factor 1											kidney(1)|large_intestine(2)|lung(3)	6	Hepatocellular(266;0.158)					AGTCTGTGAAACAGGCCTTCA	0.542																																					p.K76K	Pancreas(32;764 914 7316 34504 37150)|Ovarian(64;846 1195 21996 34382 40415)	Atlas-SNP	.											.	PMF1	12	.	0			c.A228G						.						9.0	8.0	9.0					1																	156195414		876	1981	2857	SO:0001819	synonymous_variant	11243	exon2			TGTGAAACAGGCC	AF141310	CCDS30886.1, CCDS55648.1, CCDS55649.1	1q22	2013-07-03			ENSG00000160783	ENSG00000160783			9112	protein-coding gene	gene with protein product		609176				10419538	Standard	NM_007221		Approved			Q6P1K2	OTTHUMG00000177123	ENST00000368273.4:c.228A>G	chr1.hg19:g.156195414A>G		101.0	0.0		155.0	54.0	NM_001199654		Silent	SNP	ENST00000368273.4	hg19	CCDS55648.1																																																																																			.	.		0.542	PMF1-005	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040864.2	NM_007221	
NIT1	4817	hgsc.bcm.edu	37	1	161089103	161089103	+	Missense_Mutation	SNP	G	G	C	rs149045755		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:161089103G>C	ENST00000368009.2	+	3	354	c.278G>C	c.(277-279)cGg>cCg	p.R93P	NIT1_ENST00000368008.1_Missense_Mutation_p.R93P|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank|DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000496861.1_3'UTR|NIT1_ENST00000392190.5_Missense_Mutation_p.R57P|NIT1_ENST00000368007.4_Missense_Mutation_p.R78P	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	93	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TTCATTGCACGGGACCCTGCA	0.532											OREG0013937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R93P		Atlas-SNP	.											.	NIT1	41	.	0			c.G278C						.						58.0	58.0	58.0					1																	161089103		2203	4300	6503	SO:0001583	missense	4817	exon3			TTGCACGGGACCC	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.278G>C	chr1.hg19:g.161089103G>C	ENSP00000356988:p.Arg93Pro	98.0	0.0	1814	105.0	22.0	NM_001185092	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	ENST00000368009.2	hg19	CCDS1218.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474572	0.43942	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000368008;ENST00000392190	D;D;D;D	0.87966	-2.02;-2.02;-2.32;-2.02	5.01	4.1	0.47936	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.277370	0.35615	N	0.003094	T	0.69780	0.3149	N	0.04043	-0.29	0.09310	N	1	P;P;P	0.49090	0.919;0.81;0.888	P;P;P	0.54238	0.451;0.463;0.746	T	0.67409	-0.5678	10	0.30854	T	0.27	-9.1266	11.1228	0.48300	0.0897:0.0:0.9103:0.0	.	78;93;93	Q86X76-4;B1AQP4;Q86X76	.;.;NIT1_HUMAN	P	93;78;93;57	ENSP00000356988:R93P;ENSP00000356986:R78P;ENSP00000356987:R93P;ENSP00000376028:R57P	ENSP00000356986:R78P	R	+	2	0	NIT1	159355727	0.658000	0.27402	0.733000	0.30861	0.798000	0.45092	2.762000	0.47597	1.330000	0.45394	0.655000	0.94253	CGG	.	G|1.000;A|0.000		0.532	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077060.1		
TBX19	9095	hgsc.bcm.edu	37	1	168282157	168282157	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:168282157A>G	ENST00000367821.3	+	8	1315	c.1264A>G	c.(1264-1266)Aca>Gca	p.T422A	TBX19_ENST00000465440.1_3'UTR	NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	422					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					GTCCACCTGGACAGCAGTGGC	0.632																																					p.T422A		Atlas-SNP	.											.	TBX19	68	.	0			c.A1264G						.						51.0	49.0	49.0					1																	168282157		2203	4300	6503	SO:0001583	missense	9095	exon8			ACCTGGACAGCAG	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.1264A>G	chr1.hg19:g.168282157A>G	ENSP00000356795:p.Thr422Ala	94.0	0.0		86.0	4.0	NM_005149	Q52M53	Missense_Mutation	SNP	ENST00000367821.3	hg19	CCDS1272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.91|14.91	2.675689|2.675689	0.47781|0.47781	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000431969;ENST00000441464|ENST00000367821;ENST00000367828	.|D	.|0.94330	.|-3.4	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.555807	.|0.18129	.|N	.|0.150795	T|T	0.76948|0.76948	0.4059|0.4059	L|L	0.31371|0.31371	0.925|0.925	.|0.31993	.|N	.|0.604346	.|B;B	.|0.24043	.|0.024;0.096	.|B;B	.|0.18263	.|0.012;0.021	T|T	0.64685|0.64685	-0.6349|-0.6349	4|9	.|0.08179	.|T	.|0.78	.|.	8.2793|8.2793	0.31892|0.31892	0.9117:0.0:0.0883:0.0|0.9117:0.0:0.0883:0.0	.|.	.|422;290	.|O60806;B3KRD9	.|TBX19_HUMAN;.	G|A	291;254|422;299	.|ENSP00000356795:T422A	.|ENSP00000356795:T422A	D|T	+|+	2|1	0|0	TBX19|TBX19	166548781|166548781	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.802000|3.802000	0.55553|0.55553	2.099000|2.099000	0.63709|0.63709	0.460000|0.460000	0.39030|0.39030	GAC|ACA	.	.		0.632	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
METTL13	51603	hgsc.bcm.edu	37	1	171751168	171751168	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:171751168T>C	ENST00000361735.3	+	1	327	c.61T>C	c.(61-63)Ttc>Ctc	p.F21L	METTL13_ENST00000362019.3_Intron|METTL13_ENST00000458517.1_Missense_Mutation_p.F20L|METTL13_ENST00000367737.5_Missense_Mutation_p.F21L	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	21							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GGAGAAGTTCTTCCAGCAGCG	0.483																																					p.F21L		Atlas-SNP	.											.	METTL13	67	.	0			c.T61C						.						95.0	95.0	95.0					1																	171751168		2203	4300	6503	SO:0001583	missense	51603	exon1			AAGTTCTTCCAGC	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.61T>C	chr1.hg19:g.171751168T>C	ENSP00000354920:p.Phe21Leu	100.0	0.0		118.0	28.0	NM_015935	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	ENST00000361735.3	hg19	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	T	36	5.769585	0.96914	.	.	ENSG00000010165	ENST00000458517;ENST00000367737;ENST00000361735	T;T;T	0.67345	0.8;-0.26;0.8	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.77751	0.4177	M	0.74389	2.26	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.986	D;D;P	0.80764	0.957;0.994;0.726	T	0.81113	-0.1080	10	0.87932	D	0	-1.6906	15.4857	0.75564	0.0:0.0:0.0:1.0	.	20;21;21	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	L	20;21;21	ENSP00000401955:F20L;ENSP00000356711:F21L;ENSP00000354920:F21L	ENSP00000354920:F21L	F	+	1	0	METTL13	170017791	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.100000	0.76989	2.324000	0.78689	0.533000	0.62120	TTC	.	.		0.483	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955	
EDEM3	80267	hgsc.bcm.edu	37	1	184681698	184681698	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:184681698A>G	ENST00000318130.8	-	14	1671	c.1405T>C	c.(1405-1407)Tat>Cat	p.Y469H	EDEM3_ENST00000367512.3_Missense_Mutation_p.Y426H|EDEM3_ENST00000466392.1_5'Flank	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	469					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AGGTAAAGATATTTAAACATT	0.274																																					p.Y469H		Atlas-SNP	.											.	EDEM3	63	.	0			c.T1405C						.						44.0	45.0	44.0					1																	184681698		2202	4284	6486	SO:0001583	missense	80267	exon14			AAAGATATTTAAA	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.1405T>C	chr1.hg19:g.184681698A>G	ENSP00000318147:p.Tyr469His	59.0	0.0		186.0	67.0	NM_025191	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	ENST00000318130.8	hg19	CCDS1363.2	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579843	0.86645	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.71579	-0.58;-0.58	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.90270	0.6957	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93785	0.7087	10	0.87932	D	0	.	16.1814	0.81903	1.0:0.0:0.0:0.0	.	469	Q9BZQ6	EDEM3_HUMAN	H	469;426	ENSP00000318147:Y469H;ENSP00000356482:Y426H	ENSP00000318147:Y469H	Y	-	1	0	EDEM3	182948321	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.135000	0.94478	2.234000	0.73211	0.533000	0.62120	TAT	.	.		0.274	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085785.3	NM_025191	
SYT14	255928	hgsc.bcm.edu	37	1	210187041	210187041	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:210187041T>G	ENST00000472886.1	+	3	139	c.125T>G	c.(124-126)cTt>cGt	p.L42R	SYT14_ENST00000367019.1_Missense_Mutation_p.L42R|SYT14_ENST00000534859.1_Missense_Mutation_p.L42R|SYT14_ENST00000537238.1_Missense_Mutation_p.L4R|SYT14_ENST00000367015.1_Missense_Mutation_p.L4R|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000422431.1_Missense_Mutation_p.L87R|SYT14_ENST00000399639.2_Missense_Mutation_p.L42R			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	42					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		ATGCTGCTCCTTTTTCTCTAT	0.348																																					p.L87R		Atlas-SNP	.											.	SYT14	89	.	0			c.T260G						.						154.0	165.0	161.0					1																	210187041		2203	4300	6503	SO:0001583	missense	255928	exon4			TGCTCCTTTTTCT	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.125T>G	chr1.hg19:g.210187041T>G	ENSP00000418901:p.Leu42Arg	40.0	0.0		97.0	19.0	NM_001146264	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	hg19	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973668	0.74246	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.38401	2.24;2.11;1.14;2.66;2.11;2.39;2.66	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000001	T	0.57051	0.2027	M	0.61703	1.905	0.48632	D	0.999688	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.83275	0.972;0.956;0.996;0.988	T	0.61128	-0.7125	10	0.87932	D	0	-7.901	13.9753	0.64268	0.0:0.0:0.0:1.0	.	70;42;42;87	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	R	87;42;42;4;42;42;4	ENSP00000389039:L87R;ENSP00000442891:L42R;ENSP00000445837:L42R;ENSP00000437423:L4R;ENSP00000355986:L42R;ENSP00000418901:L42R;ENSP00000355982:L4R	ENSP00000355982:L4R	L	+	2	0	SYT14	208253664	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.249000	0.72427	1.906000	0.55180	0.377000	0.23210	CTT	.	.		0.348	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
CENPF	1063	hgsc.bcm.edu	37	1	214811265	214811265	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:214811265A>C	ENST00000366955.3	+	11	1671	c.1503A>C	c.(1501-1503)gaA>gaC	p.E501D		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGGCCAGAGAAGTCTGCCACC	0.373																																					p.E501D	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.A1503C						.						81.0	84.0	83.0					1																	214811265		2203	4300	6503	SO:0001583	missense	1063	exon11			CAGAGAAGTCTGC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1503A>C	chr1.hg19:g.214811265A>C	ENSP00000355922:p.Glu501Asp	309.0	0.0		575.0	27.0	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.324434	0.60634	.	.	ENSG00000117724	ENST00000366955	T	0.03745	3.82	5.9	2.41	0.29592	.	0.000000	0.39274	N	0.001404	T	0.02929	0.0087	.	.	.	0.31312	N	0.687088	P	0.44690	0.841	B	0.37888	0.26	T	0.38520	-0.9657	9	0.37606	T	0.19	.	5.8719	0.18809	0.6027:0.1272:0.2701:0.0	.	501	P49454	CENPF_HUMAN	D	501	ENSP00000355922:E501D	ENSP00000355922:E501D	E	+	3	2	CENPF	212877888	0.954000	0.32549	0.989000	0.46669	0.998000	0.95712	0.003000	0.13083	0.168000	0.19655	0.528000	0.53228	GAA	.	.		0.373	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
EPRS	2058	hgsc.bcm.edu	37	1	220156627	220156627	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:220156627G>T	ENST00000366923.3	-	22	3473	c.3204C>A	c.(3202-3204)atC>atA	p.I1068I		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1068	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CAAGTTTCTTGATCTCAGCAT	0.423																																					p.I1068I		Atlas-SNP	.											.	EPRS	140	.	0			c.C3204A						.						85.0	88.0	87.0					1																	220156627		2203	4300	6503	SO:0001819	synonymous_variant	2058	exon22			TTTCTTGATCTCA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3204C>A	chr1.hg19:g.220156627G>T		188.0	0.0		294.0	97.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	hg19	CCDS31027.1																																																																																			.	.		0.423	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
RYR2	6262	hgsc.bcm.edu	37	1	237948162	237948162	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:237948162C>A	ENST00000366574.2	+	90	13467	c.13150C>A	c.(13150-13152)Ctg>Atg	p.L4384M	RYR2_ENST00000360064.6_Missense_Mutation_p.L4390M|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.L4368M	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4384					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGCCTGGATCTGAAGAGAGA	0.537																																					p.L4384M		Atlas-SNP	.											RYR2,right_upper_lobe,carcinoma,0,1	RYR2	1273	.	0			c.C13150A						.						41.0	40.0	41.0					1																	237948162		1935	4130	6065	SO:0001583	missense	6262	exon90			CTGGATCTGAAGA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13150C>A	chr1.hg19:g.237948162C>A	ENSP00000355533:p.Leu4384Met	51.0	0.0		92.0	28.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581562	0.28180	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.93547	-3.24;-3.24;-3.24	5.56	4.65	0.58169	Ryanodine Receptor TM 4-6 (1);	0.264471	0.24357	N	0.039229	D	0.92678	0.7673	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.984;0.999	D;D	0.87578	0.914;0.998	D	0.89923	0.4060	10	0.30078	T	0.28	-9.1367	6.783	0.23657	0.0:0.7022:0.0:0.2978	.	1358;4384	B4DGV4;Q92736	.;RYR2_HUMAN	M	4384;4390;4368;1358	ENSP00000355533:L4384M;ENSP00000353174:L4390M;ENSP00000443798:L4368M	ENSP00000353174:L4390M	L	+	1	2	RYR2	236014785	0.998000	0.40836	1.000000	0.80357	0.720000	0.41350	1.822000	0.39052	1.352000	0.45808	-0.140000	0.14226	CTG	.	.		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
AKT3	10000	hgsc.bcm.edu	37	1	243809237	243809237	+	Silent	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:243809237T>A	ENST00000366539.1	-	5	587	c.387A>T	c.(385-387)ggA>ggT	p.G129G	AKT3_ENST00000366540.1_Silent_p.G129G|AKT3_ENST00000263826.5_Silent_p.G129G|AKT3_ENST00000336199.5_Silent_p.G129G			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	129					mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			TCTCTTCCTCTCCTATATTAT	0.388																																					p.G129G		Atlas-SNP	.											.	AKT3	177	.	0			c.A387T						.						188.0	180.0	183.0					1																	243809237		2203	4300	6503	SO:0001819	synonymous_variant	10000	exon5			TTCCTCTCCTATA	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.387A>T	chr1.hg19:g.243809237T>A		23.0	0.0		36.0	13.0	NM_001206729	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Silent	SNP	ENST00000366539.1	hg19	CCDS31077.1																																																																																			.	.		0.388	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690	
SH3YL1	26751	hgsc.bcm.edu	37	2	231165	231165	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:231165T>C	ENST00000405430.1	-	9	936	c.560A>G	c.(559-561)tAt>tGt	p.Y187C	SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000403712.2_Missense_Mutation_p.Y187C|SH3YL1_ENST00000415006.2_Missense_Mutation_p.Y91C|SH3YL1_ENST00000403658.1_Missense_Mutation_p.Y91C|SH3YL1_ENST00000403657.1_Missense_Mutation_p.Y91C|SH3YL1_ENST00000356150.5_Missense_Mutation_p.Y187C			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	187					phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		TAAAATGTCATAAGCTCGGAT	0.323																																					p.Y187C		Atlas-SNP	.											.	SH3YL1	49	.	0			c.A560G						.						53.0	47.0	49.0					2																	231165		1826	4068	5894	SO:0001583	missense	26751	exon7			ATGTCATAAGCTC		CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.560A>G	chr2.hg19:g.231165T>C	ENSP00000384269:p.Tyr187Cys	43.0	0.0		95.0	25.0	NM_001159597	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Missense_Mutation	SNP	ENST00000405430.1	hg19		.	.	.	.	.	.	.	.	.	.	T	7.923	0.738948	0.15642	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658;ENST00000451005;ENST00000431160	T;T;T;T;T;T;T	0.23147	2.15;2.14;2.15;1.97;1.97;2.15;1.92	5.0	1.26	0.21427	Ysc84 actin-binding domain (1);	0.627056	0.15721	N	0.247899	T	0.28699	0.0711	L	0.36672	1.1	0.09310	N	1	D;P;D;D	0.61697	0.99;0.929;0.972;0.971	P;P;P;P	0.58780	0.8;0.599;0.845;0.695	T	0.07966	-1.0745	10	0.62326	D	0.03	-37.892	4.0505	0.09793	0.0:0.2411:0.1841:0.5749	.	91;187;187;91	Q96HL8-4;Q96HL8-2;Q96HL8;Q96HL8-3	.;.;SH3Y1_HUMAN;.	C	91;187;91;187;187;91;119;143	ENSP00000404143:Y91C;ENSP00000384276:Y187C;ENSP00000385668:Y91C;ENSP00000384269:Y187C;ENSP00000348471:Y187C;ENSP00000383928:Y91C;ENSP00000416312:Y119C	ENSP00000348471:Y187C	Y	-	2	0	SH3YL1	221165	0.920000	0.31207	0.134000	0.22075	0.040000	0.13550	0.886000	0.28241	0.250000	0.21479	-0.429000	0.05907	TAT	.	.		0.323	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677	
PPM1G	5496	hgsc.bcm.edu	37	2	27606940	27606940	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:27606940T>A	ENST00000344034.4	-	6	1109	c.845A>T	c.(844-846)gAt>gTt	p.D282V	PPM1G_ENST00000350803.4_Missense_Mutation_p.D282V	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	282	Asp/Glu-rich (acidic).				cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GCTGTAGCCATCCTCTTCCTC	0.547																																					p.D282V		Atlas-SNP	.											.	PPM1G	42	.	0			c.A845T						.						165.0	118.0	134.0					2																	27606940		2203	4300	6503	SO:0001583	missense	5496	exon6			TAGCCATCCTCTT	Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.845A>T	chr2.hg19:g.27606940T>A	ENSP00000342778:p.Asp282Val	40.0	0.0		56.0	5.0	NM_177983		Missense_Mutation	SNP	ENST00000344034.4	hg19	CCDS1752.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.288849	0.59976	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412;ENST00000395543	T;T	0.50001	0.76;0.76	5.41	5.41	0.78517	Protein phosphatase 2C-like (3);	1.365020	0.04210	N	0.331601	T	0.68879	0.3049	L	0.56769	1.78	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.85130	0.983;0.997	T	0.45833	-0.9234	10	0.56958	D	0.05	-13.8511	11.8222	0.52245	0.0:0.0:0.0:1.0	.	83;282	Q59GB2;O15355	.;PPM1G_HUMAN	V	282;282;265;83	ENSP00000342778:D282V;ENSP00000264714:D282V	ENSP00000342778:D282V	D	-	2	0	PPM1G	27460444	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.361000	0.59461	2.037000	0.60232	0.528000	0.53228	GAT	.	.		0.547	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
IFT172	26160	hgsc.bcm.edu	37	2	27668656	27668656	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:27668656C>A	ENST00000260570.3	-	45	4973	c.4870G>T	c.(4870-4872)Gac>Tac	p.D1624Y	KRTCAP3_ENST00000543753.1_Intron	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1624					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					AAGGGAATGTCTGTATCCTGA	0.547																																					p.D1624Y		Atlas-SNP	.											.	IFT172	119	.	0			c.G4870T						.						135.0	130.0	131.0					2																	27668656		2203	4300	6503	SO:0001583	missense	26160	exon45			GAATGTCTGTATC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.4870G>T	chr2.hg19:g.27668656C>A	ENSP00000260570:p.Asp1624Tyr	96.0	0.0		109.0	31.0	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	hg19	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004236	0.74932	.	.	ENSG00000138002	ENST00000260570	T	0.65364	-0.15	5.42	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.81418	0.4818	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84921	0.0854	10	0.87932	D	0	-21.5043	13.3218	0.60436	0.0:0.8413:0.1587:0.0	.	1624	Q9UG01	IF172_HUMAN	Y	1624	ENSP00000260570:D1624Y	ENSP00000260570:D1624Y	D	-	1	0	IFT172	27522160	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.490000	0.81461	1.283000	0.44513	0.561000	0.74099	GAC	.	.		0.547	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
FAM179A	165186	hgsc.bcm.edu	37	2	29237345	29237345	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:29237345C>T	ENST00000379558.4	+	8	1313	c.962C>T	c.(961-963)aCg>aTg	p.T321M	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Missense_Mutation_p.T321M	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	321										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCTGCTCCCACGCTGACAGCC	0.592																																					p.T321M		Atlas-SNP	.											.	FAM179A	106	.	0			c.C962T						.						30.0	33.0	32.0					2																	29237345		2119	4249	6368	SO:0001583	missense	165186	exon8			CTCCCACGCTGAC	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.962C>T	chr2.hg19:g.29237345C>T	ENSP00000368876:p.Thr321Met	70.0	0.0		62.0	30.0	NM_199280	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	hg19	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	c	1.347	-0.592524	0.03799	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.10573	3.02;2.86	4.6	-4.84	0.03151	.	.	.	.	.	T	0.04363	0.0120	N	0.14661	0.345	0.09310	N	1	B;B	0.33694	0.421;0.017	B;B	0.24006	0.05;0.004	T	0.34477	-0.9827	9	0.33940	T	0.23	.	6.8807	0.24170	0.1318:0.2657:0.0:0.6026	.	321;321	F8W8E4;Q6ZUX3	.;F179A_HUMAN	M	321	ENSP00000368876:T321M;ENSP00000384699:T321M	ENSP00000368876:T321M	T	+	2	0	FAM179A	29090849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.229000	0.02945	-1.293000	0.02362	-1.270000	0.01421	ACG	.	.		0.592	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
SPTBN1	6711	hgsc.bcm.edu	37	2	54870184	54870184	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:54870184A>G	ENST00000356805.4	+	19	4204	c.3923A>G	c.(3922-3924)aAt>aGt	p.N1308S	SPTBN1_ENST00000333896.5_Missense_Mutation_p.N1295S	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1308					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAAGCCAGAAATCTGCACAGT	0.413																																					p.N1308S		Atlas-SNP	.											.	SPTBN1	378	.	0			c.A3923G						.						111.0	109.0	110.0					2																	54870184		2203	4300	6503	SO:0001583	missense	6711	exon19			CCAGAAATCTGCA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3923A>G	chr2.hg19:g.54870184A>G	ENSP00000349259:p.Asn1308Ser	118.0	0.0		157.0	29.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.447166	0.84101	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.32272	1.46;1.46	5.73	5.73	0.89815	.	0.044685	0.85682	D	0.000000	T	0.52435	0.1734	M	0.89214	3.015	0.58432	D	0.999995	B;B	0.33379	0.309;0.41	B;P	0.44422	0.202;0.449	T	0.55309	-0.8161	10	0.41790	T	0.15	.	16.0193	0.80468	1.0:0.0:0.0:0.0	.	1295;1308	Q01082-3;Q01082	.;SPTB2_HUMAN	S	1308;1295	ENSP00000349259:N1308S;ENSP00000334156:N1295S	ENSP00000334156:N1295S	N	+	2	0	SPTBN1	54723688	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.281000	0.95811	2.190000	0.69967	0.533000	0.62120	AAT	.	.		0.413	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
EML6	400954	hgsc.bcm.edu	37	2	55191747	55191747	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:55191747G>A	ENST00000356458.6	+	37	5891	c.5371G>A	c.(5371-5373)Gaa>Aaa	p.E1791K	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1791						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						TGGTTCTTCTGAACACACAGT	0.478																																					p.E1791K		Atlas-SNP	.											.	EML6	85	.	0			c.G5371A						.						153.0	123.0	132.0					2																	55191747		692	1591	2283	SO:0001583	missense	400954	exon37			TCTTCTGAACACA		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.5371G>A	chr2.hg19:g.55191747G>A	ENSP00000348842:p.Glu1791Lys	86.0	0.0		112.0	34.0	NM_001039753	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	hg19	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	G	36	5.713581	0.96830	.	.	ENSG00000214595	ENST00000356458	T	0.17054	2.3	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048539	0.85682	D	0.000000	T	0.30386	0.0763	L	0.54323	1.7	0.45662	D	0.998588	P	0.44877	0.845	P	0.48873	0.593	T	0.00926	-1.1512	10	0.87932	D	0	.	19.9474	0.97186	0.0:0.0:1.0:0.0	.	1791	Q6ZMW3	EMAL6_HUMAN	K	1791	ENSP00000348842:E1791K	ENSP00000348842:E1791K	E	+	1	0	EML6	55045251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.774000	0.95407	0.655000	0.94253	GAA	.	.		0.478	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
UGP2	7360	hgsc.bcm.edu	37	2	64118290	64118290	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:64118290A>C	ENST00000337130.5	+	10	1932	c.1456A>C	c.(1456-1458)Att>Ctt	p.I486L	UGP2_ENST00000394417.2_Missense_Mutation_p.I475L|UGP2_ENST00000445915.2_Missense_Mutation_p.I495L|UGP2_ENST00000467648.2_Missense_Mutation_p.I475L	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	486	Oligomerization.				carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						TGGTGACAGAATTGATATCCC	0.378																																					p.I486L		Atlas-SNP	.											.	UGP2	38	.	0			c.A1456C						.						140.0	124.0	130.0					2																	64118290		2203	4300	6503	SO:0001583	missense	7360	exon10			GACAGAATTGATA		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.1456A>C	chr2.hg19:g.64118290A>C	ENSP00000338703:p.Ile486Leu	69.0	0.0		108.0	33.0	NM_006759	Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	hg19	CCDS1875.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.720084	0.89205	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000445915	T;T;T;T	0.47177	0.87;0.87;0.86;0.85	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.58366	0.2117	L	0.47190	1.495	0.80722	D	1	P;P	0.48589	0.912;0.912	P;P	0.60682	0.734;0.878	T	0.52373	-0.8584	10	0.23891	T	0.37	-16.8786	15.519	0.75851	1.0:0.0:0.0:0.0	.	495;486	E7EUC7;Q16851	.;UGPA_HUMAN	L	475;475;486;495	ENSP00000377939:I475L;ENSP00000420793:I475L;ENSP00000338703:I486L;ENSP00000411803:I495L	ENSP00000338703:I486L	I	+	1	0	UGP2	63971794	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.076000	0.62316	0.455000	0.32223	ATT	.	.		0.378	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	NM_006759	
CEP68	23177	hgsc.bcm.edu	37	2	65299207	65299207	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:65299207A>T	ENST00000377990.2	+	3	1180	c.977A>T	c.(976-978)gAc>gTc	p.D326V	RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000537589.1_5'UTR|CEP68_ENST00000546106.1_Missense_Mutation_p.D326V|CEP68_ENST00000497039.1_3'UTR|CEP68_ENST00000260569.4_Missense_Mutation_p.D326V	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	326					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						GTGCCAGCTGACCCTGTCCTG	0.542																																					p.D326V		Atlas-SNP	.											.	CEP68	69	.	0			c.A977T						.						91.0	100.0	97.0					2																	65299207		2203	4300	6503	SO:0001583	missense	23177	exon3			CAGCTGACCCTGT	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.977A>T	chr2.hg19:g.65299207A>T	ENSP00000367229:p.Asp326Val	28.0	0.0		38.0	19.0	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	hg19	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813394	0.50527	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000260569;ENST00000545501	T;T;T	0.18810	2.19;2.19;2.2	5.32	5.32	0.75619	.	0.376195	0.28971	N	0.013544	T	0.45115	0.1326	M	0.66939	2.045	0.80722	D	1	P;P;P;D;P	0.76494	0.933;0.933;0.911;0.999;0.845	P;P;P;D;P	0.72075	0.629;0.629;0.593;0.976;0.535	T	0.42515	-0.9447	10	0.66056	D	0.02	-8.4248	15.2809	0.73784	1.0:0.0:0.0:0.0	.	314;326;326;326;326	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	V	326;326;326;314	ENSP00000367229:D326V;ENSP00000438306:D326V;ENSP00000260569:D326V	ENSP00000260569:D326V	D	+	2	0	CEP68	65152711	1.000000	0.71417	0.910000	0.35882	0.264000	0.26372	6.695000	0.74593	2.016000	0.59253	0.397000	0.26171	GAC	.	.		0.542	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
LOXL3	84695	hgsc.bcm.edu	37	2	74761507	74761507	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:74761507A>G	ENST00000264094.3	-	11	1946	c.1875T>C	c.(1873-1875)aaT>aaC	p.N625N	LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Silent_p.N569N|LOXL3_ENST00000393937.2_Silent_p.N480N|LOXL3_ENST00000409986.1_Silent_p.N480N	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	625	Lysyl-oxidase like.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CCTTGGTGCCATTTGGGGTGA	0.512																																					p.N625N		Atlas-SNP	.											.	LOXL3	73	.	0			c.T1875C						.						201.0	193.0	195.0					2																	74761507		2203	4300	6503	SO:0001819	synonymous_variant	84695	exon11			GGTGCCATTTGGG	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1875T>C	chr2.hg19:g.74761507A>G		68.0	0.0		111.0	34.0	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	hg19	CCDS1953.1																																																																																			.	.		0.512	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
DNAH6	1768	hgsc.bcm.edu	37	2	84896476	84896476	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:84896476T>A	ENST00000237449.6	+	37	6156	c.6148T>A	c.(6148-6150)Tgg>Agg	p.W2050R	DNAH6_ENST00000389394.3_Missense_Mutation_p.W2050R|DNAH6_ENST00000398278.2_Missense_Mutation_p.W2050R|DNAH6_ENST00000602588.1_Missense_Mutation_p.W71R			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2050					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GCTGGATCCCTGGGAACGAAT	0.418																																					p.W2050R		Atlas-SNP	.											.	DNAH6	194	.	0			c.T6148A						.						148.0	122.0	130.0					2																	84896476		692	1591	2283	SO:0001583	missense	1768	exon38			GATCCCTGGGAAC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.6148T>A	chr2.hg19:g.84896476T>A	ENSP00000237449:p.Trp2050Arg	97.0	0.0		133.0	34.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.223136	0.79464	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.40225	1.05;1.04;1.05	5.25	5.25	0.73442	.	.	.	.	.	T	0.71204	0.3312	M	0.91300	3.195	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78833	-0.2048	9	0.87932	D	0	.	14.4248	0.67207	0.0:0.0:0.0:1.0	.	2050;2050	Q9C0G6;Q9C0G6-4	DYH6_HUMAN;.	R	2050	ENSP00000374045:W2050R;ENSP00000381326:W2050R;ENSP00000237449:W2050R	ENSP00000237449:W2050R	W	+	1	0	DNAH6	84749987	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.181000	0.71988	2.097000	0.63578	0.523000	0.50628	TGG	.	.		0.418	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
TMEM127	55654	hgsc.bcm.edu	37	2	96930988	96930988	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:96930988C>T	ENST00000258439.3	-	2	388	c.132G>A	c.(130-132)ctG>ctA	p.L44L	TMEM127_ENST00000432959.1_Silent_p.L44L|CIAO1_ENST00000488633.1_5'Flank	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127	44					negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						GGGCAGTGCACAGCGCCGTGA	0.731																																					p.L44L		Atlas-SNP	.											.	TMEM127	13	.	0			c.G132A						.						11.0	11.0	11.0					2																	96930988		2184	4270	6454	SO:0001819	synonymous_variant	55654	exon2			AGTGCACAGCGCC	AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454	ENST00000258439.3:c.132G>A	chr2.hg19:g.96930988C>T		958.0	1.0		953.0	275.0	NM_001193304	D3DXH0	Silent	SNP	ENST00000258439.3	hg19	CCDS2018.1																																																																																			.	.		0.731	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252845.3	NM_017849	
RANBP2	5903	hgsc.bcm.edu	37	2	109383255	109383255	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:109383255A>G	ENST00000283195.6	+	20	6386	c.6260A>G	c.(6259-6261)cAt>cGt	p.H2087R		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2087	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TGTGCTAATCATTGGATAACG	0.428																																					p.H2087R		Atlas-SNP	.											.	RANBP2	488	.	0			c.A6260G						.						228.0	239.0	235.0					2																	109383255		2203	4298	6501	SO:0001583	missense	5903	exon20			CTAATCATTGGAT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.6260A>G	chr2.hg19:g.109383255A>G	ENSP00000283195:p.His2087Arg	34.0	0.0		53.0	12.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	17.49	3.403010	0.62288	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.47869	0.83	5.65	5.65	0.86999	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.72510	0.3469	M	0.85299	2.745	0.47308	D	0.999386	D	0.89917	1.0	D	0.97110	1.0	T	0.77832	-0.2441	9	0.87932	D	0	-26.0092	15.8694	0.79101	1.0:0.0:0.0:0.0	.	2087	P49792	RBP2_HUMAN	R	1111;2087	ENSP00000283195:H2087R	ENSP00000283195:H2087R	H	+	2	0	RANBP2	108749687	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	9.339000	0.96797	2.143000	0.66587	0.455000	0.32223	CAT	.	.		0.428	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ORC4	5000	hgsc.bcm.edu	37	2	148715877	148715877	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:148715877T>C	ENST00000392857.5	-	6	484	c.377A>G	c.(376-378)gAt>gGt	p.D126G	ORC4_ENST00000536575.1_Missense_Mutation_p.D42G|ORC4_ENST00000392858.1_Missense_Mutation_p.D126G|ORC4_ENST00000264169.2_Missense_Mutation_p.D126G|ORC4_ENST00000540442.1_Missense_Mutation_p.D52G|ORC4_ENST00000542387.1_5'UTR|ORC4_ENST00000535373.1_Missense_Mutation_p.D126G	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	126					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						AAAAACTTTATCTCCAACTAC	0.299																																					p.D126G		Atlas-SNP	.											.	ORC4	40	.	0			c.A377G						.						63.0	64.0	64.0					2																	148715877		2202	4297	6499	SO:0001583	missense	5000	exon6			ACTTTATCTCCAA	AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.377A>G	chr2.hg19:g.148715877T>C	ENSP00000376597:p.Asp126Gly	63.0	0.0		127.0	48.0	NM_002552	B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Missense_Mutation	SNP	ENST00000392857.5	hg19	CCDS2187.1	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252658	0.59212	.	.	ENSG00000115947	ENST00000264169;ENST00000535373;ENST00000392858;ENST00000540442;ENST00000536575;ENST00000392857;ENST00000416719;ENST00000457954;ENST00000440042	T;T;T;D;D;T;T;T;T	0.92858	1.35;1.35;1.35;-3.12;-3.12;1.35;0.5;1.16;1.15	5.52	5.52	0.82312	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.045054	0.85682	D	0.000000	D	0.94311	0.8172	L	0.55213	1.73	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.981;0.981;0.981	D	0.92970	0.6397	10	0.27082	T	0.32	-25.7992	15.2826	0.73797	0.0:0.0:0.0:1.0	.	126;126;126	B7Z2M4;A8K7H4;O43929	.;.;ORC4_HUMAN	G	126;126;126;52;42;126;126;126;126	ENSP00000264169:D126G;ENSP00000441953:D126G;ENSP00000376598:D126G;ENSP00000438326:D52G;ENSP00000441502:D42G;ENSP00000376597:D126G;ENSP00000413939:D126G;ENSP00000391484:D126G;ENSP00000403105:D126G	ENSP00000264169:D126G	D	-	2	0	ORC4	148432347	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.082000	0.62665	0.477000	0.44152	GAT	.	.		0.299	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254797.3	NM_181742	
EPC2	26122	hgsc.bcm.edu	37	2	149528862	149528862	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:149528862A>T	ENST00000258484.6	+	10	1660	c.1626A>T	c.(1624-1626)gaA>gaT	p.E542D		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	542					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		ATAGTGAAGAATGTACCTCAA	0.393																																					p.E542D		Atlas-SNP	.											.	EPC2	57	.	0			c.A1626T						.						130.0	125.0	127.0					2																	149528862		1890	4100	5990	SO:0001583	missense	26122	exon10			TGAAGAATGTACC	AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.1626A>T	chr2.hg19:g.149528862A>T	ENSP00000258484:p.Glu542Asp	156.0	0.0		241.0	52.0	NM_015630	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	hg19	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	A	13.89	2.370631	0.42003	.	.	ENSG00000135999	ENST00000258484	T	0.17370	2.28	5.36	2.81	0.32909	.	0.265507	0.39687	N	0.001298	T	0.11153	0.0272	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.09207	-1.0685	10	0.45353	T	0.12	-4.4998	8.114	0.30930	0.7943:0.1347:0.071:0.0	.	542	Q52LR7	EPC2_HUMAN	D	542	ENSP00000258484:E542D	ENSP00000258484:E542D	E	+	3	2	EPC2	149245332	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.935000	0.40173	0.959000	0.37980	-0.400000	0.06385	GAA	.	.		0.393	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1	NM_015630	
SCN9A	6335	hgsc.bcm.edu	37	2	167136943	167136943	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:167136943A>C	ENST00000409435.1	-	13	2266	c.2267T>G	c.(2266-2268)tTa>tGa	p.L756*	SCN9A_ENST00000375387.4_Nonsense_Mutation_p.L757*|SCN9A_ENST00000303354.6_Nonsense_Mutation_p.L757*|SCN9A_ENST00000409672.1_Nonsense_Mutation_p.L745*|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	756					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAATGTGTTTAAAACTATGCA	0.313																																					p.L745X		Atlas-SNP	.											.	SCN9A	296	.	0			c.T2234G						.						60.0	58.0	59.0					2																	167136943		1830	4087	5917	SO:0001587	stop_gained	6335	exon14			GTGTTTAAAACTA	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2267T>G	chr2.hg19:g.167136943A>C	ENSP00000386330:p.Leu756*	73.0	0.0		123.0	32.0	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Nonsense_Mutation	SNP	ENST00000409435.1	hg19	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	A	43	10.253693	0.99369	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	.	.	.	5.9	5.9	0.94986	.	0.000000	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3736	0.49715	0.9302:0.0:0.0698:0.0	.	.	.	.	X	745;757;757;756	.	ENSP00000304748:L757X	L	-	2	0	SCN9A	166845189	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.489000	0.81451	2.251000	0.74343	0.528000	0.53228	TTA	.	.		0.313	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
NOSTRIN	115677	hgsc.bcm.edu	37	2	169721359	169721359	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:169721359T>C	ENST00000317647.7	+	16	1629	c.1400T>C	c.(1399-1401)aTa>aCa	p.I467T	NOSTRIN_ENST00000421711.2_Missense_Mutation_p.I439T|NOSTRIN_ENST00000397206.2_Missense_Mutation_p.I389T|NOSTRIN_ENST00000445023.2_Missense_Mutation_p.I389T|NOSTRIN_ENST00000397209.2_Missense_Mutation_p.I439T|NOSTRIN_ENST00000444448.2_Missense_Mutation_p.I524T|NOSTRIN_ENST00000458381.2_Missense_Mutation_p.I524T	NM_001039724.3	NP_001034813.2	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficking	467	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|negative regulation of transcription, DNA-templated (GO:0045892)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoskeleton (GO:0005856)|endocytic vesicle membrane (GO:0030666)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						ATTGTGATTATACACGAGAAA	0.428																																					p.I524T		Atlas-SNP	.											.	NOSTRIN	68	.	0			c.T1571C						.						128.0	117.0	120.0					2																	169721359		1872	4105	5977	SO:0001583	missense	115677	exon21			TGATTATACACGA	AJ532842	CCDS42771.1, CCDS42772.1, CCDS54415.1, CCDS54416.1	2q31.1	2013-08-05	2013-08-05		ENSG00000163072	ENSG00000163072			20203	protein-coding gene	gene with protein product		607496	"""nitric oxide synthase trafficker"""			12446846	Standard	NM_001171631		Approved	MGC20702	uc002ueg.3	Q8IVI9	OTTHUMG00000153990	ENST00000317647.7:c.1400T>C	chr2.hg19:g.169721359T>C	ENSP00000318921:p.Ile467Thr	45.0	0.0		77.0	22.0	NM_001171631	A8K2I9|B3KSF5|E7EPT9|Q27HG3|Q53S62|Q96CJ9	Missense_Mutation	SNP	ENST00000317647.7	hg19	CCDS42771.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.800826	0.70567	.	.	ENSG00000163072	ENST00000458381;ENST00000444448;ENST00000317647;ENST00000445023;ENST00000397206;ENST00000397209;ENST00000421711	T;T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38;0.38	4.96	4.96	0.65561	Src homology-3 domain (5);	0.220288	0.43579	D	0.000543	T	0.73697	0.3620	M	0.88775	2.98	0.80722	D	1	D;D;D;D;D;D	0.65815	0.959;0.994;0.995;0.995;0.978;0.988	P;P;D;D;P;D	0.63957	0.564;0.818;0.92;0.913;0.828;0.909	T	0.79512	-0.1773	10	0.87932	D	0	-15.7456	12.4555	0.55702	0.0:0.0:0.0:1.0	.	439;389;524;361;467;524	Q8IVI9-2;Q8IVI9-3;B3KSF5;D3DPB9;Q8IVI9;E7EPT9	.;.;.;.;NOSTN_HUMAN;.	T	524;524;467;389;389;439;439	ENSP00000402140:I524T;ENSP00000394051:I524T;ENSP00000318921:I467T;ENSP00000404413:I389T;ENSP00000380390:I389T;ENSP00000380392:I439T;ENSP00000401316:I439T	ENSP00000318921:I467T	I	+	2	0	NOSTRIN	169429605	0.668000	0.27493	0.980000	0.43619	0.991000	0.79684	4.778000	0.62368	1.980000	0.57719	0.455000	0.32223	ATA	.	.		0.428	NOSTRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333356.4	NM_052946	
TLK1	9874	hgsc.bcm.edu	37	2	171974343	171974343	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:171974343A>T	ENST00000431350.2	-	2	568	c.164T>A	c.(163-165)cTg>cAg	p.L55Q	TLK1_ENST00000360843.3_Missense_Mutation_p.L55Q|TLK1_ENST00000442919.2_Missense_Mutation_p.L7Q|TLK1_ENST00000521943.1_Missense_Mutation_p.L7Q			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	55					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TCTTGGATCCAGACTATGAAG	0.368																																					p.L55Q		Atlas-SNP	.											.	TLK1	134	.	0			c.T164A						.						118.0	110.0	113.0					2																	171974343		2203	4300	6503	SO:0001583	missense	9874	exon2			GGATCCAGACTAT	AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.164T>A	chr2.hg19:g.171974343A>T	ENSP00000411099:p.Leu55Gln	24.0	0.0		43.0	11.0	NM_012290	B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Missense_Mutation	SNP	ENST00000431350.2	hg19	CCDS2241.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.484091	0.84854	.	.	ENSG00000198586	ENST00000442919;ENST00000431350;ENST00000360843;ENST00000521943	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.18	5.18	0.71444	.	0.504521	0.20562	N	0.089900	D	0.96259	0.8780	M	0.74881	2.28	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96596	0.9441	10	0.87932	D	0	.	14.0124	0.64505	1.0:0.0:0.0:0.0	.	55;55	Q9UKI8-2;Q9UKI8	.;TLK1_HUMAN	Q	7;55;55;7	ENSP00000402165:L7Q;ENSP00000411099:L55Q;ENSP00000354089:L55Q;ENSP00000428113:L7Q	ENSP00000352810:L55Q	L	-	2	0	TLK1	171682589	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.042000	0.89430	1.956000	0.56807	0.377000	0.23210	CTG	.	.		0.368	TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255314.1	NM_012290	
TTN	7273	hgsc.bcm.edu	37	2	179583266	179583266	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:179583266A>G	ENST00000591111.1	-	83	23840	c.23616T>C	c.(23614-23616)gtT>gtC	p.V7872V	TTN_ENST00000342992.6_Silent_p.V6945V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.V8189V			Q8WZ42	TITIN_HUMAN	titin	12064	Ig-like 61.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCCTCGAGAACTATGGGGC	0.433																																					p.V8189V		Atlas-SNP	.											.	TTN	18412	.	0			c.T24567C						.						74.0	72.0	72.0					2																	179583266		1918	4154	6072	SO:0001819	synonymous_variant	7273	exon85			CTCGAGAACTATG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23616T>C	chr2.hg19:g.179583266A>G		65.0	0.0		121.0	34.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NBEAL1	65065	hgsc.bcm.edu	37	2	203996708	203996708	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:203996708A>G	ENST00000449802.1	+	25	3823	c.3490A>G	c.(3490-3492)Atg>Gtg	p.M1164V		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1164										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TATGGAACAAATGTTGAAATG	0.323																																					p.M1164V		Atlas-SNP	.											.	NBEAL1	266	.	0			c.A3490G						.						108.0	89.0	95.0					2																	203996708		692	1591	2283	SO:0001583	missense	65065	exon25			GAACAAATGTTGA	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3490A>G	chr2.hg19:g.203996708A>G	ENSP00000399903:p.Met1164Val	93.0	0.0		218.0	64.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548312	0.45383	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.28255	1.62	5.09	5.09	0.68999	.	.	.	.	.	T	0.25531	0.0621	L	0.45581	1.43	0.48975	D	0.999735	P	0.39665	0.682	B	0.30316	0.114	T	0.06698	-1.0812	9	0.45353	T	0.12	.	14.8067	0.69962	1.0:0.0:0.0:0.0	.	1164	Q6ZS30	NBEL1_HUMAN	V	1164	ENSP00000399903:M1164V	ENSP00000344985:M1164V	M	+	1	0	NBEAL1	203704953	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.805000	0.86005	2.046000	0.60703	0.260000	0.18958	ATG	.	.		0.323	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
MAP2	4133	hgsc.bcm.edu	37	2	210569340	210569340	+	Intron	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:210569340A>G	ENST00000360351.4	+	11	5090				MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Intron|MAP2_ENST00000475600.1_Intron|MAP2_ENST00000199940.6_Missense_Mutation_p.N228S	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2						axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAATCAGGGAACAAGGTAAGG	0.413																																					p.N228S	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.A683G						.						115.0	117.0	116.0					2																	210569340		2203	4299	6502	SO:0001627	intron_variant	4133	exon9			CAGGGAACAAGGT		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4585-964A>G	chr2.hg19:g.210569340A>G		202.0	0.0		343.0	32.0	NM_001039538	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	hg19	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	A	3.241	-0.155344	0.06544	.	.	ENSG00000078018	ENST00000199940;ENST00000452717	T;T	0.41065	2.19;1.01	5.23	2.46	0.29980	.	.	.	.	.	T	0.21427	0.0516	N	0.22421	0.69	0.54753	D	0.999983	B	0.14012	0.009	B	0.12156	0.007	T	0.10019	-1.0648	9	0.02654	T	1	.	7.338	0.26621	0.6636:0.2166:0.0:0.1198	.	228	Q8IUX2	.	S	228;170	ENSP00000199940:N228S;ENSP00000388824:N170S	ENSP00000199940:N228S	N	+	2	0	MAP2	210277585	0.965000	0.33210	1.000000	0.80357	0.954000	0.61252	0.444000	0.21661	1.973000	0.57446	0.482000	0.46254	AAC	.	.		0.413	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
CHPF	79586	hgsc.bcm.edu	37	2	220406657	220406657	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr2:220406657T>C	ENST00000243776.6	-	2	817	c.569A>G	c.(568-570)gAc>gGc	p.D190G	CHPF_ENST00000535926.1_Missense_Mutation_p.D28G|TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank|CHPF_ENST00000373891.2_Missense_Mutation_p.D190G	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	190					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GTCAAAGTCGTCGCCGTGCTG	0.692											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D190G		Atlas-SNP	.											.	CHPF	56	.	0			c.A569G						.						33.0	28.0	30.0					2																	220406657		2202	4300	6502	SO:0001583	missense	79586	exon2			AAGTCGTCGCCGT	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.569A>G	chr2.hg19:g.220406657T>C	ENSP00000243776:p.Asp190Gly	102.0	0.0	2266	103.0	32.0	NM_024536	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	hg19	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.448412	0.43429	.	.	ENSG00000123989	ENST00000243776;ENST00000535926;ENST00000373891	T;T	0.15372	2.43;2.48	4.41	4.41	0.53225	.	0.373081	0.27298	N	0.020014	T	0.13841	0.0335	L	0.32530	0.975	0.42761	D	0.9938	B;B	0.17038	0.004;0.02	B;B	0.16289	0.015;0.014	T	0.04427	-1.0952	10	0.56958	D	0.05	-10.8017	10.8932	0.47008	0.0:0.0:0.1573:0.8427	.	190;190	F8W6H2;Q8IZ52	.;CHSS2_HUMAN	G	190;28;190	ENSP00000243776:D190G;ENSP00000445571:D28G	ENSP00000243776:D190G	D	-	2	0	CHPF	220114901	0.012000	0.17670	0.647000	0.29507	0.993000	0.82548	1.757000	0.38400	1.997000	0.58415	0.448000	0.29417	GAC	.	.		0.692	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
FANCD2	2177	hgsc.bcm.edu	37	3	10084812	10084812	+	Silent	SNP	T	T	C	rs370641659		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:10084812T>C	ENST00000419585.1	+	12	1128	c.967T>C	c.(967-969)Ttg>Ctg	p.L323L	FANCD2_ENST00000383806.1_Silent_p.L323L|FANCD2_ENST00000287647.3_Silent_p.L323L|FANCD2_ENST00000383807.1_Silent_p.L323L			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	323	Interaction with BRCA2.				DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCAAGTAAAGTTGAAAAGTAA	0.418			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L323L		Atlas-SNP	.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	253	.	0			c.T967C						.						72.0	70.0	70.0					3																	10084812		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon12	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GTAAAGTTGAAAA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.967T>C	chr3.hg19:g.10084812T>C		81.0	0.0		87.0	33.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	hg19	CCDS33696.1																																																																																			.	.		0.418	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
EOMES	8320	hgsc.bcm.edu	37	3	27763601	27763601	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:27763601T>A	ENST00000295743.4	-	1	388	c.185A>T	c.(184-186)gAg>gTg	p.E62V	EOMES_ENST00000449599.1_Missense_Mutation_p.E62V|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	62					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						GCTCACCGCCTCGCAGGAGAG	0.697																																					p.E62V		Atlas-SNP	.											.	EOMES	65	.	0			c.A185T						.						2.0	2.0	2.0					3																	27763601		1420	3054	4474	SO:0001583	missense	8320	exon1			ACCGCCTCGCAGG	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.185A>T	chr3.hg19:g.27763601T>A	ENSP00000295743:p.Glu62Val	89.0	0.0		60.0	17.0	NM_005442	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	ENST00000295743.4	hg19	CCDS2646.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.642677	0.29246	.	.	ENSG00000163508	ENST00000295743;ENST00000449599	D;D	0.87334	-2.23;-2.24	4.09	4.09	0.47781	.	7.105440	0.00166	N	0.000001	D	0.84311	0.5444	N	0.22421	0.69	0.80722	D	1	B;B;B	0.24920	0.114;0.048;0.028	B;B;B	0.35688	0.208;0.014;0.006	T	0.65380	-0.6182	10	0.42905	T	0.14	.	9.4094	0.38482	0.0:0.0:0.0:1.0	.	62;62;62	F5H3K1;G3XAI5;O95936	.;.;EOMES_HUMAN	V	62	ENSP00000295743:E62V;ENSP00000388620:E62V	ENSP00000295743:E62V	E	-	2	0	EOMES	27738605	0.288000	0.24324	0.842000	0.33263	0.618000	0.37518	2.318000	0.43779	1.734000	0.51633	0.369000	0.22263	GAG	.	.		0.697	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
VIPR1	7433	hgsc.bcm.edu	37	3	42576555	42576555	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:42576555G>A	ENST00000325123.4	+	11	1212	c.1099G>A	c.(1099-1101)Gaa>Aaa	p.E367K	VIPR1_ENST00000433647.1_Missense_Mutation_p.E326K|VIPR1-AS1_ENST00000608869.1_RNA|VIPR1_ENST00000543411.1_Missense_Mutation_p.E319K|VIPR1-AS1_ENST00000610022.1_RNA|VIPR1_ENST00000438259.2_Missense_Mutation_p.E157K|VIPR1-AS1_ENST00000452639.3_RNA	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	367					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		TTTTAAGCCTGAAGTGAAGAT	0.507																																					p.E367K		Atlas-SNP	.											.	VIPR1	45	.	0			c.G1099A						.						193.0	175.0	181.0					3																	42576555		2203	4300	6503	SO:0001583	missense	7433	exon11			AAGCCTGAAGTGA	AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.1099G>A	chr3.hg19:g.42576555G>A	ENSP00000327246:p.Glu367Lys	74.0	0.0		77.0	22.0	NM_004624	A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	Missense_Mutation	SNP	ENST00000325123.4	hg19	CCDS2698.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299711	0.23650	.	.	ENSG00000114812	ENST00000433647;ENST00000543411;ENST00000438259;ENST00000325123	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.5	2.67	0.31697	GPCR, family 2-like (1);	0.057568	0.64402	D	0.000002	T	0.31949	0.0813	L	0.45422	1.42	0.51233	D	0.999917	B;B;P;B	0.40083	0.064;0.118;0.702;0.064	B;B;B;B	0.43990	0.137;0.101;0.438;0.226	T	0.02457	-1.1156	10	0.27082	T	0.32	.	8.5587	0.33498	0.1386:0.1266:0.7348:0.0	.	340;157;319;367	B4DNY6;B4DEB5;F5H1F5;P32241	.;.;.;VIPR1_HUMAN	K	326;319;157;367	ENSP00000394950:E326K;ENSP00000445701:E319K;ENSP00000415371:E157K;ENSP00000327246:E367K	ENSP00000327246:E367K	E	+	1	0	VIPR1	42551559	1.000000	0.71417	0.009000	0.14445	0.000000	0.00434	6.745000	0.74860	0.270000	0.21984	-0.251000	0.11542	GAA	.	.		0.507	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254728.4	NM_004624	
CCDC71	64925	hgsc.bcm.edu	37	3	49200857	49200857	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:49200857G>C	ENST00000321895.6	-	2	891	c.785C>G	c.(784-786)aCt>aGt	p.T262S		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	262										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGGGGACCCAGTGGCTCTGTT	0.622																																					p.T262S		Atlas-SNP	.											.	CCDC71	33	.	0			c.C785G						.						66.0	71.0	69.0					3																	49200857		2203	4300	6503	SO:0001583	missense	64925	exon2			GACCCAGTGGCTC	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.785C>G	chr3.hg19:g.49200857G>C	ENSP00000319006:p.Thr262Ser	42.0	0.0		55.0	9.0	NM_022903	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	hg19	CCDS2790.1	.	.	.	.	.	.	.	.	.	.	G	0.045	-1.267880	0.01433	.	.	ENSG00000177352	ENST00000321895	T	0.27557	1.66	4.9	1.01	0.19927	.	0.353710	0.26780	N	0.022540	T	0.19248	0.0462	L	0.47716	1.5	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.32161	-0.9917	10	0.08599	T	0.76	-5.7803	5.3015	0.15780	0.1512:0.0:0.5634:0.2854	.	262	Q8IV32	CCD71_HUMAN	S	262	ENSP00000319006:T262S	ENSP00000319006:T262S	T	-	2	0	CCDC71	49175861	0.393000	0.25237	0.000000	0.03702	0.114000	0.19823	2.159000	0.42339	0.001000	0.14605	0.491000	0.48974	ACT	.	.		0.622	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
WDR82	80335	hgsc.bcm.edu	37	3	52304771	52304771	+	Silent	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:52304771A>T	ENST00000296490.3	-	2	497	c.216T>A	c.(214-216)acT>acA	p.T72T	MIRLET7G_ENST00000362280.1_RNA	NM_025222.3	NP_079498.2	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	72					histone H3-K4 methylation (GO:0051568)	chromatin (GO:0000785)|histone methyltransferase complex (GO:0035097)|PTW/PP1 phosphatase complex (GO:0072357)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)								BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		TTGCTGCATGAGTGTATCTGA	0.373																																					p.T72T		Atlas-SNP	.											.	WDR82	19	.	0			c.T216A						.						272.0	242.0	252.0					3																	52304771		1868	4107	5975	SO:0001819	synonymous_variant	80335	exon2			TGCATGAGTGTAT	AF132207	CCDS2851.2	3p21.2	2013-01-10	2007-07-04	2007-07-04	ENSG00000164091	ENSG00000164091		"""WD repeat domain containing"""	28826	protein-coding gene	gene with protein product		611059	"""transmembrane protein 113"""	TMEM113		17355966	Standard	NM_025222		Approved	PRO2730, MST107, MSTP107, PRO34047, WDR82A, SWD2	uc003ddl.2	Q6UXN9	OTTHUMG00000150391	ENST00000296490.3:c.216T>A	chr3.hg19:g.52304771A>T		46.0	0.0		91.0	24.0	NM_025222	A8K5R5|Q8TEB2	Silent	SNP	ENST00000296490.3	hg19	CCDS2851.2																																																																																			.	.		0.373	WDR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317919.1	NM_025222	
LRIG1	26018	hgsc.bcm.edu	37	3	66431958	66431958	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:66431958T>C	ENST00000273261.3	-	17	3239	c.2715A>G	c.(2713-2715)aaA>aaG	p.K905K	SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000496559.2_5'UTR|LRIG1_ENST00000383703.3_Silent_p.K882K	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	905					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCACGGCTCTTTGTGATACG	0.522																																					p.K905K		Atlas-SNP	.											.	LRIG1	138	.	0			c.A2715G						.						130.0	125.0	127.0					3																	66431958		2203	4300	6503	SO:0001819	synonymous_variant	26018	exon17			CGGCTCTTTGTGA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2715A>G	chr3.hg19:g.66431958T>C		56.0	0.0		68.0	25.0	NM_015541	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Silent	SNP	ENST00000273261.3	hg19	CCDS33783.1																																																																																			.	.		0.522	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
PPP4R2	151987	hgsc.bcm.edu	37	3	73113262	73113262	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:73113262G>A	ENST00000356692.5	+	7	856	c.603G>A	c.(601-603)gaG>gaA	p.E201E	PPP4R2_ENST00000394284.3_Silent_p.E144E|PPP4R2_ENST00000295862.9_Silent_p.E145E			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	201					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		ACAGCAAAGAGGCAAATTTGC	0.378																																					p.E201E		Atlas-SNP	.											.	PPP4R2	30	.	0			c.G603A						.						29.0	33.0	32.0					3																	73113262		2189	4286	6475	SO:0001819	synonymous_variant	151987	exon7			CAAAGAGGCAAAT	AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.603G>A	chr3.hg19:g.73113262G>A		136.0	0.0		233.0	61.0	NM_174907	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Silent	SNP	ENST00000356692.5	hg19	CCDS2917.1	.	.	.	.	.	.	.	.	.	.	G	2.673	-0.277160	0.05679	.	.	ENSG00000163605	ENST00000460360	.	.	.	5.33	2.38	0.29361	.	.	.	.	.	T	0.54743	0.1877	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46247	-0.9205	4	.	.	.	.	6.7201	0.23325	0.1339:0.0:0.6032:0.2629	.	.	.	.	K	33	.	.	R	+	2	0	PPP4R2	73195952	0.102000	0.21896	0.983000	0.44433	0.351000	0.29236	-0.002000	0.12924	0.536000	0.28733	0.491000	0.48974	AGG	.	.		0.378	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352321.1	NM_174907	
FILIP1L	11259	hgsc.bcm.edu	37	3	99567920	99567920	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:99567920T>G	ENST00000354552.3	-	5	3070	c.2600A>C	c.(2599-2601)aAa>aCa	p.K867T	FILIP1L_ENST00000487087.1_Missense_Mutation_p.K443T|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000331335.5_Missense_Mutation_p.K867T|FILIP1L_ENST00000383694.2_Missense_Mutation_p.K627T|FILIP1L_ENST00000471562.1_Missense_Mutation_p.K627T|CMSS1_ENST00000421999.2_Intron|CMSS1_ENST00000496116.1_Intron	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	867						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						CTCCTTGGATTTCATCCAGGG	0.478																																					p.K867T		Atlas-SNP	.											.	FILIP1L	154	.	0			c.A2600C						.						147.0	136.0	139.0					3																	99567920		1910	4133	6043	SO:0001583	missense	11259	exon5			TTGGATTTCATCC		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.2600A>C	chr3.hg19:g.99567920T>G	ENSP00000346560:p.Lys867Thr	83.0	0.0		107.0	31.0	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Missense_Mutation	SNP	ENST00000354552.3	hg19	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.886986	0.52014	.	.	ENSG00000168386	ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	T;T;T;T;T;T	0.31510	1.8;1.49;1.49;1.8;1.49;1.5	5.99	5.99	0.97316	.	0.000000	0.56097	D	0.000031	T	0.51702	0.1690	L	0.55481	1.735	0.46564	D	0.999107	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.946	T	0.51810	-0.8658	10	0.72032	D	0.01	-14.9609	16.4943	0.84223	0.0:0.0:0.0:1.0	.	867;867	Q4L180-2;Q4L180	.;FIL1L_HUMAN	T	867;443;627;867;627;613;627	ENSP00000346560:K867T;ENSP00000417774:K443T;ENSP00000419642:K627T;ENSP00000327880:K867T;ENSP00000373192:K627T;ENSP00000419874:K627T	ENSP00000327880:K867T	K	-	2	0	FILIP1L	101050610	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.221000	0.58574	2.291000	0.77112	0.533000	0.62120	AAA	.	.		0.478	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
TRIM42	287015	hgsc.bcm.edu	37	3	140401678	140401678	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:140401678A>T	ENST00000286349.3	+	2	907	c.716A>T	c.(715-717)cAg>cTg	p.Q239L		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	239						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATCCTCTGCCAGGTCTGCCGC	0.627																																					p.Q239L		Atlas-SNP	.											.	TRIM42	143	.	0			c.A716T						.						74.0	73.0	73.0					3																	140401678		2203	4300	6503	SO:0001583	missense	287015	exon2			TCTGCCAGGTCTG	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.716A>T	chr3.hg19:g.140401678A>T	ENSP00000286349:p.Gln239Leu	56.0	0.0		56.0	6.0	NM_152616	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	hg19	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.986536	0.74589	.	.	ENSG00000155890	ENST00000286349	T	0.39787	1.06	5.2	5.2	0.72013	.	0.223986	0.31612	N	0.007347	T	0.36717	0.0977	L	0.46157	1.445	0.36480	D	0.867818	P	0.49447	0.924	B	0.40741	0.339	T	0.52290	-0.8595	10	0.66056	D	0.02	-12.0434	11.4507	0.50151	1.0:0.0:0.0:0.0	.	239	Q8IWZ5	TRI42_HUMAN	L	239	ENSP00000286349:Q239L	ENSP00000286349:Q239L	Q	+	2	0	TRIM42	141884368	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.816000	0.69222	1.972000	0.57404	0.459000	0.35465	CAG	.	.		0.627	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
TSC22D2	9819	hgsc.bcm.edu	37	3	150127758	150127758	+	Silent	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:150127758T>G	ENST00000361875.3	+	1	1637	c.621T>G	c.(619-621)acT>acG	p.T207T	TSC22D2_ENST00000361136.2_Silent_p.T207T	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	207					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ACAGCAGTACTTTTGACCAGA	0.617																																					p.T207T		Atlas-SNP	.											.	TSC22D2	42	.	0			c.T621G						.						76.0	79.0	78.0					3																	150127758		2203	4300	6503	SO:0001819	synonymous_variant	9819	exon1			CAGTACTTTTGAC	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.621T>G	chr3.hg19:g.150127758T>G		60.0	0.0		84.0	17.0	NM_014779	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Silent	SNP	ENST00000361875.3	hg19	CCDS3149.1																																																																																			.	.		0.617	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
SERP1	27230	hgsc.bcm.edu	37	3	150262283	150262283	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:150262283T>C	ENST00000479209.1	-	4	1435	c.163A>G	c.(163-165)Att>Gtt	p.I55V	SERP1_ENST00000487153.1_Silent_p.Q29Q|EIF2A_ENST00000273435.5_5'Flank|EIF2A_ENST00000460851.1_5'Flank|EIF2A_ENST00000406576.3_5'Flank|EIF2A_ENST00000487799.1_5'Flank|SERP1_ENST00000239944.2_Missense_Mutation_p.I55V			Q9Y6X1	SERP1_HUMAN	stress-associated endoplasmic reticulum protein 1	55					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucose metabolic process (GO:0006006)|multicellular organismal aging (GO:0010259)|muscle organ morphogenesis (GO:0048644)|plasma membrane organization (GO:0007009)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of organ growth (GO:0046622)|positive regulation of translation (GO:0045727)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein transport (GO:0015031)|response to stress (GO:0006950)|skeletal system development (GO:0001501)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|ribosome (GO:0005840)				large_intestine(1)|lung(3)	4			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATCTGGAAAATTGCTGTAAAA	0.328																																					p.I55V		Atlas-SNP	.											.	SERP1	9	.	0			c.A163G						.						83.0	87.0	85.0					3																	150262283		2203	4300	6503	SO:0001583	missense	27230	exon3			GGAAAATTGCTGT	AK125413	CCDS3150.1	3q25.1	2007-12-07	2007-12-07		ENSG00000120742	ENSG00000120742			10759	protein-coding gene	gene with protein product	"""ribosome associated membrane protein 4"""					10601334, 11230166	Standard	NM_014445		Approved	RAMP4, FLJ43424	uc003exy.3	Q9Y6X1	OTTHUMG00000159769	ENST00000479209.1:c.163A>G	chr3.hg19:g.150262283T>C	ENSP00000420076:p.Ile55Val	217.0	0.0		283.0	72.0	NM_014445	D3DNI6	Missense_Mutation	SNP	ENST00000479209.1	hg19	CCDS3150.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.529393	0.27387	.	.	ENSG00000120742	ENST00000239944;ENST00000479209	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	.	.	.	0.58432	D	0.999999	B	0.12013	0.005	B	0.14578	0.011	T	0.43327	-0.9398	8	0.20046	T	0.44	-1.4526	15.3236	0.74141	0.0:0.0:0.0:1.0	.	55	Q9Y6X1	SERP1_HUMAN	V	55	.	ENSP00000239944:I55V	I	-	1	0	SERP1	151744973	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.997000	0.76270	2.317000	0.78254	0.460000	0.39030	ATT	.	.		0.328	SERP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357239.1	NM_014445	
DHX36	170506	hgsc.bcm.edu	37	3	154022720	154022720	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:154022720T>C	ENST00000496811.1	-	8	1090	c.1010A>G	c.(1009-1011)cAt>cGt	p.H337R	DHX36_ENST00000329463.5_Missense_Mutation_p.H337R|DHX36_ENST00000544526.1_Missense_Mutation_p.H337R|DHX36_ENST00000308361.6_Missense_Mutation_p.H337R	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	337	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			ATTTCTTTCATGGATTTCATC	0.313																																					p.H337R		Atlas-SNP	.											.	DHX36	98	.	0			c.A1010G						.						47.0	47.0	47.0					3																	154022720		2203	4298	6501	SO:0001583	missense	170506	exon8			CTTTCATGGATTT	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1010A>G	chr3.hg19:g.154022720T>C	ENSP00000417078:p.His337Arg	151.0	0.0		249.0	11.0	NM_020865	B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	hg19	CCDS3171.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.556641	0.86231	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	5.9	5.9	0.94986	DEAD-like helicase (2);DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86251	0.5888	H	0.96889	3.9	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.76071	0.977;0.977;0.987	D	0.90858	0.4736	10	0.87932	D	0	.	16.3317	0.83023	0.0:0.0:0.0:1.0	.	337;337;337	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	R	337;337;337;337;251	ENSP00000417078:H337R;ENSP00000309296:H337R;ENSP00000444247:H337R;ENSP00000330113:H337R;ENSP00000419862:H251R	ENSP00000309296:H337R	H	-	2	0	DHX36	155505414	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.672000	0.83956	2.264000	0.75181	0.533000	0.62120	CAT	.	.		0.313	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	NM_020865	
IFT80	57560	hgsc.bcm.edu	37	3	160099508	160099508	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:160099508T>G	ENST00000326448.7	-	3	474	c.42A>C	c.(40-42)caA>caC	p.Q14H	IFT80_ENST00000483465.1_Splice_Site|IFT80_ENST00000477495.1_5'UTR|IFT80_ENST00000496589.1_Splice_Site|RP11-432B6.3_ENST00000483754.1_Intron	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	14				Q -> I (in Ref. 5; BAA92612). {ECO:0000305}.	bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTACTAATTCTTGATGTGTCA	0.348																																					p.Q14H		Atlas-SNP	.											.	IFT80	68	.	0			c.A42C						.						95.0	92.0	93.0					3																	160099508		2203	4300	6503	SO:0001583	missense	57560	exon3			TAATTCTTGATGT	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.42A>C	chr3.hg19:g.160099508T>G	ENSP00000312778:p.Gln14His	75.0	0.0		116.0	9.0	NM_020800	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	hg19	CCDS3188.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.398419	0.62177	.	.	ENSG00000068885	ENST00000326448;ENST00000498409;ENST00000489004;ENST00000478536	T;T;T;T	0.70869	1.56;-0.06;-0.52;-0.52	5.86	4.71	0.59529	.	0.235594	0.26023	U	0.026817	T	0.69504	0.3118	L	0.47716	1.5	0.80722	D	1	.	.	.	.	.	.	T	0.70714	-0.4796	8	0.54805	T	0.06	.	7.1202	0.25440	0.0:0.163:0.0:0.837	.	.	.	.	H	14	ENSP00000312778:Q14H;ENSP00000420001:Q14H;ENSP00000418455:Q14H;ENSP00000419468:Q14H	ENSP00000312778:Q14H	Q	-	3	2	IFT80	161582202	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.113000	0.31184	2.238000	0.73509	0.477000	0.44152	CAA	.	.		0.348	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
DVL3	1857	hgsc.bcm.edu	37	3	183884260	183884260	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:183884260G>C	ENST00000313143.3	+	9	1178	c.930G>C	c.(928-930)atG>atC	p.M310I	DVL3_ENST00000431765.1_Missense_Mutation_p.M310I|EIF2B5_ENST00000444495.1_Intron	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	310	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			TTGAGAACATGAGTAATGACG	0.532																																					p.M310I		Atlas-SNP	.											.	DVL3	68	.	0			c.G930C						.						164.0	164.0	164.0					3																	183884260		2203	4300	6503	SO:0001583	missense	1857	exon9			GAACATGAGTAAT	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.930G>C	chr3.hg19:g.183884260G>C	ENSP00000316054:p.Met310Ile	111.0	0.0		164.0	8.0	NM_004423	B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	ENST00000313143.3	hg19	CCDS3253.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527403	0.85706	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765;ENST00000423300	T;T;T	0.27890	1.64;1.64;1.64	5.45	5.45	0.79879	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	L	0.27975	0.815	0.80722	D	1	B;P;D	0.56746	0.059;0.899;0.977	B;P;D	0.66602	0.387;0.771;0.945	T	0.43909	-0.9362	10	0.87932	D	0	-19.6695	19.2837	0.94061	0.0:0.0:1.0:0.0	.	310;142;310	B4E3E5;Q9UG07;Q92997	.;.;DVL3_HUMAN	I	310;310;310;208	ENSP00000316054:M310I;ENSP00000405885:M310I;ENSP00000393849:M208I	ENSP00000316054:M310I	M	+	3	0	DVL3	185366954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.553000	0.86117	0.655000	0.94253	ATG	.	.		0.532	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423	
VPS8	23355	hgsc.bcm.edu	37	3	184642719	184642719	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:184642719C>T	ENST00000437079.3	+	30	2695	c.2524C>T	c.(2524-2526)Ctt>Ttt	p.L842F	VPS8_ENST00000446204.2_Missense_Mutation_p.L750F|VPS8_ENST00000436792.2_Missense_Mutation_p.L840F|VPS8_ENST00000287546.4_Missense_Mutation_p.L842F|VPS8_ENST00000463687.1_3'UTR	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	842							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TGCTCGGCAGCTTGCAAAGCC	0.413																																					p.L842F		Atlas-SNP	.											.	VPS8	109	.	0			c.C2524T						.						109.0	99.0	102.0					3																	184642719		1905	4122	6027	SO:0001583	missense	23355	exon29			CGGCAGCTTGCAA	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2524C>T	chr3.hg19:g.184642719C>T	ENSP00000397879:p.Leu842Phe	43.0	0.0		66.0	10.0	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	hg19	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521170	0.85600	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	6.06	6.06	0.98353	Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.48607	0.1509	L	0.55834	1.745	0.80722	D	1	D;P;D	0.76494	0.997;0.589;0.999	D;P;D	0.69142	0.916;0.573;0.962	T	0.16041	-1.0416	10	0.46703	T	0.11	-18.6441	20.2502	0.98404	0.0:1.0:0.0:0.0	.	842;750;840	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	F	842;842;840;750	ENSP00000287546:L842F;ENSP00000397879:L842F;ENSP00000404704:L840F;ENSP00000405483:L750F	ENSP00000287546:L842F	L	+	1	0	VPS8	186125413	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.225000	0.58600	2.880000	0.98712	0.650000	0.86243	CTT	.	.		0.413	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
ADIPOQ	9370	hgsc.bcm.edu	37	3	186572334	186572334	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:186572334T>A	ENST00000412955.2	+	3	717	c.576T>A	c.(574-576)aaT>aaA	p.N192K	ADIPOQ-AS1_ENST00000422718.1_RNA|ADIPOQ_ENST00000444204.2_Missense_Mutation_p.N192K|ADIPOQ_ENST00000320741.2_Missense_Mutation_p.N192K			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	192	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		ACCAGGAAAATAATGTGGACC	0.512																																					p.N192K		Atlas-SNP	.											.	ADIPOQ	35	.	0			c.T576A						.						100.0	94.0	96.0					3																	186572334		2203	4300	6503	SO:0001583	missense	9370	exon4			GGAAAATAATGTG	D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.576T>A	chr3.hg19:g.186572334T>A	ENSP00000405611:p.Asn192Lys	80.0	0.0		107.0	25.0	NM_001177800	Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	hg19	CCDS3284.1	.	.	.	.	.	.	.	.	.	.	T	10.54	1.379643	0.24944	.	.	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	T;T;T	0.38077	1.16;1.16;1.16	5.53	-1.02	0.10135	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.344714	0.29046	N	0.013310	T	0.13628	0.0330	N	0.17723	0.515	0.32858	D	0.507522	B	0.02656	0.0	B	0.10450	0.005	T	0.19582	-1.0301	10	0.06891	T	0.86	.	1.1676	0.01819	0.3199:0.217:0.3349:0.1282	.	192	Q15848	ADIPO_HUMAN	K	192	ENSP00000405611:N192K;ENSP00000320709:N192K;ENSP00000389814:N192K	ENSP00000320709:N192K	N	+	3	2	ADIPOQ	188055028	0.950000	0.32346	0.965000	0.40720	0.503000	0.33858	0.242000	0.18087	0.090000	0.17273	-0.168000	0.13345	AAT	.	.		0.512	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797	
DLG1	1739	hgsc.bcm.edu	37	3	197009694	197009694	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:197009694C>T	ENST00000419354.1	-	4	460	c.174G>A	c.(172-174)gtG>gtA	p.V58V	DLG1_ENST00000357674.4_Silent_p.V58V|DLG1_ENST00000314062.3_Silent_p.V58V|DLG1_ENST00000422288.1_Silent_p.V58V|DLG1_ENST00000392382.2_Silent_p.V58V|DLG1_ENST00000346964.2_Silent_p.V58V|DLG1_ENST00000450955.1_Silent_p.V58V|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000448528.2_Silent_p.V58V			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	58	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CCAGTAAGGTCACTTCATAAA	0.318																																					p.V58V		Atlas-SNP	.											.	DLG1	120	.	0			c.G174A						.						97.0	102.0	100.0					3																	197009694		2203	4300	6503	SO:0001819	synonymous_variant	1739	exon4			TAAGGTCACTTCA	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.174G>A	chr3.hg19:g.197009694C>T		66.0	0.0		102.0	24.0	NM_001204386	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Silent	SNP	ENST00000419354.1	hg19	CCDS43194.1																																																																																			.	.		0.318	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
DLG1	1739	hgsc.bcm.edu	37	3	197023325	197023325	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:197023325A>C	ENST00000419354.1	-	3	329	c.43T>G	c.(43-45)Ttg>Gtg	p.L15V	DLG1_ENST00000357674.4_Missense_Mutation_p.L15V|DLG1_ENST00000314062.3_Missense_Mutation_p.L15V|DLG1-AS1_ENST00000430666.1_RNA|DLG1_ENST00000422288.1_Missense_Mutation_p.L15V|DLG1_ENST00000392382.2_Missense_Mutation_p.L15V|DLG1_ENST00000346964.2_Missense_Mutation_p.L15V|DLG1-AS1_ENST00000414529.1_RNA|DLG1_ENST00000450955.1_Missense_Mutation_p.L15V|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000448528.2_Missense_Mutation_p.L15V|MIR4797_ENST00000577559.1_RNA			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	15	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TATTCCTCCAAAAGGTGCAAT	0.378																																					p.L15V		Atlas-SNP	.											.	DLG1	120	.	0			c.T43G						.						141.0	141.0	141.0					3																	197023325		2203	4300	6503	SO:0001583	missense	1739	exon3			CCTCCAAAAGGTG	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.43T>G	chr3.hg19:g.197023325A>C	ENSP00000407531:p.Leu15Val	62.0	0.0		79.0	22.0	NM_001204386	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	hg19	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287996	0.80803	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000456699;ENST00000392380;ENST00000419553;ENST00000436682;ENST00000412364;ENST00000434148	T;T;T;T;T;T;T;T;T;T;T	0.62498	1.74;1.64;1.65;1.77;1.65;1.77;1.69;1.64;0.04;0.03;0.02	5.09	3.95	0.45737	L27 (2);L27-1 (1);	0.000000	0.56097	D	0.000022	T	0.72771	0.3502	M	0.70842	2.15	0.58432	D	0.999995	D;D;D;P	0.71674	0.998;0.996;0.997;0.952	D;D;D;P	0.79108	0.99;0.986;0.992;0.606	T	0.74607	-0.3609	10	0.87932	D	0	.	5.5781	0.17235	0.8157:0.0:0.1842:0.0	.	15;15;15;15	Q12959-4;Q12959-3;Q12959;Q12959-2	.;.;DLG1_HUMAN;.	V	15	ENSP00000345731:L15V;ENSP00000350303:L15V;ENSP00000321087:L15V;ENSP00000407531:L15V;ENSP00000413238:L15V;ENSP00000391732:L15V;ENSP00000376187:L15V;ENSP00000411278:L15V;ENSP00000396474:L15V;ENSP00000376185:L15V;ENSP00000414189:L15V	ENSP00000321087:L15V	L	-	1	2	DLG1	198507722	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.303000	0.59098	2.213000	0.71641	0.528000	0.53228	TTG	.	.		0.378	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
WFS1	7466	hgsc.bcm.edu	37	4	6279336	6279336	+	Missense_Mutation	SNP	C	C	T	rs111773340	byFrequency	TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:6279336C>T	ENST00000226760.1	+	2	324	c.154C>T	c.(154-156)Cct>Tct	p.P52S	WFS1_ENST00000503569.1_Missense_Mutation_p.P52S	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	52					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		TGGCCCTGGCCCTGGTGTTAG	0.692																																					p.P52S		Atlas-SNP	.											.	WFS1	71	.	0			c.C154T						.						12.0	13.0	13.0					4																	6279336		2165	4246	6411	SO:0001583	missense	7466	exon2			CCTGGCCCTGGTG	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.154C>T	chr4.hg19:g.6279336C>T	ENSP00000226760:p.Pro52Ser	177.0	0.0		152.0	10.0	NM_001145853	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	ENST00000226760.1	hg19	CCDS3386.1	.	.	.	.	.	.	.	.	.	.	C	10.27	1.305020	0.23736	.	.	ENSG00000109501	ENST00000503569;ENST00000226760	D;D	0.93076	-3.16;-3.16	4.08	1.26	0.21427	.	0.940554	0.08855	N	0.883838	D	0.87426	0.6174	L	0.38531	1.155	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.75499	-0.3296	10	0.44086	T	0.13	0.0966	3.6545	0.08215	0.0:0.5548:0.2108:0.2344	.	52	O76024	WFS1_HUMAN	S	52	ENSP00000423337:P52S;ENSP00000226760:P52S	ENSP00000226760:P52S	P	+	1	0	WFS1	6330237	0.014000	0.17966	0.009000	0.14445	0.154000	0.21943	0.201000	0.17276	0.417000	0.25871	0.462000	0.41574	CCT	.	C|0.999;A|0.001		0.692	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1		
TLR6	10333	hgsc.bcm.edu	37	4	38828947	38828947	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:38828947G>T	ENST00000381950.1	-	1	2213	c.2148C>A	c.(2146-2148)ctC>ctA	p.L716L	TLR6_ENST00000436693.2_Silent_p.L716L			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	716	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGGCAAAATAGAGTTCGTAAT	0.403																																					p.L716L		Atlas-SNP	.											.	TLR6	67	.	0			c.C2148A						.						185.0	182.0	183.0					4																	38828947		2203	4300	6503	SO:0001819	synonymous_variant	10333	exon2			AAAATAGAGTTCG		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.2148C>A	chr4.hg19:g.38828947G>T		75.0	0.0		137.0	6.0	NM_006068	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Silent	SNP	ENST00000381950.1	hg19	CCDS3446.1																																																																																			.	.		0.403	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
TXK	7294	hgsc.bcm.edu	37	4	48096195	48096195	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:48096195T>C	ENST00000264316.4	-	8	693	c.608A>G	c.(607-609)tAt>tGt	p.Y203C	TXK_ENST00000510457.1_5'UTR	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	203	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						TTTTATCTGATAATGTTTTAT	0.383																																					p.Y203C		Atlas-SNP	.											.	TXK	58	.	0			c.A608G						.						125.0	117.0	120.0					4																	48096195		2203	4300	6503	SO:0001583	missense	7294	exon8			ATCTGATAATGTT	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.608A>G	chr4.hg19:g.48096195T>C	ENSP00000264316:p.Tyr203Cys	35.0	0.0		45.0	11.0	NM_003328	Q14220	Missense_Mutation	SNP	ENST00000264316.4	hg19	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.414452	0.62511	.	.	ENSG00000074966	ENST00000264316	D	0.89810	-2.57	5.23	5.23	0.72850	SH2 motif (5);	0.000000	0.64402	D	0.000003	D	0.93344	0.7878	M	0.66297	2.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93983	0.7260	10	0.87932	D	0	.	14.0929	0.65002	0.0:0.0:0.0:1.0	.	203	P42681	TXK_HUMAN	C	203	ENSP00000264316:Y203C	ENSP00000264316:Y203C	Y	-	2	0	TXK	47790952	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	7.630000	0.83225	2.189000	0.69895	0.528000	0.53228	TAT	.	.		0.383	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328	
SCARB2	950	hgsc.bcm.edu	37	4	77095407	77095407	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:77095407T>C	ENST00000264896.2	-	7	1233	c.884A>G	c.(883-885)tAt>tGt	p.Y295C	SCARB2_ENST00000452464.2_Missense_Mutation_p.Y152C	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	295					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			AGGAACTTTATACCGAAAGGC	0.443																																					p.Y295C		Atlas-SNP	.											.	SCARB2	47	.	0			c.A884G						.						126.0	120.0	122.0					4																	77095407		2203	4300	6503	SO:0001583	missense	950	exon7			ACTTTATACCGAA	D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.884A>G	chr4.hg19:g.77095407T>C	ENSP00000264896:p.Tyr295Cys	68.0	0.0		122.0	41.0	NM_005506	B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	ENST00000264896.2	hg19	CCDS3577.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.754917	0.49362	.	.	ENSG00000138760	ENST00000264896;ENST00000452464	T;T	0.80304	-1.36;-1.36	5.62	-2.9	0.05648	.	0.260386	0.45126	D	0.000399	D	0.88559	0.6469	M	0.88704	2.975	0.44380	D	0.997284	D;D	0.69078	0.997;0.985	D;P	0.68353	0.957;0.895	D	0.89186	0.3547	10	0.87932	D	0	.	13.5785	0.61888	0.7927:0.0:0.0:0.2073	.	152;295	E7EM68;Q14108	.;SCRB2_HUMAN	C	295;152	ENSP00000264896:Y295C;ENSP00000399154:Y152C	ENSP00000264896:Y295C	Y	-	2	0	SCARB2	77314431	1.000000	0.71417	0.080000	0.20451	0.179000	0.23085	2.831000	0.48144	-0.218000	0.10018	0.533000	0.62120	TAT	.	.		0.443	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252403.1	NM_005506	
WDFY3	23001	hgsc.bcm.edu	37	4	85639621	85639621	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:85639621T>A	ENST00000295888.4	-	48	8115	c.7708A>T	c.(7708-7710)Atg>Ttg	p.M2570L	WDFY3_ENST00000322366.6_Missense_Mutation_p.M2553L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2570	Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GTTGCTGTCATGGTAAATCCA	0.403																																					p.M2570L		Atlas-SNP	.											.	WDFY3	314	.	0			c.A7708T						.						132.0	132.0	132.0					4																	85639621		2203	4300	6503	SO:0001583	missense	23001	exon48			CTGTCATGGTAAA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7708A>T	chr4.hg19:g.85639621T>A	ENSP00000295888:p.Met2570Leu	64.0	0.0		102.0	24.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	T	9.271	1.045660	0.19748	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.60797	0.19;0.19;0.16	5.68	5.68	0.88126	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	T	0.35566	0.0936	N	0.10945	0.07	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31724	-0.9933	10	0.02654	T	1	.	15.9206	0.79562	0.0:0.0:0.0:1.0	.	2570	Q8IZQ1	WDFY3_HUMAN	L	2553;2570;173	ENSP00000318466:M2553L;ENSP00000295888:M2570L;ENSP00000424987:M173L	ENSP00000295888:M2570L	M	-	1	0	WDFY3	85858645	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.166000	0.68216	0.533000	0.62120	ATG	.	.		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
SLC39A8	64116	hgsc.bcm.edu	37	4	103236884	103236884	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:103236884A>C	ENST00000394833.2	-	2	799	c.323T>G	c.(322-324)tTg>tGg	p.L108W	SLC39A8_ENST00000356736.4_Missense_Mutation_p.L108W|SLC39A8_ENST00000510255.1_5'UTR|SLC39A8_ENST00000424970.2_Missense_Mutation_p.L108W	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	108					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		GTGAAAGTTCAATTGCTGTAA	0.388																																					p.L108W		Atlas-SNP	.											.	SLC39A8	24	.	0			c.T323G						.						191.0	187.0	189.0					4																	103236884		2203	4300	6503	SO:0001583	missense	64116	exon2			AAGTTCAATTGCT		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.323T>G	chr4.hg19:g.103236884A>C	ENSP00000378310:p.Leu108Trp	104.0	0.0		155.0	27.0	NM_022154	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	hg19	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114844	0.77210	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.74947	-0.76;-0.89;-0.89	5.5	5.5	0.81552	.	0.289768	0.29152	N	0.012985	D	0.84678	0.5525	M	0.68952	2.095	0.27279	N	0.958141	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.997;0.998	T	0.79650	-0.1715	10	0.87932	D	0	-44.4349	14.7929	0.69857	1.0:0.0:0.0:0.0	.	108;108;41	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	W	108	ENSP00000394548:L108W;ENSP00000349174:L108W;ENSP00000378310:L108W	ENSP00000349174:L108W	L	-	2	0	SLC39A8	103455907	1.000000	0.71417	0.762000	0.31397	0.995000	0.86356	6.620000	0.74224	2.103000	0.63969	0.482000	0.46254	TTG	.	.		0.388	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
CFI	3426	hgsc.bcm.edu	37	4	110687778	110687778	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:110687778T>G	ENST00000394634.2	-	2	467	c.260A>C	c.(259-261)cAa>cCa	p.Q87P	CFI_ENST00000512148.1_Missense_Mutation_p.Q87P|CFI_ENST00000510800.1_Missense_Mutation_p.Q87P|CFI_ENST00000394635.3_Missense_Mutation_p.Q87P	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I	87	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		ACTCTTTTGTTGACAGTATGT	0.428																																					p.Q87P		Atlas-SNP	.											.	CFI	59	.	0			c.A260C						.						120.0	114.0	116.0					4																	110687778		2203	4300	6503	SO:0001583	missense	3426	exon2			TTTTGTTGACAGT	J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.260A>C	chr4.hg19:g.110687778T>G	ENSP00000378130:p.Gln87Pro	87.0	0.0		100.0	24.0	NM_000204	O60442	Missense_Mutation	SNP	ENST00000394634.2	hg19	CCDS34049.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940370	0.52972	.	.	ENSG00000205403	ENST00000394635;ENST00000394634;ENST00000540104;ENST00000512148;ENST00000536228;ENST00000510800	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.6	5.6	0.85130	Factor I / membrane attack complex (1);	0.248310	0.42053	D	0.000776	T	0.78616	0.4311	M	0.77820	2.39	0.43698	D	0.996152	D;D;D	0.71674	0.995;0.997;0.998	P;D;D	0.66602	0.873;0.945;0.914	T	0.81645	-0.0839	10	0.72032	D	0.01	-8.3276	15.7733	0.78190	0.0:0.0:0.0:1.0	.	87;87;87	E7ETH0;G3XAM2;P05156	.;.;CFAI_HUMAN	P	87;87;87;87;69;87	ENSP00000378131:Q87P;ENSP00000378130:Q87P;ENSP00000427438:Q87P;ENSP00000422009:Q87P	ENSP00000378130:Q87P	Q	-	2	0	CFI	110907227	1.000000	0.71417	0.877000	0.34402	0.038000	0.13279	5.861000	0.69553	2.122000	0.65172	0.533000	0.62120	CAA	.	.		0.428	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000204	
TBC1D9	23158	hgsc.bcm.edu	37	4	141543436	141543436	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:141543436G>A	ENST00000442267.2	-	21	3788	c.3714C>T	c.(3712-3714)gcC>gcT	p.A1238A		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1238							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TGGTAATCCTGGCCATCATGC	0.582																																					p.A1238A		Atlas-SNP	.											.	TBC1D9	198	.	0			c.C3714T						.						68.0	69.0	69.0					4																	141543436		2016	4179	6195	SO:0001819	synonymous_variant	23158	exon21			AATCCTGGCCATC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3714C>T	chr4.hg19:g.141543436G>A		138.0	0.0		127.0	15.0	NM_015130	A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	hg19	CCDS47136.1																																																																																			.	.		0.582	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
PALLD	23022	hgsc.bcm.edu	37	4	169835138	169835138	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:169835138C>G	ENST00000505667.1	+	16	2856	c.2683C>G	c.(2683-2685)Ccc>Gcc	p.P895A	PALLD_ENST00000507735.1_Missense_Mutation_p.P391A|CBR4_ENST00000509108.1_Intron|PALLD_ENST00000512127.1_Missense_Mutation_p.P496A|PALLD_ENST00000335742.7_Missense_Mutation_p.P720A|PALLD_ENST00000261509.6_Missense_Mutation_p.P878A			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	1102					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		AGGTCGAAGTCCCCGGTCTCC	0.393									Pancreatic Cancer, Familial Clustering of																												p.P895A	Esophageal Squamous(109;1482 1532 18347 40239 51172)	Atlas-SNP	.											.	PALLD	179	.	0			c.C2683G						.						100.0	95.0	96.0					4																	169835138		2203	4300	6503	SO:0001583	missense	23022	exon16	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	CGAAGTCCCCGGT	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2683C>G	chr4.hg19:g.169835138C>G	ENSP00000425556:p.Pro895Ala	64.0	0.0		109.0	8.0	NM_001166108	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	hg19	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460053	0.63401	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000507735	T;T;T;T;T	0.65364	-0.15;-0.15;0.13;-0.11;0.19	5.46	5.46	0.80206	.	0.000000	0.31922	U	0.006845	T	0.44477	0.1295	N	0.16478	0.41	0.80722	D	1	B;B;B;B	0.25719	0.132;0.003;0.002;0.132	B;B;B;B	0.17098	0.017;0.003;0.003;0.01	T	0.35847	-0.9772	10	0.17832	T	0.49	.	14.8556	0.70335	0.0:0.8566:0.1433:0.0	.	895;1102;496;878	B7ZMM5;Q8WX93;B3KTG2;B2RTX2	.;PALLD_HUMAN;.;.	A	878;720;895;496;391	ENSP00000261509:P878A;ENSP00000336735:P720A;ENSP00000425556:P895A;ENSP00000426947:P496A;ENSP00000424016:P391A	ENSP00000261509:P878A	P	+	1	0	PALLD	170071713	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	2.345000	0.44018	2.560000	0.86352	0.655000	0.94253	CCC	.	.		0.393	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
GLRA3	8001	hgsc.bcm.edu	37	4	175580328	175580328	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:175580328A>G	ENST00000274093.3	-	8	1450	c.948T>C	c.(946-948)atT>atC	p.I316I	GLRA3_ENST00000340217.5_Silent_p.I316I	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	316					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TCCAAATATCAATAGCTTTGA	0.353																																					p.I316I		Atlas-SNP	.											.	GLRA3	76	.	0			c.T948C						.						81.0	77.0	78.0					4																	175580328		2203	4300	6503	SO:0001819	synonymous_variant	8001	exon8			AATATCAATAGCT	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.948T>C	chr4.hg19:g.175580328A>G		52.0	0.0		80.0	23.0	NM_001042543	D3DP44|O75816|Q5D0E3	Silent	SNP	ENST00000274093.3	hg19	CCDS3822.1																																																																																			.	.		0.353	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1		
TLR3	7098	hgsc.bcm.edu	37	4	186997921	186997921	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:186997921C>A	ENST00000296795.3	+	2	252	c.148C>A	c.(148-150)Ccc>Acc	p.P50T		NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	50	LRRNT.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		CGATGATCTACCCACAAACAT	0.483																																					p.P50T		Atlas-SNP	.											.	TLR3	83	.	0			c.C148A						.						130.0	118.0	122.0					4																	186997921		2203	4300	6503	SO:0001583	missense	7098	exon2			GATCTACCCACAA	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.148C>A	chr4.hg19:g.186997921C>A	ENSP00000296795:p.Pro50Thr	81.0	0.0		87.0	30.0	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	hg19	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.158916	0.57368	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.68479	-0.33;-0.33	5.47	5.47	0.80525	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87111	0.6096	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.89884	0.4032	10	0.87932	D	0	.	19.6979	0.96034	0.0:1.0:0.0:0.0	.	50	O15455	TLR3_HUMAN	T	50	ENSP00000296795:P50T;ENSP00000423386:P50T	ENSP00000296795:P50T	P	+	1	0	TLR3	187234915	1.000000	0.71417	0.992000	0.48379	0.091000	0.18340	7.168000	0.77570	2.728000	0.93425	0.591000	0.81541	CCC	.	.		0.483	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
DNAH5	1767	hgsc.bcm.edu	37	5	13718998	13718998	+	Silent	SNP	T	T	C	rs141935657		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:13718998T>C	ENST00000265104.4	-	72	12596	c.12492A>G	c.(12490-12492)acA>acG	p.T4164T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4164	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CACCACTATATGTTCTTTTCA	0.403									Kartagener syndrome																												p.T4164T		Atlas-SNP	.											.	DNAH5	868	.	0			c.A12492G						.	T		1,4405	2.1+/-5.4	0,1,2202	100.0	102.0	101.0		12492	-9.5	0.3	5	dbSNP_134	101	0,8600		0,0,4300	no	coding-synonymous	DNAH5	NM_001369.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		4164/4625	13718998	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1767	exon72	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ACTATATGTTCTT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12492A>G	chr5.hg19:g.13718998T>C		65.0	0.0		85.0	30.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	hg19	CCDS3882.1																																																																																			.	T|1.000;C|0.000		0.403	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
NPR3	4883	hgsc.bcm.edu	37	5	32739134	32739134	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:32739134T>A	ENST00000265074.8	+	3	1400	c.1057T>A	c.(1057-1059)Tac>Aac	p.Y353N	NPR3_ENST00000434067.2_Missense_Mutation_p.Y137N|NPR3_ENST00000415685.2_Missense_Mutation_p.Y137N|NPR3_ENST00000415167.2_Missense_Mutation_p.Y353N	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	353					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	TATGGAGGATTACGTAAGTGC	0.418																																					p.Y353N		Atlas-SNP	.											.	NPR3	65	.	0			c.T1057A						.						107.0	105.0	105.0					5																	32739134		1895	4108	6003	SO:0001583	missense	4883	exon3			GAGGATTACGTAA		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1057T>A	chr5.hg19:g.32739134T>A	ENSP00000265074:p.Tyr353Asn	43.0	0.0		58.0	16.0	NM_000908	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	hg19	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.345454	0.24426	.	.	ENSG00000113389	ENST00000509104;ENST00000434067;ENST00000415685;ENST00000265074;ENST00000415167	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.157201	0.64402	D	0.000014	T	0.81108	0.4754	N	0.08118	0	0.52501	D	0.999953	B;B;B;D	0.89917	0.009;0.009;0.016;1.0	B;B;B;D	0.76575	0.01;0.01;0.007;0.988	T	0.78489	-0.2184	10	0.13108	T	0.6	-13.6443	16.2987	0.82793	0.0:0.0:0.0:1.0	.	137;137;353;353	E7EPG9;B4DT84;P17342;Q60I31	.;.;ANPRC_HUMAN;.	N	130;137;137;353;353	ENSP00000425325:Y130N;ENSP00000388408:Y137N;ENSP00000402490:Y137N;ENSP00000265074:Y353N;ENSP00000398028:Y353N	ENSP00000265074:Y353N	Y	+	1	0	NPR3	32774891	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	6.649000	0.74364	2.257000	0.74773	0.459000	0.35465	TAC	.	.		0.418	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908	
RICTOR	253260	hgsc.bcm.edu	37	5	38945618	38945618	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:38945618T>A	ENST00000357387.3	-	34	4638	c.4608A>T	c.(4606-4608)caA>caT	p.Q1536H	RICTOR_ENST00000296782.5_Missense_Mutation_p.Q1560H	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TTGCACTCAGTTGGTTGCTGG	0.388																																					p.Q1536H		Atlas-SNP	.											.	RICTOR	182	.	0			c.A4608T						.						130.0	119.0	123.0					5																	38945618		2203	4300	6503	SO:0001583	missense	253260	exon34			ACTCAGTTGGTTG		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4608A>T	chr5.hg19:g.38945618T>A	ENSP00000349959:p.Gln1536His	64.0	0.0		89.0	27.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	hg19	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562660	0.45694	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.48201	0.83;0.82	5.63	-0.663	0.11410	.	0.053669	0.85682	D	0.000000	T	0.31544	0.0800	N	0.11560	0.145	0.35712	D	0.816469	P;P	0.39624	0.545;0.681	P;P	0.45138	0.471;0.471	T	0.41980	-0.9478	10	0.87932	D	0	-14.4491	10.2569	0.43403	0.0:0.4372:0.0:0.5628	.	1536;1560	Q6R327;Q6R327-3	RICTR_HUMAN;.	H	1536;1560	ENSP00000349959:Q1536H;ENSP00000296782:Q1560H	ENSP00000296782:Q1560H	Q	-	3	2	RICTOR	38981375	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	0.626000	0.24492	-0.047000	0.13423	0.460000	0.39030	CAA	.	.		0.388	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
MAST4	375449	hgsc.bcm.edu	37	5	66396331	66396331	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:66396331C>A	ENST00000403625.2	+	8	1276	c.981C>A	c.(979-981)ttC>ttA	p.F327L	MAST4_ENST00000405643.1_Missense_Mutation_p.F148L|MAST4_ENST00000490016.2_Missense_Mutation_p.F138L|MAST4_ENST00000404260.3_Missense_Mutation_p.F330L|MAST4_ENST00000261569.7_Missense_Mutation_p.F133L|MAST4_ENST00000403666.1_Missense_Mutation_p.F138L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	330						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGTTACACTTCTTATCAAAAC	0.493																																					p.F327L		Atlas-SNP	.											.	MAST4	218	.	0			c.C981A						.						101.0	100.0	100.0					5																	66396331		2070	4212	6282	SO:0001583	missense	375449	exon8			ACACTTCTTATCA	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.981C>A	chr5.hg19:g.66396331C>A	ENSP00000385727:p.Phe327Leu	67.0	0.0		83.0	5.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414818	0.62511	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61	6.07	3.78	0.43462	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.64402	U	0.000003	T	0.53753	0.1816	M	0.85197	2.74	0.29344	N	0.865829	P;D;D;D;P	0.89917	0.592;1.0;0.999;0.971;0.685	P;D;D;P;B	0.79108	0.739;0.992;0.99;0.867;0.381	T	0.53528	-0.8426	10	0.56958	D	0.05	-13.8156	7.0967	0.25313	0.0:0.6378:0.0:0.3622	.	148;330;133;138;138	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	L	330;327;138;138;148;148;133;133;133	ENSP00000385048:F330L;ENSP00000385727:F327L;ENSP00000421739:F138L;ENSP00000384313:F138L;ENSP00000384099:F148L;ENSP00000261569:F133L;ENSP00000392478:F133L	ENSP00000261569:F133L	F	+	3	2	MAST4	66432087	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	1.530000	0.36007	1.415000	0.47037	0.655000	0.94253	TTC	.	.		0.493	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
HMGCR	3156	hgsc.bcm.edu	37	5	74650335	74650335	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:74650335C>T	ENST00000287936.4	+	12	1532	c.1376C>T	c.(1375-1377)gCa>gTa	p.A459V	HMGCR_ENST00000343975.5_Missense_Mutation_p.A459V|HMGCR_ENST00000511206.1_Missense_Mutation_p.A459V	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	459	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TAGAAAGGTGCAAAATTCCTT	0.373																																					p.A459V		Atlas-SNP	.											.	HMGCR	53	.	0			c.C1376T						.						72.0	65.0	67.0					5																	74650335		2203	4300	6503	SO:0001583	missense	3156	exon12			AAGGTGCAAAATT		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1376C>T	chr5.hg19:g.74650335C>T	ENSP00000287936:p.Ala459Val	46.0	0.0		77.0	10.0	NM_001130996	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	hg19	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	C	31	5.088676	0.94100	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.41758	0.99;0.99;0.99	5.14	5.14	0.70334	Hydroxymethylglutaryl-CoA reductase, N-terminal (1);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);	0.100150	0.64402	D	0.000002	T	0.53254	0.1785	L	0.42686	1.345	0.80722	D	1	B;D;B	0.58268	0.205;0.982;0.367	B;P;B	0.58970	0.034;0.849;0.034	T	0.41662	-0.9496	10	0.28530	T	0.3	-18.2885	18.978	0.92745	0.0:1.0:0.0:0.0	.	459;459;459	B2R649;P04035-2;P04035	.;.;HMDH_HUMAN	V	459;390;459;459	ENSP00000426745:A459V;ENSP00000287936:A459V;ENSP00000340816:A459V	ENSP00000287936:A459V	A	+	2	0	HMGCR	74686091	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	7.425000	0.80255	2.570000	0.86706	0.467000	0.42956	GCA	.	.		0.373	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
AP3B1	8546	hgsc.bcm.edu	37	5	77423969	77423969	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:77423969T>C	ENST00000255194.6	-	17	2028	c.1853A>G	c.(1852-1854)cAg>cGg	p.Q618R	AP3B1_ENST00000519295.1_Missense_Mutation_p.Q569R	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	618					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GGTGCCAAGCTGGAAATGATC	0.368									Hermansky-Pudlak syndrome																												p.Q618R		Atlas-SNP	.											.	AP3B1	94	.	0			c.A1853G						.						45.0	45.0	45.0					5																	77423969		2203	4300	6503	SO:0001583	missense	8546	exon17	Familial Cancer Database	HPS, HPS1-8	CCAAGCTGGAAAT	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1853A>G	chr5.hg19:g.77423969T>C	ENSP00000255194:p.Gln618Arg	33.0	0.0		76.0	29.0	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	hg19	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	T	12.78	2.039663	0.35989	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.57273	0.41;0.42	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	M	0.82923	2.615	0.80722	D	1	B	0.24823	0.112	B	0.26864	0.074	T	0.60642	-0.7223	10	0.52906	T	0.07	-13.4045	16.3453	0.83126	0.0:0.0:0.0:1.0	.	618	O00203	AP3B1_HUMAN	R	618;569;618;522	ENSP00000255194:Q618R;ENSP00000430597:Q569R	ENSP00000255194:Q618R	Q	-	2	0	AP3B1	77459725	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.021000	0.88750	2.261000	0.74972	0.533000	0.62120	CAG	.	.		0.368	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
ERAP1	51752	hgsc.bcm.edu	37	5	96117490	96117490	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:96117490A>G	ENST00000443439.2	-	16	2420	c.2354T>C	c.(2353-2355)cTt>cCt	p.L785P	ERAP1_ENST00000296754.3_Missense_Mutation_p.L785P|ERAP1_ENST00000514604.1_5'UTR|CTD-2260A17.1_ENST00000512856.1_RNA	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	785					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TTTACTATAAAGAAAATCCCA	0.453																																					p.L785P		Atlas-SNP	.											.	ERAP1	59	.	0			c.T2354C						.						80.0	86.0	84.0					5																	96117490		2203	4300	6503	SO:0001583	missense	51752	exon16			CTATAAAGAAAAT	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2354T>C	chr5.hg19:g.96117490A>G	ENSP00000406304:p.Leu785Pro	47.0	0.0		65.0	14.0	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	hg19	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703982	0.88924	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.09911	2.93;2.93	6.16	6.16	0.99307	.	0.063553	0.64402	D	0.000004	T	0.39462	0.1079	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	T	0.32455	-0.9906	10	0.72032	D	0.01	.	16.4675	0.84087	1.0:0.0:0.0:0.0	.	785;785;785	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	P	785	ENSP00000296754:L785P;ENSP00000406304:L785P	ENSP00000296754:L785P	L	-	2	0	ERAP1	96143246	1.000000	0.71417	0.953000	0.39169	0.997000	0.91878	8.571000	0.90752	2.367000	0.80283	0.528000	0.53228	CTT	.	.		0.453	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
PCDHA3	56145	hgsc.bcm.edu	37	5	140181280	140181280	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:140181280G>A	ENST00000522353.2	+	1	498	c.498G>A	c.(496-498)tcG>tcA	p.S166S	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Silent_p.S166S|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACAAATTCGTTGTTGACTT	0.398																																					p.S166S		Atlas-SNP	.											.	PCDHA3	396	.	0			c.G498A						.						76.0	81.0	79.0					5																	140181280		2203	4300	6503	SO:0001819	synonymous_variant	56145	exon1			AAATTCGTTGTTG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.498G>A	chr5.hg19:g.140181280G>A		68.0	0.0		96.0	34.0	NM_031497	O75286	Silent	SNP	ENST00000522353.2	hg19	CCDS54915.1																																																																																			.	.		0.398	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
MRPL22	29093	hgsc.bcm.edu	37	5	154330405	154330405	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:154330405C>G	ENST00000523037.1	+	3	143	c.102C>G	c.(100-102)caC>caG	p.H34Q	MRPL22_ENST00000522038.1_Missense_Mutation_p.H40Q|MRPL22_ENST00000265229.8_Intron|MRPL22_ENST00000439747.3_Missense_Mutation_p.H60Q	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	34					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CATATATCCACACAAGTGCTT	0.388																																					p.H34Q		Atlas-SNP	.											.	MRPL22	18	.	0			c.C102G						.						124.0	122.0	123.0					5																	154330405		2203	4300	6503	SO:0001583	missense	29093	exon3			TATCCACACAAGT	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.102C>G	chr5.hg19:g.154330405C>G	ENSP00000431040:p.His34Gln	44.0	0.0		67.0	5.0	NM_014180	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	hg19	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885539	0.33255	.	.	ENSG00000082515	ENST00000523037;ENST00000439747;ENST00000522038	T;T;T	0.55930	0.57;0.49;0.72	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	M	0.79693	2.465	0.58432	D	0.999994	B	0.28880	0.226	B	0.29524	0.103	T	0.60692	-0.7213	10	0.87932	D	0	-3.8561	9.6481	0.39881	0.0:0.9031:0.0:0.0969	.	34	Q9NWU5	RM22_HUMAN	Q	34;60;40	ENSP00000431040:H34Q;ENSP00000411177:H60Q;ENSP00000429039:H40Q	ENSP00000411177:H60Q	H	+	3	2	MRPL22	154310598	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	0.886000	0.28241	2.404000	0.81709	0.591000	0.81541	CAC	.	.		0.388	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
GABRA6	2559	hgsc.bcm.edu	37	5	161128536	161128536	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:161128536G>T	ENST00000274545.5	+	9	1552	c.1119G>T	c.(1117-1119)agG>agT	p.R373S	GABRA6_ENST00000523217.1_Missense_Mutation_p.R363S			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	373					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGAAGAAAAGGATCACTTCTC	0.398										TCGA Ovarian(5;0.080)																											p.R373S		Atlas-SNP	.											.	GABRA6	139	.	0			c.G1119T						.						107.0	112.0	110.0					5																	161128536		2203	4300	6503	SO:0001583	missense	2559	exon9			GAAAAGGATCACT		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1119G>T	chr5.hg19:g.161128536G>T	ENSP00000274545:p.Arg373Ser	48.0	0.0		81.0	25.0	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	hg19	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518012	0.44763	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.83419	-1.72;-1.72	5.16	2.74	0.32292	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.377798	0.28057	N	0.016775	T	0.80984	0.4729	M	0.72894	2.215	0.36535	D	0.87093	P	0.38863	0.65	B	0.43155	0.41	T	0.76217	-0.3040	10	0.15499	T	0.54	.	9.2142	0.37337	0.8448:0.0:0.1552:0.0	.	373	Q16445	GBRA6_HUMAN	S	373;363	ENSP00000274545:R373S;ENSP00000430527:R363S	ENSP00000274545:R373S	R	+	3	2	GABRA6	161061114	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.021000	0.30040	0.363000	0.24346	-0.294000	0.09567	AGG	.	.		0.398	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
CDHR2	54825	hgsc.bcm.edu	37	5	176018233	176018233	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:176018233A>G	ENST00000510636.1	+	29	3836	c.3562A>G	c.(3562-3564)Atg>Gtg	p.M1188V	CDHR2_ENST00000261944.5_Missense_Mutation_p.M1188V|CDHR2_ENST00000506348.1_Missense_Mutation_p.M1188V	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1188					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GCTTCAAGCTATGAAGGCTGC	0.602																																					p.M1188V		Atlas-SNP	.											.	CDHR2	152	.	0			c.A3562G						.						57.0	54.0	55.0					5																	176018233		2203	4300	6503	SO:0001583	missense	54825	exon29			CAAGCTATGAAGG	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.3562A>G	chr5.hg19:g.176018233A>G	ENSP00000424565:p.Met1188Val	97.0	0.0		91.0	22.0	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	a	0.022	-1.415332	0.01136	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.53423	0.62;0.62;0.62	4.24	0.564	0.17302	.	.	.	.	.	T	0.21509	0.0518	N	0.14661	0.345	0.23320	N	0.997911	B	0.02656	0.0	B	0.04013	0.001	T	0.28364	-1.0046	9	0.02654	T	1	-14.8133	4.6247	0.12472	0.5211:0.1673:0.3116:0.0	.	1188	Q9BYE9	CDHR2_HUMAN	V	1188	ENSP00000424565:M1188V;ENSP00000261944:M1188V;ENSP00000421078:M1188V	ENSP00000261944:M1188V	M	+	1	0	CDHR2	175950839	0.026000	0.19158	0.999000	0.59377	0.634000	0.38068	0.010000	0.13242	0.247000	0.21414	0.376000	0.23039	ATG	.	.		0.602	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
SLC34A1	6569	hgsc.bcm.edu	37	5	176813072	176813072	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr5:176813072G>A	ENST00000324417.5	+	3	285	c.194G>A	c.(193-195)gGg>gAg	p.G65E	SLC34A1_ENST00000512593.1_Missense_Mutation_p.G65E	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	65					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCCCCTGTGGGGAGGTCCTG	0.687																																					p.G65E		Atlas-SNP	.											.	SLC34A1	73	.	0			c.G194A						.						34.0	37.0	36.0					5																	176813072		2203	4300	6503	SO:0001583	missense	6569	exon3			CCTGTGGGGAGGT	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.194G>A	chr5.hg19:g.176813072G>A	ENSP00000321424:p.Gly65Glu	107.0	0.0		100.0	8.0	NM_003052	B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	hg19	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564823	0.27915	.	.	ENSG00000131183	ENST00000504577;ENST00000512593;ENST00000324417	T;T	0.56103	0.48;1.32	5.06	5.06	0.68205	.	0.159936	0.38217	N	0.001777	T	0.39809	0.1092	L	0.29908	0.895	0.20873	N	0.999839	D	0.53619	0.961	P	0.44597	0.454	T	0.28170	-1.0052	10	0.10111	T	0.7	-11.1428	12.541	0.56169	0.0:0.0:0.8342:0.1658	.	65	Q06495	NPT2A_HUMAN	E	65	ENSP00000423022:G65E;ENSP00000321424:G65E	ENSP00000321424:G65E	G	+	2	0	SLC34A1	176745678	1.000000	0.71417	0.995000	0.50966	0.246000	0.25737	3.316000	0.51960	2.642000	0.89623	0.561000	0.74099	GGG	.	.		0.687	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
NUP153	9972	hgsc.bcm.edu	37	6	17675798	17675798	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:17675798T>G	ENST00000262077.2	-	3	537	c.538A>C	c.(538-540)Aac>Cac	p.N180H	NUP153_ENST00000537253.1_Missense_Mutation_p.N180H	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	180					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GTTGAGATGTTATCATCATCA	0.383																																					p.N180H		Atlas-SNP	.											.	NUP153	116	.	0			c.A538C						.						79.0	76.0	77.0					6																	17675798		2203	4300	6503	SO:0001583	missense	9972	exon3			AGATGTTATCATC	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.538A>C	chr6.hg19:g.17675798T>G	ENSP00000262077:p.Asn180His	95.0	0.0		132.0	24.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	hg19	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216511	0.79352	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.44881	0.91;0.91	5.37	5.37	0.77165	Nucleoporin, Nup153-like (1);	0.000000	0.56097	D	0.000021	T	0.56441	0.1985	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.998	T	0.61950	-0.6957	10	0.62326	D	0.03	-14.39	15.3876	0.74714	0.0:0.0:0.0:1.0	.	180;202;180	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	H	180;202;180	ENSP00000262077:N180H;ENSP00000444029:N180H	ENSP00000262077:N180H	N	-	1	0	NUP153	17783777	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.622000	0.83099	2.041000	0.60428	0.528000	0.53228	AAC	.	.		0.383	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
ETV7	51513	hgsc.bcm.edu	37	6	36334437	36334437	+	Silent	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:36334437T>A	ENST00000340181.4	-	8	1252	c.1011A>T	c.(1009-1011)ccA>ccT	p.P337P	ETV7_ENST00000339796.5_Intron|ETV7_ENST00000373738.1_Silent_p.P282P|ETV7_ENST00000373737.4_Silent_p.P260P|ETV7_ENST00000538992.1_Silent_p.P186P	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	337					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						GAGAGATTTCTGGCCTCTTGT	0.597																																					p.P337P		Atlas-SNP	.											.	ETV7	31	.	0			c.A1011T						.						133.0	129.0	131.0					6																	36334437		2203	4300	6503	SO:0001819	synonymous_variant	51513	exon8			GATTTCTGGCCTC	AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.1011A>T	chr6.hg19:g.36334437T>A		61.0	0.0		76.0	20.0	NM_016135	B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Silent	SNP	ENST00000340181.4	hg19	CCDS4819.1																																																																																			.	.		0.597	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040341.1	NM_016135	
MEP1A	4224	hgsc.bcm.edu	37	6	46794122	46794122	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:46794122T>C	ENST00000230588.4	+	9	819	c.810T>C	c.(808-810)acT>acC	p.T270T		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	270	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			ACCACTGTACTTTTGAGAAGG	0.423																																					p.T270T		Atlas-SNP	.											.	MEP1A	93	.	0			c.T810C						.						118.0	113.0	115.0					6																	46794122		2203	4300	6503	SO:0001819	synonymous_variant	4224	exon9			CTGTACTTTTGAG		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.810T>C	chr6.hg19:g.46794122T>C		50.0	0.0		92.0	33.0	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	ENST00000230588.4	hg19	CCDS4918.1																																																																																			.	.		0.423	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
PKHD1	5314	hgsc.bcm.edu	37	6	51889983	51889983	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:51889983T>G	ENST00000371117.3	-	32	4900	c.4625A>C	c.(4624-4626)gAc>gCc	p.D1542A	PKHD1_ENST00000340994.4_Missense_Mutation_p.D1542A	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1542	IPT/TIG 10.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGGGGCCAAGTCTCTTGTCTG	0.443																																					p.D1542A		Atlas-SNP	.											.	PKHD1	927	.	0			c.A4625C						.						60.0	61.0	60.0					6																	51889983		2203	4300	6503	SO:0001583	missense	5314	exon32			GCCAAGTCTCTTG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4625A>C	chr6.hg19:g.51889983T>G	ENSP00000360158:p.Asp1542Ala	75.0	0.0		87.0	22.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	0.458	-0.890493	0.02491	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.74209	-0.82;-0.82	5.66	-2.59	0.06209	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.431689	0.25148	N	0.032762	T	0.51398	0.1672	M	0.64997	1.995	0.09310	N	1	B;P	0.44659	0.011;0.84	B;P	0.48334	0.041;0.574	T	0.62849	-0.6767	10	0.02654	T	1	.	12.8415	0.57805	0.0:0.4775:0.0:0.5225	.	1542;1542	P08F94-2;P08F94	.;PKHD1_HUMAN	A	1542	ENSP00000360158:D1542A;ENSP00000341097:D1542A	ENSP00000341097:D1542A	D	-	2	0	PKHD1	51997942	0.000000	0.05858	0.063000	0.19743	0.224000	0.24922	-0.035000	0.12205	-0.368000	0.08040	0.528000	0.53228	GAC	.	.		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
GSTA4	2941	hgsc.bcm.edu	37	6	52850272	52850272	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:52850272G>T	ENST00000370959.1	-	4	366	c.249C>A	c.(247-249)ggC>ggA	p.G83G	GSTA4_ENST00000486559.1_5'UTR|GSTA4_ENST00000541324.1_Splice_Site|GSTA4_ENST00000370960.1_Intron			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	83	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	TGAGGTTCTTGCCAAAGAGAT	0.488																																					p.G83G		Atlas-SNP	.											.	GSTA4	20	.	0			c.C249A						.						190.0	152.0	165.0					6																	52850272		2203	4300	6503	SO:0001819	synonymous_variant	2941	exon4			GTTCTTGCCAAAG	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.249C>A	chr6.hg19:g.52850272G>T		97.0	0.0		118.0	28.0	NM_001512	B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Silent	SNP	ENST00000370959.1	hg19	CCDS4948.1																																																																																			.	.		0.488	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040946.1	NM_001512	
DST	667	hgsc.bcm.edu	37	6	56401645	56401645	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:56401645T>C	ENST00000361203.3	-	58	16076	c.16069A>G	c.(16069-16071)Act>Gct	p.T5357A	DST_ENST00000370769.4_Missense_Mutation_p.T5359A|DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Missense_Mutation_p.T5537A|DST_ENST00000244364.6_Missense_Mutation_p.T2945A|DST_ENST00000421834.2_Missense_Mutation_p.T3271A|DST_ENST00000370788.2_Missense_Mutation_p.T3271A|DST_ENST00000340834.4_5'UTR|DST_ENST00000446842.2_Missense_Mutation_p.T5033A			Q03001	DYST_HUMAN	dystonin	5357					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGAGTGCTAGTGCTTTTGGCA	0.448																																					p.T2945A		Atlas-SNP	.											.	DST	1427	.	0			c.A8833G						.						150.0	149.0	149.0					6																	56401645		2022	4204	6226	SO:0001583	missense	667	exon43			TGCTAGTGCTTTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16069A>G	chr6.hg19:g.56401645T>C	ENSP00000354508:p.Thr5357Ala	54.0	0.0		100.0	27.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	T	12.09	1.833360	0.32421	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.7	0.679	0.17975	.	0.390983	0.21571	N	0.072416	T	0.11580	0.0282	N	0.25201	0.72	0.25422	N	0.98827	B;B;B;B;B	0.19817	0.039;0.031;0.015;0.001;0.002	B;B;B;B;B	0.26969	0.036;0.075;0.02;0.009;0.008	T	0.22941	-1.0202	9	0.07813	T	0.8	.	9.827	0.40919	0.0:0.2452:0.0:0.7548	.	3271;5359;5537;5357;2945	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	A	2945;5537;5359;3271;5033;3271;5357	ENSP00000244364:T2945A;ENSP00000359790:T5537A;ENSP00000359805:T5359A;ENSP00000400883:T3271A;ENSP00000393645:T5033A;ENSP00000359824:T3271A;ENSP00000354508:T5357A	ENSP00000244364:T2945A	T	-	1	0	DST	56509604	0.814000	0.29104	0.513000	0.27749	0.972000	0.66771	0.270000	0.18607	0.133000	0.18654	0.477000	0.44152	ACT	.	.		0.448	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
NT5E	4907	hgsc.bcm.edu	37	6	86194984	86194984	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:86194984G>T	ENST00000257770.3	+	4	832	c.783G>T	c.(781-783)ggG>ggT	p.G261G	NT5E_ENST00000369651.3_Silent_p.G261G	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	261					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.G261G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TGCCTGCTGGGAAGTACCCAT	0.502																																					p.G261G	Melanoma(140;797 1765 2035 2752 18208)	Atlas-SNP	.											NT5E,rectum,carcinoma,0,1	NT5E	56	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G783T						.						102.0	87.0	92.0					6																	86194984		2203	4300	6503	SO:0001819	synonymous_variant	4907	exon4			TGCTGGGAAGTAC	X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.783G>T	chr6.hg19:g.86194984G>T		56.0	0.0		67.0	19.0	NM_001204813	B3KQI8|O75520|Q5W116	Silent	SNP	ENST00000257770.3	hg19	CCDS5002.1	.	.	.	.	.	.	.	.	.	.	G	9.172	1.021416	0.19433	.	.	ENSG00000135318	ENST00000416334	T	0.67523	-0.27	5.63	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.56441	0.1985	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67256	-0.5716	7	0.87932	D	0	-15.3447	2.3625	0.04310	0.1318:0.1432:0.4772:0.2478	.	.	.	.	V	26	ENSP00000414674:G26V	ENSP00000414674:G26V	G	+	2	0	NT5E	86251703	0.032000	0.19561	1.000000	0.80357	0.996000	0.88848	0.224000	0.17738	2.646000	0.89796	0.462000	0.41574	GGA	.	.		0.502	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1		
AKIRIN2	55122	hgsc.bcm.edu	37	6	88387595	88387595	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:88387595T>G	ENST00000257787.5	-	3	994	c.470A>C	c.(469-471)aAa>aCa	p.K157T		NM_018064.3	NP_060534.1	Q53H80	AKIR2_HUMAN	akirin 2	157					embryo development (GO:0009790)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to lipopolysaccharide (GO:0032496)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)			large_intestine(4)	4						TTCACGTTCTTTCAACAAACG	0.388																																					p.K157T		Atlas-SNP	.											.	AKIRIN2	13	.	0			c.A470C						.						157.0	153.0	154.0					6																	88387595		2203	4300	6503	SO:0001583	missense	55122	exon3			CGTTCTTTCAACA	BC000764	CCDS5013.1	6q15	2009-04-17	2008-06-23	2008-06-23	ENSG00000135334	ENSG00000135334			21407	protein-coding gene	gene with protein product		615165	"""chromosome 6 open reading frame 166"""	C6orf166			Standard	NM_018064		Approved	FLJ10342, dJ486L4.2	uc003pmk.3	Q53H80	OTTHUMG00000015180	ENST00000257787.5:c.470A>C	chr6.hg19:g.88387595T>G	ENSP00000257787:p.Lys157Thr	52.0	0.0		86.0	29.0	NM_018064	Q9BQB1	Missense_Mutation	SNP	ENST00000257787.5	hg19	CCDS5013.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439334	0.83885	.	.	ENSG00000135334	ENST00000257787	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	M	0.90425	3.115	0.80722	D	1	P	0.51537	0.946	P	0.48840	0.592	T	0.79172	-0.1913	9	0.87932	D	0	-17.9963	16.5764	0.84681	0.0:0.0:0.0:1.0	.	157	Q53H80	AKIR2_HUMAN	T	157	.	ENSP00000257787:K157T	K	-	2	0	AKIRIN2	88444314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.926000	0.70070	2.371000	0.80710	0.533000	0.62120	AAA	.	.		0.388	AKIRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041455.1	NM_018064	
CCNC	892	hgsc.bcm.edu	37	6	100016396	100016396	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:100016396C>T	ENST00000520429.1	-	1	453	c.8G>A	c.(7-9)gGg>gAg	p.G3E	CCNC_ENST00000520371.1_Missense_Mutation_p.G3E|CCNC_ENST00000369220.4_Missense_Mutation_p.G3E|CCNC_ENST00000523985.1_5'UTR|RP1-199J3.7_ENST00000607332.1_RNA|CCNC_ENST00000521017.1_5'UTR|CCNC_ENST00000482541.2_Missense_Mutation_p.G3E|CCNC_ENST00000523799.1_Intron|CCNC_ENST00000518714.1_Missense_Mutation_p.G3E	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C	3					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)							all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		CCAAAAGTTCCCTGCCATGGA	0.632																																					p.G3E	GBM(57;273 1020 40094 44454 49348)	Atlas-SNP	.											.	CCNC	23	.	0			c.G8A						.						55.0	54.0	54.0					6																	100016396		2203	4300	6503	SO:0001583	missense	892	exon1			AAGTTCCCTGCCA		CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.8G>A	chr6.hg19:g.100016396C>T	ENSP00000428982:p.Gly3Glu	77.0	0.0		72.0	7.0	NM_005190	B4DPZ1|Q9H543	Missense_Mutation	SNP	ENST00000520429.1	hg19	CCDS34502.1	.	.	.	.	.	.	.	.	.	.	C	36	5.728326	0.96856	.	.	ENSG00000112237	ENST00000520429;ENST00000369220;ENST00000520371;ENST00000518714;ENST00000369217;ENST00000482541	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.25	5.25	0.73442	Cyclin-like (1);	0.000000	0.85682	D	0.000000	T	0.35335	0.0928	M	0.82630	2.6	0.80722	D	1	D;D;D	0.64830	0.988;0.994;0.988	P;P;P	0.54026	0.575;0.74;0.575	T	0.14172	-1.0482	9	.	.	.	-7.1502	18.3691	0.90401	0.0:1.0:0.0:0.0	.	3;36;3	Q7Z4L3;Q05CF7;P24863	.;.;CCNC_HUMAN	E	3	ENSP00000428982:G3E;ENSP00000358222:G3E;ENSP00000430381:G3E;ENSP00000430294:G3E	.	G	-	2	0	CCNC	100123117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.627000	0.74258	2.885000	0.99019	0.655000	0.94253	GGG	.	.		0.632	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041613.2	NM_005190	
AK9	221264	hgsc.bcm.edu	37	6	109863371	109863371	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:109863371G>T	ENST00000424296.2	-	27	3305	c.3229C>A	c.(3229-3231)Cca>Aca	p.P1077T	AK9_ENST00000355283.1_Missense_Mutation_p.P156T|AK9_ENST00000341338.6_Missense_Mutation_p.P156T	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1077	Adenylate kinase 2.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TGTACTTCTGGAAGCTAAAAA	0.333																																					p.P1077T		Atlas-SNP	.											.	AKD1	223	.	0			c.C3229A						.						67.0	61.0	63.0					6																	109863371		2202	4299	6501	SO:0001583	missense	221264	exon27			CTTCTGGAAGCTA	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3229C>A	chr6.hg19:g.109863371G>T	ENSP00000410186:p.Pro1077Thr	50.0	0.0		98.0	29.0	NM_001145128	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	ENST00000424296.2	hg19	CCDS55048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.945|9.945	1.218611|1.218611	0.22373|0.22373	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000491875|ENST00000424296;ENST00000355283;ENST00000341338	.|T;T;T	.|0.64085	.|0.0;-0.02;-0.08	5.3|5.3	1.01|1.01	0.19927|0.19927	.|ATPase, AAA+ type, core (1);	.|0.843243	.|0.10495	.|N	.|0.667922	T|T	0.22166|0.22166	0.0534|0.0534	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|B;B	.|0.31503	.|0.257;0.326	.|B;B	.|0.29077	.|0.098;0.096	T|T	0.12451|0.12451	-1.0547|-1.0547	5|9	.|.	.|.	.|.	.|.	4.6042|4.6042	0.12368|0.12368	0.078:0.2052:0.5163:0.2006|0.078:0.2052:0.5163:0.2006	.|.	.|156;1077	.|Q5TCS8-5;Q5TCS8	.|.;AKD1_HUMAN	L|T	11|1077;156;156	.|ENSP00000410186:P1077T;ENSP00000347431:P156T;ENSP00000344637:P156T	.|.	F|P	-|-	3|1	2|0	AKD1|AKD1	109970064|109970064	0.004000|0.004000	0.15560|0.15560	0.009000|0.009000	0.14445|0.14445	0.544000|0.544000	0.35116|0.35116	-0.091000|-0.091000	0.11146|0.11146	0.260000|0.260000	0.21731|0.21731	0.650000|0.650000	0.86243|0.86243	TTC|CCA	.	.		0.333	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128	
TAAR2	9287	hgsc.bcm.edu	37	6	132938564	132938564	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:132938564C>A	ENST00000367931.1	-	2	780	c.781G>T	c.(781-783)Gcc>Tcc	p.A261S	TAAR2_ENST00000275191.2_Missense_Mutation_p.A216S|TAAR2_ENST00000537809.1_Missense_Mutation_p.A216S			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	261					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		AAAGTTTTGGCAGCTTTTTTG	0.328																																					p.A261S		Atlas-SNP	.											.	TAAR2	45	.	0			c.G781T						.						58.0	47.0	51.0					6																	132938564		2203	4300	6503	SO:0001583	missense	9287	exon2			TTTTGGCAGCTTT	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.781G>T	chr6.hg19:g.132938564C>A	ENSP00000356908:p.Ala261Ser	92.0	0.0		152.0	46.0	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	hg19	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764113	0.69878	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.74315	-0.83;-0.83;-0.83	6.1	6.1	0.99115	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	M	0.78637	2.42	0.47862	D	0.999539	D	0.89917	1.0	D	0.91635	0.999	D	0.85690	0.1306	10	0.72032	D	0.01	-31.153	20.7146	0.99709	0.0:1.0:0.0:0.0	.	261	Q9P1P5	TAAR2_HUMAN	S	216;261;216	ENSP00000275191:A216S;ENSP00000356908:A261S;ENSP00000441263:A216S	ENSP00000275191:A216S	A	-	1	0	TAAR2	132980257	0.956000	0.32656	1.000000	0.80357	0.949000	0.60115	2.128000	0.42045	2.902000	0.99343	0.650000	0.86243	GCC	.	.		0.328	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
HBS1L	10767	hgsc.bcm.edu	37	6	135357985	135357985	+	Intron	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:135357985T>G	ENST00000367837.5	-	4	637				HBS1L_ENST00000367826.2_Intron|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000314674.3_Intron|HBS1L_ENST00000367824.4_Intron|HBS1L_ENST00000367822.5_Missense_Mutation_p.N537T|HBS1L_ENST00000367820.2_Intron|HBS1L_ENST00000415177.2_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		GCCTTTGTTGTTTTTCTTATT	0.428																																					p.N537T		Atlas-SNP	.											.	HBS1L	75	.	0			c.A1610C						.						50.0	43.0	45.0					6																	135357985		692	1591	2283	SO:0001627	intron_variant	10767	exon5			TTGTTGTTTTTCT	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.430+2725A>C	chr6.hg19:g.135357985T>G		53.0	0.0		99.0	26.0	NM_001145207	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	hg19	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.685830	0.00738	.	.	ENSG00000112339	ENST00000367822	.	.	.	5.32	-5.91	0.02269	.	.	.	.	.	T	0.09335	0.0230	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.17228	-1.0376	7	0.08599	T	0.76	.	6.5883	0.22632	0.0889:0.2843:0.4983:0.1284	.	537	Q9Y450-2	.	T	537	.	ENSP00000356796:N537T	N	-	2	0	HBS1L	135399678	0.028000	0.19301	0.170000	0.22879	0.885000	0.51271	-1.150000	0.03178	-0.990000	0.03481	0.533000	0.62120	AAC	.	.		0.428	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2		
KIAA1244	57221	hgsc.bcm.edu	37	6	138584345	138584345	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:138584345T>C	ENST00000251691.4	+	12	1891	c.1725T>C	c.(1723-1725)acT>acC	p.T575T		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CTGACATAACTAACTTCCTGT	0.488																																					p.T575T		Atlas-SNP	.											.	KIAA1244	236	.	0			c.T1725C						.						112.0	103.0	106.0					6																	138584345		2203	4300	6503	SO:0001819	synonymous_variant	57221	exon12			CATAACTAACTTC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1725T>C	chr6.hg19:g.138584345T>C		84.0	0.0		75.0	30.0	NM_020340		Silent	SNP	ENST00000251691.4	hg19	CCDS5189.2																																																																																			.	.		0.488	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
THBS2	7058	hgsc.bcm.edu	37	6	169650830	169650830	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:169650830T>G	ENST00000366787.3	-	3	299	c.50A>C	c.(49-51)cAa>cCa	p.Q17P		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	17					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ACACTCACCTTGCGTGCTGGG	0.547																																					p.Q17P	Esophageal Squamous(91;219 1934 18562 44706)	Atlas-SNP	.											.	THBS2	230	.	0			c.A50C						.						57.0	48.0	51.0					6																	169650830		2203	4300	6503	SO:0001583	missense	7058	exon3			TCACCTTGCGTGC		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.50A>C	chr6.hg19:g.169650830T>G	ENSP00000355751:p.Gln17Pro	77.0	0.0		125.0	38.0	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	hg19	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	T	11.16	1.557613	0.27827	.	.	ENSG00000186340	ENST00000366787;ENST00000435791	T	0.80994	-1.44	4.85	-0.542	0.11854	.	0.635159	0.12737	U	0.443334	T	0.51924	0.1703	L	0.53249	1.67	0.09310	N	1	B	0.29508	0.246	B	0.25405	0.06	T	0.48445	-0.9035	10	0.87932	D	0	-11.7346	2.2793	0.04110	0.1699:0.0923:0.1345:0.6032	.	17	P35442	TSP2_HUMAN	P	17	ENSP00000355751:Q17P	ENSP00000355751:Q17P	Q	-	2	0	THBS2	169392755	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.696000	0.01912	-0.241000	0.09681	0.533000	0.62120	CAA	.	.		0.547	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
HDAC9	9734	hgsc.bcm.edu	37	7	18687484	18687484	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:18687484A>G	ENST00000432645.2	+	9	1103	c.1103A>G	c.(1102-1104)tAt>tGt	p.Y368C	HDAC9_ENST00000406451.4_Missense_Mutation_p.Y368C|HDAC9_ENST00000524023.1_Missense_Mutation_p.Y291C|HDAC9_ENST00000456174.2_Missense_Mutation_p.Y340C|HDAC9_ENST00000441542.2_Missense_Mutation_p.Y371C|HDAC9_ENST00000417496.2_Missense_Mutation_p.Y366C|HDAC9_ENST00000406072.1_Missense_Mutation_p.Y355C|HDAC9_ENST00000428307.2_Missense_Mutation_p.Y324C|HDAC9_ENST00000401921.1_Missense_Mutation_p.Y327C|HDAC9_ENST00000405010.3_Missense_Mutation_p.Y368C	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	368					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CCTGGGCAGTATGGAGGCAGC	0.502																																					p.Y371C		Atlas-SNP	.											.	HDAC9	560	.	0			c.A1112G						.						38.0	40.0	40.0					7																	18687484		2074	4219	6293	SO:0001583	missense	9734	exon9			GGCAGTATGGAGG	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1103A>G	chr7.hg19:g.18687484A>G	ENSP00000410337:p.Tyr368Cys	73.0	0.0		106.0	37.0	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	hg19	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	A	13.76	2.333428	0.41297	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T	0.57907	0.92;0.94;0.37;0.93;0.93;0.37;0.37;0.37;0.94;0.93	5.64	5.64	0.86602	.	0.000000	0.51477	D	0.000097	T	0.67401	0.2889	L	0.51422	1.61	0.43211	D	0.995078	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.997;0.975;0.999;0.985;0.999;0.998;0.986;0.999;0.998;0.979;0.975;0.998;0.985;0.999	P;P;D;P;P;D;P;D;D;P;P;D;P;P	0.81914	0.778;0.594;0.937;0.731;0.867;0.929;0.733;0.995;0.911;0.613;0.647;0.911;0.77;0.894	T	0.68085	-0.5502	10	0.51188	T	0.08	-21.3907	15.8344	0.78787	1.0:0.0:0.0:0.0	.	291;340;368;355;366;368;371;327;371;368;340;368;368;346	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q9UKV0-2;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	C	366;369;368;368;324;355;327;368;371;340;291;368	ENSP00000401669:Y366C;ENSP00000384382:Y368C;ENSP00000384657:Y368C;ENSP00000395655:Y324C;ENSP00000384017:Y355C;ENSP00000383912:Y327C;ENSP00000410337:Y368C;ENSP00000408617:Y371C;ENSP00000388568:Y340C;ENSP00000430036:Y291C	ENSP00000262069:Y369C	Y	+	2	0	HDAC9	18654009	1.000000	0.71417	0.995000	0.50966	0.358000	0.29455	6.778000	0.75043	2.153000	0.67306	0.477000	0.44152	TAT	.	.		0.502	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
STK31	56164	hgsc.bcm.edu	37	7	23776654	23776654	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:23776654A>G	ENST00000355870.3	+	8	1093	c.974A>G	c.(973-975)aAg>aGg	p.K325R	STK31_ENST00000354639.3_Missense_Mutation_p.K302R|STK31_ENST00000428484.1_Missense_Mutation_p.K302R|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.K325R	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	325						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GAAAGTTATAAGGCGTTAGAA	0.418																																					p.K325R		Atlas-SNP	.											.	STK31	175	.	0			c.A974G						.						64.0	67.0	66.0					7																	23776654		2203	4300	6503	SO:0001583	missense	56164	exon8			GTTATAAGGCGTT	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.974A>G	chr7.hg19:g.23776654A>G	ENSP00000348132:p.Lys325Arg	29.0	0.0		29.0	10.0	NM_031414	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	hg19	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	a	8.921	0.960994	0.18583	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.7	4.54	0.55810	.	0.224235	0.45606	D	0.000346	T	0.26412	0.0645	M	0.62723	1.935	0.22639	N	0.998906	B;B	0.15473	0.013;0.013	B;B	0.12156	0.007;0.007	T	0.15206	-1.0445	10	0.33141	T	0.24	-9.8787	11.0951	0.48139	0.8447:0.1553:0.0:0.0	.	325;325	B4DZ06;Q9BXU1	.;STK31_HUMAN	R	325;325;302;302	ENSP00000348132:K325R;ENSP00000411852:K325R;ENSP00000346660:K302R;ENSP00000406146:K302R	ENSP00000346660:K302R	K	+	2	0	STK31	23743179	0.491000	0.26019	0.467000	0.27180	0.059000	0.15707	1.982000	0.40638	1.080000	0.41073	0.491000	0.48974	AAG	.	.		0.418	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
ZNF679	168417	hgsc.bcm.edu	37	7	63720639	63720639	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:63720639T>A	ENST00000421025.1	+	3	349	c.80T>A	c.(79-81)cTg>cAg	p.L27Q	ZNF679_ENST00000255746.4_Missense_Mutation_p.L27Q	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	27	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GAATTCTCTCTGGAGGAGTGG	0.408																																					p.L27Q		Atlas-SNP	.											.	ZNF679	80	.	0			c.T80A						.						60.0	53.0	55.0					7																	63720639		692	1591	2283	SO:0001583	missense	168417	exon3			TCTCTCTGGAGGA	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.80T>A	chr7.hg19:g.63720639T>A	ENSP00000416809:p.Leu27Gln	109.0	0.0		168.0	50.0	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	t	3.653	-0.071042	0.07228	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.01379	4.96;4.96	0.195	0.195	0.15151	Krueppel-associated box (4);	.	.	.	.	T	0.01254	0.0041	N	0.03930	-0.32	0.09310	N	0.999996	D	0.62365	0.991	P	0.62298	0.9	T	0.48479	-0.9032	9	0.12430	T	0.62	.	2.3209	0.04211	0.4746:1.0E-4:1.0E-4:0.5253	.	27	Q8IYX0	ZN679_HUMAN	Q	27	ENSP00000416809:L27Q;ENSP00000255746:L27Q	ENSP00000255746:L27Q	L	+	2	0	ZNF679	63358074	0.000000	0.05858	0.035000	0.18076	0.035000	0.12851	-2.012000	0.01451	0.257000	0.21650	0.254000	0.18369	CTG	.	.		0.408	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
ARPC1B	10095	hgsc.bcm.edu	37	7	98985732	98985732	+	Silent	SNP	G	G	A	rs373569413		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:98985732G>A	ENST00000451682.1	+	6	549	c.240G>A	c.(238-240)acG>acA	p.T80T	ARPC1A_ENST00000432884.2_3'UTR|ARPC1B_ENST00000252725.5_Silent_p.T80T|ARPC1B_ENST00000474880.1_3'UTR			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	80					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ACGTGTGGACGCTGAAGGGCC	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17516	0.0		0.0	False		,,,				2504	0.001				p.T80T		Atlas-SNP	.											.	ARPC1B	41	.	0			c.G240A						.	G		0,4406		0,0,2203	69.0	68.0	68.0		240	-9.2	0.7	7		68	1,8599		0,1,4299	no	coding-synonymous	ARPC1B	NM_005720.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		80/373	98985732	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10095	exon4			GTGGACGCTGAAG	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.240G>A	chr7.hg19:g.98985732G>A		161.0	0.0		146.0	44.0	NM_005720	Q9BU00	Silent	SNP	ENST00000451682.1	hg19	CCDS5661.1																																																																																			.	.		0.652	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
AGFG2	3268	hgsc.bcm.edu	37	7	100148104	100148104	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:100148104T>C	ENST00000300176.4	+	3	523	c.401T>C	c.(400-402)tTt>tCt	p.F134S	AGFG2_ENST00000474713.1_3'UTR|AGFG2_ENST00000262935.4_Missense_Mutation_p.F134S	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	134	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTGAAGGAGTTTCTCCAGGAA	0.423																																					p.F134S		Atlas-SNP	.											.	AGFG2	44	.	0			c.T401C						.						105.0	106.0	105.0					7																	100148104		2203	4300	6503	SO:0001583	missense	3268	exon3			AGGAGTTTCTCCA	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.401T>C	chr7.hg19:g.100148104T>C	ENSP00000300176:p.Phe134Ser	57.0	0.0		70.0	19.0	NM_006076	O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	ENST00000300176.4	hg19	CCDS5697.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.038637	0.93630	.	.	ENSG00000106351	ENST00000300176;ENST00000262935	T;T	0.49432	0.78;0.78	6.14	6.14	0.99180	.	0.000000	0.85682	D	0.000000	T	0.74481	0.3722	M	0.89904	3.07	0.47214	D	0.99935	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.80070	-0.1536	10	0.87932	D	0	-20.6581	14.758	0.69583	0.0:0.0:0.0:1.0	.	134;134	O95081-2;O95081	.;AGFG2_HUMAN	S	134	ENSP00000300176:F134S;ENSP00000262935:F134S	ENSP00000262935:F134S	F	+	2	0	AGFG2	99986040	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.338000	0.79269	2.367000	0.80283	0.529000	0.55759	TTT	.	.		0.423	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342769.1	NM_006076	
CALU	813	hgsc.bcm.edu	37	7	128394594	128394594	+	Intron	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:128394594A>G	ENST00000249364.4	+	3	517				CALU_ENST00000479257.1_Intron|CALU_ENST00000535623.1_3'UTR|CALU_ENST00000449187.2_Missense_Mutation_p.D78G|CALU_ENST00000538546.1_Intron|CALU_ENST00000542996.2_Missense_Mutation_p.D86G|CALU_ENST00000535011.2_Intron	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)			kidney(2)|large_intestine(3)|lung(5)	10						ATGATTGTAGATAAAATAGAC	0.438																																					p.D86G		Atlas-SNP	.											.	CALU	42	.	0			c.A257G						.						86.0	75.0	78.0					7																	128394594		692	1591	2283	SO:0001627	intron_variant	813	exon4			TTGTAGATAAAAT	AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.415+85A>G	chr7.hg19:g.128394594A>G		133.0	0.0		190.0	56.0	NM_001199672	B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	ENST00000249364.4	hg19	CCDS5805.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.697472	0.48202	.	.	ENSG00000128595	ENST00000542996;ENST00000537667;ENST00000537014;ENST00000449187	T;T	0.72725	-0.68;-0.68	5.96	5.96	0.96718	.	.	.	.	.	T	0.62183	0.2407	L	0.48260	1.515	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.58999	-0.7536	9	0.40728	T	0.16	.	8.8469	0.35174	0.9175:0.0:0.0825:0.0	.	86	D6QS48	.	G	86;78;78;78	ENSP00000438248:D86G;ENSP00000408838:D78G	ENSP00000408838:D78G	D	+	2	0	CALU	128181830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.848000	0.55903	2.280000	0.76307	0.533000	0.62120	GAT	.	.		0.438	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350533.1	NM_001219	
TTI2	80185	hgsc.bcm.edu	37	8	33361357	33361357	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:33361357C>A	ENST00000431156.2	-	5	1642	c.1024G>T	c.(1024-1026)Gtc>Ttc	p.V342F	TTI2_ENST00000360742.5_Missense_Mutation_p.V342F|TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Missense_Mutation_p.V311F	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	342																	AGCCGCAGGACCTCATCACAA	0.572																																					p.V342F		Atlas-SNP	.											.	.	.	.	0			c.G1024T						.						79.0	66.0	71.0					8																	33361357		2203	4300	6503	SO:0001583	missense	80185	exon5			GCAGGACCTCATC	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1024G>T	chr8.hg19:g.33361357C>A	ENSP00000411169:p.Val342Phe	58.0	0.0		45.0	17.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654169	0.67472	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.80123	-1.34;-1.34;-1.34	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000004	D	0.87474	0.6186	M	0.72894	2.215	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.70016	0.959;0.967	D	0.88060	0.2793	10	0.72032	D	0.01	-21.1261	11.6635	0.51361	0.0:0.9186:0.0:0.0814	.	342;311	Q6NXR4;E5RIH5	TTI2_HUMAN;.	F	342;342;342;311	ENSP00000353971:V342F;ENSP00000411169:V342F;ENSP00000428401:V311F	ENSP00000353971:V342F	V	-	1	0	C8orf41	33480899	1.000000	0.71417	0.960000	0.40013	0.763000	0.43281	3.565000	0.53798	2.629000	0.89072	0.650000	0.86243	GTC	.	.		0.572	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
UNC5D	137970	hgsc.bcm.edu	37	8	35579903	35579903	+	Silent	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:35579903A>T	ENST00000404895.2	+	9	1621	c.1293A>T	c.(1291-1293)acA>acT	p.T431T	UNC5D_ENST00000420357.1_Silent_p.T364T|UNC5D_ENST00000449677.1_5'Flank|UNC5D_ENST00000416672.1_Silent_p.T436T|UNC5D_ENST00000453357.2_Silent_p.T426T|UNC5D_ENST00000287272.2_Intron	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	431					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ACTTCAAAACAGTCCGTCAAG	0.547																																					p.T431T		Atlas-SNP	.											.	UNC5D	393	.	0			c.A1293T						.						183.0	153.0	163.0					8																	35579903		2203	4300	6503	SO:0001819	synonymous_variant	137970	exon9			CAAAACAGTCCGT	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1293A>T	chr8.hg19:g.35579903A>T		68.0	0.0		41.0	7.0	NM_080872	Q8WYP7	Silent	SNP	ENST00000404895.2	hg19	CCDS6093.2																																																																																			.	.		0.547	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
INTS8	55656	hgsc.bcm.edu	37	8	95884163	95884163	+	Silent	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:95884163T>G	ENST00000523731.1	+	21	2599	c.2466T>G	c.(2464-2466)gtT>gtG	p.V822V	INTS8_ENST00000447247.1_Silent_p.V822V	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	822					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					AAGAGCTAGTTCGATATACAC	0.348																																					p.V822V		Atlas-SNP	.											.	INTS8	92	.	0			c.T2466G						.						117.0	110.0	112.0					8																	95884163		2203	4300	6503	SO:0001819	synonymous_variant	55656	exon21			GCTAGTTCGATAT	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2466T>G	chr8.hg19:g.95884163T>G		42.0	0.0		75.0	25.0	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Silent	SNP	ENST00000523731.1	hg19	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	T	9.708	1.156277	0.21454	.	.	ENSG00000164941	ENST00000520526	.	.	.	5.57	1.82	0.25136	.	.	.	.	.	T	0.51210	0.1661	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35251	-0.9796	4	.	.	.	-14.866	4.7485	0.13049	0.0:0.3583:0.1647:0.4771	.	.	.	.	C	644	.	.	F	+	2	0	INTS8	95953339	0.996000	0.38824	0.965000	0.40720	0.969000	0.65631	0.305000	0.19254	0.134000	0.18681	0.482000	0.46254	TTC	.	.		0.348	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
ZNF706	51123	hgsc.bcm.edu	37	8	102213861	102213861	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:102213861A>C	ENST00000520347.1	-	2	3065	c.109T>G	c.(109-111)Tta>Gta	p.L37V	ZNF706_ENST00000521272.1_Missense_Mutation_p.L37V|ZNF706_ENST00000519744.1_Missense_Mutation_p.L37V|ZNF706_ENST00000519882.1_Missense_Mutation_p.L37V|ZNF706_ENST00000518336.1_Missense_Mutation_p.L37V|ZNF706_ENST00000517844.1_Missense_Mutation_p.L37V|ZNF706_ENST00000520984.1_Missense_Mutation_p.L37V|ZNF706_ENST00000311212.4_Missense_Mutation_p.L37V			Q9Y5V0	ZN706_HUMAN	zinc finger protein 706	37							metal ion binding (GO:0046872)			large_intestine(1)|ovary(2)	3	all_cancers(14;3.3e-07)|all_epithelial(15;3.47e-09)|Lung NSC(17;3.44e-05)|all_lung(17;0.000117)		Epithelial(11;8.57e-11)|all cancers(13;1.43e-08)|OV - Ovarian serous cystadenocarcinoma(57;1.43e-05)			GTATATATTAAGGCAGCTTTG	0.413																																					p.L37V		Atlas-SNP	.											.	ZNF706	12	.	0			c.T109G						.						138.0	130.0	133.0					8																	102213861		2203	4300	6503	SO:0001583	missense	51123	exon3			ATATTAAGGCAGC	AF125099	CCDS6291.1	8q22.3	2005-09-22				ENSG00000120963			24992	protein-coding gene	gene with protein product						11042152	Standard	NM_001042510		Approved	HSPC038	uc031tbv.1	Q9Y5V0		ENST00000520347.1:c.109T>G	chr8.hg19:g.102213861A>C	ENSP00000430823:p.Leu37Val	59.0	0.0		60.0	10.0	NM_001042510	A8K362	Missense_Mutation	SNP	ENST00000520347.1	hg19	CCDS6291.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770884	0.49680	.	.	ENSG00000120963	ENST00000520984;ENST00000311212;ENST00000519744;ENST00000517844;ENST00000519103;ENST00000520347;ENST00000519882;ENST00000521272;ENST00000518336;ENST00000523922	.	.	.	5.14	3.99	0.46301	.	0.000000	0.85682	D	0.000000	T	0.69342	0.3100	.	.	.	0.58432	D	0.999995	P	0.51057	0.941	P	0.60415	0.874	T	0.70185	-0.4941	8	0.87932	D	0	.	8.0412	0.30523	0.8442:0.0:0.1558:0.0	.	37	Q9Y5V0	ZN706_HUMAN	V	37;37;37;37;9;37;37;37;37;37	.	ENSP00000311768:L37V	L	-	1	2	ZNF706	102283037	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.415000	0.44635	0.820000	0.34516	0.533000	0.62120	TTA	.	.		0.413	ZNF706-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380477.1	NM_016096	
ATP6V1C1	528	hgsc.bcm.edu	37	8	104065039	104065039	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:104065039A>G	ENST00000395862.3	+	6	621	c.462A>G	c.(460-462)gaA>gaG	p.E154E	ATP6V1C1_ENST00000518738.1_Silent_p.E154E|ATP6V1C1_ENST00000518857.1_Silent_p.E79E|ATP6V1C1_ENST00000521514.1_Silent_p.E79E	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	154					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			AGAATTTGGAACGAAAGAATG	0.368																																					p.E154E		Atlas-SNP	.											.	ATP6V1C1	33	.	0			c.A462G						.						85.0	88.0	87.0					8																	104065039		2203	4299	6502	SO:0001819	synonymous_variant	528	exon6			TTTGGAACGAAAG	X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.462A>G	chr8.hg19:g.104065039A>G		39.0	0.0		65.0	17.0	NM_001695		Silent	SNP	ENST00000395862.3	hg19	CCDS6296.1																																																																																			.	.		0.368	ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380101.1	NM_001695	
KLHL38	340359	hgsc.bcm.edu	37	8	124664885	124664885	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:124664885C>T	ENST00000325995.7	-	1	305	c.282G>A	c.(280-282)acG>acA	p.T94T	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	94	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						GTGCCTCCCCCGTATACACGT	0.567																																					p.T94T		Atlas-SNP	.											.	KLHL38	81	.	0			c.G282A						.						67.0	75.0	72.0					8																	124664885		2051	4184	6235	SO:0001819	synonymous_variant	340359	exon1			CTCCCCCGTATAC		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.282G>A	chr8.hg19:g.124664885C>T		82.0	0.0		108.0	29.0	NM_001081675	A0PK12	Silent	SNP	ENST00000325995.7	hg19	CCDS43766.1																																																																																			.	.		0.567	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1		
HHLA1	10086	hgsc.bcm.edu	37	8	133099901	133099901	+	Splice_Site	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:133099901C>G	ENST00000414222.1	-	9	674	c.675G>C	c.(673-675)ctG>ctC	p.L225L	OC90_ENST00000262283.5_5'Flank|HHLA1_ENST00000434736.2_Splice_Site_p.L261L	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	225						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						GGTACTCACCCAGAACACCAG	0.473																																					p.L225L		Atlas-SNP	.											.	HHLA1	35	.	0			c.G675C						.						130.0	143.0	139.0					8																	133099901		692	1591	2283	SO:0001630	splice_region_variant	10086	exon9			CTCACCCAGAACA	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.676+1G>C	chr8.hg19:g.133099901C>G		73.0	0.0		146.0	33.0	NM_001145095		Silent	SNP	ENST00000414222.1	hg19																																																																																				.	.		0.473	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XR_017860	Silent
ZNF7	7553	hgsc.bcm.edu	37	8	146068016	146068016	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:146068016G>C	ENST00000528372.1	+	5	1764	c.1524G>C	c.(1522-1524)caG>caC	p.Q508H	ZNF7_ENST00000325241.6_Missense_Mutation_p.Q508H|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Missense_Mutation_p.Q412H|ZNF7_ENST00000446747.2_Missense_Mutation_p.Q519H			P17097	ZNF7_HUMAN	zinc finger protein 7	508					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		CCTTCAGTCAGAGTTCCAGCC	0.463																																					p.Q508H		Atlas-SNP	.											.	ZNF7	62	.	0			c.G1524C						.						71.0	72.0	72.0					8																	146068016		2203	4300	6503	SO:0001583	missense	7553	exon5			CAGTCAGAGTTCC	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1524G>C	chr8.hg19:g.146068016G>C	ENSP00000432724:p.Gln508His	49.0	0.0		127.0	63.0	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Missense_Mutation	SNP	ENST00000528372.1	hg19	CCDS6435.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270072	0.40194	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	4.93	3.09	0.35607	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000437	T	0.14700	0.0355	N	0.04805	-0.155	0.22127	N	0.999345	P;P	0.46784	0.884;0.884	B;B	0.39531	0.302;0.302	T	0.06954	-1.0798	9	.	.	.	-23.7472	6.5309	0.22326	0.1611:0.1542:0.6847:0.0	.	519;508	B4DT08;P17097	.;ZNF7_HUMAN	H	508;519;412;508	ENSP00000320627:Q508H;ENSP00000393260:Q519H;ENSP00000439424:Q412H;ENSP00000432724:Q508H	.	Q	+	3	2	ZNF7	146038820	0.000000	0.05858	0.998000	0.56505	0.880000	0.50808	-6.504000	0.00063	1.294000	0.44707	0.655000	0.94253	CAG	.	.		0.463	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
JAK2	3717	hgsc.bcm.edu	37	9	5081813	5081813	+	Silent	SNP	T	T	G	rs112584696		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr9:5081813T>G	ENST00000381652.3	+	19	3017	c.2523T>G	c.(2521-2523)ccT>ccG	p.P841P	JAK2_ENST00000539801.1_Silent_p.P841P|JAK2_ENST00000544510.1_Silent_p.P692P|AL161450.1_ENST00000601793.1_Intron	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	841					actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ACCGGGATCCTACACAGTTTG	0.348		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.P841P		Atlas-SNP	.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	35466	.	0			c.T2523G						.						110.0	109.0	110.0					9																	5081813		2203	4300	6503	SO:0001819	synonymous_variant	3717	exon19	Familial Cancer Database		GGATCCTACACAG		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.2523T>G	chr9.hg19:g.5081813T>G		76.0	0.0		132.0	7.0	NM_004972	O14636|O75297	Silent	SNP	ENST00000381652.3	hg19	CCDS6457.1																																																																																			.	T|0.500;C|0.500		0.348	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
SPATA31C2	645961	hgsc.bcm.edu	37	9	90746809	90746809	+	IGR	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr9:90746809C>T								U6 (133559 upstream) : U3 (242374 downstream)																							TATTCTGCGACGCAGGGCAAG	0.512																																					p.A381A		Atlas-SNP	.											.	.	.	.	0			c.G1143A						.						8.0	8.0	8.0					9																	90746809		683	1579	2262	SO:0001628	intergenic_variant	645961	exon4			CTGCGACGCAGGG																													chr9.hg19:g.90746809C>T		67.0	0.0		75.0	20.0	NM_001166137		Silent	SNP		hg19																																																																																				.	.	0	0.512								
FIBCD1	84929	hgsc.bcm.edu	37	9	133799206	133799206	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr9:133799206G>A	ENST00000372338.4	-	4	1016	c.774C>T	c.(772-774)taC>taT	p.Y258Y	FIBCD1_ENST00000448616.1_Silent_p.Y258Y|FIBCD1_ENST00000372337.2_Silent_p.Y100Y|FIBCD1_ENST00000253018.4_Silent_p.Y100Y	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	258	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		GAAAGACAGAGTAGACGCCAT	0.687																																					p.Y258Y		Atlas-SNP	.											.	FIBCD1	34	.	0			c.C774T						.						90.0	77.0	81.0					9																	133799206		2203	4300	6503	SO:0001819	synonymous_variant	84929	exon5			GACAGAGTAGACG	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.774C>T	chr9.hg19:g.133799206G>A		116.0	0.0		127.0	47.0	NM_001145106	A3KFK0|Q6UXK6|Q96SJ7	Silent	SNP	ENST00000372338.4	hg19	CCDS6937.1	.	.	.	.	.	.	.	.	.	.	G	1.723	-0.496026	0.04291	.	.	ENSG00000130720	ENST00000444139	.	.	.	5.54	3.36	0.38483	.	.	.	.	.	T	0.59729	0.2215	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57112	-0.7867	4	.	.	.	.	9.9519	0.41645	0.2416:0.0:0.7584:0.0	.	.	.	.	I	212	.	.	T	-	2	0	FIBCD1	132789027	1.000000	0.71417	0.982000	0.44146	0.051000	0.14879	3.382000	0.52463	1.334000	0.45468	0.462000	0.41574	ACT	.	.		0.687	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843	
COMMD3	23412	hgsc.bcm.edu	37	10	22605353	22605353	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr10:22605353C>T	ENST00000376836.3	+	1	451	c.7C>T	c.(7-9)Ctc>Ttc	p.L3F	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.L3F	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	3										kidney(2)|lung(2)|ovary(1)	5						CACAATGGAGCTCTCGGAGTC	0.677																																					p.L3F		Atlas-SNP	.											.	.	.	.	0			c.C7T						.						56.0	36.0	43.0					10																	22605353		2099	4129	6228	SO:0001583	missense	0	exon1			ATGGAGCTCTCGG	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.7C>T	chr10.hg19:g.22605353C>T	ENSP00000366032:p.Leu3Phe	94.0	0.0		76.0	28.0	NM_001204062	D3DRU7|Q5T8Y9	Missense_Mutation	SNP	ENST00000376836.3	hg19	CCDS7137.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.99|17.99	3.522332|3.522332	0.64747|0.64747	.|.	.|.	ENSG00000148444|ENSG00000148444	ENST00000456711;ENST00000444869|ENST00000376836;ENST00000376776;ENST00000376787	.|T	.|0.64438	.|-0.1	4.78|4.78	2.92|2.92	0.33932|0.33932	.|.	.|0.083658	.|0.47852	.|N	.|0.000214	T|T	0.74688|0.74688	0.3749|0.3749	M|M	0.72118|0.72118	2.19|2.19	0.47245|0.47245	D|D	0.999361|0.999361	.|B;D	.|0.71674	.|0.037;0.998	.|B;D	.|0.78314	.|0.042;0.991	T|T	0.75323|0.75323	-0.3358|-0.3358	5|10	.|0.72032	.|D	.|0.01	-21.1052|-21.1052	10.1234|10.1234	0.42634|0.42634	0.0:0.8331:0.0:0.1669|0.0:0.8331:0.0:0.1669	.|.	.|3;3	.|Q9UBI1;E9PC68	.|COMD3_HUMAN;.	V|F	3;2|3	.|ENSP00000366032:L3F	.|ENSP00000365968:L3F	A|L	+|+	2|1	0|0	COMMD3|COMMD3	22645359|22645359	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	3.513000|3.513000	0.53414|0.53414	0.737000|0.737000	0.32582|0.32582	-0.140000|-0.140000	0.14226|0.14226	GCT|CTC	.	.		0.677	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
AGAP6	414189	hgsc.bcm.edu	37	10	51768608	51768608	+	Silent	SNP	G	G	C	rs373725135	byFrequency	TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr10:51768608G>C	ENST00000374056.4	+	7	1052	c.654G>C	c.(652-654)acG>acC	p.T218T	AGAP6_ENST00000412531.3_Silent_p.T241T			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	218					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.T241T(2)		NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						ACACACCCACGCCCGTTTGCA	0.542													.|||	15	0.00299521	0.0061	0.0	5008	,	,		18332	0.002		0.001	False		,,,				2504	0.0041				p.T241T		Atlas-SNP	.											AGAP6,NS,carcinoma,0,2	AGAP6	53	.	2	Substitution - coding silent(2)	endometrium(2)	c.G723C						.																																			SO:0001819	synonymous_variant	414189	exon8			ACCCACGCCCGTT		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.654G>C	chr10.hg19:g.51768608G>C		48.0	1.0		45.0	3.0	NM_001077665		Silent	SNP	ENST00000374056.4	hg19																																																																																				.	G|0.500;C|0.500		0.542	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665	
PHYHIPL	84457	hgsc.bcm.edu	37	10	60996312	60996312	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr10:60996312A>G	ENST00000373880.4	+	3	637	c.373A>G	c.(373-375)Agc>Ggc	p.S125G	PHYHIPL_ENST00000373878.3_Missense_Mutation_p.S99G|PHYHIPL_ENST00000472199.1_3'UTR	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	125	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						CTGGTTTTTAAGCCCAAGAAC	0.418																																					p.S125G		Atlas-SNP	.											.	PHYHIPL	44	.	0			c.A373G						.						115.0	105.0	109.0					10																	60996312		2203	4300	6503	SO:0001583	missense	84457	exon3			TTTTTAAGCCCAA	AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.373A>G	chr10.hg19:g.60996312A>G	ENSP00000362987:p.Ser125Gly	61.0	0.0		84.0	30.0	NM_032439	B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Missense_Mutation	SNP	ENST00000373880.4	hg19	CCDS7254.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.964011	0.92791	.	.	ENSG00000165443	ENST00000373880;ENST00000373878	T;T	0.57752	0.38;0.38	5.97	5.97	0.96955	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63686	0.2532	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.72625	0.947;0.978	T	0.66484	-0.5912	10	0.72032	D	0.01	-8.5982	16.4461	0.83932	1.0:0.0:0.0:0.0	.	99;125	Q96FC7-2;Q96FC7	.;PHIPL_HUMAN	G	125;99	ENSP00000362987:S125G;ENSP00000362985:S99G	ENSP00000362985:S99G	S	+	1	0	PHYHIPL	60666318	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.310000	0.96267	2.285000	0.76669	0.528000	0.53228	AGC	.	.		0.418	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048156.1	NM_032439	
LGI1	9211	hgsc.bcm.edu	37	10	95557391	95557391	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr10:95557391A>G	ENST00000371418.4	+	8	1765	c.1505A>G	c.(1504-1506)tAt>tGt	p.Y502C	LGI1_ENST00000542308.1_Missense_Mutation_p.Y454C|LGI1_ENST00000371413.3_Intron	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	502					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				ACTCAAGTGTATAACTGGGAT	0.378																																					p.Y502C		Atlas-SNP	.											.	LGI1	69	.	0			c.A1505G						.						71.0	72.0	72.0					10																	95557391		2203	4300	6503	SO:0001583	missense	9211	exon8			AAGTGTATAACTG	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.1505A>G	chr10.hg19:g.95557391A>G	ENSP00000360472:p.Tyr502Cys	1022.0	0.0		1673.0	310.0	NM_005097	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	hg19	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.704147	0.48412	.	.	ENSG00000108231	ENST00000542308;ENST00000371418	D;D	0.86627	-2.15;-2.15	5.65	4.51	0.55191	.	0.000000	0.85682	D	0.000000	D	0.92453	0.7604	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.91635	0.999;0.969	D	0.92757	0.6221	10	0.87932	D	0	-12.0876	12.3183	0.54971	0.8733:0.0:0.0:0.1266	.	454;502	O95970-3;O95970	.;LGI1_HUMAN	C	454;502	ENSP00000440763:Y454C;ENSP00000360472:Y502C	ENSP00000360472:Y502C	Y	+	2	0	LGI1	95547381	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.964000	0.76061	1.141000	0.42275	-0.301000	0.09380	TAT	.	.		0.378	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	
BLOC1S2	282991	hgsc.bcm.edu	37	10	102040753	102040753	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr10:102040753T>C	ENST00000370372.2	-	3	282	c.230A>G	c.(229-231)tAt>tGt	p.Y77C	BLOC1S2_ENST00000441611.1_Missense_Mutation_p.Y34C|BLOC1S2_ENST00000361832.2_5'UTR	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	77					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)			large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		CATTTCAAGATACTTCAAGCT	0.284																																					p.Y77C		Atlas-SNP	.											.	BLOC1S2	10	.	0			c.A230G						.						75.0	78.0	77.0					10																	102040753		2202	4299	6501	SO:0001583	missense	282991	exon3			TCAAGATACTTCA	AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.230A>G	chr10.hg19:g.102040753T>C	ENSP00000359398:p.Tyr77Cys	46.0	0.0		89.0	5.0	NM_173809	B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	ENST00000370372.2	hg19	CCDS7490.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.276180	0.80580	.	.	ENSG00000196072	ENST00000361832;ENST00000358848;ENST00000441611;ENST00000370372	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.78253	0.4254	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.81315	-0.0988	9	0.87932	D	0	-4.2434	14.3247	0.66512	0.0:0.0:0.0:1.0	.	77	Q6QNY1	BL1S2_HUMAN	C	9;77;34;9	.	ENSP00000351716:Y77C	Y	-	2	0	BLOC1S2	102030743	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.435000	0.80391	1.979000	0.57680	0.533000	0.62120	TAT	.	.		0.284	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049861.2	NM_173809	
WDR11	55717	hgsc.bcm.edu	37	10	122626230	122626230	+	Missense_Mutation	SNP	A	A	G	rs543120664		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr10:122626230A>G	ENST00000263461.6	+	8	1390	c.1144A>G	c.(1144-1146)Ata>Gta	p.I382V		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	493					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						CAGGGTCATGATATGGGAACT	0.443													A|||	1	0.000199681	0.0	0.0	5008	,	,		15774	0.0		0.0	False		,,,				2504	0.001				p.I382V		Atlas-SNP	.											.	WDR11	95	.	0			c.A1144G						.						168.0	160.0	162.0					10																	122626230		2203	4300	6503	SO:0001583	missense	55717	exon8			GTCATGATATGGG	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.1144A>G	chr10.hg19:g.122626230A>G	ENSP00000263461:p.Ile382Val	92.0	0.0		128.0	37.0	NM_018117	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	hg19	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	A	9.560	1.118139	0.20877	.	.	ENSG00000120008	ENST00000263461	T	0.27557	1.66	5.45	4.27	0.50696	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);	0.096661	0.64402	N	0.000001	T	0.26484	0.0647	L	0.47716	1.5	0.45662	D	0.99858	B	0.02656	0.0	B	0.04013	0.001	T	0.03706	-1.1011	10	0.37606	T	0.19	-15.4014	10.3059	0.43680	0.9158:0.0:0.0842:0.0	.	382	Q9BZH6	WDR11_HUMAN	V	382	ENSP00000263461:I382V	ENSP00000263461:I382V	I	+	1	0	WDR11	122616220	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.016000	0.49607	0.839000	0.34971	0.533000	0.62120	ATA	.	.		0.443	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
IPO7	10527	hgsc.bcm.edu	37	11	9435885	9435885	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:9435885T>G	ENST00000379719.3	+	5	705	c.563T>G	c.(562-564)cTt>cGt	p.L188R		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	188					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TTTATCCAGCTTCTTTCTGAC	0.408																																					p.L188R		Atlas-SNP	.											.	IPO7	72	.	0			c.T563G						.						122.0	114.0	117.0					11																	9435885		2201	4296	6497	SO:0001583	missense	10527	exon5			TCCAGCTTCTTTC	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.563T>G	chr11.hg19:g.9435885T>G	ENSP00000369042:p.Leu188Arg	49.0	0.0		78.0	24.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	hg19	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.545203	0.86022	.	.	ENSG00000205339	ENST00000379719;ENST00000527431	T;T	0.70282	-0.47;-0.47	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86826	0.6026	M	0.90145	3.09	0.80722	D	1	D	0.60160	0.987	D	0.76071	0.987	D	0.89664	0.3879	10	0.87932	D	0	.	15.6119	0.76727	0.0:0.0:0.0:1.0	.	188	O95373	IPO7_HUMAN	R	188;126	ENSP00000369042:L188R;ENSP00000435235:L126R	ENSP00000369042:L188R	L	+	2	0	IPO7	9392461	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.083000	0.62718	0.528000	0.53228	CTT	.	.		0.408	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
EIF4G2	1982	hgsc.bcm.edu	37	11	10823243	10823243	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:10823243G>T	ENST00000526148.1	-	14	1888	c.1378C>A	c.(1378-1380)Cgg>Agg	p.R460R	EIF4G2_ENST00000396525.2_Intron|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525681.1_Silent_p.R460R|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000339995.5_Silent_p.R460R	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TTAGAAAACCGAGGTGGCATA	0.423																																					p.R460R		Atlas-SNP	.											EIF4G2,NS,carcinoma,0,1	EIF4G2	89	.	0			c.C1378A						.						144.0	138.0	140.0					11																	10823243		2201	4294	6495	SO:0001819	synonymous_variant	1982	exon14			AAAACCGAGGTGG	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.1378C>A	chr11.hg19:g.10823243G>T		66.0	0.0		79.0	15.0	NM_001172705		Silent	SNP	ENST00000526148.1	hg19	CCDS31428.1																																																																																			.	.		0.423	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
EIF4G2	1982	hgsc.bcm.edu	37	11	10826502	10826502	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:10826502C>T	ENST00000526148.1	-	5	819	c.309G>A	c.(307-309)gtG>gtA	p.V103V	EIF4G2_ENST00000396525.2_Silent_p.V103V|EIF4G2_ENST00000525995.1_5'Flank|EIF4G2_ENST00000525681.1_Silent_p.V103V|EIF4G2_ENST00000339995.5_Silent_p.V103V	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		ACTCTACACCCACATTGAGGA	0.368																																					p.V103V		Atlas-SNP	.											.	EIF4G2	89	.	0			c.G309A						.						118.0	112.0	114.0					11																	10826502		2201	4294	6495	SO:0001819	synonymous_variant	1982	exon5			TACACCCACATTG	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.309G>A	chr11.hg19:g.10826502C>T		78.0	0.0		125.0	15.0	NM_001172705		Silent	SNP	ENST00000526148.1	hg19	CCDS31428.1																																																																																			.	.		0.368	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
HPS5	11234	hgsc.bcm.edu	37	11	18333536	18333536	+	Silent	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:18333536A>T	ENST00000349215.3	-	3	421	c.144T>A	c.(142-144)gcT>gcA	p.A48A	HPS5_ENST00000531848.1_5'UTR|HPS5_ENST00000438420.2_5'UTR|HPS5_ENST00000396253.3_5'UTR	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	48					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AACTGCCCAAAGCCAACCATT	0.448									Hermansky-Pudlak syndrome																												p.A48A		Atlas-SNP	.											.	HPS5	70	.	0			c.T144A						.						115.0	121.0	119.0					11																	18333536		2199	4293	6492	SO:0001819	synonymous_variant	11234	exon3	Familial Cancer Database	HPS, HPS1-8	GCCCAAAGCCAAC	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.144T>A	chr11.hg19:g.18333536A>T		58.0	0.0		80.0	22.0	NM_181507	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Silent	SNP	ENST00000349215.3	hg19	CCDS7836.1																																																																																			.	.		0.448	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	
PRR5L	79899	hgsc.bcm.edu	37	11	36472812	36472812	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:36472812G>A	ENST00000378867.3	+	9	994	c.639G>A	c.(637-639)ctG>ctA	p.L213L	PRR5L_ENST00000311599.5_Silent_p.L140L|PRR5L_ENST00000530639.1_Silent_p.L213L|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000527487.1_Intron	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	213					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TGGAGGAGCTGGTGAAGCAAG	0.527																																					p.L213L		Atlas-SNP	.											.	PRR5L	35	.	0			c.G639A						.						188.0	158.0	168.0					11																	36472812		2202	4298	6500	SO:0001819	synonymous_variant	79899	exon9			GGAGCTGGTGAAG		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.639G>A	chr11.hg19:g.36472812G>A		78.0	0.0		116.0	29.0	NM_024841	A4QN22|E9PKY1|Q96H46|Q9H7V4	Silent	SNP	ENST00000378867.3	hg19	CCDS31463.1																																																																																			.	.		0.527	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389209.1	NM_024841	
SYT13	57586	hgsc.bcm.edu	37	11	45307590	45307590	+	Missense_Mutation	SNP	C	C	A	rs139035860	byFrequency	TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:45307590C>A	ENST00000020926.3	-	1	280	c.169G>T	c.(169-171)Ggg>Tgg	p.G57W		NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	57					vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)				breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						TGTGCAGACCCGAGCAAGCTG	0.721																																					p.G57W		Atlas-SNP	.											.	SYT13	45	.	0			c.G169T						.						17.0	21.0	19.0					11																	45307590		2202	4295	6497	SO:0001583	missense	57586	exon1			CAGACCCGAGCAA	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.169G>T	chr11.hg19:g.45307590C>A	ENSP00000020926:p.Gly57Trp	66.0	0.0		66.0	19.0	NM_020826	A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	hg19	CCDS31470.1	.	.	.	.	.	.	.	.	.	.	C	7.314	0.615616	0.14129	.	.	ENSG00000019505	ENST00000020926	T	0.05717	3.4	3.82	-3.05	0.05396	.	0.680336	0.12091	N	0.500434	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	P	0.39759	0.687	B	0.34590	0.186	T	0.39078	-0.9631	10	0.87932	D	0	.	7.3907	0.26909	0.0:0.26:0.327:0.4131	.	57	Q7L8C5	SYT13_HUMAN	W	57	ENSP00000020926:G57W	ENSP00000020926:G57W	G	-	1	0	SYT13	45264166	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.163000	0.16520	-0.969000	0.03573	-0.458000	0.05436	GGG	.	C|0.999;G|0.001		0.721	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826	
OR4D9	390199	hgsc.bcm.edu	37	11	59282778	59282778	+	Silent	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:59282778C>T	ENST00000329328.3	+	1	393	c.393C>T	c.(391-393)caC>caT	p.H131H		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						AGCCCCTGCACTATATGACCA	0.527																																					p.H131H		Atlas-SNP	.											.	OR4D9	47	.	0			c.C393T						.						79.0	77.0	78.0					11																	59282778		2201	4295	6496	SO:0001819	synonymous_variant	390199	exon1			CCTGCACTATATG	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.393C>T	chr11.hg19:g.59282778C>T		46.0	0.0		59.0	16.0	NM_001004711	Q6IFF3	Silent	SNP	ENST00000329328.3	hg19	CCDS31564.1																																																																																			.	.		0.527	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	NM_001004711	
CHRM1	1128	hgsc.bcm.edu	37	11	62678251	62678251	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:62678251C>T	ENST00000306960.3	-	2	863	c.322G>A	c.(322-324)Gcc>Acc	p.A108T	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	108					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	GCATTGCTGGCCACATAGTCC	0.612																																					p.A108T		Atlas-SNP	.											.	CHRM1	29	.	0			c.G322A						.						69.0	60.0	63.0					11																	62678251		2201	4298	6499	SO:0001583	missense	1128	exon2			TGCTGGCCACATA	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.322G>A	chr11.hg19:g.62678251C>T	ENSP00000306490:p.Ala108Thr	82.0	0.0		135.0	43.0	NM_000738	Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	hg19	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176643	0.78564	.	.	ENSG00000168539	ENST00000306960;ENST00000543973;ENST00000536524	T;T;T	0.19806	2.12;2.12;2.12	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.093208	0.42053	D	0.000770	T	0.22513	0.0543	N	0.25426	0.745	0.53688	D	0.999972	P	0.41978	0.767	P	0.48334	0.574	T	0.01814	-1.1268	10	0.32370	T	0.25	-18.9112	14.8803	0.70528	0.0:1.0:0.0:0.0	.	108	P11229	ACM1_HUMAN	T	108	ENSP00000306490:A108T;ENSP00000441188:A108T;ENSP00000444482:A108T	ENSP00000306490:A108T	A	-	1	0	CHRM1	62434827	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.632000	0.83247	2.376000	0.81061	0.563000	0.77884	GCC	.	.		0.612	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
CCS	9973	hgsc.bcm.edu	37	11	66367052	66367052	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:66367052G>T	ENST00000533244.1	+	4	814	c.373G>T	c.(373-375)Ggg>Tgg	p.G125W	CCS_ENST00000310190.4_Missense_Mutation_p.G106W	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	125	Superoxide dismutase-like.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						CCTGGAGCCTGGGCTGCATGG	0.592																																					p.G125W		Atlas-SNP	.											.	CCS	22	.	0			c.G373T						.						39.0	38.0	38.0					11																	66367052		2200	4295	6495	SO:0001583	missense	9973	exon4			GAGCCTGGGCTGC	AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.373G>T	chr11.hg19:g.66367052G>T	ENSP00000436318:p.Gly125Trp	207.0	0.0		196.0	54.0	NM_005125	Q2M366|Q8NEV0	Missense_Mutation	SNP	ENST00000533244.1	hg19	CCDS8146.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667217	0.88251	.	.	ENSG00000173992	ENST00000533244;ENST00000310190	D;D	0.99818	-6.92;-6.92	5.23	5.23	0.72850	Superoxide dismutase, copper/zinc binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99902	0.9953	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96407	0.9301	10	0.87932	D	0	.	14.1637	0.65464	0.0:0.0:1.0:0.0	.	125	O14618	CCS_HUMAN	W	125;106	ENSP00000436318:G125W;ENSP00000307870:G106W	ENSP00000307870:G106W	G	+	1	0	CCS	66123628	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.008000	0.93601	2.732000	0.93576	0.655000	0.94253	GGG	.	.		0.592	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393826.1	NM_005125	
MTNR1B	4544	hgsc.bcm.edu	37	11	92714649	92714649	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:92714649T>A	ENST00000257068.2	+	2	266	c.260T>A	c.(259-261)cTg>cAg	p.L87Q		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	87					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TTGGCTGACCTGGTGGTGGCC	0.557																																					p.L87Q		Atlas-SNP	.											.	MTNR1B	75	.	0			c.T260A						.						280.0	272.0	275.0					11																	92714649		2201	4298	6499	SO:0001583	missense	4544	exon2			CTGACCTGGTGGT	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.260T>A	chr11.hg19:g.92714649T>A	ENSP00000257068:p.Leu87Gln	36.0	0.0		64.0	22.0	NM_005959		Missense_Mutation	SNP	ENST00000257068.2	hg19	CCDS8290.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175472	0.78564	.	.	ENSG00000134640	ENST00000257068	T	0.54071	0.59	3.97	3.97	0.46021	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	D	0.82614	0.5075	H	0.99042	4.41	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89232	0.3578	10	0.87932	D	0	-15.8101	13.3318	0.60492	0.0:0.0:0.0:1.0	.	87	P49286	MTR1B_HUMAN	Q	87	ENSP00000257068:L87Q	ENSP00000257068:L87Q	L	+	2	0	MTNR1B	92354297	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.082000	0.76851	1.803000	0.52742	0.402000	0.26972	CTG	.	.		0.557	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1		
CCDC67	159989	hgsc.bcm.edu	37	11	93104432	93104432	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:93104432C>T	ENST00000298050.3	+	7	875	c.775C>T	c.(775-777)Caa>Taa	p.Q259*		NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	259					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				GAAAATGTACCAAAGACAGTG	0.308																																					p.Q259X		Atlas-SNP	.											.	CCDC67	57	.	0			c.C775T						.						49.0	47.0	47.0					11																	93104432		1818	4077	5895	SO:0001587	stop_gained	159989	exon7			ATGTACCAAAGAC	AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.775C>T	chr11.hg19:g.93104432C>T	ENSP00000298050:p.Gln259*	229.0	0.0		366.0	113.0	NM_181645	Q8NEF1|Q96LL7	Nonsense_Mutation	SNP	ENST00000298050.3	hg19	CCDS44707.1	.	.	.	.	.	.	.	.	.	.	C	38	6.860173	0.97893	.	.	ENSG00000165325	ENST00000534747;ENST00000298050;ENST00000532819	.	.	.	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	18.6238	0.91330	0.0:1.0:0.0:0.0	.	.	.	.	X	259	.	ENSP00000298050:Q259X	Q	+	1	0	CCDC67	92744080	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.953000	0.63624	2.650000	0.89964	0.655000	0.94253	CAA	.	.		0.308	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181645	
MAML2	84441	hgsc.bcm.edu	37	11	95724767	95724767	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:95724767T>C	ENST00000524717.1	-	3	3544	c.2260A>G	c.(2260-2262)Atg>Gtg	p.M754V		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	754					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TTCTTTCCCATCAATTGCTGA	0.483			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.M754V		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94	.	0			c.A2260G						.						155.0	149.0	151.0					11																	95724767		1933	4150	6083	SO:0001583	missense	84441	exon3			TTCCCATCAATTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.2260A>G	chr11.hg19:g.95724767T>C	ENSP00000434552:p.Met754Val	63.0	0.0		97.0	6.0	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	hg19	CCDS44714.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419798	0.62622	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.42131	0.98;0.98	5.46	4.34	0.51931	.	0.339054	0.27327	N	0.019863	T	0.35770	0.0943	L	0.50333	1.59	0.38625	D	0.951245	B	0.11235	0.004	B	0.11329	0.006	T	0.17531	-1.0366	10	0.25106	T	0.35	-6.9862	10.8531	0.46782	0.0:0.0733:0.0:0.9267	.	754	Q8IZL2	MAML2_HUMAN	V	754	ENSP00000434552:M754V;ENSP00000412394:M754V	ENSP00000412394:M754V	M	-	1	0	MAML2	95364415	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.114000	0.41911	0.938000	0.37419	0.455000	0.32223	ATG	.	.		0.483	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
C11orf70	85016	hgsc.bcm.edu	37	11	101918604	101918604	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:101918604T>A	ENST00000434758.2	+	2	197	c.169T>A	c.(169-171)Tat>Aat	p.Y57N	C11orf70_ENST00000526781.1_Missense_Mutation_p.Y57N|C11orf70_ENST00000534360.1_Missense_Mutation_p.Y57N	NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	57										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		CTTTCAGTCCTATCGGAAGGA	0.522																																					p.Y57N		Atlas-SNP	.											.	C11orf70	33	.	0			c.T169A						.						75.0	67.0	70.0					11																	101918604		2203	4299	6502	SO:0001583	missense	85016	exon2			CAGTCCTATCGGA	AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.169T>A	chr11.hg19:g.101918604T>A	ENSP00000414390:p.Tyr57Asn	77.0	0.0		83.0	19.0	NM_032930	E9PJU1	Missense_Mutation	SNP	ENST00000434758.2	hg19	CCDS8313.2	.	.	.	.	.	.	.	.	.	.	T	16.37	3.104885	0.56291	.	.	ENSG00000137691	ENST00000434758;ENST00000526781;ENST00000534360;ENST00000393209;ENST00000423732	.	.	.	4.47	3.34	0.38264	.	0.000000	0.85682	D	0.000000	T	0.65616	0.2708	M	0.82923	2.615	0.26395	N	0.976518	D;D	0.76494	0.999;0.999	D;D	0.70016	0.952;0.967	T	0.58538	-0.7619	9	0.87932	D	0	-14.5655	7.3391	0.26627	0.0:0.1029:0.0:0.8971	.	57;57	Q9BRQ4;E9PJU1	CK070_HUMAN;.	N	57;57;57;19;19	.	ENSP00000376904:Y19N	Y	+	1	0	C11orf70	101423814	0.954000	0.32549	0.259000	0.24435	0.779000	0.44077	1.527000	0.35975	0.582000	0.29556	0.460000	0.39030	TAT	.	.		0.522	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394144.1	NM_032930	
GRIA4	2893	hgsc.bcm.edu	37	11	105795386	105795386	+	Missense_Mutation	SNP	G	G	T	rs200205997		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:105795386G>T	ENST00000530497.1	+	11	1738	c.1738G>T	c.(1738-1740)Gac>Tac	p.D580Y	GRIA4_ENST00000282499.5_Missense_Mutation_p.D580Y|GRIA4_ENST00000525187.1_Missense_Mutation_p.D580Y|GRIA4_ENST00000393127.2_Missense_Mutation_p.D580Y			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	580					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		AGAGCCAGAGGACGGAAAGGA	0.478																																					p.D580Y		Atlas-SNP	.											.	GRIA4	380	.	0			c.G1738T						.						142.0	118.0	126.0					11																	105795386		2202	4299	6501	SO:0001583	missense	2893	exon12			CCAGAGGACGGAA	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1738G>T	chr11.hg19:g.105795386G>T	ENSP00000435775:p.Asp580Tyr	111.0	0.0		185.0	12.0	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	31	5.086968	0.94100	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.14144	2.69;2.53;2.69;2.53	6.05	6.05	0.98169	Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000001	T	0.27419	0.0673	L	0.33339	1.005	0.80722	D	1	P;D	0.54397	0.845;0.966	P;P	0.60541	0.529;0.876	T	0.00089	-1.2089	10	0.44086	T	0.13	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	580;580	P48058;G3V164	GRIA4_HUMAN;.	Y	580	ENSP00000282499:D580Y;ENSP00000376835:D580Y;ENSP00000435775:D580Y;ENSP00000432180:D580Y	ENSP00000282499:D580Y	D	+	1	0	GRIA4	105300596	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	GAC	.	G|1.000;A|0.000		0.478	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
NXPE2	120406	hgsc.bcm.edu	37	11	114550401	114550401	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:114550401G>T	ENST00000389586.4	+	2	239	c.49G>T	c.(49-51)Gcc>Tcc	p.A17S	NXPE2_ENST00000375475.5_Missense_Mutation_p.A17S	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	17						integral component of membrane (GO:0016021)											GTTTCCAAATGCCATAGCTCG	0.353																																					p.A17S		Atlas-SNP	.											.	.	.	.	0			c.G49T						.						231.0	178.0	194.0					11																	114550401		692	1590	2282	SO:0001583	missense	120406	exon2			CCAAATGCCATAG	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.49G>T	chr11.hg19:g.114550401G>T	ENSP00000374237:p.Ala17Ser	28.0	0.0		62.0	21.0	NM_182495	Q2NKI8	Missense_Mutation	SNP	ENST00000389586.4	hg19	CCDS44738.1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246085	0.22796	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.17854	2.75;2.25	4.1	0.399	0.16325	.	0.831663	0.10288	N	0.692646	T	0.11836	0.0288	L	0.43152	1.355	0.09310	N	1	B	0.26318	0.146	B	0.22152	0.038	T	0.33137	-0.9880	10	0.34782	T	0.22	.	2.4915	0.04611	0.3393:0.0:0.4401:0.2206	.	17	Q96DL1	FA55B_HUMAN	S	17	ENSP00000374237:A17S;ENSP00000364624:A17S	ENSP00000364624:A17S	A	+	1	0	FAM55B	114055611	0.000000	0.05858	0.012000	0.15200	0.521000	0.34408	0.255000	0.18333	0.111000	0.17947	0.484000	0.47621	GCC	.	.		0.353	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495	
OR8D2	283160	hgsc.bcm.edu	37	11	124190043	124190043	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:124190043C>G	ENST00000357438.2	-	1	141	c.51G>C	c.(49-51)ttG>ttC	p.L17F		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		GGCGTTGTGTCAAGCCTGCCA	0.433																																					p.L17F		Atlas-SNP	.											.	OR8D2	65	.	0			c.G51C						.						67.0	67.0	67.0					11																	124190043		2200	4299	6499	SO:0001583	missense	283160	exon1			TTGTGTCAAGCCT	AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.51G>C	chr11.hg19:g.124190043C>G	ENSP00000350022:p.Leu17Phe	54.0	0.0		69.0	18.0	NM_001002918	B9EH49|Q6IFR0	Missense_Mutation	SNP	ENST00000357438.2	hg19	CCDS31707.1	.	.	.	.	.	.	.	.	.	.	c	9.749	1.167022	0.21621	.	.	ENSG00000197263	ENST00000357438	T	0.00009	9.5	3.42	2.21	0.28008	.	0.000000	0.32287	N	0.006309	T	0.00073	0.0002	L	0.39633	1.23	0.20307	N	0.999913	B	0.25390	0.125	B	0.20184	0.028	T	0.22730	-1.0208	10	0.59425	D	0.04	.	3.1741	0.06562	0.0:0.1629:0.2351:0.602	.	17	Q9GZM6	OR8D2_HUMAN	F	17	ENSP00000350022:L17F	ENSP00000350022:L17F	L	-	3	2	OR8D2	123695253	0.001000	0.12720	0.290000	0.24890	0.075000	0.17131	-0.456000	0.06754	0.590000	0.29694	0.395000	0.25975	TTG	.	.		0.433	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918	
VSIG2	23584	hgsc.bcm.edu	37	11	124618302	124618302	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:124618302C>G	ENST00000326621.5	-	6	935	c.835G>C	c.(835-837)Ggg>Cgg	p.G279R	RP11-677M14.2_ENST00000531241.1_RNA|VSIG2_ENST00000403470.1_Missense_Mutation_p.G279R	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	279						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		TCACTACCCCCATATGTCTCC	0.592																																					p.G279R		Atlas-SNP	.											.	VSIG2	38	.	0			c.G835C						.						119.0	105.0	110.0					11																	124618302		2201	4299	6500	SO:0001583	missense	23584	exon6			TACCCCCATATGT	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.835G>C	chr11.hg19:g.124618302C>G	ENSP00000318684:p.Gly279Arg	64.0	0.0		69.0	31.0	NM_014312	O95791|Q9NX42	Missense_Mutation	SNP	ENST00000326621.5	hg19	CCDS8452.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900926	0.72754	.	.	ENSG00000019102	ENST00000326621;ENST00000403470	T;T	0.75938	-0.82;-0.98	5.53	4.6	0.57074	.	0.208205	0.34435	N	0.003967	T	0.69097	0.3073	M	0.68317	2.08	0.37115	D	0.900557	B	0.24882	0.113	B	0.23419	0.046	T	0.66760	-0.5842	10	0.13470	T	0.59	.	12.0522	0.53513	0.0:0.8271:0.1728:0.0	.	279	Q96IQ7	VSIG2_HUMAN	R	279	ENSP00000318684:G279R;ENSP00000385013:G279R	ENSP00000318684:G279R	G	-	1	0	VSIG2	124123512	0.128000	0.22383	0.994000	0.49952	0.959000	0.62525	0.228000	0.17814	1.525000	0.49052	0.655000	0.94253	GGG	.	.		0.592	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312	
SLC6A13	6540	hgsc.bcm.edu	37	12	330614	330614	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:330614A>G	ENST00000343164.4	-	14	1666	c.1614T>C	c.(1612-1614)gcT>gcC	p.A538A	SLC6A13_ENST00000539668.1_5'Flank|SLC6A13_ENST00000445055.2_Silent_p.A446A	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	538					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TGGAGGACAGAGCCAGGAGCC	0.592																																					p.A538A		Atlas-SNP	.											.	SLC6A13	62	.	0			c.T1614C						.						57.0	60.0	59.0					12																	330614		2203	4300	6503	SO:0001819	synonymous_variant	6540	exon14			GGACAGAGCCAGG	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1614T>C	chr12.hg19:g.330614A>G		64.0	0.0		68.0	8.0	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Silent	SNP	ENST00000343164.4	hg19	CCDS8502.1																																																																																			.	.		0.592	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
KCNA1	3736	hgsc.bcm.edu	37	12	5020868	5020868	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:5020868G>T	ENST00000382545.3	+	2	1431	c.324G>T	c.(322-324)gtG>gtT	p.V108V	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	108					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CGGTCAACGTGCCCCTGGACA	0.617																																					p.V108V		Atlas-SNP	.											.	KCNA1	112	.	0			c.G324T						.						49.0	54.0	52.0					12																	5020868		2203	4300	6503	SO:0001819	synonymous_variant	3736	exon2			CAACGTGCCCCTG	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.324G>T	chr12.hg19:g.5020868G>T		97.0	0.0		65.0	14.0	NM_000217	A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	hg19	CCDS8535.1																																																																																			.	.		0.617	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
A2M	2	hgsc.bcm.edu	37	12	9262919	9262919	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:9262919T>C	ENST00000318602.7	-	5	802	c.495A>G	c.(493-495)gtA>gtG	p.V165V		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	165					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	CCTGAATGTATACTAGTGGAA	0.274																																					p.V165V		Atlas-SNP	.											.	A2M	180	.	0			c.A495G						.						74.0	63.0	66.0					12																	9262919		1725	3934	5659	SO:0001819	synonymous_variant	2	exon5			AATGTATACTAGT	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.495A>G	chr12.hg19:g.9262919T>C		27.0	0.0		37.0	14.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	ENST00000318602.7	hg19	CCDS44827.1																																																																																			.	.		0.274	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
CLEC12A	160364	hgsc.bcm.edu	37	12	10131563	10131563	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:10131563A>T	ENST00000304361.4	+	2	273		c.e2-1		CLEC12A_ENST00000350667.4_Intron|CLEC12A_ENST00000434319.2_Splice_Site|CLEC12A_ENST00000355690.4_Splice_Site	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						TGCTTTCCACAGCACCTCCAG	0.403																																					.	Melanoma(197;1487 2125 16611 22221 34855)	Atlas-SNP	.											.	CLEC12A	65	.	0			c.122-2A>T						.						182.0	169.0	173.0					12																	10131563		2203	4300	6503	SO:0001630	splice_region_variant	160364	exon3			TTCCACAGCACCT	AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.92-1A>T	chr12.hg19:g.10131563A>T		50.0	0.0		73.0	15.0	NM_001207010	B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Splice_Site	SNP	ENST00000304361.4	hg19	CCDS8608.1	.	.	.	.	.	.	.	.	.	.	A	6.103	0.387355	0.11581	.	.	ENSG00000172322	ENST00000355690;ENST00000396507;ENST00000304361;ENST00000434319	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9004	0.47049	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CLEC12A	10022830	0.783000	0.28701	0.086000	0.20670	0.033000	0.12548	3.560000	0.53763	2.005000	0.58758	0.528000	0.53228	.	.	.		0.403	CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399545.1	NM_138337	Intron
LRP6	4040	hgsc.bcm.edu	37	12	12332891	12332891	+	Silent	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:12332891T>A	ENST00000261349.4	-	7	1474	c.1398A>T	c.(1396-1398)ggA>ggT	p.G466G	LRP6_ENST00000543091.1_Silent_p.G466G	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	466	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TCGGAATTTCTCCCCAGTCAG	0.378																																					p.G466G		Atlas-SNP	.											.	LRP6	170	.	0			c.A1398T						.						89.0	83.0	85.0					12																	12332891		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon7			AATTTCTCCCCAG	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1398A>T	chr12.hg19:g.12332891T>A		59.0	0.0		115.0	23.0	NM_002336	Q17RZ2	Silent	SNP	ENST00000261349.4	hg19	CCDS8647.1																																																																																			.	.		0.378	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
PIK3C2G	5288	hgsc.bcm.edu	37	12	18576952	18576952	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:18576952A>G	ENST00000266497.5	+	16	2398	c.2360A>G	c.(2359-2361)cAg>cGg	p.Q787R	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.Q787R|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.Q828R			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	787	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CAGAGCATCCAGGTTGCCCAT	0.438																																					p.Q787R		Atlas-SNP	.											.	PIK3C2G	315	.	0			c.A2360G						.						70.0	66.0	67.0					12																	18576952		1883	4117	6000	SO:0001583	missense	5288	exon17			GCATCCAGGTTGC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.2360A>G	chr12.hg19:g.18576952A>G	ENSP00000266497:p.Gln787Arg	64.0	0.0		100.0	26.0	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	hg19	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	A	2.629	-0.286846	0.05605	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.61158	0.13;0.13;0.13	4.52	3.12	0.35913	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.077202	0.52532	N	0.000073	T	0.27933	0.0688	N	0.04746	-0.17	0.34095	D	0.661153	B;B;B	0.15719	0.014;0.011;0.014	B;B;B	0.22753	0.041;0.024;0.038	T	0.33828	-0.9853	10	0.02654	T	1	-7.2976	7.0123	0.24869	0.8484:0.0:0.1516:0.0	.	827;828;787	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	R	787;787;828	ENSP00000404845:Q787R;ENSP00000266497:Q787R;ENSP00000445381:Q828R	ENSP00000266497:Q787R	Q	+	2	0	PIK3C2G	18468219	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.096000	0.50243	0.861000	0.35504	0.377000	0.23210	CAG	.	.		0.438	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
ITGA5	3678	hgsc.bcm.edu	37	12	54798981	54798981	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:54798981G>T	ENST00000293379.4	-	12	1455	c.1194C>A	c.(1192-1194)ccC>ccA	p.P398P	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	398					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						GGTCCCCCAGGGGGGTCAAGG	0.602																																					p.P398P		Atlas-SNP	.											.	ITGA5	99	.	0			c.C1194A						.						62.0	67.0	65.0					12																	54798981		2203	4300	6503	SO:0001819	synonymous_variant	3678	exon12			CCCCAGGGGGGTC		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1194C>A	chr12.hg19:g.54798981G>T		146.0	0.0		149.0	29.0	NM_002205	Q96HA5	Silent	SNP	ENST00000293379.4	hg19	CCDS8880.1																																																																																			.	.		0.602	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
ITGA5	3678	hgsc.bcm.edu	37	12	54799001	54799001	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:54799001A>C	ENST00000293379.4	-	12	1435	c.1174T>G	c.(1174-1176)Ttt>Gtt	p.F392V	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	392					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						GAGCTGCCAAATCGGCCAAAC	0.622																																					p.F392V		Atlas-SNP	.											.	ITGA5	99	.	0			c.T1174G						.						65.0	66.0	66.0					12																	54799001		2203	4300	6503	SO:0001583	missense	3678	exon12			TGCCAAATCGGCC		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1174T>G	chr12.hg19:g.54799001A>C	ENSP00000293379:p.Phe392Val	142.0	0.0		153.0	26.0	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	hg19	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463026	0.84425	.	.	ENSG00000161638	ENST00000293379	T	0.73258	-0.73	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.87358	0.6157	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.90171	0.4235	10	0.87932	D	0	.	11.4414	0.50099	1.0:0.0:0.0:0.0	.	392	P08648	ITA5_HUMAN	V	392	ENSP00000293379:F392V	ENSP00000293379:F392V	F	-	1	0	ITGA5	53085268	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.704000	0.91351	1.869000	0.54173	0.533000	0.62120	TTT	.	.		0.622	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
DGKA	1606	hgsc.bcm.edu	37	12	56346937	56346937	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:56346937A>G	ENST00000331886.5	+	22	2510	c.2056A>G	c.(2056-2058)Acc>Gcc	p.T686A	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Missense_Mutation_p.T686A|DGKA_ENST00000551156.1_Missense_Mutation_p.T686A	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	686					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	CTCTGAGATCACCTTCCAGTA	0.567																																					p.T686A		Atlas-SNP	.											.	DGKA	70	.	0			c.A2056G						.						80.0	79.0	79.0					12																	56346937		2203	4300	6503	SO:0001583	missense	1606	exon22			GAGATCACCTTCC	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.2056A>G	chr12.hg19:g.56346937A>G	ENSP00000328405:p.Thr686Ala	57.0	0.0		72.0	24.0	NM_201554	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	hg19	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.825075	0.71143	.	.	ENSG00000065357	ENST00000331886;ENST00000394147;ENST00000551156	T;T;T	0.29142	1.58;1.58;1.58	4.83	4.83	0.62350	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	M	0.74881	2.28	0.53005	D	0.999969	B	0.34290	0.447	P	0.47251	0.542	T	0.48811	-0.9002	10	0.49607	T	0.09	.	13.6807	0.62484	1.0:0.0:0.0:0.0	.	686	P23743	DGKA_HUMAN	A	686	ENSP00000328405:T686A;ENSP00000377703:T686A;ENSP00000450359:T686A	ENSP00000328405:T686A	T	+	1	0	DGKA	54633204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.792000	0.91856	1.932000	0.55993	0.459000	0.35465	ACC	.	.		0.567	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
SMARCC2	6601	hgsc.bcm.edu	37	12	56575848	56575848	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:56575848G>T	ENST00000267064.4	-	8	734	c.648C>A	c.(646-648)atC>atA	p.I216I	RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Silent_p.I216I|SMARCC2_ENST00000394023.3_Silent_p.I216I|SMARCC2_ENST00000550859.1_5'UTR|SMARCC2_ENST00000347471.4_Silent_p.I216I	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	216					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CACTCGCTGGGATCCACGTGT	0.443																																					p.I216I		Atlas-SNP	.											.	SMARCC2	212	.	0			c.C648A						.						81.0	74.0	77.0					12																	56575848		2203	4300	6503	SO:0001819	synonymous_variant	6601	exon8			CGCTGGGATCCAC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.648C>A	chr12.hg19:g.56575848G>T		116.0	0.0		142.0	42.0	NM_139067	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Silent	SNP	ENST00000267064.4	hg19	CCDS8907.1																																																																																			.	.		0.443	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
PTPRB	5787	hgsc.bcm.edu	37	12	70928714	70928714	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:70928714G>T	ENST00000261266.5	-	28	5478	c.5449C>A	c.(5449-5451)Cca>Aca	p.P1817T	PTPRB_ENST00000538708.1_Missense_Mutation_p.P1727T|RP11-588H23.3_ENST00000547656.1_RNA|RP11-588H23.3_ENST00000551438.1_RNA|PTPRB_ENST00000334414.6_Missense_Mutation_p.P2035T|PTPRB_ENST00000550857.1_Missense_Mutation_p.P1727T|RP11-588H23.3_ENST00000546836.1_RNA|RP11-588H23.3_ENST00000549460.1_RNA|PTPRB_ENST00000451516.2_Missense_Mutation_p.P1727T|PTPRB_ENST00000550358.1_Missense_Mutation_p.P1947T|RP11-588H23.3_ENST00000548687.1_RNA	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1817	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGGTCCGCTGGCCAGTAATGA	0.512																																					p.P2035T		Atlas-SNP	.											.	PTPRB	676	.	0			c.C6103A						.						65.0	63.0	64.0					12																	70928714		1929	4131	6060	SO:0001583	missense	5787	exon30			CCGCTGGCCAGTA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.5449C>A	chr12.hg19:g.70928714G>T	ENSP00000261266:p.Pro1817Thr	88.0	0.0		97.0	25.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772249	0.90108	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09	5.5	5.5	0.81552	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.64068	0.2565	H	0.96720	3.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.76868	-0.2800	10	0.87932	D	0	.	19.7664	0.96346	0.0:0.0:1.0:0.0	.	1727;1727;2035;1817;1947	P23467-2;F5H3G6;P23467-3;P23467;F8VU56	.;.;.;PTPRB_HUMAN;.	T	2035;1727;1947;1727;1727;1817	ENSP00000334928:P2035T;ENSP00000393028:P1727T;ENSP00000448058:P1947T;ENSP00000438927:P1727T;ENSP00000447302:P1727T;ENSP00000261266:P1817T	ENSP00000261266:P1817T	P	-	1	0	PTPRB	69214981	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.420000	0.97426	2.735000	0.93741	0.655000	0.94253	CCA	.	.		0.512	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
SLC6A15	55117	hgsc.bcm.edu	37	12	85279833	85279833	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:85279833G>T	ENST00000266682.5	-	3	845	c.304C>A	c.(304-306)Cca>Aca	p.P102T	SLC6A15_ENST00000552192.1_5'UTR|SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000450363.3_Missense_Mutation_p.P102T	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	102					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						ATTAAATATGGTAAAAGATAT	0.308																																					p.P102T		Atlas-SNP	.											.	SLC6A15	159	.	0			c.C304A						.						47.0	53.0	51.0					12																	85279833		2202	4299	6501	SO:0001583	missense	55117	exon3			AATATGGTAAAAG	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.304C>A	chr12.hg19:g.85279833G>T	ENSP00000266682:p.Pro102Thr	102.0	0.0		174.0	58.0	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	hg19	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570256	0.65765	.	.	ENSG00000072041	ENST00000266682;ENST00000450363	D;D	0.86769	-2.17;-2.17	5.18	4.29	0.51040	.	0.000000	0.85682	D	0.000000	D	0.94453	0.8215	M	0.91872	3.25	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	D	0.95393	0.8483	10	0.87932	D	0	.	13.996	0.64402	0.0738:0.0:0.9262:0.0	.	102;102	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	T	102	ENSP00000266682:P102T;ENSP00000390706:P102T	ENSP00000266682:P102T	P	-	1	0	SLC6A15	83803964	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	7.537000	0.82033	1.318000	0.45170	0.585000	0.79938	CCA	.	.		0.308	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
HIP1R	9026	hgsc.bcm.edu	37	12	123340546	123340546	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr12:123340546A>G	ENST00000253083.4	+	14	1273	c.1148A>G	c.(1147-1149)cAg>cGg	p.Q383R		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	383					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		TACATCGCGCAGCTGAAGAGC	0.682																																					p.Q383R		Atlas-SNP	.											.	HIP1R	68	.	0			c.A1148G						.						39.0	39.0	39.0					12																	123340546		2195	4296	6491	SO:0001583	missense	9026	exon14			TCGCGCAGCTGAA	AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.1148A>G	chr12.hg19:g.123340546A>G	ENSP00000253083:p.Gln383Arg	142.0	0.0		133.0	21.0	NM_003959	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	ENST00000253083.4	hg19	CCDS31922.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.294675	0.60086	.	.	ENSG00000130787	ENST00000253083	T	0.17528	2.27	4.84	3.61	0.41365	.	0.055614	0.64402	D	0.000001	T	0.28632	0.0709	M	0.78637	2.42	0.52501	D	0.99995	P;P;P	0.49447	0.92;0.92;0.924	B;P;P	0.49829	0.439;0.623;0.512	T	0.04930	-1.0917	10	0.44086	T	0.13	-26.0226	10.3947	0.44194	0.8536:0.0:0.0:0.1464	.	383;383;371	O75146;Q6NXG8;B3KQW8	HIP1R_HUMAN;.;.	R	383	ENSP00000253083:Q383R	ENSP00000253083:Q383R	Q	+	2	0	HIP1R	121906499	1.000000	0.71417	0.989000	0.46669	0.562000	0.35680	7.337000	0.79256	1.816000	0.52996	0.459000	0.35465	CAG	.	.		0.682	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959	
TPTE2	93492	hgsc.bcm.edu	37	13	20056675	20056675	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:20056675T>C	ENST00000400230.2	-	4	176	c.132A>G	c.(130-132)cgA>cgG	p.R44R	TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382977.4_Silent_p.R44R|TPTE2_ENST00000382978.1_Silent_p.R44R|TPTE2_ENST00000400103.2_Silent_p.R44R|TPTE2_ENST00000382975.4_Silent_p.R44R|TPTE2_ENST00000457266.2_Silent_p.R44R|TPTE2_ENST00000255310.6_Intron			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	44					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ACTTGGAAAGTCGTTCTAACA	0.308																																					p.R44R		Atlas-SNP	.											.	TPTE2	225	.	0			c.A132G						.						53.0	52.0	53.0					13																	20056675		2201	4299	6500	SO:0001819	synonymous_variant	93492	exon5			GGAAAGTCGTTCT	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.132A>G	chr13.hg19:g.20056675T>C		279.0	0.0		495.0	138.0	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	hg19	CCDS45014.1																																																																																			.	.		0.308	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
TPTE2	93492	hgsc.bcm.edu	37	13	20067639	20067639	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:20067639G>A	ENST00000400230.2	-	2	58	c.14C>T	c.(13-15)cCa>cTa	p.P5L	TPTE2_ENST00000390680.2_Missense_Mutation_p.P5L|TPTE2_ENST00000382977.4_Missense_Mutation_p.P5L|TPTE2_ENST00000382978.1_Missense_Mutation_p.P5L|TPTE2_ENST00000400103.2_Missense_Mutation_p.P5L|TPTE2_ENST00000382975.4_Missense_Mutation_p.P5L|TPTE2_ENST00000457266.2_Missense_Mutation_p.P5L|TPTE2_ENST00000255310.6_Missense_Mutation_p.P5L			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	5					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GTTTGTCTGTGGACTAGCGGA	0.358																																					p.P5L		Atlas-SNP	.											.	TPTE2	225	.	0			c.C14T						.						105.0	99.0	101.0					13																	20067639		2203	4300	6503	SO:0001583	missense	93492	exon3			GTCTGTGGACTAG	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.14C>T	chr13.hg19:g.20067639G>A	ENSP00000383089:p.Pro5Leu	26.0	0.0		35.0	11.0	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	hg19	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	G	6.425	0.446511	0.12223	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548;ENST00000419256	D;D;D;D;D;D;D;D	0.97959	-4.06;-4.63;-3.57;-4.11;-4.11;-3.57;-4.06;-4.63	0.854	0.854	0.19007	.	.	.	.	.	D	0.93993	0.8076	L	0.36672	1.1	0.09310	N	1	B;B;B	0.25904	0.015;0.137;0.084	B;B;B	0.31614	0.005;0.133;0.063	D	0.87413	0.2377	8	.	.	.	.	5.0122	0.14319	0.0:0.0:1.0:0.0	.	5;5;5	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	L	5	ENSP00000372438:P5L;ENSP00000382974:P5L;ENSP00000383089:P5L;ENSP00000255310:P5L;ENSP00000375098:P5L;ENSP00000372437:P5L;ENSP00000372435:P5L;ENSP00000442218:P5L	.	P	-	2	0	TPTE2	18965639	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-0.206000	0.09398	0.743000	0.32719	0.462000	0.41574	CCA	.	.		0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
SACS	26278	hgsc.bcm.edu	37	13	23909684	23909684	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:23909684C>A	ENST00000382292.3	-	9	8604	c.8331G>T	c.(8329-8331)agG>agT	p.R2777S	SACS_ENST00000402364.1_Missense_Mutation_p.R2027S|SACS_ENST00000382298.3_Missense_Mutation_p.R2777S			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2777					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAAATTGTTTCCTTTTCAATC	0.343																																					p.R2777S		Atlas-SNP	.											.	SACS	871	.	0			c.G8331T						.						104.0	96.0	99.0					13																	23909684		2203	4299	6502	SO:0001583	missense	26278	exon10			TTGTTTCCTTTTC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.8331G>T	chr13.hg19:g.23909684C>A	ENSP00000371729:p.Arg2777Ser	32.0	0.0		50.0	13.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	18.99	3.739123	0.69304	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.89415	-2.37;-2.51;-2.37	5.2	5.2	0.72013	.	0.051835	0.85682	D	0.000000	D	0.86623	0.5977	L	0.36672	1.1	0.40141	D	0.976831	D	0.59357	0.985	P	0.50314	0.637	D	0.86669	0.1909	10	0.49607	T	0.09	.	10.3663	0.44026	0.0:0.8773:0.0:0.1227	.	2777	Q9NZJ4	SACS_HUMAN	S	2777;2027;2777	ENSP00000371729:R2777S;ENSP00000385844:R2027S;ENSP00000371735:R2777S	ENSP00000371729:R2777S	R	-	3	2	SACS	22807684	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.769000	0.38522	2.584000	0.87258	0.462000	0.41574	AGG	.	.		0.343	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
ENOX1	55068	hgsc.bcm.edu	37	13	43918692	43918692	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:43918692T>C	ENST00000261488.6	-	9	1595	c.1018A>G	c.(1018-1020)Act>Gct	p.T340A	ENOX1_ENST00000540032.1_Missense_Mutation_p.T153A|ENOX1_ENST00000412891.1_Missense_Mutation_p.T340A	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	340					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		AGAATCCCAGTTAAGGCATTT	0.413																																					p.T340A		Atlas-SNP	.											.	ENOX1	158	.	0			c.A1018G						.						103.0	109.0	107.0					13																	43918692		2203	4300	6503	SO:0001583	missense	55068	exon9			TCCCAGTTAAGGC	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.1018A>G	chr13.hg19:g.43918692T>C	ENSP00000261488:p.Thr340Ala	126.0	0.0		137.0	43.0	NM_017993	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	hg19	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	T	6.131	0.392382	0.11638	.	.	ENSG00000120658	ENST00000261488;ENST00000412891;ENST00000540032	T;T	0.40756	1.02;1.02	5.92	4.68	0.58851	.	0.381472	0.31519	N	0.007508	T	0.26666	0.0652	L	0.29908	0.895	0.32516	N	0.536881	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23013	-1.0200	10	0.08837	T	0.75	-6.0281	10.1971	0.43060	0.2562:0.0:0.0:0.7438	.	153;340	B7Z5K1;Q8TC92	.;ENOX1_HUMAN	A	340;340;153	ENSP00000261488:T340A;ENSP00000415054:T340A	ENSP00000261488:T340A	T	-	1	0	ENOX1	42816692	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.476000	0.22180	2.263000	0.75096	0.533000	0.62120	ACT	.	.		0.413	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
COG3	83548	hgsc.bcm.edu	37	13	46067517	46067517	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:46067517A>T	ENST00000349995.5	+	12	1335	c.1223A>T	c.(1222-1224)gAt>gTt	p.D408V	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	408					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		TCATTGTATGATGTCTTCAGG	0.333																																					p.D408V	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.A1223T						.						209.0	199.0	202.0					13																	46067517		2203	4300	6503	SO:0001583	missense	83548	exon12			TGTATGATGTCTT	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1223A>T	chr13.hg19:g.46067517A>T	ENSP00000258654:p.Asp408Val	82.0	0.0		127.0	44.0	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.516445	0.85495	.	.	ENSG00000136152	ENST00000349995	T	0.61392	0.11	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.80924	0.4717	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.994;0.998;0.984	D	0.85326	0.1087	10	0.72032	D	0.01	-16.4288	15.0147	0.71576	1.0:0.0:0.0:0.0	.	245;408;408	B4E2F3;Q96JB2;Q96JB2-2	.;COG3_HUMAN;.	V	408	ENSP00000258654:D408V	ENSP00000258654:D408V	D	+	2	0	COG3	44965518	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.331000	0.96430	2.138000	0.66242	0.377000	0.23210	GAT	.	.		0.333	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
COG3	83548	hgsc.bcm.edu	37	13	46104830	46104830	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:46104830A>G	ENST00000349995.5	+	22	2484	c.2372A>G	c.(2371-2373)cAa>cGa	p.Q791R		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	791					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		AATATTCAGCAAGTCTTCCAG	0.398																																					p.Q791R	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.A2372G						.						107.0	105.0	106.0					13																	46104830		2203	4300	6503	SO:0001583	missense	83548	exon22			TTCAGCAAGTCTT	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.2372A>G	chr13.hg19:g.46104830A>G	ENSP00000258654:p.Gln791Arg	53.0	0.0		73.0	5.0	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	a	12.13	1.846113	0.32606	.	.	ENSG00000136152	ENST00000349995	T	0.48201	0.82	5.5	4.32	0.51571	.	0.148963	0.64402	D	0.000008	T	0.45657	0.1353	L	0.60455	1.87	0.80722	D	1	B;P	0.48230	0.176;0.907	B;B	0.44224	0.068;0.444	T	0.34625	-0.9821	10	0.34782	T	0.22	-10.2719	10.7764	0.46353	0.9255:0.0:0.0745:0.0	.	628;791	B4E2F3;Q96JB2	.;COG3_HUMAN	R	791	ENSP00000258654:Q791R	ENSP00000258654:Q791R	Q	+	2	0	COG3	45002831	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.166000	0.77553	0.921000	0.36994	-0.286000	0.09958	CAA	.	.		0.398	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
DIAPH3	81624	hgsc.bcm.edu	37	13	60348376	60348376	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr13:60348376C>A	ENST00000400324.4	-	27	3486	c.3266G>T	c.(3265-3267)cGg>cTg	p.R1089L	DIAPH3_ENST00000400319.1_Missense_Mutation_p.R1019L|DIAPH3_ENST00000400330.1_Missense_Mutation_p.R1089L|DIAPH3_ENST00000267215.4_Missense_Mutation_p.R1089L|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400320.1_Missense_Mutation_p.R1043L|DIAPH3_ENST00000377908.2_Missense_Mutation_p.R1078L	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	1089					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		GAGACTCTGCCGAACATCTGt	0.323																																					p.R1089L		Atlas-SNP	.											.	DIAPH3	139	.	0			c.G3266T						.						62.0	59.0	60.0					13																	60348376		1802	4071	5873	SO:0001583	missense	81624	exon27			CTCTGCCGAACAT	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.3266G>T	chr13.hg19:g.60348376C>A	ENSP00000383178:p.Arg1089Leu	195.0	0.0		301.0	18.0	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	hg19	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068699	0.36470	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214	D;D;D;D;D;T	0.81739	-1.52;-1.52;-1.53;-1.51;-1.5;-1.49	5.59	2.93	0.34026	.	0.364730	0.25759	N	0.028489	T	0.64305	0.2586	L	0.29908	0.895	0.38703	D	0.953034	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.55192	-0.8179	10	0.41790	T	0.15	.	1.9514	0.03367	0.1232:0.468:0.1782:0.2305	.	826;1089	Q9NSV4-1;Q9NSV4	.;DIAP3_HUMAN	L	1089;1089;1078;1043;1019;1078;1019;1043;1089;826	ENSP00000383178:R1089L;ENSP00000383184:R1089L;ENSP00000367141:R1078L;ENSP00000383173:R1019L;ENSP00000383174:R1043L;ENSP00000267215:R1089L	ENSP00000267214:R826L	R	-	2	0	DIAPH3	59246377	0.342000	0.24809	0.986000	0.45419	0.995000	0.86356	0.643000	0.24750	0.316000	0.23135	0.655000	0.94253	CGG	.	.		0.323	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
RNF31	55072	hgsc.bcm.edu	37	14	24617276	24617276	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr14:24617276G>A	ENST00000324103.6	+	2	604	c.284G>A	c.(283-285)tGg>tAg	p.W95*	PSME2_ENST00000216802.5_5'Flank|RNF31_ENST00000382687.3_5'Flank|PSME2_ENST00000560410.1_5'Flank|PSME2_ENST00000471700.2_5'Flank|RNF31_ENST00000559275.1_5'UTR|RNF31_ENST00000557878.1_3'UTR	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	95	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		CCTCGGTACTGGCGTGGTGTC	0.587																																					p.W95X		Atlas-SNP	.											.	RNF31	95	.	0			c.G284A						.						103.0	105.0	104.0					14																	24617276		2026	4183	6209	SO:0001587	stop_gained	55072	exon2			GGTACTGGCGTGG	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.284G>A	chr14.hg19:g.24617276G>A	ENSP00000315112:p.Trp95*	44.0	0.0		47.0	15.0	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Nonsense_Mutation	SNP	ENST00000324103.6	hg19	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	G	36	5.800112	0.96960	.	.	ENSG00000092098	ENST00000324103	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.5194	17.9131	0.88940	0.0:0.0:1.0:0.0	.	.	.	.	X	95	.	.	W	+	2	0	RNF31	23687116	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	8.315000	0.89983	2.779000	0.95612	0.655000	0.94253	TGG	.	.		0.587	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
PLEKHH1	57475	hgsc.bcm.edu	37	14	68046545	68046545	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr14:68046545C>A	ENST00000329153.5	+	22	3267	c.3135C>A	c.(3133-3135)gaC>gaA	p.D1045E	PLEKHH1_ENST00000417684.2_5'UTR	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	1045	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TCTTCACGGACGATCCCTCGG	0.592																																					p.D1045E		Atlas-SNP	.											.	PLEKHH1	118	.	0			c.C3135A						.						31.0	31.0	31.0					14																	68046545		1989	4162	6151	SO:0001583	missense	57475	exon22			CACGGACGATCCC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.3135C>A	chr14.hg19:g.68046545C>A	ENSP00000330278:p.Asp1045Glu	49.0	0.0		55.0	19.0	NM_020715	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	hg19	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035093	0.54896	.	.	ENSG00000054690	ENST00000329153	T	0.60171	0.21	5.19	-6.3	0.02007	Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	T	0.52158	0.1717	M	0.67569	2.06	0.80722	D	1	P	0.34562	0.457	B	0.36186	0.219	T	0.49679	-0.8914	10	0.46703	T	0.11	.	17.0261	0.86447	0.0:0.1424:0.0:0.8576	.	1045	Q9ULM0	PKHH1_HUMAN	E	1045	ENSP00000330278:D1045E	ENSP00000330278:D1045E	D	+	3	2	PLEKHH1	67116298	0.046000	0.20272	0.333000	0.25482	0.575000	0.36095	-0.794000	0.04584	-1.415000	0.02022	-1.069000	0.02264	GAC	.	.		0.592	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
SERPINA10	51156	hgsc.bcm.edu	37	14	94752462	94752462	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr14:94752462T>G	ENST00000393096.1	-	4	1591	c.1126A>C	c.(1126-1128)Aat>Cat	p.N376H	SERPINA10_ENST00000261994.4_Missense_Mutation_p.N376H|SERPINA10_ENST00000554723.1_Missense_Mutation_p.N416H|SERPINA10_ENST00000554173.1_Missense_Mutation_p.N376H	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	376					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		ACTTGGAGATTTCTTCCAGTA	0.418																																					p.N376H		Atlas-SNP	.											.	SERPINA10	83	.	0			c.A1126C						.						94.0	84.0	87.0					14																	94752462		2203	4300	6503	SO:0001583	missense	51156	exon4			GGAGATTTCTTCC	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.1126A>C	chr14.hg19:g.94752462T>G	ENSP00000376809:p.Asn376His	60.0	0.0		83.0	24.0	NM_001100607	A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	ENST00000393096.1	hg19	CCDS9923.1	.	.	.	.	.	.	.	.	.	.	T	4.702	0.130550	0.08981	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	4.86	2.29	0.28610	Serpin domain (3);	0.561717	0.16103	N	0.229455	D	0.83672	0.5305	M	0.71296	2.17	0.09310	N	1	B	0.28900	0.227	B	0.27608	0.081	T	0.72364	-0.4316	10	0.36615	T	0.2	.	1.0894	0.01660	0.1459:0.215:0.1504:0.4887	.	376	Q9UK55	ZPI_HUMAN	H	416;376;376;376	ENSP00000450896:N416H;ENSP00000376809:N376H;ENSP00000261994:N376H;ENSP00000450971:N376H	ENSP00000261994:N376H	N	-	1	0	SERPINA10	93822215	0.055000	0.20627	0.012000	0.15200	0.237000	0.25408	1.379000	0.34340	0.593000	0.29745	0.260000	0.18958	AAT	.	.		0.418	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
INF2	64423	hgsc.bcm.edu	37	14	105180664	105180664	+	Silent	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr14:105180664C>A	ENST00000392634.4	+	21	3277	c.3165C>A	c.(3163-3165)ccC>ccA	p.P1055P	INF2_ENST00000330634.7_Silent_p.P1055P	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	1055					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CCGTGACCCCCGGCCCTCAGC	0.667																																					p.P1055P		Atlas-SNP	.											.	INF2	148	.	0			c.C3165A						.						25.0	31.0	29.0					14																	105180664		1921	4101	6022	SO:0001819	synonymous_variant	64423	exon21			GACCCCCGGCCCT	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.3165C>A	chr14.hg19:g.105180664C>A		46.0	0.0		59.0	26.0	NM_022489	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Silent	SNP	ENST00000392634.4	hg19	CCDS9989.2																																																																																			.	.		0.667	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
NPAP1	23742	hgsc.bcm.edu	37	15	24923532	24923532	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:24923532T>A	ENST00000329468.2	+	1	2992	c.2518T>A	c.(2518-2520)Ttt>Att	p.F840I		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	840					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCAGTCTACCTTTGTCTCCAG	0.507																																					p.F840I		Atlas-SNP	.											.	.	.	.	0			c.T2518A						.						116.0	105.0	109.0					15																	24923532		2203	4300	6503	SO:0001583	missense	23742	exon1			TCTACCTTTGTCT	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2518T>A	chr15.hg19:g.24923532T>A	ENSP00000333735:p.Phe840Ile	38.0	0.0		54.0	17.0	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	hg19	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	12.19	1.863291	0.32884	.	.	ENSG00000185823	ENST00000329468	T	0.06528	3.29	1.83	-0.557	0.11800	.	.	.	.	.	T	0.03651	0.0104	N	0.22421	0.69	0.09310	N	1	B	0.27823	0.19	B	0.17722	0.019	T	0.41998	-0.9477	9	0.38643	T	0.18	.	4.2576	0.10724	0.0:0.4931:0.0:0.5069	.	840	Q9NZP6	CO002_HUMAN	I	840	ENSP00000333735:F840I	ENSP00000333735:F840I	F	+	1	0	C15orf2	22474625	0.003000	0.15002	0.000000	0.03702	0.052000	0.14988	-0.192000	0.09587	-0.150000	0.11195	0.338000	0.21704	TTT	.	.		0.507	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
SPINT1	6692	hgsc.bcm.edu	37	15	41136861	41136861	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:41136861C>T	ENST00000344051.4	+	2	343	c.109C>T	c.(109-111)Cca>Tca	p.P37S	SPINT1_ENST00000431806.1_Missense_Mutation_p.P37S|RP11-532F12.5_ENST00000565315.1_RNA|RP11-532F12.5_ENST00000564302.1_RNA|SPINT1_ENST00000562057.1_Missense_Mutation_p.P37S|RP11-532F12.5_ENST00000568419.1_RNA|RP11-532F12.5_ENST00000568525.1_RNA			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	37					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		CCAGGCCGGGCCACCGCCCGC	0.751																																					p.P37S		Atlas-SNP	.											.	SPINT1	28	.	0			c.C109T						.						7.0	9.0	8.0					15																	41136861		2110	4128	6238	SO:0001583	missense	6692	exon2			GCCGGGCCACCGC		CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.109C>T	chr15.hg19:g.41136861C>T	ENSP00000342098:p.Pro37Ser	146.0	0.0		114.0	39.0	NM_181642	Q7Z7D2	Missense_Mutation	SNP	ENST00000344051.4	hg19	CCDS10067.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.790268	0.31685	.	.	ENSG00000166145	ENST00000344051;ENST00000431806	D;D	0.95238	-3.65;-3.65	4.04	3.12	0.35913	.	0.738856	0.12548	N	0.459326	D	0.84920	0.5579	N	0.08118	0	0.09310	N	1	B;B;B	0.22983	0.047;0.078;0.047	B;B;B	0.25291	0.027;0.059;0.027	T	0.73630	-0.3922	10	0.18710	T	0.47	-3.585	5.691	0.17829	0.0:0.6898:0.2:0.1101	.	37;37;37	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	S	37	ENSP00000342098:P37S;ENSP00000409935:P37S	ENSP00000342098:P37S	P	+	1	0	SPINT1	38924153	0.883000	0.30277	0.346000	0.25655	0.003000	0.03518	1.434000	0.34958	1.030000	0.39839	0.563000	0.77884	CCA	.	.		0.751	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252359.2	NM_003710	
PDIA3	2923	hgsc.bcm.edu	37	15	44060746	44060746	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:44060746G>T	ENST00000300289.5	+	9	1236	c.1088G>T	c.(1087-1089)aGa>aTa	p.R363I	PDIA3_ENST00000538521.1_Missense_Mutation_p.R343I	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3	363	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		AATCTGAAGAGATACCTGAAG	0.473																																					p.R363I		Atlas-SNP	.											.	PDIA3	40	.	0			c.G1088T						.						116.0	117.0	116.0					15																	44060746		2198	4296	6494	SO:0001583	missense	2923	exon9			TGAAGAGATACCT		CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444	ENST00000300289.5:c.1088G>T	chr15.hg19:g.44060746G>T	ENSP00000300289:p.Arg363Ile	52.0	0.0		83.0	31.0	NM_005313	Q13453|Q14255|Q8IYF8|Q9UMU7	Missense_Mutation	SNP	ENST00000300289.5	hg19	CCDS10101.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453777	0.63290	.	.	ENSG00000167004	ENST00000300289;ENST00000538826;ENST00000537673;ENST00000538521	T;T	0.22743	1.94;1.94	5.71	3.84	0.44239	Thioredoxin-like fold (3);	0.175943	0.64402	D	0.000016	T	0.21145	0.0509	L	0.50333	1.59	0.80722	D	1	P;P	0.38992	0.645;0.653	B;B	0.39299	0.296;0.255	T	0.03139	-1.1068	10	0.72032	D	0.01	.	9.8998	0.41340	0.222:0.0:0.778:0.0	.	343;363	G5EA52;P30101	.;PDIA3_HUMAN	I	363;338;137;343	ENSP00000300289:R363I;ENSP00000438260:R343I	ENSP00000300289:R363I	R	+	2	0	PDIA3	41848038	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.838000	0.55828	1.410000	0.46936	0.561000	0.74099	AGA	.	.		0.473	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103532.3	NM_005313	
SEMA6D	80031	hgsc.bcm.edu	37	15	48052603	48052603	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:48052603T>C	ENST00000316364.5	+	3	651	c.212T>C	c.(211-213)aTt>aCt	p.I71T	SEMA6D_ENST00000558014.1_Missense_Mutation_p.I71T|SEMA6D_ENST00000537942.1_Missense_Mutation_p.I71T|SEMA6D_ENST00000536845.2_Missense_Mutation_p.I71T|SEMA6D_ENST00000354744.4_Missense_Mutation_p.I71T|SEMA6D_ENST00000389428.3_Missense_Mutation_p.I71T|SEMA6D_ENST00000389433.2_Missense_Mutation_p.I71T|SEMA6D_ENST00000558816.1_Missense_Mutation_p.I71T|SEMA6D_ENST00000389432.2_Missense_Mutation_p.I71T|SEMA6D_ENST00000358066.4_Missense_Mutation_p.I71T|SEMA6D_ENST00000355997.3_Missense_Mutation_p.I71T|SEMA6D_ENST00000389425.3_Missense_Mutation_p.I71T	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	71	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		ACACTTTATATTGCTGGCAGG	0.388																																					p.I71T		Atlas-SNP	.											.	SEMA6D	322	.	0			c.T212C						.						82.0	81.0	82.0					15																	48052603		2198	4297	6495	SO:0001583	missense	80031	exon3			TTTATATTGCTGG	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.212T>C	chr15.hg19:g.48052603T>C	ENSP00000324857:p.Ile71Thr	54.0	0.0		95.0	4.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	hg19	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754694	0.69648	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64;2.64;2.64;2.64;2.64	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.046039	0.85682	D	0.000000	T	0.42675	0.1213	M	0.85197	2.74	0.80722	D	1	D;P;D;P;D	0.76494	0.999;0.881;0.974;0.78;0.999	D;P;P;P;D	0.71184	0.972;0.72;0.786;0.72;0.972	T	0.47328	-0.9126	10	0.87932	D	0	.	16.087	0.81065	0.0:0.0:0.0:1.0	.	71;71;71;71;71	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	T	71	ENSP00000442040:I71T;ENSP00000446152:I71T;ENSP00000324857:I71T;ENSP00000374084:I71T;ENSP00000374083:I71T;ENSP00000346786:I71T;ENSP00000350770:I71T;ENSP00000374079:I71T;ENSP00000348276:I71T;ENSP00000374076:I71T	ENSP00000324857:I71T	I	+	2	0	SEMA6D	45839895	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.202000	0.70862	0.533000	0.62120	ATT	.	.		0.388	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
RORA	6095	hgsc.bcm.edu	37	15	60803529	60803529	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:60803529A>G	ENST00000335670.6	-	5	816	c.716T>C	c.(715-717)aTc>aCc	p.I239T	RP11-219B17.1_ENST00000501579.2_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RP11-219B17.1_ENST00000559902.1_RNA|RORA_ENST00000309157.4_Missense_Mutation_p.I264T|RORA_ENST00000449337.2_Missense_Mutation_p.I184T|RP11-219B17.1_ENST00000558140.1_RNA|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000560004.1_5'Flank|RORA_ENST00000261523.5_Missense_Mutation_p.I272T	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	239	Hinge.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTCTGGTTTGATTCCATTGAT	0.532																																					p.I272T		Atlas-SNP	.											.	RORA	114	.	0			c.T815C						.						213.0	158.0	176.0					15																	60803529		2203	4300	6503	SO:0001583	missense	6095	exon6			GGTTTGATTCCAT	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.716T>C	chr15.hg19:g.60803529A>G	ENSP00000335087:p.Ile239Thr	82.0	0.0		102.0	32.0	NM_134260	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	hg19	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046933	0.55110	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.94758	-3.45;-3.45;-3.51;-3.42	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.95708	0.8604	L	0.58925	1.835	0.80722	D	1	B;B;D;B	0.67145	0.094;0.126;0.996;0.364	B;B;D;B	0.67900	0.108;0.112;0.954;0.236	D	0.93838	0.7134	10	0.10111	T	0.7	.	16.3322	0.83039	1.0:0.0:0.0:0.0	.	239;264;272;184	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	T	239;184;264;272	ENSP00000335087:I239T;ENSP00000402971:I184T;ENSP00000309753:I264T;ENSP00000261523:I272T	ENSP00000261523:I272T	I	-	2	0	RORA	58590821	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	9.326000	0.96389	2.251000	0.74343	0.528000	0.53228	ATC	.	.		0.532	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
DENND4A	10260	hgsc.bcm.edu	37	15	65962168	65962168	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:65962168G>A	ENST00000431932.2	-	26	4812	c.4604C>T	c.(4603-4605)tCt>tTt	p.S1535F	DENND4A_ENST00000443035.3_Missense_Mutation_p.S1578F	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1535					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GTCAAGACCAGAGGCTGATGT	0.358																																					p.S1578F		Atlas-SNP	.											.	DENND4A	217	.	0			c.C4733T						.						116.0	109.0	112.0					15																	65962168		1884	4112	5996	SO:0001583	missense	10260	exon27			AGACCAGAGGCTG	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.4604C>T	chr15.hg19:g.65962168G>A	ENSP00000396830:p.Ser1535Phe	67.0	0.0		104.0	30.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	hg19	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	G	7.641	0.680932	0.14907	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.05996	3.37;3.36	5.64	5.64	0.86602	.	0.512841	0.19789	N	0.106040	T	0.05593	0.0147	L	0.27053	0.805	0.31650	N	0.646881	P;B	0.34462	0.454;0.207	B;B	0.23716	0.048;0.048	T	0.06881	-1.0802	10	0.62326	D	0.03	.	14.8629	0.70394	0.0707:0.0:0.9293:0.0	.	1578;1535	E7EPL3;Q7Z401	.;MYCPP_HUMAN	F	1578;1535	ENSP00000391167:S1578F;ENSP00000396830:S1535F	ENSP00000396830:S1535F	S	-	2	0	DENND4A	63749222	0.996000	0.38824	1.000000	0.80357	0.305000	0.27757	2.386000	0.44380	2.659000	0.90383	0.650000	0.86243	TCT	.	.		0.358	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
CCDC33	80125	hgsc.bcm.edu	37	15	74559069	74559069	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:74559069T>A	ENST00000398814.3	+	4	801	c.370T>A	c.(370-372)Tac>Aac	p.Y124N	CCDC33_ENST00000321288.5_Missense_Mutation_p.Y327N	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	327										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GTTGTTGTCCTACAAAATCCC	0.493																																					p.Y124N		Atlas-SNP	.											.	CCDC33	160	.	0			c.T370A						.						161.0	156.0	158.0					15																	74559069		1932	4142	6074	SO:0001583	missense	80125	exon4			TTGTCCTACAAAA	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.370T>A	chr15.hg19:g.74559069T>A	ENSP00000381795:p.Tyr124Asn	64.0	0.0		95.0	26.0	NM_025055	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	ENST00000398814.3	hg19	CCDS42058.1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.522255	0.64747	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.39787	1.06;1.06	4.45	4.45	0.53987	.	0.134612	0.32703	N	0.005750	T	0.50616	0.1626	L	0.56769	1.78	0.25473	N	0.987801	D	0.54207	0.965	P	0.54312	0.748	T	0.47535	-0.9110	10	0.87932	D	0	.	10.3962	0.44203	0.0:0.0:0.0:1.0	.	124	Q8N5R6-6	.	N	327;124	ENSP00000325012:Y327N;ENSP00000381795:Y124N	ENSP00000325012:Y327N	Y	+	1	0	CCDC33	72346122	0.874000	0.30092	0.691000	0.30163	0.979000	0.70002	3.910000	0.56371	1.781000	0.52344	0.379000	0.24179	TAC	.	.		0.493	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791	
TMC3	342125	hgsc.bcm.edu	37	15	81635637	81635637	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr15:81635637T>A	ENST00000359440.5	-	15	1832	c.1697A>T	c.(1696-1698)tAc>tTc	p.Y566F	RP11-761I4.3_ENST00000559277.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.Y567F|RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TCCTTGGTTGTAGACTAAATG	0.353																																					p.Y566F		Atlas-SNP	.											.	TMC3	112	.	0			c.A1697T						.						117.0	116.0	116.0					15																	81635637		1847	4097	5944	SO:0001583	missense	342125	exon15			TGGTTGTAGACTA	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.1697A>T	chr15.hg19:g.81635637T>A	ENSP00000352413:p.Tyr566Phe	51.0	0.0		112.0	37.0	NM_001080532		Missense_Mutation	SNP	ENST00000359440.5	hg19	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.931068	0.52866	.	.	ENSG00000188869	ENST00000359440	T	0.68765	-0.35	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.68924	0.3054	N	0.25031	0.7	0.58432	D	0.999996	D;P	0.76494	0.999;0.943	D;P	0.72982	0.979;0.803	T	0.65569	-0.6136	10	0.22109	T	0.4	-22.9581	14.7994	0.69903	0.0:0.0:0.0:1.0	.	566;566	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	F	566	ENSP00000352413:Y566F	ENSP00000352413:Y566F	Y	-	2	0	TMC3	79422692	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.539000	0.60657	2.136000	0.66102	0.533000	0.62120	TAC	.	.		0.353	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
CCNF	899	hgsc.bcm.edu	37	16	2483037	2483037	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:2483037C>A	ENST00000397066.4	+	3	335	c.247C>A	c.(247-249)Ccg>Acg	p.P83T		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	83					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GGAGCTGTGGCCGTCTCCAGG	0.592																																					p.P83T		Atlas-SNP	.											.	CCNF	110	.	0			c.C247A						.						75.0	68.0	70.0					16																	2483037		2198	4300	6498	SO:0001583	missense	899	exon3			CTGTGGCCGTCTC	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.247C>A	chr16.hg19:g.2483037C>A	ENSP00000380256:p.Pro83Thr	50.0	0.0		49.0	11.0	NM_001761	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	hg19	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985295	0.93044	.	.	ENSG00000162063	ENST00000397066	T	0.21543	2.0	5.29	5.29	0.74685	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50608	-0.8808	10	0.87932	D	0	-17.4443	17.872	0.88813	0.0:1.0:0.0:0.0	.	83	P41002	CCNF_HUMAN	T	83	ENSP00000380256:P83T	ENSP00000380256:P83T	P	+	1	0	CCNF	2423038	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.325000	0.79124	2.619000	0.88677	0.655000	0.94253	CCG	.	.		0.592	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
GDE1	51573	hgsc.bcm.edu	37	16	19514862	19514862	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:19514862T>G	ENST00000353258.3	-	6	1106	c.926A>C	c.(925-927)tAc>tCc	p.Y309S	CTA-363E6.7_ENST00000569345.1_RNA	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	309	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						GGATTCGTAGTAACTCTTTTC	0.463											OREG0023659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y309S		Atlas-SNP	.											.	GDE1	31	.	0			c.A926C						.						163.0	143.0	150.0					16																	19514862		2197	4300	6497	SO:0001583	missense	51573	exon6			TCGTAGTAACTCT		CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.926A>C	chr16.hg19:g.19514862T>G	ENSP00000261386:p.Tyr309Ser	55.0	0.0	733	94.0	13.0	NM_016641	O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	ENST00000353258.3	hg19	CCDS10578.1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.799746	0.70567	.	.	ENSG00000006007	ENST00000353258	T	0.27720	1.65	6.08	3.63	0.41609	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.166743	0.56097	D	0.000038	T	0.51058	0.1652	M	0.80422	2.495	0.58432	D	0.999999	D	0.69078	0.997	D	0.67382	0.951	T	0.49808	-0.8900	10	0.34782	T	0.22	-20.1303	9.3852	0.38338	0.1172:0.0651:0.0:0.8176	.	309	Q9NZC3	GDE1_HUMAN	S	309	ENSP00000261386:Y309S	ENSP00000261386:Y309S	Y	-	2	0	GDE1	19422363	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.939000	0.63526	1.111000	0.41721	0.533000	0.62120	TAC	.	.		0.463	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641	
N4BP1	9683	hgsc.bcm.edu	37	16	48596122	48596122	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:48596122T>G	ENST00000262384.3	-	2	668	c.432A>C	c.(430-432)aaA>aaC	p.K144N	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	144					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GTAGGTTCTCTTTATTTTCAA	0.408																																					p.K144N		Atlas-SNP	.											.	N4BP1	121	.	0			c.A432C						.						85.0	84.0	85.0					16																	48596122		1865	4107	5972	SO:0001583	missense	9683	exon2			GTTCTCTTTATTT	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.432A>C	chr16.hg19:g.48596122T>G	ENSP00000262384:p.Lys144Asn	59.0	0.0		81.0	15.0	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	hg19	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	T	3.154	-0.173589	0.06421	.	.	ENSG00000102921	ENST00000262384	T	0.40756	1.02	5.45	-7.86	0.01187	.	0.189315	0.56097	N	0.000037	T	0.07007	0.0178	N	0.00788	-1.185	0.25293	N	0.989342	B	0.02656	0.0	B	0.01281	0.0	T	0.31194	-0.9952	10	0.02654	T	1	-6.9171	3.392	0.07293	0.3683:0.1854:0.3513:0.095	.	144	O75113	N4BP1_HUMAN	N	144	ENSP00000262384:K144N	ENSP00000262384:K144N	K	-	3	2	N4BP1	47153623	0.946000	0.32159	0.018000	0.16275	0.972000	0.66771	0.019000	0.13444	-1.614000	0.01575	-0.339000	0.08088	AAA	.	.		0.408	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
HEATR3	55027	hgsc.bcm.edu	37	16	50100277	50100277	+	Splice_Site	SNP	G	G	T	rs532568579		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:50100277G>T	ENST00000299192.7	+	2	329		c.e2-1		RP11-429P3.3_ENST00000568130.2_RNA|HEATR3_ENST00000285767.4_Intron	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3											cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CTCATCCGCAGCTCCAGCACC	0.741																																					.		Atlas-SNP	.											.	HEATR3	59	.	0			c.139-1G>T						.						8.0	11.0	10.0					16																	50100277		2008	3991	5999	SO:0001630	splice_region_variant	55027	exon2			TCCGCAGCTCCAG	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.139-1G>T	chr16.hg19:g.50100277G>T		38.0	0.0		45.0	16.0	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Splice_Site	SNP	ENST00000299192.7	hg19	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948180	0.73787	.	.	ENSG00000155393	ENST00000299192	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5296	0.84354	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HEATR3	48657778	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	8.261000	0.89860	2.298000	0.77334	0.462000	0.41574	.	.	.		0.741	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	Intron
CHD9	80205	hgsc.bcm.edu	37	16	53340154	53340154	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:53340154A>T	ENST00000398510.3	+	31	6712	c.6625A>T	c.(6625-6627)Act>Tct	p.T2209S	CHD9_ENST00000566029.1_Missense_Mutation_p.T2209S|CHD9_ENST00000564845.1_Missense_Mutation_p.T2209S|CHD9_ENST00000447540.1_Missense_Mutation_p.T2210S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2209					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AGCAGAAAGTACTACTCACAT	0.328																																					p.T2209S		Atlas-SNP	.											.	CHD9	203	.	0			c.A6625T						.						72.0	69.0	70.0					16																	53340154		1848	4095	5943	SO:0001583	missense	80205	exon32			GAAAGTACTACTC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6625A>T	chr16.hg19:g.53340154A>T	ENSP00000381522:p.Thr2209Ser	113.0	0.0		188.0	53.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	hg19		.	.	.	.	.	.	.	.	.	.	A	10.08	1.251232	0.22880	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.85629	-1.94;-2.01	5.88	2.27	0.28462	.	0.093544	0.46442	D	0.000286	T	0.72748	0.3499	N	0.12182	0.205	0.23366	N	0.997822	B;P;B;P;P	0.46220	0.384;0.801;0.03;0.836;0.874	B;B;B;P;P	0.50440	0.127;0.438;0.022;0.52;0.641	T	0.64279	-0.6445	10	0.09590	T	0.72	-2.211	5.3982	0.16281	0.5837:0.1379:0.2784:0.0	.	275;2209;2210;2209;2209	C9JR69;B7ZML1;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;.;CHD9_HUMAN;.	S	2210;2209;275	ENSP00000396345:T2210S;ENSP00000381522:T2209S	ENSP00000381522:T2209S	T	+	1	0	CHD9	51897655	0.057000	0.20700	0.987000	0.45799	0.459000	0.32528	0.253000	0.18296	0.487000	0.27698	0.528000	0.53228	ACT	.	.		0.328	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53639514	53639514	+	Silent	SNP	G	G	C	rs538306358		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:53639514G>C	ENST00000379925.3	-	26	3764	c.3714C>G	c.(3712-3714)acC>acG	p.T1238T	RPGRIP1L_ENST00000262135.4_Silent_p.T1158T|RPGRIP1L_ENST00000564374.1_Silent_p.T1192T|RPGRIP1L_ENST00000563746.1_Silent_p.T1204T	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	1238					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CACTGACCACGGTGAAGCGAA	0.547																																					p.T1238T		Atlas-SNP	.											.	RPGRIP1L	118	.	0			c.C3714G						.						95.0	77.0	83.0					16																	53639514		2198	4300	6498	SO:0001819	synonymous_variant	23322	exon26			GACCACGGTGAAG		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.3714C>G	chr16.hg19:g.53639514G>C		28.0	0.0		36.0	9.0	NM_015272	A0PJ88|Q9Y2K8	Silent	SNP	ENST00000379925.3	hg19	CCDS32447.1																																																																																			.	.		0.547	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
PSMB10	5699	hgsc.bcm.edu	37	16	67969964	67969964	+	Silent	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:67969964T>A	ENST00000358514.4	-	4	622	c.285A>T	c.(283-285)acA>acT	p.T95T	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	95					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	CCACCATCCGTGTGGTCATCT	0.672																																					p.T95T		Atlas-SNP	.											.	PSMB10	19	.	0			c.A285T						.						33.0	37.0	36.0					16																	67969964		2195	4285	6480	SO:0001819	synonymous_variant	5699	exon4			CATCCGTGTGGTC	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.285A>T	chr16.hg19:g.67969964T>A		64.0	0.0		43.0	16.0	NM_002801	B2R5J4|Q5U098	Silent	SNP	ENST00000358514.4	hg19	CCDS10853.1																																																																																			.	.		0.672	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801	
SF3B3	23450	hgsc.bcm.edu	37	16	70597888	70597888	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:70597888A>T	ENST00000302516.5	+	18	2609	c.2398A>T	c.(2398-2400)Att>Ttt	p.I800F		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	800					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CCTTATTATCATTGAAACGGA	0.458																																					p.I800F		Atlas-SNP	.											.	SF3B3	99	.	0			c.A2398T						.						157.0	136.0	143.0					16																	70597888		2198	4300	6498	SO:0001583	missense	23450	exon18			ATTATCATTGAAA	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2398A>T	chr16.hg19:g.70597888A>T	ENSP00000305790:p.Ile800Phe	84.0	0.0		103.0	14.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	hg19	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.502342	0.85176	.	.	ENSG00000189091	ENST00000302516	T	0.17854	2.25	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.32285	0.0824	M	0.81942	2.565	0.80722	D	1	P	0.45176	0.852	P	0.47981	0.563	T	0.08472	-1.0720	10	0.33940	T	0.23	-16.5354	15.6284	0.76882	1.0:0.0:0.0:0.0	.	800	Q15393	SF3B3_HUMAN	F	800	ENSP00000305790:I800F	ENSP00000305790:I800F	I	+	1	0	SF3B3	69155389	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.229000	0.95273	2.155000	0.67459	0.533000	0.62120	ATT	.	.		0.458	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
ZNRF1	84937	hgsc.bcm.edu	37	16	75033939	75033939	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:75033939C>A	ENST00000335325.4	+	1	1012	c.370C>A	c.(370-372)Ctg>Atg	p.L124M	WDR59_ENST00000562331.1_5'Flank|ZNRF1_ENST00000567962.1_Missense_Mutation_p.L124M|ZNRF1_ENST00000320619.6_Missense_Mutation_p.L124M|ZNRF1_ENST00000566250.1_Missense_Mutation_p.L124M	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase	124					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)	1						CCGAGCCTCGCTGGCGGATGC	0.667																																					p.L124M		Atlas-SNP	.											.	ZNRF1	6	.	0			c.C370A						.						31.0	30.0	31.0					16																	75033939		2197	4299	6496	SO:0001583	missense	84937	exon1			GCCTCGCTGGCGG	AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606	ENST00000335325.4:c.370C>A	chr16.hg19:g.75033939C>A	ENSP00000335091:p.Leu124Met	72.0	0.0		61.0	24.0	NM_032268	D3DUJ9|Q9H083	Missense_Mutation	SNP	ENST00000335325.4	hg19	CCDS10912.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953752	0.53293	.	.	ENSG00000186187	ENST00000320619;ENST00000335325	.	.	.	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000016	T	0.68155	0.2970	L	0.40543	1.245	0.48571	D	0.999671	D;P;D	0.62365	0.991;0.7;0.984	D;B;D	0.75484	0.986;0.368;0.969	T	0.64879	-0.6303	9	0.35671	T	0.21	-7.6933	17.2525	0.87046	0.0:1.0:0.0:0.0	.	124;124;124	B4DG67;Q8ND25-2;Q8ND25	.;.;ZNRF1_HUMAN	M	124	.	ENSP00000323362:L124M	L	+	1	2	ZNRF1	73591440	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.772000	0.55325	2.701000	0.92244	0.650000	0.86243	CTG	.	.		0.667	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269020.2		
KIAA0513	9764	hgsc.bcm.edu	37	16	85112566	85112566	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:85112566G>T	ENST00000566428.1	+	8	1490	c.859G>T	c.(859-861)Gag>Tag	p.E287*	KIAA0513_ENST00000567328.1_Nonsense_Mutation_p.E287*|KIAA0513_ENST00000538274.1_Nonsense_Mutation_p.E287*|KIAA0513_ENST00000258180.3_Nonsense_Mutation_p.E287*			O60268	K0513_HUMAN	KIAA0513	287						cytoplasm (GO:0005737)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(9)|pancreas(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.234)		AAAGAAGGGGGAGAAGATCTA	0.607																																					p.E287X		Atlas-SNP	.											.	KIAA0513	43	.	0			c.G859T						.						117.0	100.0	106.0					16																	85112566		2198	4300	6498	SO:0001587	stop_gained	9764	exon8			AAGGGGGAGAAGA	AB011085	CCDS32499.1, CCDS67091.1, CCDS73919.1	16q24.1	2012-11-29			ENSG00000135709	ENSG00000135709			29058	protein-coding gene	gene with protein product		611675				9628581	Standard	XM_005256265		Approved		uc002fiu.3	O60268	OTTHUMG00000176597	ENST00000566428.1:c.859G>T	chr16.hg19:g.85112566G>T	ENSP00000457408:p.Glu287*	62.0	0.0		58.0	24.0	NM_014732	B4DSS5|D3DUM2|Q8N6G0	Nonsense_Mutation	SNP	ENST00000566428.1	hg19	CCDS32499.1	.	.	.	.	.	.	.	.	.	.	G	40	8.242504	0.98722	.	.	ENSG00000135709	ENST00000538274;ENST00000258180	.	.	.	5.62	5.62	0.85841	.	0.048418	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-7.6844	18.2538	0.90012	0.0:0.0:1.0:0.0	.	.	.	.	X	287	.	ENSP00000258180:E287X	E	+	1	0	KIAA0513	83670067	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.290000	0.78711	2.644000	0.89710	0.561000	0.74099	GAG	.	.		0.607	KIAA0513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432736.1	NM_014732	
ZFPM1	161882	hgsc.bcm.edu	37	16	88555560	88555560	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:88555560A>G	ENST00000319555.3	+	3	589	c.267A>G	c.(265-267)ccA>ccG	p.P89P	ZFPM1_ENST00000569086.1_3'UTR	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	89					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGAGCGGGCCAGGTAACCACG	0.731																																					p.P89P	Pancreas(49;850 1106 29641 32847 38344)	Atlas-SNP	.											.	ZFPM1	32	.	0			c.A267G						.						38.0	31.0	33.0					16																	88555560		2172	4252	6424	SO:0001630	splice_region_variant	161882	exon3			CGGGCCAGGTAAC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.268+1A>G	chr16.hg19:g.88555560A>G		52.0	0.0		52.0	14.0	NM_153813		Silent	SNP	ENST00000319555.3	hg19	CCDS32502.1																																																																																			.	.		0.731	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		Silent
MVD	4597	hgsc.bcm.edu	37	16	88723903	88723903	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:88723903A>G	ENST00000301012.3	-	4	373	c.344T>C	c.(343-345)gTg>gCg	p.V115A	MVD_ENST00000568709.1_5'UTR	NM_002461.1	NP_002452.1	P53602	MVD1_HUMAN	mevalonate (diphospho) decarboxylase	115					cellular protein metabolic process (GO:0044267)|cholesterol biosynthetic process (GO:0006695)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|positive regulation of cell proliferation (GO:0008284)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|diphosphomevalonate decarboxylase activity (GO:0004163)|Hsp70 protein binding (GO:0030544)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(1)|lung(7)|ovary(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAAGTTGTTCACCGATGCCAC	0.682																																					p.V115A		Atlas-SNP	.											.	MVD	27	.	0			c.T344C						.						39.0	33.0	35.0					16																	88723903		2198	4299	6497	SO:0001583	missense	4597	exon4			TTGTTCACCGATG	U49260	CCDS10968.1	16q24.3	2010-04-29			ENSG00000167508	ENSG00000167508	4.1.1.33		7529	protein-coding gene	gene with protein product	"""mevalonate pyrophosphate decarboxylase"""	603236				8626466	Standard	NM_002461		Approved	MPD	uc002flg.1	P53602	OTTHUMG00000137865	ENST00000301012.3:c.344T>C	chr16.hg19:g.88723903A>G	ENSP00000301012:p.Val115Ala	170.0	0.0		173.0	8.0	NM_002461	Q53Y65	Missense_Mutation	SNP	ENST00000301012.3	hg19	CCDS10968.1	.	.	.	.	.	.	.	.	.	.	A	8.701	0.909655	0.17833	.	.	ENSG00000167508	ENST00000301012	D	0.85088	-1.94	5.18	-4.06	0.03986	Ribosomal protein S5 domain 2-type fold (1);GHMP kinase (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.667620	0.15084	N	0.281510	T	0.74152	0.3679	L	0.39514	1.22	0.42796	D	0.993917	B	0.15719	0.014	B	0.18871	0.023	T	0.50320	-0.8842	10	0.22109	T	0.4	-11.4073	10.1365	0.42710	0.2498:0.0:0.0636:0.6866	.	115	P53602	MVD1_HUMAN	A	115	ENSP00000301012:V115A	ENSP00000301012:V115A	V	-	2	0	MVD	87251404	0.067000	0.21026	0.086000	0.20670	0.118000	0.20060	0.451000	0.21779	-1.075000	0.03129	-1.546000	0.00904	GTG	.	.		0.682	MVD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269547.2	NM_002461	
ANKRD11	29123	hgsc.bcm.edu	37	16	89349878	89349878	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr16:89349878T>C	ENST00000301030.4	-	9	3532	c.3072A>G	c.(3070-3072)aaA>aaG	p.K1024K	ANKRD11_ENST00000378330.2_Silent_p.K1024K	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1024	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		ATCTTTCTGGTTTTGTCTTCT	0.453																																					p.K1024K		Atlas-SNP	.											.	ANKRD11	195	.	0			c.A3072G						.						155.0	152.0	153.0					16																	89349878		2198	4300	6498	SO:0001819	synonymous_variant	29123	exon9			TTCTGGTTTTGTC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3072A>G	chr16.hg19:g.89349878T>C		33.0	0.0		55.0	15.0	NM_001256183	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.487664	0.01018	.	.	ENSG00000167522	ENST00000330736	.	.	.	4.72	-7.07	0.01563	.	.	.	.	.	T	0.43166	0.1235	.	.	.	0.36447	D	0.865824	.	.	.	.	.	.	T	0.45145	-0.9281	5	0.14252	T	0.57	.	11.2506	0.49024	0.0:0.602:0.1003:0.2977	.	.	.	.	S	575	.	ENSP00000330815:N575S	N	-	2	0	ANKRD11	87877379	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.058000	0.11750	-1.657000	0.01492	-0.912000	0.02778	AAC	.	.		0.453	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ASGR1	432	hgsc.bcm.edu	37	17	7077382	7077382	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:7077382A>C	ENST00000269299.3	-	8	998	c.599T>G	c.(598-600)tTt>tGt	p.F200C	ASGR1_ENST00000574388.1_Missense_Mutation_p.F161C|ASGR1_ENST00000380920.4_Missense_Mutation_p.F99C|ASGR1_ENST00000572879.1_Missense_Mutation_p.F60C	NM_001197216.2|NM_001671.4	NP_001184145.1|NP_001662.1	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	200	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular response to extracellular stimulus (GO:0031668)|receptor-mediated endocytosis (GO:0006898)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	10						GTGCTGGACAAATTTCTGAGG	0.632																																					p.F200C		Atlas-SNP	.											.	ASGR1	20	.	0			c.T599G						.						111.0	113.0	112.0					17																	7077382		2203	4300	6503	SO:0001583	missense	432	exon8			TGGACAAATTTCT		CCDS11089.1, CCDS56017.1	17p13-p11	2011-08-30			ENSG00000141505	ENSG00000141505		"""C-type lectin domain containing"""	742	protein-coding gene	gene with protein product		108360					Standard	NM_001671		Approved	CLEC4H1	uc002ges.4	P07306	OTTHUMG00000102159	ENST00000269299.3:c.599T>G	chr17.hg19:g.7077382A>C	ENSP00000269299:p.Phe200Cys	80.0	0.0		86.0	30.0	NM_001671	I3L1X1	Missense_Mutation	SNP	ENST00000269299.3	hg19	CCDS11089.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.191804	0.38707	.	.	ENSG00000141505	ENST00000269299;ENST00000380920	T	0.26067	1.76	4.46	3.33	0.38152	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.125081	0.36854	N	0.002376	T	0.63593	0.2524	H	0.98612	4.28	0.21184	N	0.999765	D	0.89917	1.0	D	0.97110	1.0	T	0.61922	-0.6963	10	0.87932	D	0	.	8.6047	0.33767	0.828:0.0:0.0:0.172	.	200	P07306	ASGR1_HUMAN	C	200;161	ENSP00000269299:F200C	ENSP00000269299:F200C	F	-	2	0	ASGR1	7018106	0.419000	0.25449	0.230000	0.23976	0.441000	0.31987	1.535000	0.36061	0.805000	0.34159	0.165000	0.16767	TTT	.	.		0.632	ASGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220004.3	NM_001671	
SLC2A4	6517	hgsc.bcm.edu	37	17	7187920	7187920	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:7187920C>G	ENST00000317370.8	+	7	1112	c.844C>G	c.(844-846)Cgt>Ggt	p.R282G	RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000571308.1_Missense_Mutation_p.R282G|SLC2A4_ENST00000424875.2_Missense_Mutation_p.R272G	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	282					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						CCTGGGCAGCCGTACCCACCG	0.637																																					p.R282G		Atlas-SNP	.											SLC2A4,caecum,carcinoma,0,1	SLC2A4	44	.	0			c.C844G						.						37.0	42.0	40.0					17																	7187920		2200	4300	6500	SO:0001583	missense	6517	exon7			GGCAGCCGTACCC	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.844C>G	chr17.hg19:g.7187920C>G	ENSP00000320935:p.Arg282Gly	78.0	0.0		86.0	23.0	NM_001042	Q05BQ3|Q14CX2	Missense_Mutation	SNP	ENST00000317370.8	hg19	CCDS11097.1	.	.	.	.	.	.	.	.	.	.	C	9.548	1.115161	0.20795	.	.	ENSG00000181856	ENST00000317370;ENST00000424875	T;T	0.74947	-0.89;-0.89	4.82	3.84	0.44239	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.394340	0.26045	N	0.026668	T	0.63698	0.2533	L	0.38733	1.17	0.27305	N	0.95747	B;B	0.15473	0.0;0.013	B;B	0.18561	0.007;0.022	T	0.58405	-0.7642	10	0.51188	T	0.08	.	10.14	0.42730	0.3638:0.6362:0.0:0.0	.	282;272	P14672;F5H081	GTR4_HUMAN;.	G	282;272	ENSP00000320935:R282G;ENSP00000396887:R272G	ENSP00000320935:R282G	R	+	1	0	SLC2A4	7128644	0.005000	0.15991	0.662000	0.29724	0.538000	0.34931	0.865000	0.27940	1.239000	0.43787	-0.182000	0.12963	CGT	.	.		0.637	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3		
MYH10	4628	hgsc.bcm.edu	37	17	8416885	8416885	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:8416885G>T	ENST00000269243.4	-	21	2761	c.2623C>A	c.(2623-2625)Ctg>Atg	p.L875M	MYH10_ENST00000396239.1_Missense_Mutation_p.L896M|RNU7-43P_ENST00000516554.1_RNA|MYH10_ENST00000379980.4_Missense_Mutation_p.L891M|MYH10_ENST00000360416.3_Missense_Mutation_p.L906M	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	875					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						ATCTCCTCCAGCTCTCCTTCC	0.537																																					p.L906M		Atlas-SNP	.											.	MYH10	148	.	0			c.C2716A						.						185.0	137.0	153.0					17																	8416885		2203	4300	6503	SO:0001583	missense	4628	exon23			CCTCCAGCTCTCC	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.2623C>A	chr17.hg19:g.8416885G>T	ENSP00000269243:p.Leu875Met	21.0	0.0		44.0	5.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	hg19	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685001	0.68157	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	M	0.68728	2.09	0.51233	D	0.999917	P;P;P	0.35600	0.499;0.511;0.499	B;B;B	0.38755	0.164;0.281;0.164	T	0.79006	-0.1979	10	0.62326	D	0.03	.	18.7586	0.91840	0.0:0.0:1.0:0.0	.	884;906;875	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	M	875;906;896;891	ENSP00000269243:L875M;ENSP00000353590:L906M;ENSP00000379539:L896M;ENSP00000369315:L891M	ENSP00000269243:L875M	L	-	1	2	MYH10	8357610	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	6.559000	0.73946	2.649000	0.89929	0.561000	0.74099	CTG	.	.		0.537	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MYH3	4621	hgsc.bcm.edu	37	17	10543714	10543714	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:10543714G>T	ENST00000583535.1	-	21	2449	c.2362C>A	c.(2362-2364)Cgg>Agg	p.R788R	MYH3_ENST00000226209.7_Silent_p.R788R	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	788	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GCTTGTGTCCGGGTGATTAGT	0.547																																					p.R788R		Atlas-SNP	.											.	MYH3	227	.	0			c.C2362A						.						112.0	109.0	110.0					17																	10543714		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon21			GTGTCCGGGTGAT		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2362C>A	chr17.hg19:g.10543714G>T		43.0	0.0		52.0	19.0	NM_002470	Q15492	Silent	SNP	ENST00000583535.1	hg19	CCDS11157.1																																																																																			.	.		0.547	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
NT5M	56953	hgsc.bcm.edu	37	17	17206959	17206959	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:17206959G>T	ENST00000389022.4	+	1	311	c.95G>T	c.(94-96)gGa>gTa	p.G32V		NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	32					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						ggcctggcgggaggccgcgcc	0.766																																					p.G32V		Atlas-SNP	.											.	NT5M	17	.	0			c.G95T						.						6.0	6.0	6.0					17																	17206959		1947	3926	5873	SO:0001583	missense	56953	exon1			TGGCGGGAGGCCG	AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.95G>T	chr17.hg19:g.17206959G>T	ENSP00000373674:p.Gly32Val	56.0	0.0		60.0	21.0	NM_020201		Missense_Mutation	SNP	ENST00000389022.4	hg19	CCDS32581.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490979	0.26774	.	.	ENSG00000205309	ENST00000446264;ENST00000389022	T	0.41758	0.99	3.05	0.898	0.19264	.	1.004140	0.08029	N	0.993176	T	0.20536	0.0494	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.33171	0.278;0.278;0.4	B;B;B	0.34452	0.089;0.089;0.183	T	0.24799	-1.0150	10	0.15499	T	0.54	-1.9385	5.6994	0.17873	0.1224:0.4236:0.454:0.0	.	32;32;32	Q2I378;Q9NPB1;F6S3X3	.;NT5M_HUMAN;.	V	32	ENSP00000373674:G32V	ENSP00000373674:G32V	G	+	2	0	NT5M	17147684	1.000000	0.71417	0.046000	0.18839	0.376000	0.30014	2.221000	0.42917	0.126000	0.18424	0.313000	0.20887	GGA	.	.		0.766	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1		
MAP2K3	5606	hgsc.bcm.edu	37	17	21203863	21203863	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:21203863G>T	ENST00000342679.4	+	4	421	c.172G>T	c.(172-174)Gag>Tag	p.E58*	MAP2K3_ENST00000361818.5_Nonsense_Mutation_p.E29*|MAP2K3_ENST00000316920.6_Nonsense_Mutation_p.E29*	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	58					activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAAGAACTTTGAGGTGGAGGC	0.582																																					p.E58X		Atlas-SNP	.											.	MAP2K3	135	.	0			c.G172T						.						50.0	45.0	47.0					17																	21203863		2201	4299	6500	SO:0001587	stop_gained	5606	exon4			AACTTTGAGGTGG	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.172G>T	chr17.hg19:g.21203863G>T	ENSP00000345083:p.Glu58*	76.0	0.0		89.0	19.0	NM_145109	B3KSK7|Q99441|Q9UE71|Q9UE72	Nonsense_Mutation	SNP	ENST00000342679.4	hg19	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	G	35	5.516985	0.96416	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	.	.	.	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-49.5232	19.3291	0.94278	0.0:0.0:1.0:0.0	.	.	.	.	X	58;29;29;29;62	.	ENSP00000319139:E62X	E	+	1	0	MAP2K3	21144456	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.760000	0.98935	2.582000	0.87167	0.655000	0.94253	GAG	.	.		0.582	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
TADA2A	6871	hgsc.bcm.edu	37	17	35804827	35804827	+	Silent	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:35804827G>A	ENST00000394395.2	+	8	734	c.561G>A	c.(559-561)ttG>ttA	p.L187L	TADA2A_ENST00000225396.6_Silent_p.L187L|TADA2A_ENST00000586023.1_Silent_p.L187L|TADA2A_ENST00000417170.1_Silent_p.L187L|TADA2A_ENST00000591992.1_3'UTR	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	187					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						AATGGGACTTGAGAGACATTG	0.403																																					p.L187L		Atlas-SNP	.											.	TADA2A	91	.	0			c.G561A						.						237.0	226.0	230.0					17																	35804827		2203	4300	6503	SO:0001819	synonymous_variant	6871	exon8			GGACTTGAGAGAC	AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.561G>A	chr17.hg19:g.35804827G>A		87.0	0.0		105.0	32.0	NM_001488	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Silent	SNP	ENST00000394395.2	hg19	CCDS11319.1																																																																																			.	.		0.403	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256677.3	NM_001488	
HEXIM1	10614	hgsc.bcm.edu	37	17	43226702	43226702	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:43226702T>A	ENST00000332499.2	+	1	2019	c.145T>A	c.(145-147)Tcg>Acg	p.S49T	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	49					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TAGGTGGCAATCGAGAGCGTT	0.662											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S49T		Atlas-SNP	.											.	HEXIM1	25	.	0			c.T145A						.						46.0	49.0	48.0					17																	43226702		2203	4300	6503	SO:0001583	missense	10614	exon1			TGGCAATCGAGAG	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.145T>A	chr17.hg19:g.43226702T>A	ENSP00000328773:p.Ser49Thr	197.0	0.0	914	193.0	54.0	NM_006460	B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	hg19	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.523821	0.44866	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.49	3.39	0.38822	.	0.701221	0.10831	U	0.629313	T	0.32971	0.0847	L	0.44542	1.39	0.27475	N	0.952763	B	0.30281	0.275	B	0.24701	0.055	T	0.19289	-1.0310	9	0.40728	T	0.16	-3.2714	7.9836	0.30198	0.0:0.0:0.2079:0.7921	.	49	O94992	HEXI1_HUMAN	T	49	.	ENSP00000328773:S49T	S	+	1	0	HEXIM1	40582485	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.364000	0.34171	0.737000	0.32582	0.533000	0.62120	TCG	.	.		0.662	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460	
MED13	9969	hgsc.bcm.edu	37	17	60112898	60112898	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:60112898T>C	ENST00000397786.2	-	4	618	c.542A>G	c.(541-543)aAc>aGc	p.N181S	Y_RNA_ENST00000363972.1_RNA	NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	181					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TTGATGTTGGTTAATTTCCAC	0.358																																					p.N181S		Atlas-SNP	.											.	MED13	181	.	0			c.A542G						.						112.0	107.0	109.0					17																	60112898		1895	4141	6036	SO:0001583	missense	9969	exon4			TGTTGGTTAATTT	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.542A>G	chr17.hg19:g.60112898T>C	ENSP00000380888:p.Asn181Ser	41.0	0.0		84.0	6.0	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	hg19	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	T	9.127	1.010362	0.19277	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.75938	-0.98	5.28	5.28	0.74379	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.047299	0.85682	D	0.000000	T	0.66268	0.2772	L	0.60455	1.87	0.50632	D	0.99988	B	0.11235	0.004	B	0.14578	0.011	T	0.59144	-0.7509	10	0.09843	T	0.71	-19.484	10.2956	0.43623	0.0:0.0842:0.0:0.9158	.	181	Q9UHV7	MED13_HUMAN	S	181;180	ENSP00000380888:N181S	ENSP00000262436:N180S	N	-	2	0	MED13	57467680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.498000	0.60373	2.119000	0.64992	0.455000	0.32223	AAC	.	.		0.358	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
TACO1	51204	hgsc.bcm.edu	37	17	61678596	61678596	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:61678596T>C	ENST00000258975.6	+	1	366	c.154T>C	c.(154-156)Ttt>Ctt	p.F52L		NM_016360.3	NP_057444.2	Q9BSH4	TACO1_HUMAN	translational activator of mitochondrially encoded cytochrome c oxidase I	52					regulation of translation (GO:0006417)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)	4						GACGCTGCACTTTACCGCGGC	0.701																																					p.F52L		Atlas-SNP	.											.	TACO1	13	.	0			c.T154C						.						14.0	12.0	13.0					17																	61678596		2183	4262	6445	SO:0001583	missense	51204	exon1			CTGCACTTTACCG	BC005049	CCDS11640.1	17q23.3	2009-06-26	2009-06-26	2009-06-26		ENSG00000136463			24316	protein-coding gene	gene with protein product		612958	"""coiled-coil domain containing 44"""	CCDC44		19503089	Standard	NM_016360		Approved		uc002jbd.3	Q9BSH4		ENST00000258975.6:c.154T>C	chr17.hg19:g.61678596T>C	ENSP00000258975:p.Phe52Leu	81.0	0.0		81.0	17.0	NM_016360	B2RD21|Q8N3N6|Q9UI60	Missense_Mutation	SNP	ENST00000258975.6	hg19	CCDS11640.1	.	.	.	.	.	.	.	.	.	.	T	0.813	-0.751410	0.03041	.	.	ENSG00000136463	ENST00000258975	T	0.38887	1.11	5.29	-0.2	0.13216	.	0.669509	0.15039	N	0.284001	T	0.10508	0.0257	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30679	-0.9970	10	0.02654	T	1	-4.1079	2.7245	0.05210	0.1222:0.3776:0.3218:0.1784	.	52	Q9BSH4	TACO1_HUMAN	L	52	ENSP00000258975:F52L	ENSP00000258975:F52L	F	+	1	0	TACO1	59032328	0.893000	0.30496	0.673000	0.29887	0.048000	0.14542	0.090000	0.15025	0.125000	0.18397	-0.252000	0.11476	TTT	.	.		0.701	TACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443862.1	NM_016360	
MRPS7	51081	hgsc.bcm.edu	37	17	73258604	73258604	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:73258604A>G	ENST00000245539.6	+	2	337	c.110A>G	c.(109-111)tAt>tGt	p.Y37C	GGA3_ENST00000582717.1_5'Flank|MRPS7_ENST00000579002.1_Missense_Mutation_p.Y66C|GGA3_ENST00000582486.1_5'Flank|GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000537686.1_5'Flank|GGA3_ENST00000538886.1_5'Flank|GGA3_ENST00000578348.1_5'Flank|MRPS7_ENST00000579761.1_Missense_Mutation_p.Y37C|GGA3_ENST00000351904.7_5'Flank|GGA3_ENST00000245541.6_5'Flank	NM_015971.3	NP_057055.2	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7	37					translation (GO:0006412)	cytosolic small ribosomal subunit (GO:0022627)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)	6	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TGGAGCCGCTATAGTCCTGAA	0.498																																					p.Y37C		Atlas-SNP	.											.	MRPS7	19	.	0			c.A110G						.						141.0	145.0	144.0					17																	73258604		2203	4300	6503	SO:0001583	missense	51081	exon2			GCCGCTATAGTCC	AB051348	CCDS11718.1	17q25.1	2012-09-13				ENSG00000125445		"""Mitochondrial ribosomal proteins / small subunits"""	14499	protein-coding gene	gene with protein product		611974					Standard	NM_015971		Approved	MRP-S, RP-S7, RPMS7	uc002jnm.4	Q9Y2R9		ENST00000245539.6:c.110A>G	chr17.hg19:g.73258604A>G	ENSP00000245539:p.Tyr37Cys	58.0	0.0		80.0	23.0	NM_015971	B2R9N5|Q53GD6	Missense_Mutation	SNP	ENST00000245539.6	hg19	CCDS11718.1	.	.	.	.	.	.	.	.	.	.	A	12.40	1.925564	0.34002	.	.	ENSG00000125445	ENST00000245539	T	0.52295	0.67	5.57	5.57	0.84162	Ribosomal protein S7 domain (2);	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.71892	-0.4455	10	0.87932	D	0	-13.2234	15.7354	0.77839	1.0:0.0:0.0:0.0	.	37	Q9Y2R9	RT07_HUMAN	C	37	ENSP00000245539:Y37C	ENSP00000245539:Y37C	Y	+	2	0	MRPS7	70770199	1.000000	0.71417	0.936000	0.37596	0.308000	0.27856	9.099000	0.94207	2.122000	0.65172	0.528000	0.53228	TAT	.	.		0.498	MRPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446666.1	NM_015971	
TRIM65	201292	hgsc.bcm.edu	37	17	73892831	73892831	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr17:73892831T>G	ENST00000269383.3	-	1	253	c.188A>C	c.(187-189)aAc>aCc	p.N63T	RP11-552F3.10_ENST00000587267.1_RNA	NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	63						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGGGCCACGTTGCGGCGCAG	0.786																																					p.N63T		Atlas-SNP	.											.	TRIM65	23	.	0			c.A188C						.						2.0	2.0	2.0					17																	73892831		1468	3073	4541	SO:0001583	missense	201292	exon1			GCCACGTTGCGGC	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.188A>C	chr17.hg19:g.73892831T>G	ENSP00000269383:p.Asn63Thr	36.0	0.0		57.0	21.0	NM_001256124	Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	ENST00000269383.3	hg19	CCDS11732.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.49|16.49	3.137829|3.137829	0.56936|0.56936	.|.	.|.	ENSG00000141569|ENSG00000141569	ENST00000269383|ENST00000540128	T|.	0.22539|.	1.95|.	5.45|5.45	4.38|4.38	0.52667|0.52667	Zinc finger, RING/FYVE/PHD-type (1);|.	0.000000|.	0.53938|.	D|.	0.000048|.	T|T	0.27241|0.27241	0.0668|0.0668	N|N	0.08118|0.08118	0|0	0.34321|0.34321	D|D	0.686626|0.686626	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.34079|0.34079	-0.9843|-0.9843	10|5	0.51188|.	T|.	0.08|.	.|.	7.7749|7.7749	0.29030|0.29030	0.0:0.0725:0.1391:0.7884|0.0:0.0725:0.1391:0.7884	.|.	63|.	Q6PJ69|.	TRI65_HUMAN|.	T|H	63|54	ENSP00000269383:N63T|.	ENSP00000269383:N63T|.	N|Q	-|-	2|3	0|2	TRIM65|TRIM65	71404426|71404426	1.000000|1.000000	0.71417|0.71417	0.927000|0.927000	0.36925|0.36925	0.015000|0.015000	0.08874|0.08874	3.922000|3.922000	0.56462|0.56462	0.920000|0.920000	0.36970|0.36970	0.460000|0.460000	0.39030|0.39030	AAC|CAA	.	.		0.786	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547	
SPIRE1	56907	hgsc.bcm.edu	37	18	12535487	12535487	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr18:12535487C>A	ENST00000409402.4	-	4	984	c.717G>T	c.(715-717)aaG>aaT	p.K239N	snoU13_ENST00000459256.1_RNA|SPIRE1_ENST00000410092.3_Missense_Mutation_p.K239N|SPIRE1_ENST00000309836.5_Missense_Mutation_p.K42N|SPIRE1_ENST00000383356.2_Missense_Mutation_p.K80N|SPIRE1_ENST00000453447.2_Missense_Mutation_p.K119N	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						CTTTCGCACTCTTAATTTTGG	0.368																																					p.K239N		Atlas-SNP	.											.	SPIRE1	120	.	0			c.G717T						.						154.0	137.0	143.0					18																	12535487		2203	4300	6503	SO:0001583	missense	56907	exon4			CGCACTCTTAATT	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.717G>T	chr18.hg19:g.12535487C>A	ENSP00000387266:p.Lys239Asn	27.0	0.0		59.0	13.0	NM_020148		Missense_Mutation	SNP	ENST00000409402.4	hg19	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669560	0.67814	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356;ENST00000449797	T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26	5.83	2.1	0.27182	.	0.046511	0.85682	D	0.000000	T	0.48095	0.1481	L	0.60455	1.87	0.50813	D	0.999893	P;D;D	0.76494	0.93;0.993;0.999	P;D;D	0.68483	0.572;0.913;0.958	T	0.26849	-1.0091	10	0.28530	T	0.3	-12.5837	8.4823	0.33049	0.0:0.5413:0.0:0.4587	.	239;42;239	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	N	119;239;239;42;80;119	ENSP00000407050:K119N;ENSP00000387266:K239N;ENSP00000387226:K239N;ENSP00000309661:K42N;ENSP00000372847:K80N;ENSP00000401392:K119N	ENSP00000309661:K42N	K	-	3	2	SPIRE1	12525487	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	0.710000	0.25748	0.103000	0.17682	0.557000	0.71058	AAG	.	.		0.368	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818	
GREB1L	80000	hgsc.bcm.edu	37	18	19098141	19098141	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr18:19098141T>C	ENST00000580732.2	+	31	5799	c.5418T>C	c.(5416-5418)caT>caC	p.H1806H	GREB1L_ENST00000400483.4_3'UTR|GREB1L_ENST00000269218.6_Silent_p.H1697H|GREB1L_ENST00000424526.1_Silent_p.H1806H			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1806						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						AAGCCATCCATAACTTCAGGA	0.498																																					p.H1806H		Atlas-SNP	.											.	GREB1L	69	.	0			c.T5418C						.						119.0	98.0	105.0					18																	19098141		692	1591	2283	SO:0001819	synonymous_variant	80000	exon31			CATCCATAACTTC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.5418T>C	chr18.hg19:g.19098141T>C		89.0	0.0		101.0	6.0	NM_001142966	A4QN17|Q9H8F1	Silent	SNP	ENST00000580732.2	hg19	CCDS45836.1																																																																																			.	.		0.498	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
MIB1	57534	hgsc.bcm.edu	37	18	19437092	19437092	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr18:19437092C>T	ENST00000261537.6	+	19	2931	c.2667C>T	c.(2665-2667)aaC>aaT	p.N889N	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	889					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GTTTTCCAGACTGTGCTAACC	0.398																																					p.N889N		Atlas-SNP	.											.	MIB1	87	.	0			c.C2667T						.						172.0	130.0	144.0					18																	19437092		2203	4300	6503	SO:0001630	splice_region_variant	57534	exon19			TCCAGACTGTGCT	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2666-1C>T	chr18.hg19:g.19437092C>T		55.0	0.0		65.0	22.0	NM_020774	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Silent	SNP	ENST00000261537.6	hg19	CCDS11871.1																																																																																			.	.		0.398	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	Silent
MALT1	10892	hgsc.bcm.edu	37	18	56348515	56348515	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr18:56348515A>G	ENST00000348428.3	+	2	581	c.323A>G	c.(322-324)gAt>gGt	p.D108G	MALT1_ENST00000345724.3_Missense_Mutation_p.D108G|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	108	Death.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						GAATTGAGTGATTTCCTGCAG	0.478			T	BIRC3	MALT																																p.D108G		Atlas-SNP	.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	MALT1	55	.	0			c.A323G						.						112.0	104.0	107.0					18																	56348515		2203	4300	6503	SO:0001583	missense	10892	exon2			TGAGTGATTTCCT		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.323A>G	chr18.hg19:g.56348515A>G	ENSP00000319279:p.Asp108Gly	79.0	0.0		100.0	26.0	NM_173844	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	hg19	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.314949	0.40996	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.61274	0.12;0.12	6.03	6.03	0.97812	DEATH-like (2);	0.201056	0.52532	D	0.000078	T	0.42630	0.1211	N	0.12182	0.205	0.54753	D	0.999985	B;B	0.11235	0.004;0.003	B;B	0.10450	0.005;0.002	T	0.25641	-1.0126	10	0.41790	T	0.15	.	16.2338	0.82360	1.0:0.0:0.0:0.0	.	108;108	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	G	108	ENSP00000319279:D108G;ENSP00000304161:D108G	ENSP00000304161:D108G	D	+	2	0	MALT1	54499495	1.000000	0.71417	0.999000	0.59377	0.704000	0.40688	7.825000	0.86693	2.313000	0.78055	0.455000	0.32223	GAT	.	.		0.478	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		
MUC16	94025	hgsc.bcm.edu	37	19	9049646	9049646	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:9049646T>A	ENST00000397910.4	-	5	32188	c.31985A>T	c.(31984-31986)gAt>gTt	p.D10662V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10664	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTACTAGTATCTGTCCCCGA	0.498																																					p.D10662V		Atlas-SNP	.											.	MUC16	4315	.	0			c.A31985T						.						150.0	135.0	140.0					19																	9049646		2033	4189	6222	SO:0001583	missense	94025	exon5			CTAGTATCTGTCC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31985A>T	chr19.hg19:g.9049646T>A	ENSP00000381008:p.Asp10662Val	79.0	0.0		107.0	36.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	4.267	0.048737	0.08243	.	.	ENSG00000181143	ENST00000397910	T	0.03065	4.06	2.5	0.0178	0.14113	.	.	.	.	.	T	0.04318	0.0119	L	0.29908	0.895	.	.	.	P	0.50710	0.938	P	0.50049	0.629	T	0.37056	-0.9722	8	0.87932	D	0	.	3.0434	0.06146	0.0:0.154:0.2514:0.5946	.	10662	B5ME49	.	V	10662	ENSP00000381008:D10662V	ENSP00000381008:D10662V	D	-	2	0	MUC16	8910646	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.144000	0.10280	-0.080000	0.12685	0.248000	0.18094	GAT	.	.		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
KEAP1	9817	hgsc.bcm.edu	37	19	10610240	10610240	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:10610240T>C	ENST00000171111.5	-	2	1017	c.470A>G	c.(469-471)aAc>aGc	p.N157S	KEAP1_ENST00000393623.2_Missense_Mutation_p.N157S|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	157					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GACAGCACCGTTCATGACGTG	0.577																																					p.N157S		Atlas-SNP	.											.	KEAP1	182	.	0			c.A470G						.						183.0	144.0	157.0					19																	10610240		2203	4300	6503	SO:0001583	missense	9817	exon2			GCACCGTTCATGA	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.470A>G	chr19.hg19:g.10610240T>C	ENSP00000171111:p.Asn157Ser	99.0	0.0		82.0	12.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	hg19	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	9.822	1.186004	0.21870	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.65549	-0.16;-0.16	4.81	4.81	0.61882	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.132309	0.64402	D	0.000013	T	0.44746	0.1308	N	0.11364	0.135	0.53005	D	0.999962	P	0.39624	0.681	B	0.40741	0.339	T	0.46569	-0.9182	10	0.35671	T	0.21	.	12.3271	0.55018	0.0:0.0:0.0:1.0	.	157	Q14145	KEAP1_HUMAN	S	157	ENSP00000171111:N157S;ENSP00000377245:N157S	ENSP00000171111:N157S	N	-	2	0	KEAP1	10471240	0.990000	0.36364	0.992000	0.48379	0.484000	0.33280	2.136000	0.42121	1.811000	0.52892	0.459000	0.35465	AAC	.	.		0.577	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
GADD45GIP1	90480	hgsc.bcm.edu	37	19	13065097	13065097	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:13065097C>A	ENST00000316939.1	-	2	617	c.594G>T	c.(592-594)aaG>aaT	p.K198N		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	198					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				ovary(2)|prostate(1)|skin(1)	4						GCGCCTCCTTCTTCCGTTTCT	0.602																																					p.K198N		Atlas-SNP	.											.	GADD45GIP1	11	.	0			c.G594T						.						71.0	75.0	74.0					19																	13065097		2203	4300	6503	SO:0001583	missense	90480	exon2			CTCCTTCTTCCGT	AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.594G>T	chr19.hg19:g.13065097C>A	ENSP00000323065:p.Lys198Asn	96.0	0.0		104.0	5.0	NM_052850	Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Missense_Mutation	SNP	ENST00000316939.1	hg19	CCDS12290.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872594	0.51695	.	.	ENSG00000179271	ENST00000316939	.	.	.	5.04	3.99	0.46301	.	0.170944	0.48286	D	0.000189	T	0.68961	0.3058	M	0.75777	2.31	0.43885	D	0.996509	D	0.69078	0.997	D	0.68039	0.955	T	0.69822	-0.5041	9	0.72032	D	0.01	-0.2416	4.7827	0.13210	0.1817:0.6497:0.0:0.1686	.	198	Q8TAE8	G45IP_HUMAN	N	198	.	ENSP00000323065:K198N	K	-	3	2	GADD45GIP1	12926097	1.000000	0.71417	0.998000	0.56505	0.385000	0.30292	1.264000	0.33015	1.115000	0.41800	0.558000	0.71614	AAG	.	.		0.602	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452759.2	NM_052850	
CILP2	148113	hgsc.bcm.edu	37	19	19655014	19655014	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:19655014A>T	ENST00000291495.5	+	8	1745	c.1660A>T	c.(1660-1662)Atg>Ttg	p.M554L	CILP2_ENST00000586018.1_Missense_Mutation_p.M560L	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	554						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GGTCAAGGCCATGCGGAAGAA	0.617																																					p.M554L		Atlas-SNP	.											.	CILP2	84	.	0			c.A1660T						.						76.0	82.0	80.0					19																	19655014		2203	4300	6503	SO:0001583	missense	148113	exon8			AAGGCCATGCGGA	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1660A>T	chr19.hg19:g.19655014A>T	ENSP00000291495:p.Met554Leu	63.0	0.0		50.0	15.0	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	hg19	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	A	0.319	-0.962991	0.02249	.	.	ENSG00000160161	ENST00000291495	T	0.38887	1.11	3.77	2.42	0.29668	.	0.153045	0.56097	N	0.000032	T	0.17365	0.0417	N	0.05534	-0.03	0.30559	N	0.76469	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.34304	-0.9834	10	0.02654	T	1	-10.23	8.978	0.35948	0.4523:0.5477:0.0:0.0	.	554;554	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	L	554	ENSP00000291495:M554L	ENSP00000291495:M554L	M	+	1	0	CILP2	19516014	0.907000	0.30839	0.988000	0.46212	0.959000	0.62525	0.920000	0.28705	0.144000	0.18951	0.352000	0.21897	ATG	.	.		0.617	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
LSR	51599	hgsc.bcm.edu	37	19	35758146	35758146	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:35758146C>A	ENST00000361790.3	+	9	1582	c.1423C>A	c.(1423-1425)Ccc>Acc	p.P475T	LSR_ENST00000602122.1_Missense_Mutation_p.P455T|USF2_ENST00000222305.3_5'Flank|USF2_ENST00000595068.1_5'Flank|LSR_ENST00000360798.3_Missense_Mutation_p.P407T|LSR_ENST00000347609.4_Missense_Mutation_p.P417T|USF2_ENST00000594064.1_5'Flank|USF2_ENST00000343550.5_5'Flank|LSR_ENST00000354900.3_Missense_Mutation_p.P456T|AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000427250.1_Missense_Mutation_p.P319T|USF2_ENST00000379134.3_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	475					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGACCAGGAGCCCGCCAGGGA	0.776																																					p.P475T		Atlas-SNP	.											.	LSR	60	.	0			c.C1423A						.						6.0	8.0	8.0					19																	35758146		1891	4016	5907	SO:0001583	missense	51599	exon9			CAGGAGCCCGCCA	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1423C>A	chr19.hg19:g.35758146C>A	ENSP00000354575:p.Pro475Thr	78.0	0.0		84.0	20.0	NM_205834	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	ENST00000361790.3	hg19	CCDS12450.1	.	.	.	.	.	.	.	.	.	.	C	5.926	0.354977	0.11239	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	T;T;T;T;T	0.63255	0.53;0.69;0.36;0.35;-0.03	4.45	-2.38	0.06622	.	0.803076	0.11011	N	0.609505	T	0.41719	0.1171	L	0.39898	1.24	0.09310	N	1	B;B;B;B;B;B	0.32467	0.094;0.0;0.152;0.372;0.094;0.361	B;B;B;B;B;B	0.21917	0.01;0.001;0.036;0.037;0.016;0.036	T	0.23547	-1.0185	10	0.48119	T	0.1	-7.9039	3.382	0.07257	0.2694:0.385:0.2633:0.0824	.	413;417;455;407;456;475	Q9BT33;Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;.;LSR_HUMAN	T	475;456;407;417;319	ENSP00000354575:P475T;ENSP00000346976:P456T;ENSP00000354034:P407T;ENSP00000262627:P417T;ENSP00000394479:P319T	ENSP00000262627:P417T	P	+	1	0	LSR	40449986	0.000000	0.05858	0.099000	0.21106	0.005000	0.04900	-0.757000	0.04772	-0.245000	0.09625	-0.257000	0.10917	CCC	.	.		0.776	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	
COX6B1	1340	hgsc.bcm.edu	37	19	36142180	36142180	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:36142180A>G	ENST00000592141.1	+	2	300	c.35A>G	c.(34-36)tAc>tGc	p.Y12C	COX6B1_ENST00000246554.3_Missense_Mutation_p.Y12C|COX6B1_ENST00000392201.1_Missense_Mutation_p.Y12C			P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)	12					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			lung(6)|prostate(1)|stomach(1)	8	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ATCAAGAACTACAAGACCGCC	0.572																																					p.Y12C		Atlas-SNP	.											.	COX6B1	20	.	0			c.A35G						.						99.0	84.0	89.0					19																	36142180		2203	4300	6503	SO:0001583	missense	1340	exon2			AGAACTACAAGAC	BC001015	CCDS12469.1	19q13.1	2011-07-04	2010-01-07	2004-08-12	ENSG00000126267	ENSG00000126267	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2280	protein-coding gene	gene with protein product		124089	"""cytochrome c oxidase subunit Vib"", ""cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)"""	COX6B		1650756	Standard	NM_001863		Approved	COXG	uc002oav.3	P14854	OTTHUMG00000048112	ENST00000592141.1:c.35A>G	chr19.hg19:g.36142180A>G	ENSP00000466818:p.Tyr12Cys	62.0	0.0		93.0	29.0	NM_001863	B2R5C9|Q6IBL4	Missense_Mutation	SNP	ENST00000592141.1	hg19	CCDS12469.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.217516	0.79352	.	.	ENSG00000126267	ENST00000246554;ENST00000392201	D	0.82893	-1.66	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.89577	0.6755	.	.	.	0.58432	D	0.999995	D	0.71674	0.998	D	0.65443	0.935	D	0.90473	0.4454	9	0.66056	D	0.02	-11.8536	11.6541	0.51306	1.0:0.0:0.0:0.0	.	12	P14854	CX6B1_HUMAN	C	12;29	ENSP00000246554:Y12C	ENSP00000246554:Y12C	Y	+	2	0	COX6B1	40834020	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.116000	0.89574	2.017000	0.59298	0.523000	0.50628	TAC	.	.		0.572	COX6B1-004	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459068.3	NM_001863	
ZNF573	126231	hgsc.bcm.edu	37	19	38229948	38229948	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:38229948A>G	ENST00000590414.2	-	4	1464	c.1443T>C	c.(1441-1443)acT>acC	p.T481T	ZNF573_ENST00000357309.3_Silent_p.T393T|ZNF573_ENST00000339503.4_Silent_p.T423T|ZNF573_ENST00000392138.1_Silent_p.T394T|ZNF573_ENST00000536220.1_Silent_p.T393T			Q86YE8	ZN573_HUMAN	zinc finger protein 573	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			GGTTTGAGCCAGTACTATAGG	0.363																																					p.T481T		Atlas-SNP	.											.	ZNF573	63	.	0			c.T1443C						.						85.0	83.0	84.0					19																	38229948		2203	4300	6503	SO:0001819	synonymous_variant	126231	exon5			TGAGCCAGTACTA	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1443T>C	chr19.hg19:g.38229948A>G		76.0	0.0		137.0	24.0	NM_001172690	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Silent	SNP	ENST00000590414.2	hg19	CCDS59381.1																																																																																			.	.		0.363	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360	
SPTBN4	57731	hgsc.bcm.edu	37	19	40993612	40993612	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:40993612G>A	ENST00000352632.3	+	3	264	c.178G>A	c.(178-180)Gaa>Aaa	p.E60K	SPTBN4_ENST00000344104.3_Missense_Mutation_p.E60K|SPTBN4_ENST00000595535.1_Missense_Mutation_p.E60K|SPTBN4_ENST00000338932.3_Missense_Mutation_p.E60K|SPTBN4_ENST00000598249.1_Missense_Mutation_p.E60K			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	60	Actin-binding.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGATGAGCGGGAAGCCGTGCA	0.647																																					p.E60K		Atlas-SNP	.											.	SPTBN4	213	.	0			c.G178A						.						44.0	45.0	45.0					19																	40993612		2203	4300	6503	SO:0001583	missense	57731	exon3			GAGCGGGAAGCCG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.178G>A	chr19.hg19:g.40993612G>A	ENSP00000263373:p.Glu60Lys	47.0	0.0		60.0	22.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	34	5.329225	0.95733	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.60672	0.17;0.17;0.17	4.28	4.28	0.50868	Calponin homology domain (2);	0.094520	0.41605	U	0.000851	T	0.68961	0.3058	M	0.68728	2.09	0.80722	D	1	D;D	0.63880	0.982;0.993	B;P	0.56916	0.446;0.809	T	0.72462	-0.4286	10	0.51188	T	0.08	.	15.6338	0.76933	0.0:0.0:1.0:0.0	.	60;60	Q9H254;Q71S06	SPTN4_HUMAN;.	K	60	ENSP00000263373:E60K;ENSP00000340345:E60K;ENSP00000340741:E60K	ENSP00000340345:E60K	E	+	1	0	SPTBN4	45685452	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.595000	0.98260	2.215000	0.71742	0.591000	0.81541	GAA	.	.		0.647	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
CEACAM3	1084	hgsc.bcm.edu	37	19	42301605	42301605	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:42301605A>T	ENST00000357396.3	+	2	390	c.149A>T	c.(148-150)gAg>gTg	p.E50V	CEACAM3_ENST00000344550.4_Missense_Mutation_p.E50V|CEACAM3_ENST00000221999.4_Missense_Mutation_p.E50V|CEACAM3_ENST00000595255.1_3'UTR	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	50	Ig-like V-type.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						GAGGGGAAGGAGGTGCTTCTA	0.507																																					p.E50V		Atlas-SNP	.											.	CEACAM3	37	.	0			c.A149T						.						172.0	158.0	163.0					19																	42301605		2203	4300	6503	SO:0001583	missense	1084	exon2			GGAAGGAGGTGCT	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.149A>T	chr19.hg19:g.42301605A>T	ENSP00000349971:p.Glu50Val	105.0	0.0		195.0	53.0	NM_001815	G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	hg19	CCDS12586.2	.	.	.	.	.	.	.	.	.	.	A	13.57	2.276239	0.40294	.	.	ENSG00000170956	ENST00000357396;ENST00000389667;ENST00000221999;ENST00000344550	T;T;T	0.65549	-0.16;-0.16;-0.16	3.44	1.13	0.20643	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76241	0.3960	M	0.83852	2.665	0.09310	N	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.994	T	0.61865	-0.6975	9	0.87932	D	0	.	5.8708	0.18802	0.7344:0.0:0.2656:0.0	.	50;50	G5E978;P40198	.;CEAM3_HUMAN	V	50	ENSP00000349971:E50V;ENSP00000221999:E50V;ENSP00000341725:E50V	ENSP00000221999:E50V	E	+	2	0	CEACAM3	46993445	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.568000	0.23623	0.300000	0.22699	0.421000	0.28195	GAG	.	.		0.507	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2	NM_001815	
SMG9	56006	hgsc.bcm.edu	37	19	44249035	44249035	+	Splice_Site	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:44249035T>C	ENST00000270066.6	-	6	932	c.590A>G	c.(589-591)tAc>tGc	p.Y197C	SMG9_ENST00000601170.1_Splice_Site_p.Y197C	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	197					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)			kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						ATCCAACAGGTACTGTGGGAA	0.547											OREG0025533	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y197C		Atlas-SNP	.											.	SMG9	39	.	0			c.A590G						.						154.0	111.0	126.0					19																	44249035		2203	4300	6503	SO:0001630	splice_region_variant	56006	exon6			AACAGGTACTGTG	BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.589-1A>G	chr19.hg19:g.44249035T>C		72.0	0.0	922	121.0	26.0	NM_019108	O60429|Q9H9A9	Missense_Mutation	SNP	ENST00000270066.6	hg19	CCDS33043.2	.	.	.	.	.	.	.	.	.	.	T	16.54	3.150669	0.57151	.	.	ENSG00000105771	ENST00000270066	.	.	.	5.41	5.41	0.78517	.	0.074229	0.56097	D	0.000030	T	0.68421	0.2999	M	0.72894	2.215	0.58432	D	0.999994	D;D	0.63046	0.99;0.992	P;P	0.60345	0.799;0.873	T	0.70088	-0.4968	9	0.46703	T	0.11	-18.3183	8.814	0.34985	0.1676:0.0:0.0:0.8323	.	197;197	Q9H0W8-2;Q9H0W8	.;SMG9_HUMAN	C	197	.	ENSP00000270066:Y197C	Y	-	2	0	SMG9	48940875	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	5.162000	0.64942	2.059000	0.61396	0.374000	0.22700	TAC	.	.		0.547	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317668.1	NM_019108	Missense_Mutation
ERCC2	2068	hgsc.bcm.edu	37	19	45860629	45860629	+	Splice_Site	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:45860629T>C	ENST00000391945.4	-	15	1455	c.1378A>G	c.(1378-1380)Aca>Gca	p.T460A	ERCC2_ENST00000391944.3_Splice_Site_p.T382A	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	460	Mediates interaction with MMS19.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGGGACAGTGTCTGTGGCGGG	0.637			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.T460A		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2	78	.	0			c.A1378G						.						81.0	73.0	76.0					19																	45860629		2203	4300	6503	SO:0001630	splice_region_variant	2068	exon15	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	ACAGTGTCTGTGG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1378-1A>G	chr19.hg19:g.45860629T>C		91.0	0.0		147.0	42.0	NM_000400	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	hg19	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.544815	0.65198	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	D;D	0.91631	-2.88;-2.88	5.42	5.42	0.78866	.	0.107337	0.64402	D	0.000007	D	0.96071	0.8720	M	0.93197	3.39	0.80722	D	1	D;D;D	0.65815	0.995;0.987;0.969	P;P;P	0.57283	0.817;0.718;0.659	D	0.96709	0.9524	10	0.87932	D	0	-16.4385	11.8517	0.52415	0.0:0.0:0.0:1.0	.	382;460;153	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	A	410;436;460;382	ENSP00000375809:T460A;ENSP00000375808:T382A	ENSP00000375805:T410A	T	-	1	0	ERCC2	50552469	1.000000	0.71417	0.955000	0.39395	0.244000	0.25665	6.731000	0.74785	2.052000	0.61016	0.533000	0.62120	ACA	.	.		0.637	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	Missense_Mutation
PRR12	57479	hgsc.bcm.edu	37	19	50102580	50102580	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:50102580G>C	ENST00000418929.2	+	5	3742	c.3730G>C	c.(3730-3732)Gat>Cat	p.D1244H		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CTCATCGGGTGATGCCATATC	0.612																																					p.D1244H		Atlas-SNP	.											.	PRR12	157	.	0			c.G3730C						.						31.0	32.0	32.0					19																	50102580		2068	4219	6287	SO:0001583	missense	57479	exon5			TCGGGTGATGCCA	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.3730G>C	chr19.hg19:g.50102580G>C	ENSP00000394510:p.Asp1244His	49.0	0.0		73.0	5.0	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	hg19	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	4.688	0.127918	0.08981	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.85	4.85	0.62838	.	0.128409	0.34879	N	0.003614	T	0.44787	0.1310	L	0.34521	1.04	0.21416	N	0.999691	P	0.47677	0.899	P	0.50378	0.639	T	0.38478	-0.9659	9	0.52906	T	0.07	-15.9338	16.889	0.86082	0.0:0.0:1.0:0.0	.	1244	Q9ULL5-3	.	H	1244;424;424	.	ENSP00000246798:D424H	D	+	1	0	PRR12	54794392	0.851000	0.29673	0.050000	0.19076	0.017000	0.09413	3.560000	0.53763	2.527000	0.85204	0.563000	0.77884	GAT	.	.		0.612	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
ZNF615	284370	hgsc.bcm.edu	37	19	52496613	52496613	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:52496613T>C	ENST00000602063.1	-	6	2065	c.1716A>G	c.(1714-1716)gaA>gaG	p.E572E	ZNF615_ENST00000598071.1_Silent_p.E583E|ZNF615_ENST00000391795.3_Silent_p.E577E|ZNF615_ENST00000594083.1_Silent_p.E583E|ZNF615_ENST00000376716.5_Silent_p.E572E			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	572					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CTTTGCCACATTCACTGCATA	0.433																																					p.E583E		Atlas-SNP	.											.	ZNF615	111	.	0			c.A1749G						.						119.0	102.0	108.0					19																	52496613		2203	4300	6503	SO:0001819	synonymous_variant	284370	exon7			GCCACATTCACTG	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1716A>G	chr19.hg19:g.52496613T>C		47.0	0.0		75.0	18.0	NM_001199324	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	hg19	CCDS12846.1																																																																																			.	.		0.433	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
ZNF766	90321	hgsc.bcm.edu	37	19	52793977	52793977	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:52793977T>C	ENST00000439461.1	+	4	976	c.933T>C	c.(931-933)agT>agC	p.S311S	ZNF766_ENST00000359102.4_Silent_p.S326S|ZNF766_ENST00000593612.1_Silent_p.S326S|ZNF766_ENST00000599581.1_3'UTR|CTD-2525I3.5_ENST00000594865.1_RNA	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		ATAGTAGCAGTTCATACCTAG	0.373																																					p.S311S		Atlas-SNP	.											.	ZNF766	45	.	0			c.T933C						.						34.0	37.0	36.0					19																	52793977		2140	4277	6417	SO:0001819	synonymous_variant	90321	exon4			TAGCAGTTCATAC	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.933T>C	chr19.hg19:g.52793977T>C		90.0	0.0		167.0	33.0	NM_001010851	B2RNE0|Q7Z326	Silent	SNP	ENST00000439461.1	hg19	CCDS46163.1																																																																																			.	.		0.373	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851	
ZNF528	84436	hgsc.bcm.edu	37	19	52919622	52919622	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:52919622C>A	ENST00000360465.3	+	7	1943	c.1517C>A	c.(1516-1518)tCa>tAa	p.S506*	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AGTCGCAGTTCAAACCTGGTA	0.393																																					p.S506X		Atlas-SNP	.											.	ZNF528	95	.	0			c.C1517A						.						50.0	50.0	50.0					19																	52919622		2203	4300	6503	SO:0001587	stop_gained	84436	exon7			GCAGTTCAAACCT	AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1517C>A	chr19.hg19:g.52919622C>A	ENSP00000353652:p.Ser506*	72.0	0.0		153.0	43.0	NM_032423	B3KPN4|Q86T88|Q96JK0	Nonsense_Mutation	SNP	ENST00000360465.3	hg19	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310654	0.95629	.	.	ENSG00000167555	ENST00000360465	.	.	.	1.83	-1.31	0.09230	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999976	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3109	0.32071	0.4038:0.5961:0.0:0.0	.	.	.	.	X	506	.	ENSP00000353652:S506X	S	+	2	0	ZNF528	57611434	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.583000	0.05807	0.070000	0.16634	-0.321000	0.08615	TCA	.	.		0.393	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
ZNF415	55786	hgsc.bcm.edu	37	19	53613070	53613070	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:53613070A>T	ENST00000500065.4	-	4	561	c.228T>A	c.(226-228)caT>caA	p.H76Q	ZNF415_ENST00000421033.1_Missense_Mutation_p.H88Q|ZNF415_ENST00000601215.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.H63Q|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000448501.1_Missense_Mutation_p.H124Q|ZNF415_ENST00000455735.2_Missense_Mutation_p.H124Q|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.H76Q|ZNF415_ENST00000595813.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CATGTTTTTCATGTTGTTCCA	0.383																																					p.H76Q		Atlas-SNP	.											.	ZNF415	68	.	0			c.T228A						.						161.0	140.0	147.0					19																	53613070		2203	4300	6503	SO:0001583	missense	55786	exon4			TTTTTCATGTTGT	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.228T>A	chr19.hg19:g.53613070A>T	ENSP00000439435:p.His76Gln	72.0	0.0		122.0	30.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	hg19	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.349984	0.24426	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.06933	3.4;3.4;3.24;3.24;3.24;3.29	2.5	1.44	0.22558	.	.	.	.	.	T	0.11367	0.0277	N	0.17631	0.505	0.09310	N	1	P;B;P;D;P;P	0.69078	0.879;0.138;0.895;0.997;0.879;0.936	B;B;B;D;B;P	0.75484	0.308;0.05;0.334;0.986;0.381;0.534	T	0.29088	-1.0023	9	0.27082	T	0.32	.	4.4153	0.11454	0.8286:0.0:0.1714:0.0	.	76;124;124;76;63;88	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	Q	76;76;124;88;124;63	ENSP00000243643:H76Q;ENSP00000439435:H76Q;ENSP00000396492:H124Q;ENSP00000395055:H88Q;ENSP00000388787:H124Q;ENSP00000414601:H63Q	ENSP00000243643:H76Q	H	-	3	2	ZNF415	58304882	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.534000	0.06150	0.196000	0.20367	0.260000	0.18958	CAT	.	.		0.383	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
ZNF347	84671	hgsc.bcm.edu	37	19	53643694	53643694	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:53643694C>A	ENST00000334197.7	-	5	2455	c.2387G>T	c.(2386-2388)gGg>gTg	p.G796V	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.G797V|ZNF347_ENST00000452676.2_Missense_Mutation_p.G797V	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	796					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		AAAGGGTTTCCCACACTCATA	0.408																																					p.G797V	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											.	ZNF347	87	.	0			c.G2390T						.						184.0	182.0	182.0					19																	53643694		2203	4300	6503	SO:0001583	missense	84671	exon5			GGTTTCCCACACT	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2387G>T	chr19.hg19:g.53643694C>A	ENSP00000334146:p.Gly796Val	80.0	0.0		191.0	43.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	hg19	CCDS33097.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.97|11.97	1.798129|1.798129	0.31777|0.31777	.|.	.|.	ENSG00000197937|ENSG00000197937	ENST00000436933|ENST00000334197;ENST00000452676	.|T;T	.|0.17854	.|2.25;2.25	2.35|2.35	-1.87|-1.87	0.07737|0.07737	.|Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	.|T	.|0.32912	.|0.0845	M|M	0.74546|0.74546	2.27|2.27	0.19575|0.19575	N|N	0.999968|0.999968	.|D;D	.|0.89917	.|1.0;0.998	.|D;P	.|0.91635	.|0.999;0.786	.|T	.|0.17228	.|-1.0376	.|9	.|0.87932	.|D	.|0	.|.	2.8131|2.8131	0.05447|0.05447	0.182:0.5265:0.1775:0.114|0.182:0.5265:0.1775:0.114	.|.	.|797;796	.|G5E9N4;Q96SE7	.|.;ZN347_HUMAN	.|V	-1|796;797	.|ENSP00000334146:G796V;ENSP00000405218:G797V	.|ENSP00000334146:G796V	.|G	-|-	.|2	.|0	ZNF347|ZNF347	58335506|58335506	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.101000|-0.101000	0.10973|0.10973	-0.459000|-0.459000	0.07013|0.07013	-0.266000|-0.266000	0.10368|0.10368	.|GGG	.	.		0.408	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
ZNF761	388561	hgsc.bcm.edu	37	19	53959293	53959293	+	RNA	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:53959293G>A	ENST00000454407.1	+	0	1985							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TACCTCACATGCCATCATAGA	0.418																																					p.C511Y		Atlas-SNP	.											.	ZNF761	104	.	0			c.G1532A						.						105.0	101.0	102.0					19																	53959293		2203	4300	6503			388561	exon7			TCACATGCCATCA	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		chr19.hg19:g.53959293G>A		78.0	0.0		142.0	7.0	NM_001008401	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	hg19																																																																																				.	.		0.418	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
BRSK1	84446	hgsc.bcm.edu	37	19	55798667	55798667	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:55798667T>A	ENST00000309383.1	+	3	594	c.317T>A	c.(316-318)tTg>tAg	p.L106*	BRSK1_ENST00000590333.1_Splice_Site_p.L122*|BRSK1_ENST00000585418.1_Splice_Site_p.L106*	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	106	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		AAGAAATATTTGTAGGTATTT	0.557																																					p.L106X		Atlas-SNP	.											.	BRSK1	192	.	0			c.T317A						.						121.0	106.0	111.0					19																	55798667		2203	4300	6503	SO:0001630	splice_region_variant	84446	exon3			AATATTTGTAGGT	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.317+1T>A	chr19.hg19:g.55798667T>A		42.0	0.0		93.0	22.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Nonsense_Mutation	SNP	ENST00000309383.1	hg19	CCDS12921.1	.	.	.	.	.	.	.	.	.	.	.	40	8.174435	0.98691	.	.	ENSG00000160469	ENST00000309383	.	.	.	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4864	0.61369	0.0:0.0:0.0:1.0	.	.	.	.	X	106	.	ENSP00000310649:L106X	L	+	2	0	BRSK1	60490479	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.815000	0.69215	1.978000	0.57642	0.409000	0.27619	TTG	.	.		0.557	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	Nonsense_Mutation
NLRP4	147945	hgsc.bcm.edu	37	19	56390306	56390306	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:56390306C>T	ENST00000301295.6	+	9	3265	c.2843C>T	c.(2842-2844)cCa>cTa	p.P948L	NLRP4_ENST00000346986.5_Missense_Mutation_p.P892L|NLRP4_ENST00000587891.1_Missense_Mutation_p.P873L	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	948					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CTGAGACACCCAGAGTGTGCC	0.582																																					p.P948L		Atlas-SNP	.											.	NLRP4	331	.	0			c.C2843T						.						66.0	60.0	62.0					19																	56390306		2203	4300	6503	SO:0001583	missense	147945	exon9			GACACCCAGAGTG	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2843C>T	chr19.hg19:g.56390306C>T	ENSP00000301295:p.Pro948Leu	93.0	0.0		120.0	38.0	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	hg19	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000550	0.35320	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.16324	2.35;2.35	4.01	0.488	0.16848	.	.	.	.	.	T	0.28134	0.0694	M	0.66939	2.045	0.09310	N	1	P;D;D	0.67145	0.663;0.996;0.994	B;P;P	0.59889	0.346;0.865;0.737	T	0.10474	-1.0628	9	0.51188	T	0.08	.	3.6292	0.08124	0.2003:0.5809:0.0:0.2188	.	892;873;948	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	L	948;892	ENSP00000301295:P948L;ENSP00000344787:P892L	ENSP00000301295:P948L	P	+	2	0	NLRP4	61082118	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.406000	0.21032	0.079000	0.16929	0.650000	0.86243	CCA	.	.		0.582	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
ZNF329	79673	hgsc.bcm.edu	37	19	58639453	58639453	+	Missense_Mutation	SNP	T	T	A	rs201280634		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:58639453T>A	ENST00000598312.1	-	4	1651	c.1418A>T	c.(1417-1419)cAc>cTc	p.H473L	ZNF329_ENST00000358067.4_Missense_Mutation_p.H473L	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		AATTCTCTGGTGCTTGGTCAG	0.512																																					p.H473L		Atlas-SNP	.											.	ZNF329	70	.	0			c.A1418T						.						97.0	92.0	94.0					19																	58639453		2203	4300	6503	SO:0001583	missense	79673	exon4			CTCTGGTGCTTGG	AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.1418A>T	chr19.hg19:g.58639453T>A	ENSP00000470008:p.His473Leu	50.0	0.0		127.0	28.0	NM_024620	B3KR32|Q9H9R7	Missense_Mutation	SNP	ENST00000598312.1	hg19	CCDS12972.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.447932	0.63178	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	D;D	0.86865	-2.18;-2.18	4.31	4.31	0.51392	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43919	D	0.000510	D	0.95281	0.8469	H	0.98351	4.21	0.49051	D	0.999745	D	0.67145	0.996	P	0.60345	0.873	D	0.96722	0.9533	10	0.87932	D	0	-12.1513	13.3971	0.60861	0.0:0.0:0.0:1.0	.	473	Q86UD4	ZN329_HUMAN	L	473	ENSP00000350773:H473L;ENSP00000439527:H473L	ENSP00000350773:H473L	H	-	2	0	ZNF329	63331265	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.619000	0.83057	2.173000	0.68751	0.533000	0.62120	CAC	.	T|1.000;C|0.000		0.512	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620	
FAM110A	83541	hgsc.bcm.edu	37	20	826010	826010	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:826010A>T	ENST00000304189.2	+	3	944	c.563A>T	c.(562-564)aAg>aTg	p.K188M	FAM110A_ENST00000381939.1_Missense_Mutation_p.K188M|FAM110A_ENST00000381941.3_Missense_Mutation_p.K188M|FAM110A_ENST00000541082.1_Missense_Mutation_p.K188M|FAM110A_ENST00000246100.3_Missense_Mutation_p.K188M			Q9BQ89	F110A_HUMAN	family with sequence similarity 110, member A	188						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|lung(2)	3						CAACGCTCCAAGTCGGACTTG	0.701																																					p.K188M		Atlas-SNP	.											.	FAM110A	18	.	0			c.A563T						.						9.0	11.0	11.0					20																	826010		2145	4258	6403	SO:0001583	missense	83541	exon2			GCTCCAAGTCGGA	BC012800	CCDS13008.1	20p13	2007-06-21	2007-03-21	2007-03-21	ENSG00000125898	ENSG00000125898			16188	protein-coding gene	gene with protein product		611393	"""chromosome 20 open reading frame 55"""	C20orf55		17499476	Standard	NM_001042353		Approved	bA371L19.3	uc002wef.1	Q9BQ89	OTTHUMG00000031649	ENST00000304189.2:c.563A>T	chr20.hg19:g.826010A>T	ENSP00000354163:p.Lys188Met	172.0	0.0		135.0	47.0	NM_207121	D3DVW2|Q5R1M7	Missense_Mutation	SNP	ENST00000304189.2	hg19	CCDS13008.1	.	.	.	.	.	.	.	.	.	.	.	22.8	4.334585	0.81801	.	.	ENSG00000125898	ENST00000381941;ENST00000304189;ENST00000381939;ENST00000246100;ENST00000541082	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	4.73	4.73	0.59995	.	0.130221	0.48286	D	0.000194	T	0.71837	0.3387	M	0.79258	2.445	0.47547	D	0.999454	D	0.89917	1.0	D	0.91635	0.999	T	0.76258	-0.3025	10	0.87932	D	0	0.1606	13.181	0.59655	1.0:0.0:0.0:0.0	.	188	Q9BQ89	F110A_HUMAN	M	188	ENSP00000371367:K188M;ENSP00000354163:K188M;ENSP00000371365:K188M;ENSP00000246100:K188M;ENSP00000445228:K188M	ENSP00000246100:K188M	K	+	2	0	FAM110A	774010	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.090000	0.94144	1.997000	0.58415	0.254000	0.18369	AAG	.	.		0.701	FAM110A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077489.1	NM_031424	
PLCB1	23236	hgsc.bcm.edu	37	20	8608966	8608966	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:8608966A>G	ENST00000338037.6	+	4	299	c.272A>G	c.(271-273)gAt>gGt	p.D91G	PLCB1_ENST00000378641.3_Missense_Mutation_p.D91G|PLCB1_ENST00000378637.2_Missense_Mutation_p.D91G	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	91					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						GAACTTTTGGATGTGGGGAAC	0.438																																					p.L91R		Atlas-SNP	.											.	PLCB1	394	.	0			c.T272G						.						84.0	83.0	83.0					20																	8608966		2203	4300	6503	SO:0001583	missense	23236	exon4			TTTTGGATGTGGG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.272A>G	chr20.hg19:g.8608966A>G	ENSP00000338185:p.Asp91Gly	102.0	0.0		126.0	34.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	hg19	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	11.54	1.670535	0.29693	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098;ENST00000441163;ENST00000535719	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	6.17	6.17	0.99709	.	0.000000	0.39210	U	0.001434	T	0.26231	0.0640	N	0.05414	-0.055	0.48696	D	0.999694	B;B;P	0.42296	0.001;0.013;0.775	B;B;B	0.41412	0.002;0.008;0.356	T	0.11792	-1.0573	10	0.13470	T	0.59	.	15.8048	0.78491	1.0:0.0:0.0:0.0	.	91;91;90	Q9NQ66;Q9NQ66-2;B1AK73	PLCB1_HUMAN;.;.	G	91;91;91;90;11;11	ENSP00000367908:D91G;ENSP00000338185:D91G;ENSP00000367904:D91G;ENSP00000384001:D90G	ENSP00000338185:D91G	D	+	2	0	PLCB1	8556966	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.391000	0.79828	2.371000	0.80710	0.533000	0.62120	GAT	.	.		0.438	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
MGME1	92667	hgsc.bcm.edu	37	20	17968898	17968898	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:17968898C>T	ENST00000377710.5	+	4	1109	c.821C>T	c.(820-822)gCa>gTa	p.A274V	MGME1_ENST00000467391.1_3'UTR|MGME1_ENST00000377709.1_Missense_Mutation_p.A194V|MGME1_ENST00000377704.4_Intron	NM_052865.2	NP_443097.1			mitochondrial genome maintenance exonuclease 1																		CAAGTTGTGGCATACATGGGT	0.408																																					p.A274V		Atlas-SNP	.											.	.	.	.	0			c.C821T						.						107.0	95.0	99.0					20																	17968898		2203	4300	6503	SO:0001583	missense	92667	exon4			TTGTGGCATACAT		CCDS13131.1	20p11.23	2013-08-29	2013-01-11	2013-01-11	ENSG00000125871	ENSG00000125871			16205	protein-coding gene	gene with protein product		615076	"""chromosome 20 open reading frame 72"""	C20orf72		23313956, 23358826, 23434322	Standard	NM_052865		Approved	bA504H3.4, DDK1	uc002wqh.3	Q9BQP7	OTTHUMG00000031955	ENST00000377710.5:c.821C>T	chr20.hg19:g.17968898C>T	ENSP00000366939:p.Ala274Val	93.0	0.0		95.0	23.0	NM_052865		Missense_Mutation	SNP	ENST00000377710.5	hg19	CCDS13131.1	.	.	.	.	.	.	.	.	.	.	C	35	5.453966	0.96223	.	.	ENSG00000125871	ENST00000377710;ENST00000377709	T;T	0.74106	-0.81;-0.45	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89343	0.6688	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90977	0.4824	10	0.87932	D	0	-21.1275	19.2525	0.93930	0.0:1.0:0.0:0.0	.	274	Q9BQP7	CT072_HUMAN	V	274;194	ENSP00000366939:A274V;ENSP00000366938:A194V	ENSP00000366938:A194V	A	+	2	0	C20orf72	17916898	1.000000	0.71417	0.940000	0.37924	0.992000	0.81027	7.258000	0.78371	2.645000	0.89757	0.462000	0.41574	GCA	.	.		0.408	MGME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078139.1	NM_052865	
MATN4	8785	hgsc.bcm.edu	37	20	43922619	43922619	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:43922619G>A	ENST00000372754.1	-	9	1747	c.1739C>T	c.(1738-1740)cCa>cTa	p.P580L	MATN4_ENST00000353917.5_Missense_Mutation_p.P457L|MATN4_ENST00000372756.1_Missense_Mutation_p.P539L|MATN4_ENST00000537548.1_Missense_Mutation_p.P539L|MATN4_ENST00000342716.4_Missense_Mutation_p.P539L|MATN4_ENST00000372751.4_Missense_Mutation_p.P390L|MATN4_ENST00000360607.6_Missense_Mutation_p.P498L			O95460	MATN4_HUMAN	matrilin 4	580					extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				GCATTCGCATGGGCTCCGAAG	0.632																																					p.P539L		Atlas-SNP	.											.	MATN4	57	.	0			c.C1616T						.						49.0	51.0	50.0					20																	43922619		2203	4300	6503	SO:0001583	missense	8785	exon9			TCGCATGGGCTCC	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1739C>T	chr20.hg19:g.43922619G>A	ENSP00000361840:p.Pro580Leu	25.0	0.0		27.0	6.0	NM_003833	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.53	3.149166	0.57151	.	.	ENSG00000124159	ENST00000372753;ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132;ENST00000372751	T;T;T;T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04;0.04;0.04;0.04	4.76	2.82	0.32997	.	0.170176	0.28182	N	0.016285	T	0.57961	0.2089	L	0.52126	1.63	0.80722	D	1	B;B;B	0.23442	0.085;0.013;0.044	B;B;B	0.33960	0.173;0.021;0.056	T	0.57057	-0.7876	10	0.59425	D	0.04	.	10.213	0.43152	0.1619:0.0:0.8381:0.0	.	457;498;539	A6NNA4;O95460-4;O95460-2	.;.;.	L	390;580;539;457;498;539;539;580;390	ENSP00000361839:P390L;ENSP00000361840:P580L;ENSP00000361842:P539L;ENSP00000243983:P457L;ENSP00000353819:P498L;ENSP00000343164:P539L;ENSP00000440328:P539L;ENSP00000361837:P390L	ENSP00000255132:P580L	P	-	2	0	MATN4	43356033	1.000000	0.71417	0.532000	0.27989	0.934000	0.57294	5.539000	0.67199	0.619000	0.30197	-0.136000	0.14681	CCA	.	.		0.632	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
CSE1L	1434	hgsc.bcm.edu	37	20	47695153	47695153	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:47695153A>G	ENST00000262982.2	+	14	1599	c.1476A>G	c.(1474-1476)agA>agG	p.R492R	CSE1L_ENST00000542325.1_Silent_p.R275R|CSE1L_ENST00000396192.3_Silent_p.R436R	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	492					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TGATTTTTAGAAATCAAGTAA	0.308																																					p.R492R		Atlas-SNP	.											.	CSE1L	83	.	0			c.A1476G						.						94.0	96.0	96.0					20																	47695153		2202	4284	6486	SO:0001819	synonymous_variant	1434	exon14			TTTTAGAAATCAA	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1476A>G	chr20.hg19:g.47695153A>G		26.0	0.0		55.0	16.0	NM_001316	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	ENST00000262982.2	hg19	CCDS13412.1																																																																																			.	.		0.308	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
BCAS1	8537	hgsc.bcm.edu	37	20	52675210	52675210	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:52675210A>T	ENST00000395961.3	-	2	214	c.48T>A	c.(46-48)aaT>aaA	p.N16K	BCAS1_ENST00000371435.2_Missense_Mutation_p.N16K|BCAS1_ENST00000371440.3_Missense_Mutation_p.N16K|BCAS1_ENST00000411563.1_Intron	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	16						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CTTCTGGTTCATTCTCTTGGT	0.383																																					p.N16K		Atlas-SNP	.											.	BCAS1	77	.	0			c.T48A						.						193.0	198.0	196.0					20																	52675210		2203	4300	6503	SO:0001583	missense	8537	exon2			TGGTTCATTCTCT	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.48T>A	chr20.hg19:g.52675210A>T	ENSP00000379290:p.Asn16Lys	35.0	0.0		49.0	17.0	NM_003657	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	hg19	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.377355	0.42105	.	.	ENSG00000064787	ENST00000371440;ENST00000395961;ENST00000371435	T;T;T	0.14516	2.5;2.5;2.5	5.18	-7.66	0.01277	.	0.366486	0.23303	N	0.049656	T	0.10551	0.0258	L	0.54323	1.7	0.09310	N	0.999996	B;B;B	0.24368	0.102;0.102;0.102	B;B;B	0.24701	0.055;0.055;0.055	T	0.07616	-1.0763	10	0.62326	D	0.03	-3.5666	9.7481	0.40459	0.3474:0.0:0.5406:0.112	.	16;16;16	G3XAF7;A0AVG7;O75363	.;.;BCAS1_HUMAN	K	16	ENSP00000360495:N16K;ENSP00000379290:N16K;ENSP00000360490:N16K	ENSP00000360490:N16K	N	-	3	2	BCAS1	52108617	0.000000	0.05858	0.001000	0.08648	0.100000	0.18952	-2.087000	0.01360	-1.706000	0.01404	0.533000	0.62120	AAT	.	.		0.383	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
CASS4	57091	hgsc.bcm.edu	37	20	55027580	55027580	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:55027580A>T	ENST00000360314.3	+	6	1573	c.1348A>T	c.(1348-1350)Aag>Tag	p.K450*	CASS4_ENST00000434344.1_Intron|CASS4_ENST00000371336.3_Nonsense_Mutation_p.K450*	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	450					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						TCTGCAGCACAAGGTGGTCAG	0.562																																					p.K450X		Atlas-SNP	.											.	CASS4	121	.	0			c.A1348T						.						63.0	53.0	57.0					20																	55027580		2203	4300	6503	SO:0001587	stop_gained	57091	exon5			CAGCACAAGGTGG	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.1348A>T	chr20.hg19:g.55027580A>T	ENSP00000353462:p.Lys450*	55.0	0.0		66.0	18.0	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Nonsense_Mutation	SNP	ENST00000360314.3	hg19	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	A	37	6.114249	0.97296	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	.	.	.	5.6	-0.964	0.10326	.	0.570568	0.20583	N	0.089483	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-9.9257	6.4888	0.22103	0.4805:0.3339:0.1856:0.0	.	.	.	.	X	450	.	ENSP00000353462:K450X	K	+	1	0	CASS4	54460987	0.230000	0.23740	0.961000	0.40146	0.739000	0.42172	0.172000	0.16704	-0.379000	0.07906	0.528000	0.53228	AAG	.	.		0.562	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
DIDO1	11083	hgsc.bcm.edu	37	20	61526440	61526440	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr20:61526440A>G	ENST00000266070.4	-	9	2617	c.2292T>C	c.(2290-2292)tcT>tcC	p.S764S	DIDO1_ENST00000395335.2_Silent_p.S764S|DIDO1_ENST00000395340.1_Silent_p.S764S|DIDO1_ENST00000395343.1_Silent_p.S764S	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	764	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					AAAGCTCTTTAGATACAAGTT	0.453																																					p.S764S	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.T2292C						.						157.0	171.0	166.0					20																	61526440		2203	4300	6503	SO:0001819	synonymous_variant	11083	exon9			CTCTTTAGATACA	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2292T>C	chr20.hg19:g.61526440A>G		60.0	0.0		84.0	26.0	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	hg19	CCDS33506.1																																																																																			.	.		0.453	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
BACE2	25825	hgsc.bcm.edu	37	21	42622773	42622773	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr21:42622773T>C	ENST00000330333.6	+	7	1542	c.1079T>C	c.(1078-1080)aTc>aCc	p.I360T	BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Missense_Mutation_p.I360T|BACE2_ENST00000347667.5_Intron	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	360					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				AAAATCTCCATCTACCTGAGA	0.463																																					p.I360T		Atlas-SNP	.											.	BACE2	45	.	0			c.T1079C						.						119.0	101.0	107.0					21																	42622773		2203	4300	6503	SO:0001583	missense	25825	exon7			TCTCCATCTACCT	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1079T>C	chr21.hg19:g.42622773T>C	ENSP00000332979:p.Ile360Thr	48.0	0.0		63.0	13.0	NM_138992	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	hg19	CCDS13668.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.536116	0.85812	.	.	ENSG00000182240	ENST00000330333;ENST00000328735;ENST00000544566	T;T	0.47177	0.85;0.85	5.48	5.48	0.80851	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.054482	0.64402	D	0.000001	T	0.68622	0.3021	M	0.74881	2.28	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72679	-0.4220	10	0.72032	D	0.01	.	14.7744	0.69713	0.0:0.0:0.0:1.0	.	360;360	Q9Y5Z0-3;Q9Y5Z0	.;BACE2_HUMAN	T	360;360;265	ENSP00000332979:I360T;ENSP00000333854:I360T	ENSP00000333854:I360T	I	+	2	0	BACE2	41544643	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.338000	0.79269	2.082000	0.62665	0.528000	0.53228	ATC	.	.		0.463	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
CCDC116	164592	hgsc.bcm.edu	37	22	21988580	21988580	+	Silent	SNP	A	A	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr22:21988580A>G	ENST00000292779.3	+	3	503	c.342A>G	c.(340-342)ccA>ccG	p.P114P	CCDC116_ENST00000607942.1_Silent_p.P114P	NM_152612.2	NP_689825.2	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	114										endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(5)	22	Colorectal(54;0.105)					TGCAGGACCCAGTGGAGGTGC	0.672																																					p.P114P		Atlas-SNP	.											.	CCDC116	56	.	0			c.A342G						.						89.0	82.0	84.0					22																	21988580		2203	4299	6502	SO:0001819	synonymous_variant	164592	exon3			GGACCCAGTGGAG	BC033499	CCDS13791.1	22q11.21	2006-06-27			ENSG00000161180	ENSG00000161180			26688	protein-coding gene	gene with protein product						12477932	Standard	NM_152612		Approved	FLJ36046	uc002zve.3	Q8IYX3	OTTHUMG00000150821	ENST00000292779.3:c.342A>G	chr22.hg19:g.21988580A>G		46.0	0.0		53.0	13.0	NM_152612	Q8N9Y9	Silent	SNP	ENST00000292779.3	hg19	CCDS13791.1																																																																																			.	.		0.672	CCDC116-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320199.1	NM_152612	
TRIOBP	11078	hgsc.bcm.edu	37	22	38120263	38120263	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr22:38120263C>G	ENST00000406386.3	+	7	1955	c.1700C>G	c.(1699-1701)cCc>cGc	p.P567R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	567					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					ACCTCCTCTCCCAATAGAGCC	0.577																																					p.P567R		Atlas-SNP	.											.	TRIOBP	262	.	0			c.C1700G						.						32.0	53.0	46.0					22																	38120263		1830	4097	5927	SO:0001583	missense	11078	exon7			CCTCTCCCAATAG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1700C>G	chr22.hg19:g.38120263C>G	ENSP00000384312:p.Pro567Arg	250.0	0.0		295.0	28.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	hg19	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	-	13.41	2.227411	0.39399	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.39229	1.09	3.08	2.02	0.26589	.	.	.	.	.	T	0.39937	0.1097	L	0.55481	1.735	0.21499	N	0.999663	P	0.42757	0.789	B	0.44278	0.445	T	0.28364	-1.0046	9	0.87932	D	0	.	5.493	0.16787	0.0:0.8236:0.0:0.1764	.	567	Q9H2D6	TARA_HUMAN	R	567	ENSP00000384312:P567R	ENSP00000384312:P567R	P	+	2	0	TRIOBP	36450209	0.318000	0.24598	0.281000	0.24762	0.446000	0.32137	1.709000	0.37909	0.266000	0.21894	0.289000	0.19496	CCC	.	.		0.577	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
CACNA1I	8911	hgsc.bcm.edu	37	22	40059828	40059828	+	Silent	SNP	G	G	A	rs58500586	byFrequency	TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr22:40059828G>A	ENST00000402142.3	+	19	3579	c.3579G>A	c.(3577-3579)caG>caA	p.Q1193Q	CACNA1I_ENST00000404898.1_Silent_p.Q1158Q|CACNA1I_ENST00000401624.1_Silent_p.Q1193Q|CACNA1I_ENST00000407673.1_Silent_p.Q1158Q|CACNA1I_ENST00000336649.4_Silent_p.Q1199Q|CACNA1I_ENST00000400164.3_Silent_p.Q1158Q	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1193					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	AGCGGCCTCAGATCGAGGCCG	0.622																																					p.Q1193Q		Atlas-SNP	.											.	CACNA1I	264	.	0			c.G3579A						.						98.0	108.0	105.0					22																	40059828		2034	4178	6212	SO:0001819	synonymous_variant	8911	exon19			GCCTCAGATCGAG	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.3579G>A	chr22.hg19:g.40059828G>A		66.0	0.0		51.0	15.0	NM_021096	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	hg19	CCDS46710.1																																																																																			.	G|0.997;C|0.003		0.622	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
VCX3B	425054	hgsc.bcm.edu	37	X	8434394	8434395	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:8434394_8434395GA>AT	ENST00000381032.1	+	3	1018_1019	c.711_712GA>AT	c.(709-714)gaGAgc>gaATgc	p.S238C	VCX3B_ENST00000381029.4_Missense_Mutation_p.S206C|VCX3B_ENST00000444481.1_Missense_Mutation_p.S208C|VCX3B_ENST00000453306.1_Missense_Mutation_p.S178C|VCX3B_ENST00000440654.2_Missense_Mutation_p.S178C	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	238	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						TGAGTCAGGAGAGCGAGATGGA	0.559																																					p.E237E|p.S238C		Atlas-SNP	.											.	VCX3B	34	.	0			c.G711A|c.A712T						.																																			SO:0001583	missense	425054	exon3			TCAGGAGAGCGAG|CAGGAGAGCGAGA		CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	Exception_encountered	chrX.hg19:g.8434394_8434395delinsAT	ENSP00000370420:p.Ser238Cys	212.0	0.0		272.0	26.0	NM_001001888	C9JS46|Q4KN12	Silent|Missense_Mutation	SNP	ENST00000381032.1	hg19	CCDS48077.2																																																																																			.	.		0.559	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055691.1		
DMD	1756	hgsc.bcm.edu	37	X	31366711	31366711	+	Missense_Mutation	SNP	T	T	G	rs398124080		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:31366711T>G	ENST00000357033.4	-	61	9331	c.9125A>C	c.(9124-9126)cAc>cCc	p.H3042P	DMD_ENST00000541735.1_Missense_Mutation_p.H582P|DMD_ENST00000474231.1_Missense_Mutation_p.H582P|DMD_ENST00000343523.2_Missense_Mutation_p.H582P|DMD_ENST00000378677.2_Missense_Mutation_p.H3038P|DMD_ENST00000359836.1_Missense_Mutation_p.H582P|RNU6-894P_ENST00000517094.1_RNA|DMD_ENST00000378707.3_Missense_Mutation_p.H582P	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3042					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAAGTCCCTGTGGGCTTCATG	0.408																																					p.H3042P		Atlas-SNP	.											.	DMD	2127	.	0			c.A9125C						.						67.0	58.0	61.0					X																	31366711		2202	4300	6502	SO:0001583	missense	1756	exon61			TCCCTGTGGGCTT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9125A>C	chrX.hg19:g.31366711T>G	ENSP00000354923:p.His3042Pro	125.0	0.0		245.0	161.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203333	0.79127	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	T;T;T;T;T;T;T;T	0.64260	3.84;-0.09;-0.09;3.8;3.82;3.8;3.82;3.86	5.64	5.64	0.86602	.	0.000000	0.38663	U	0.001605	T	0.79209	0.4407	M	0.80028	2.48	0.46376	D	0.99901	P;D;D;D;D;D;D;D;D;D;D	0.71674	0.9;0.998;0.995;0.996;0.996;0.96;0.966;0.966;0.991;0.995;0.998	P;D;D;P;P;P;P;P;P;D;D	0.75484	0.699;0.915;0.986;0.896;0.896;0.782;0.703;0.703;0.823;0.914;0.964	T	0.79417	-0.1812	10	0.36615	T	0.2	.	14.8565	0.70341	0.0:0.0:0.0:1.0	.	3034;3042;3038;1701;1698;582;582;582;582;582;2919	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	P	3034;1701;1698;738;3038;3042;582;582;3042;2919;582;582;582	ENSP00000350765:H738P;ENSP00000367948:H3038P;ENSP00000354923:H3042P;ENSP00000352894:H582P;ENSP00000340057:H582P;ENSP00000367979:H582P;ENSP00000444119:H582P;ENSP00000417123:H582P	ENSP00000340057:H582P	H	-	2	0	DMD	31276632	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.694000	0.74587	1.890000	0.54733	0.430000	0.28490	CAC	.	.		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CXorf22	170063	hgsc.bcm.edu	37	X	35989801	35989801	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:35989801T>A	ENST00000297866.5	+	12	2135	c.2069T>A	c.(2068-2070)cTg>cAg	p.L690Q		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	690										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GAAGAGGAGCTGTCTTCAGCA	0.463																																					p.L690Q		Atlas-SNP	.											.	CXorf22	272	.	0			c.T2069A						.						42.0	36.0	38.0					X																	35989801		2202	4300	6502	SO:0001583	missense	170063	exon12			AGGAGCTGTCTTC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2069T>A	chrX.hg19:g.35989801T>A	ENSP00000297866:p.Leu690Gln	121.0	0.0		192.0	68.0	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	hg19	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	T	13.53	2.264398	0.39995	.	.	ENSG00000165164	ENST00000297866	T	0.17370	2.28	5.72	-9.28	0.00656	.	2.243790	0.01612	N	0.022591	T	0.13457	0.0326	M	0.69823	2.125	0.09310	N	1	P	0.37276	0.589	B	0.35971	0.215	T	0.30937	-0.9961	10	0.11794	T	0.64	.	2.4198	0.04445	0.2145:0.3968:0.2124:0.1763	.	690	Q6ZTR5	CX022_HUMAN	Q	690	ENSP00000297866:L690Q	ENSP00000297866:L690Q	L	+	2	0	CXorf22	35899722	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.767000	0.01795	-2.618000	0.00441	-0.391000	0.06502	CTG	.	.		0.463	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
ARMCX2	9823	hgsc.bcm.edu	37	X	100912386	100912386	+	Silent	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:100912386G>T	ENST00000328766.5	-	5	642	c.189C>A	c.(187-189)atC>atA	p.I63I	ARMCX2_ENST00000330154.2_Silent_p.I63I|ARMCX2_ENST00000356824.4_Silent_p.I63I|ARMCX2_ENST00000467416.1_5'UTR	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	63						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						ACCCAAGGTCGATTGTGAATC	0.597																																					p.I63I		Atlas-SNP	.											.	ARMCX2	75	.	0			c.C189A						.						72.0	69.0	70.0					X																	100912386		2203	4300	6503	SO:0001819	synonymous_variant	9823	exon5			AAGGTCGATTGTG	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.189C>A	chrX.hg19:g.100912386G>T		42.0	0.0		40.0	13.0	NM_014782	O60267|Q5H9D9	Silent	SNP	ENST00000328766.5	hg19	CCDS14490.1																																																																																			.	.		0.597	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782	
WDR44	54521	hgsc.bcm.edu	37	X	117570751	117570751	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:117570751T>A	ENST00000254029.3	+	14	2333	c.1938T>A	c.(1936-1938)caT>caA	p.H646Q	WDR44_ENST00000371825.3_Missense_Mutation_p.H646Q|WDR44_ENST00000371822.5_Missense_Mutation_p.H621Q	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	646						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						GTTTTCAACATATAGATTTTG	0.348																																					p.H646Q		Atlas-SNP	.											.	WDR44	188	.	0			c.T1938A						.						111.0	97.0	102.0					X																	117570751		2202	4299	6501	SO:0001583	missense	54521	exon14			TCAACATATAGAT	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1938T>A	chrX.hg19:g.117570751T>A	ENSP00000254029:p.His646Gln	65.0	0.0		106.0	66.0	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	hg19	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.99|17.99	3.523682|3.523682	0.64747|0.64747	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825;ENST00000318919|ENST00000371848	D;T;T|.	0.86865|.	-2.18;-1.49;-1.49|.	5.58|5.58	0.409|0.409	0.16382|0.16382	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75072|0.75072	0.3800|0.3800	M|M	0.88842|0.88842	2.985|2.985	0.45883|0.45883	D|D	0.99873|0.99873	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.999;0.999;1.0|.	T|T	0.74542|0.74542	-0.3631|-0.3631	10|5	0.87932|.	D|.	0|.	-7.626|-7.626	9.6514|9.6514	0.39899|0.39899	0.0:0.3823:0.0:0.6177|0.0:0.3823:0.0:0.6177	.|.	621;646;646;646|.	F8W913;E9PCI7;Q5JSH3-2;Q5JSH3|.	.;.;.;WDR44_HUMAN|.	Q|N	621;646;646;32|546	ENSP00000360887:H621Q;ENSP00000254029:H646Q;ENSP00000360890:H646Q|.	ENSP00000254029:H646Q|.	H|Y	+|+	3|1	2|0	WDR44|WDR44	117454779|117454779	0.997000|0.997000	0.39634|0.39634	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	0.381000|0.381000	0.20619|0.20619	0.015000|0.015000	0.14971|0.14971	0.478000|0.478000	0.44815|0.44815	CAT|TAT	.	.		0.348	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
TMEM255A	55026	hgsc.bcm.edu	37	X	119410802	119410802	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:119410802T>A	ENST00000309720.5	-	8	808	c.685A>T	c.(685-687)Aac>Tac	p.N229Y	TMEM255A_ENST00000440464.1_Intron|TMEM255A_ENST00000371369.4_Missense_Mutation_p.N205Y|TMEM255A_ENST00000371352.1_Missense_Mutation_p.N65Y	NM_017938.3	NP_060408.3	Q5JRV8	T255A_HUMAN	transmembrane protein 255A	229						integral component of membrane (GO:0016021)											CCAACAATGTTGAGGATGGTG	0.517																																					p.N229Y		Atlas-SNP	.											.	.	.	.	0			c.A685T						.						234.0	169.0	191.0					X																	119410802		2203	4300	6503	SO:0001583	missense	55026	exon8			CAATGTTGAGGAT	BC047054	CCDS14597.1, CCDS43986.1, CCDS48157.1	Xq24	2012-11-30	2012-11-30	2012-11-30	ENSG00000125355	ENSG00000125355			26086	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member A"""	FAM70A		12477932	Standard	NM_017938		Approved	FLJ20716	uc004eso.4	Q5JRV8	OTTHUMG00000022298	ENST00000309720.5:c.685A>T	chrX.hg19:g.119410802T>A	ENSP00000310110:p.Asn229Tyr	68.0	0.0		88.0	58.0	NM_017938	A8K0W9|B1APR4|B3KPI6|E9PAR3|Q86Y72|Q9NWN8	Missense_Mutation	SNP	ENST00000309720.5	hg19	CCDS14597.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.460942	0.84317	.	.	ENSG00000125355	ENST00000309720;ENST00000371369;ENST00000371352	T;T;T	0.57752	0.38;0.38;0.38	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.73830	0.3637	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.78427	-0.2208	10	0.87932	D	0	-14.5795	13.3151	0.60403	0.0:0.0:0.0:1.0	.	205;229	B1APR4;Q5JRV8	.;FA70A_HUMAN	Y	229;205;65	ENSP00000310110:N229Y;ENSP00000360420:N205Y;ENSP00000360403:N65Y	ENSP00000310110:N229Y	N	-	1	0	FAM70A	119294830	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.698000	0.84413	1.737000	0.51674	0.481000	0.45027	AAC	.	.		0.517	TMEM255A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058091.1	NM_017938	
ZNF75D	7626	hgsc.bcm.edu	37	X	134427746	134427746	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:134427746G>T	ENST00000370766.3	-	3	3030	c.321C>A	c.(319-321)aaC>aaA	p.N107K	ZNF75D_ENST00000370764.1_Missense_Mutation_p.N107K|ZNF75D_ENST00000494295.1_Intron	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	107	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TCTGCACCCAGTTCTGGGTCT	0.502																																					p.N107K		Atlas-SNP	.											.	ZNF75D	65	.	0			c.C321A						.						84.0	77.0	79.0					X																	134427746		2203	4300	6503	SO:0001583	missense	7626	exon2			CACCCAGTTCTGG	S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.321C>A	chrX.hg19:g.134427746G>T	ENSP00000359802:p.Asn107Lys	38.0	0.0		77.0	14.0	NM_007131	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	ENST00000370766.3	hg19	CCDS14648.1	.	.	.	.	.	.	.	.	.	.	G	1.322	-0.599278	0.03744	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.05319	3.46;3.46	2.98	2.09	0.27110	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.07234	0.0183	L	0.53249	1.67	0.09310	N	1	B;B	0.13145	0.004;0.007	B;B	0.14578	0.007;0.011	T	0.29150	-1.0021	9	0.54805	T	0.06	.	5.5968	0.17331	0.161:0.0:0.839:0.0	.	107;107	P51815;A6NK62	ZN75D_HUMAN;.	K	107	ENSP00000359802:N107K;ENSP00000359800:N107K	ENSP00000359800:N107K	N	-	3	2	ZNF75D	134255412	0.356000	0.24930	0.046000	0.18839	0.385000	0.30292	0.475000	0.22164	0.641000	0.30601	0.509000	0.49947	AAC	.	.		0.502	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058415.1	NM_007131	
MT-ND3	4537	hgsc.bcm.edu	37	M	10253	10253	+	Silent	SNP	T	T	C			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrM:10253T>C	ENST00000361227.2	+	1	195	c.195T>C	c.(193-195)ttT>ttC	p.F65F	MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	65					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										TTCTTATTATTTGATCTAGAA	0.428																																					p.F65F		Atlas-SNP	.											.	.	.	.	0			c.T195C						.																																			SO:0001819	synonymous_variant	0	exon1			ATTATTTGATCTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.195T>C	chrM.hg19:g.10253T>C		24.0	0.0		85.0	45.0	ENST00000361227		Silent	SNP	ENST00000361227.2	hg19																																																																																				.	.		0.428	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
ZNF583	147949	hgsc.bcm.edu	37	19	56935118	56935153	+	In_Frame_Del	DEL	GTGGATACCTAATTGTACATCAGAGAATTCATACTG	GTGGATACCTAATTGTACATCAGAGAATTCATACTG	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	GTGGATACCTAATTGTACATCAGAGAATTCATACTG	GTGGATACCTAATTGTACATCAGAGAATTCATACTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:56935118_56935153delGTGGATACCTAATTGTACATCAGAGAATTCATACTG	ENST00000333201.9	+	5	1301_1336	c.1091_1126delGTGGATACCTAATTGTACATCAGAGAATTCATACTG	c.(1090-1128)cgtggatacctaattgtacatcagagaattcatactgga>cga	p.GYLIVHQRIHTG365del	ZNF583_ENST00000585612.1_3'UTR|ZNF583_ENST00000291598.7_In_Frame_Del_p.GYLIVHQRIHTG365del	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q371*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TTTAGCCATCGTGGATACCTAATTGTACATCAGAGAATTCATACTGGAGAGAGACC	0.415																																					p.364_375del		Atlas-INDEL	.											.	ZNF583	83	.	1	Substitution - Nonsense(1)	lung(1)	c.1090_1125del						.																																			SO:0001651	inframe_deletion	147949	exon5			.	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1091_1126delGTGGATACCTAATTGTACATCAGAGAATTCATACTG	chr19.hg19:g.56935118_56935153delGTGGATACCTAATTGTACATCAGAGAATTCATACTG	ENSP00000388502:p.Gly365_Gly376del	55.0	0.0		126.0	18.0	NM_152478	O14850|Q2NKK3	In_Frame_Del	DEL	ENST00000333201.9	hg19	CCDS12943.1																																																																																			.	.		0.415	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
UGT2B4	7363	hgsc.bcm.edu	37	4	70361213	70361216	+	Frame_Shift_Del	DEL	GTAT	GTAT	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	GTAT	GTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:70361213_70361216delGTAT	ENST00000305107.6	-	1	410_413	c.364_367delATAC	c.(364-369)atacttfs	p.IL122fs	UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000512583.1_Frame_Shift_Del_p.IL122fs	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	122					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	AACTTTCTAAGTATGTCATTAAAT	0.338																																					p.122_123del		Atlas-INDEL	.											.	UGT2B4	105	.	0			c.365_368del						.																																			SO:0001589	frameshift_variant	7363	exon1			.	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.364_367delATAC	chr4.hg19:g.70361213_70361216delGTAT	ENSP00000305221:p.Ile122fs	89.0	0.0		119.0	42.0	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Frame_Shift_Del	DEL	ENST00000305107.6	hg19	CCDS43234.1																																																																																			.	.		0.338	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
MAN2B2	23324	hgsc.bcm.edu	37	4	6596347	6596354	+	Frame_Shift_Del	DEL	GCTCGGTG	GCTCGGTG	-	rs368931196|rs201727705	byFrequency	TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	GCTCGGTG	GCTCGGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr4:6596347_6596354delGCTCGGTG	ENST00000285599.3	+	7	981_988	c.945_952delGCTCGGTG	c.(943-954)gagctcggtgtcfs	p.ELGV315fs	MAN2B2_ENST00000504248.1_Splice_Site_p.ELGV264fs	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	315					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						ATGCTGCCGAGCTCGGTGTCTCGGTGCA	0.601																																					p.315_317del		Atlas-INDEL	.											.	MAN2B2	80	.	0			c.944_951del						.																																			SO:0001589	frameshift_variant	23324	exon7			.	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.945_952delGCTCGGTG	chr4.hg19:g.6596347_6596354delGCTCGGTG	ENSP00000285599:p.Glu315fs	46.0	0.0		51.0	14.0	NM_015274	Q66MP2|Q86T67	Frame_Shift_Del	DEL	ENST00000285599.3	hg19	CCDS33951.1																																																																																			.	.		0.601	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
SLC30A1	7779	hgsc.bcm.edu	37	1	211748979	211748980	+	Frame_Shift_Ins	INS	-	-	CCTAC			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:211748979_211748980insCCTAC	ENST00000367001.4	-	2	1403_1404	c.1274_1275insGTAGG	c.(1273-1275)ggcfs	p.-425fs		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1						cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TTGATTTAGAGCCTACACTAGC	0.446																																					p.G425_S426delinsGX		Atlas-INDEL	.											.	SLC30A1	27	.	0			c.1275_1276insGTAGG						.																																			SO:0001589	frameshift_variant	7779	exon2			.	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1270_1274dupGTAGG	chr1.hg19:g.211748980_211748984dupCCTAC	ENSP00000355968:p.Gly425fs	71.0	0.0		84.0	19.0	NM_021194	Q0VAK9|Q9BZF6	Frame_Shift_Ins	INS	ENST00000367001.4	hg19	CCDS1499.1																																																																																			.	.		0.446	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
UTRN	7402	hgsc.bcm.edu	37	6	144869853	144869874	+	Frame_Shift_Del	DEL	ATTTCAATTCCTGCTGATCTTG	ATTTCAATTCCTGCTGATCTTG	-	rs116515472	byFrequency	TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	ATTTCAATTCCTGCTGATCTTG	ATTTCAATTCCTGCTGATCTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr6:144869853_144869874delATTTCAATTCCTGCTGATCTTG	ENST00000367545.3	+	46	6673_6694	c.6673_6694delATTTCAATTCCTGCTGATCTTG	c.(6673-6696)atttcaattcctgctgatcttgatfs	p.ISIPADLD2225fs		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2225					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TACTTCGGAAATTTCAATTCCTGCTGATCTTGATAAAACTAT	0.401																																					p.2224_2231del		Atlas-INDEL	.											.	UTRN	327	.	0			c.6672_6693del						.																																			SO:0001589	frameshift_variant	7402	exon46			.	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.6673_6694delATTTCAATTCCTGCTGATCTTG	chr6.hg19:g.144869853_144869874delATTTCAATTCCTGCTGATCTTG	ENSP00000356515:p.Ile2225fs	73.0	0.0		102.0	12.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Frame_Shift_Del	DEL	ENST00000367545.3	hg19	CCDS34547.1																																																																																			.	.		0.401	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
FNDC5	252995	hgsc.bcm.edu	37	1	33330349	33330349	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr1:33330349delT	ENST00000373471.3	-	5	615	c.549delA	c.(547-549)gaafs	p.E183fs	FNDC5_ENST00000609187.1_Frame_Shift_Del_p.E108fs|FNDC5_ENST00000481487.1_5'Flank|FNDC5_ENST00000496770.1_Frame_Shift_Del_p.E108fs	NM_001171940.1|NM_153756.2	NP_001165411.2|NP_715637.2	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5	183					positive regulation of brown fat cell differentiation (GO:0090336)|response to muscle activity (GO:0014850)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TGTTATTGGGTTCATTGTCCT	0.562																																					p.P109fs		Atlas-INDEL	.											.	FNDC5	16	.	0			c.325delC						.						167.0	140.0	149.0					1																	33330349		2203	4300	6503	SO:0001589	frameshift_variant	252995	exon5			.	AK092102	CCDS369.1, CCDS369.2, CCDS65483.1	1p34.3	2013-10-16			ENSG00000160097	ENSG00000160097		"""Fibronectin type III domain containing"""	20240	protein-coding gene	gene with protein product	"""irisin"""	611906				12384288, 22237023, 24120943	Standard	NM_153756		Approved	FRCP2	uc001bwg.3	Q8NAU1	OTTHUMG00000004015	ENST00000373471.3:c.549delA	chr1.hg19:g.33330349delT	ENSP00000362570:p.Glu183fs	60.0	0.0		73.0	22.0	NM_153756	A6NMC9|D3DPQ6|Q6P6D9|Q7Z676	Frame_Shift_Del	DEL	ENST00000373471.3	hg19																																																																																				.	.		0.562	FNDC5-001	KNOWN	non_ATG_start|basic	protein_coding	protein_coding	OTTHUMT00000011467.3	NM_153756	
SPECC1L	23384	hgsc.bcm.edu	37	22	24698203	24698203	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr22:24698203delA	ENST00000314328.9	+	3	289	c.4delA	c.(4-6)aagfs	p.K3fs	SPECC1L_ENST00000416735.1_3'UTR|SPECC1L_ENST00000437398.1_Frame_Shift_Del_p.K3fs|SPECC1L_ENST00000541492.1_Frame_Shift_Del_p.K3fs|SPECC1L-ADORA2A_ENST00000358654.2_Frame_Shift_Del_p.K3fs	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	3					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						GCCCAGAATGAAGAAAGCAAG	0.408																																					p.M1fs		Atlas-INDEL	.											.	SPECC1L	85	.	0			c.3delG						.						72.0	65.0	67.0					22																	24698203		2203	4300	6503	SO:0001589	frameshift_variant	23384	exon2			.	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.4delA	chr22.hg19:g.24698203delA	ENSP00000325785:p.Lys3fs	147.0	0.0		215.0	66.0	NM_001145468	B7Z758|F5H1H6|O15081	Frame_Shift_Del	DEL	ENST00000314328.9	hg19	CCDS33619.1																																																																																			.	.		0.408	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
GPHN	10243	hgsc.bcm.edu	37	14	67291253	67291253	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr14:67291253delC	ENST00000315266.5	+	4	1384	c.263delC	c.(262-264)acafs	p.T88fs	GPHN_ENST00000459628.1_Intron|GPHN_ENST00000543237.1_Frame_Shift_Del_p.T88fs|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000478722.1_Frame_Shift_Del_p.T88fs|GPHN_ENST00000305960.9_Intron	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	88	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ACTGGAGGAACAGGATTTGCA	0.338			T	MLL	AL																																p.T88fs		Atlas-INDEL	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.262delA						.						102.0	95.0	97.0					14																	67291253		2203	4300	6503	SO:0001589	frameshift_variant	10243	exon4			.	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.263delC	chr14.hg19:g.67291253delC	ENSP00000312771:p.Thr88fs	77.0	0.0		103.0	25.0	NM_001024218	Q9H4E9|Q9P2G2	Frame_Shift_Del	DEL	ENST00000315266.5	hg19	CCDS32103.1																																																																																			.	.		0.338	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
CXorf36	79742	hgsc.bcm.edu	37	X	45010995	45010995	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chrX:45010995delC	ENST00000398000.2	-	5	1278	c.1204delG	c.(1204-1206)gccfs	p.A403fs	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	403						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						TGGCTGGCGGCCCCAAGGACT	0.537																																					p.A402fs		Atlas-INDEL	.											.	CXorf36	53	.	0			c.1205delC						.						74.0	67.0	69.0					X																	45010995		1568	3582	5150	SO:0001589	frameshift_variant	79742	exon5			.	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.1204delG	chrX.hg19:g.45010995delC	ENSP00000381086:p.Ala403fs	69.0	0.0		76.0	54.0	NM_176819	A8MUU5|B2RPN7|Q6UWJ5	Frame_Shift_Del	DEL	ENST00000398000.2	hg19	CCDS48096.1																																																																																			.	.		0.537	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689	
ZNF510	22869	hgsc.bcm.edu	37	9	99521444	99521447	+	Frame_Shift_Del	DEL	TTTT	TTTT	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	TTTT	TTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr9:99521444_99521447delTTTT	ENST00000375231.1	-	6	2315_2318	c.1665_1668delAAAA	c.(1663-1668)cgaaaafs	p.RK555fs	ZNF510_ENST00000223428.4_Frame_Shift_Del_p.RK555fs			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TGAGATGATCTTTTCGCCAGAAGG	0.417																																					p.556_557del		Atlas-INDEL	.											.	ZNF510	59	.	0			c.1666_1669del						.																																			SO:0001589	frameshift_variant	22869	exon6			.	AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.1665_1668delAAAA	chr9.hg19:g.99521444_99521447delTTTT	ENSP00000364379:p.Arg555fs	78.0	0.0		88.0	19.0	NM_014930	Q5SZP5	Frame_Shift_Del	DEL	ENST00000375231.1	hg19	CCDS35074.1																																																																																			.	.		0.417	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053287.1	NM_014930	
MBOAT7	79143	hgsc.bcm.edu	37	19	54677808	54677808	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr19:54677808delC	ENST00000245615.1	-	8	1829	c.1349delG	c.(1348-1350)ggcfs	p.G450fs	MBOAT7_ENST00000431666.2_Frame_Shift_Del_p.G377fs|TMC4_ENST00000476013.2_5'Flank|MBOAT7_ENST00000338624.6_Frame_Shift_Del_p.G377fs|TMC4_ENST00000376591.4_5'Flank|TMC4_ENST00000301187.4_5'Flank	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	450					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCTGGGGCTGCCCCCACCTAA	0.662																																					p.G450fs	NSCLC(97;826 2151 10470 22540)	Atlas-INDEL	.											.	MBOAT7	37	.	0			c.1350delC						.						29.0	30.0	30.0					19																	54677808		2203	4300	6503	SO:0001589	frameshift_variant	79143	exon8			.	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.1349delG	chr19.hg19:g.54677808delC	ENSP00000245615:p.Gly450fs	83.0	0.0		129.0	16.0	NM_024298	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Frame_Shift_Del	DEL	ENST00000245615.1	hg19	CCDS12883.1																																																																																			.	.		0.662	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	NM_024298	
NLGN1	22871	hgsc.bcm.edu	37	3	173997093	173997094	+	In_Frame_Ins	INS	-	-	ACC			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr3:173997093_173997094insACC	ENST00000457714.1	+	6	1731_1732	c.1302_1303insACC	c.(1303-1305)acc>ACCacc	p.435_435T>TT	NLGN1_ENST00000361589.4_In_Frame_Ins_p.435_435T>TT|NLGN1_ENST00000401917.3_In_Frame_Ins_p.475_475T>TT|NLGN1_ENST00000545397.1_In_Frame_Ins_p.435_435T>TT|NLGN1_ENST00000466350.1_3'UTR	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	452					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TTTTGAGAGAAACCATTAAGTT	0.391																																					p.E434delinsET		Atlas-INDEL	.											.	NLGN1	209	.	0			c.1302_1303insACC						.																																			SO:0001652	inframe_insertion	22871	exon6			.	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1303_1305dupACC	chr3.hg19:g.173997094_173997096dupACC	ENSP00000392500:p.Thr435dup	81.0	0.0		142.0	33.0	NM_014932	Q9UPT2	In_Frame_Ins	INS	ENST00000457714.1	hg19	CCDS3222.1																																																																																			.	.		0.391	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
IMPA1	3612	hgsc.bcm.edu	37	8	82598039	82598046	+	Intron	DEL	CTGTTTCT	CTGTTTCT	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	CTGTTTCT	CTGTTTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr8:82598039_82598046delCTGTTTCT	ENST00000256108.5	-	1	442				IMPA1_ENST00000449740.2_Frame_Shift_Del_p.ETA36fs|IMPA1_ENST00000311489.4_Intron|IMPA1_ENST00000523710.1_Intron	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1						inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	CTGTTTCCTGCTGTTTCTGTCCTGGTCA	0.51																																					p.36_38del		Atlas-INDEL	.											.	IMPA1	46	.	0			c.106_113del						.																																			SO:0001627	intron_variant	3612	exon2			.		CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.23+440AGAAACAG>-	chr8.hg19:g.82598039_82598046delCTGTTTCT		186.0	0.0		224.0	59.0	NM_001144878	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Frame_Shift_Del	DEL	ENST00000256108.5	hg19	CCDS6231.1																																																																																			.	.		0.510	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379723.1		
COL6A2	1292	hgsc.bcm.edu	37	21	47549212	47549215	+	Intron	DEL	TAAA	TAAA	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	TAAA	TAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr21:47549212_47549215delTAAA	ENST00000300527.4	+	28	2565				COL6A2_ENST00000409416.1_3'UTR|COL6A2_ENST00000357838.4_Frame_Shift_Del_p.LN855fs|COL6A2_ENST00000310645.5_3'UTR|COL6A2_ENST00000397763.1_Frame_Shift_Del_p.LN855fs	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAACAGTTGCTAAACGCCACGGAG	0.701																																					p.855_856del		Atlas-INDEL	.											.	COL6A2	351	.	0			c.2563_2566del						.																																			SO:0001627	intron_variant	1292	exon28			.	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2462-2653TAAA>-	chr21.hg19:g.47549212_47549215delTAAA		147.0	0.0		134.0	41.0	NM_058174	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Frame_Shift_Del	DEL	ENST00000300527.4	hg19	CCDS13728.1																																																																																			.	.		0.701	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
ANO5	203859	hgsc.bcm.edu	37	11	22247597	22247597	+	Splice_Site	DEL	G	G	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr11:22247597delG	ENST00000324559.8	+	6	679	c.362delG	c.(361-363)agg>ag	p.R121fs		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	121					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GAAGACAAAAGGGTAAATGTA	0.343																																					p.R121fs		Atlas-INDEL	.											.	ANO5	162	.	0			c.361delA						.						50.0	54.0	53.0					11																	22247597		2203	4300	6503	SO:0001630	splice_region_variant	203859	exon6			.	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.363+1G>-	chr11.hg19:g.22247597delG		228.0	0.0		326.0	79.0	NM_213599		Frame_Shift_Del	DEL	ENST00000324559.8	hg19	CCDS31444.1																																																																																			.	.		0.343	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	Frame_Shift_Del
GRIK1	2897	hgsc.bcm.edu	37	21	30927495	30927497	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr21:30927495_30927497delCAC	ENST00000399907.1	-	16	2894_2896	c.2483_2485delGTG	c.(2482-2487)agtgcc>acc	p.828_829SA>T	GRIK1_ENST00000399909.1_In_Frame_Del_p.813_814SA>T|GRIK1_ENST00000535441.1_In_Frame_Del_p.830_831SA>T|GRIK1_ENST00000389124.2_In_Frame_Del_p.828_829SA>T|GRIK1_ENST00000389125.3_In_Frame_Del_p.813_814SA>T|GRIK1_ENST00000309434.7_In_Frame_Del_p.830_831SA>T|GRIK1_ENST00000399913.1_In_Frame_Del_p.828_829SA>T|GRIK1_ENST00000327783.4_In_Frame_Del_p.828_829SA>T|GRIK1_ENST00000399914.1_In_Frame_Del_p.813_814SA>T	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	828					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	ACTCCCAGGGCACTGGCTTCTTT	0.463																																					p.828_829del		Atlas-INDEL	.											GRIK1_ENST00000399907,NS,carcinoma,0,2	GRIK1	293	.	0			c.2484_2486del						.																																			SO:0001651	inframe_deletion	2897	exon16			.		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2483_2485delGTG	chr21.hg19:g.30927495_30927497delCAC	ENSP00000382791:p.Ser828_Ala829delinsThr	56.0	0.0		58.0	18.0	NM_000830	Q13001|Q86SU9	In_Frame_Del	DEL	ENST00000399907.1	hg19	CCDS42913.1																																																																																			.	.		0.463	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
HGF	3082	hgsc.bcm.edu	37	7	81350161	81350197	+	Splice_Site	DEL	AATCTAGACATAAAATATACAGAAATAAGTCCAATGA	AATCTAGACATAAAATATACAGAAATAAGTCCAATGA	-	rs151068465		TCGA-DD-AAE7-01A-11D-A40R-10	TCGA-DD-AAE7-10A-01D-A40U-10	AATCTAGACATAAAATATACAGAAATAAGTCCAATGA	AATCTAGACATAAAATATACAGAAATAAGTCCAATGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b7fc7c0-18c0-4c05-9a0a-5493e05b850c	b24da751-d43f-49c4-80e4-ac9d237e5bbe	g.chr7:81350161_81350197delAATCTAGACATAAAATATACAGAAATAAGTCCAATGA	ENST00000222390.5	-	10	1395_1397	c.1169_1171delTCATTGGACTTATTTCTGTATATTTTATGTCTAGATT	c.(1168-1173)gtcatt>gtt	p.I391fs	HGF_ENST00000457544.2_Splice_Site_p.I386fs	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	391	Kringle 4. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.D390E(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						CCACGATAACAATCTAGACATAAAATATACAGAAATAAGTCCAATGAATATCAAGGC	0.35																																					p.390_391del		Atlas-INDEL	.											HGF,colon,carcinoma,0,1	HGF	171	.	1	Substitution - Missense(1)	endometrium(1)	c.1169_1172del						.																																			SO:0001630	splice_region_variant	3082	exon10			.		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1169-1TCATTGGACTTATTTCTGTATATTTTATGTCTAGATT>-	chr7.hg19:g.81350161_81350197delAATCTAGACATAAAATATACAGAAATAAGTCCAATGA		44.0	0.0		76.0	18.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Frame_Shift_Del	DEL	ENST00000222390.5	hg19	CCDS5597.1																																																																																			.	.		0.350	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	Frame_Shift_Del
