#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AIM1L	55057	hgsc.bcm.edu	37	1	26663754	26663754	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:26663754A>G	ENST00000308182.5	-	9	1055	c.626T>C	c.(625-627)gTc>gCc	p.V209A	AIM1L_ENST00000522993.1_5'UTR|AIM1L_ENST00000527815.1_Missense_Mutation_p.V380A			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	209	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		CGTCCGGATGACCCGGAGGGA	0.602																																					p.V1254A		Atlas-SNP	.											.	AIM1L	98	.	0			c.T3761C						.						93.0	85.0	87.0					1																	26663754		2203	4300	6503	SO:0001583	missense	55057	exon10			CGGATGACCCGGA			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.626T>C	chr1.hg19:g.26663754A>G	ENSP00000310435:p.Val209Ala	80.0	0.0		119.0	7.0	NM_001039775	B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	ENST00000308182.5	hg19		.	.	.	.	.	.	.	.	.	.	A	17.95	3.513747	0.64522	.	.	ENSG00000176092	ENST00000527815;ENST00000308182	T;T	0.76060	-0.99;-0.99	4.88	4.88	0.63580	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.831490	0.11239	N	0.584824	T	0.66528	0.2798	N	0.21545	0.675	0.80722	D	1	B;B	0.32051	0.089;0.354	B;B	0.39771	0.309;0.174	T	0.56257	-0.8009	10	0.13853	T	0.58	.	14.3291	0.66541	1.0:0.0:0.0:0.0	.	126;209	Q9NTH7;Q8N1P7	.;AIM1L_HUMAN	A	380;209	ENSP00000433931:V380A;ENSP00000310435:V209A	ENSP00000310435:V209A	V	-	2	0	AIM1L	26536341	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.675000	0.68123	2.055000	0.61198	0.533000	0.62120	GTC	.	.		0.602	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
SYCP1	6847	hgsc.bcm.edu	37	1	115400064	115400064	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:115400064G>A	ENST00000369522.3	+	5	477		c.e5-1		SYCP1_ENST00000369518.1_Splice_Site	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1						chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TATCTTTTTAGGTTGGTAATT	0.289																																					.		Atlas-SNP	.											.	SYCP1	149	.	0			c.238-1G>A						.						32.0	32.0	32.0					1																	115400064		2203	4281	6484	SO:0001630	splice_region_variant	6847	exon5			TTTTTAGGTTGGT	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.238-1G>A	chr1.hg19:g.115400064G>A		265.0	0.0		261.0	65.0	NM_003176	O14963|Q5VXJ6	Splice_Site	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	5.062	0.197077	0.09599	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	.	.	.	4.57	2.53	0.30540	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8399	0.18627	0.108:0.1964:0.6956:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYCP1	115201587	1.000000	0.71417	0.998000	0.56505	0.149000	0.21700	2.745000	0.47459	1.043000	0.40175	-0.384000	0.06662	.	.	.		0.289	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	Intron
FCRL2	79368	hgsc.bcm.edu	37	1	157736740	157736740	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:157736740T>C	ENST00000361516.3	-	7	1232	c.1184A>G	c.(1183-1185)gAc>gGc	p.D395G	FCRL2_ENST00000469986.1_Missense_Mutation_p.D142G|FCRL2_ENST00000392274.3_Missense_Mutation_p.D395G|FCRL2_ENST00000368181.4_Missense_Mutation_p.D111G	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	395					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGTCATGAGGTCTCTTCTATA	0.458																																					p.D395G		Atlas-SNP	.											.	FCRL2	104	.	0			c.A1184G						.						114.0	114.0	114.0					1																	157736740		2203	4300	6503	SO:0001583	missense	79368	exon7			ATGAGGTCTCTTC	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.1184A>G	chr1.hg19:g.157736740T>C	ENSP00000355157:p.Asp395Gly	326.0	0.0		440.0	90.0	NM_030764	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	hg19	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	T	9.042	0.989950	0.18966	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181;ENST00000392274;ENST00000469986	T;T;T;T	0.21031	2.25;3.78;2.03;3.11	3.22	-2.7	0.06004	.	2.947670	0.02082	U	0.052465	T	0.02012	0.0063	N	0.11818	0.18	0.09310	N	1	B;B;B;B	0.29378	0.001;0.005;0.243;0.015	B;B;B;B	0.30716	0.007;0.005;0.119;0.026	T	0.10543	-1.0625	10	0.02654	T	1	.	2.342	0.04262	0.374:0.2398:0.0:0.3861	.	395;111;395;142	B4DVJ9;Q96LA5-5;Q96LA5;Q96LA5-2	.;.;FCRL2_HUMAN;.	G	111;395;111;395;142	ENSP00000355157:D395G;ENSP00000357163:D111G;ENSP00000376100:D395G;ENSP00000417393:D142G	ENSP00000292389:D111G	D	-	2	0	FCRL2	156003364	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	0.140000	0.16056	-0.724000	0.04908	0.533000	0.62120	GAC	.	.		0.458	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764	
OR6P1	128366	hgsc.bcm.edu	37	1	158532627	158532627	+	Silent	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:158532627G>T	ENST00000334632.1	-	1	767	c.768C>A	c.(766-768)ctC>ctA	p.L256L		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						CATAGGTGAAGAGAGTGGAGG	0.517																																					p.L256L		Atlas-SNP	.											.	OR6P1	47	.	0			c.C768A						.						148.0	120.0	129.0					1																	158532627		692	1591	2283	SO:0001819	synonymous_variant	128366	exon1			GGTGAAGAGAGTG	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.768C>A	chr1.hg19:g.158532627G>T		113.0	0.0		140.0	22.0	NM_001160325	Q6IFR9	Silent	SNP	ENST00000334632.1	hg19	CCDS53391.1																																																																																			.	.		0.517	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
HMCN1	83872	hgsc.bcm.edu	37	1	186024715	186024715	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:186024715G>T	ENST00000271588.4	+	45	7282	c.7053G>T	c.(7051-7053)aaG>aaT	p.K2351N	HMCN1_ENST00000367492.2_Missense_Mutation_p.K2351N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2351	Ig-like C2-type 21.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTCAGCTGAAGAACATTCATG	0.438																																					p.K2351N		Atlas-SNP	.											.	HMCN1	797	.	0			c.G7053T						.						154.0	133.0	140.0					1																	186024715		2203	4300	6503	SO:0001583	missense	83872	exon45			GCTGAAGAACATT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7053G>T	chr1.hg19:g.186024715G>T	ENSP00000271588:p.Lys2351Asn	156.0	0.0		231.0	12.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789666	0.50102	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67865	-0.29;-0.29	5.5	3.3	0.37823	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.308175	0.38272	N	0.001750	T	0.59074	0.2167	N	0.04959	-0.14	0.25310	N	0.989208	D	0.76494	0.999	D	0.85130	0.997	T	0.50684	-0.8799	10	0.22109	T	0.4	.	8.9041	0.35512	0.3339:0.0:0.6661:0.0	.	2351	Q96RW7	HMCN1_HUMAN	N	2351	ENSP00000271588:K2351N;ENSP00000356462:K2351N	ENSP00000271588:K2351N	K	+	3	2	HMCN1	184291338	0.997000	0.39634	0.974000	0.42286	0.816000	0.46133	0.569000	0.23638	1.316000	0.45131	0.650000	0.86243	AAG	.	.		0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CACNA1S	779	hgsc.bcm.edu	37	1	201009074	201009074	+	Missense_Mutation	SNP	C	C	G	rs368214163		TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:201009074C>G	ENST00000362061.3	-	44	5733	c.5507G>C	c.(5506-5508)cGa>cCa	p.R1836P	CACNA1S_ENST00000367338.3_Missense_Mutation_p.R1817P|RP11-168O16.2_ENST00000415359.1_RNA	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1836					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGGCCTCTCGTCCTTTCAG	0.597																																					p.R1836P		Atlas-SNP	.											.	CACNA1S	249	.	0			c.G5507C						.	C	PRO/ARG	0,4406		0,0,2203	152.0	141.0	144.0		5507	1.2	0.0	1		144	1,8599		0,1,4299	no	missense	CACNA1S	NM_000069.2	103	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	possibly-damaging	1836/1874	201009074	1,13005	2203	4300	6503	SO:0001583	missense	779	exon44			GCCTCTCGTCCTT	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.5507G>C	chr1.hg19:g.201009074C>G	ENSP00000355192:p.Arg1836Pro	41.0	0.0		42.0	16.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	11.42	1.634961	0.29068	0.0	1.16E-4	ENSG00000081248	ENST00000362061;ENST00000367338	T;T	0.45668	0.89;0.89	4.36	1.22	0.21188	.	1.536250	0.04611	U	0.400231	T	0.39118	0.1066	L	0.50333	1.59	0.09310	N	1	P	0.35872	0.525	B	0.35510	0.204	T	0.33624	-0.9861	10	0.38643	T	0.18	.	8.8209	0.35025	0.0:0.7063:0.0:0.2937	.	1836	Q13698	CAC1S_HUMAN	P	1836;1817	ENSP00000355192:R1836P;ENSP00000356307:R1817P	ENSP00000355192:R1836P	R	-	2	0	CACNA1S	199275697	0.156000	0.22821	0.004000	0.12327	0.752000	0.42762	0.954000	0.29175	0.346000	0.23899	0.404000	0.27445	CGA	.	.		0.597	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
LMOD1	25802	hgsc.bcm.edu	37	1	201869293	201869293	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr1:201869293T>C	ENST00000367288.4	-	2	1094	c.848A>G	c.(847-849)aAg>aGg	p.K283R	RP11-307B6.3_ENST00000458139.1_RNA|RP11-307B6.3_ENST00000414927.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	283	8 X approximate tandem repeats.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCTGTCATCCTTGGCTTCCTT	0.517																																					p.K283R		Atlas-SNP	.											.	LMOD1	59	.	0			c.A848G						.						102.0	103.0	102.0					1																	201869293		2007	4176	6183	SO:0001583	missense	25802	exon2			TCATCCTTGGCTT	X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.848A>G	chr1.hg19:g.201869293T>C	ENSP00000356257:p.Lys283Arg	98.0	0.0		132.0	18.0	NM_012134	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	ENST00000367288.4	hg19	CCDS53457.1	.	.	.	.	.	.	.	.	.	.	T	7.136	0.580896	0.13686	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.94793	-3.52	5.32	-3.02	0.05446	.	0.665977	0.12390	N	0.473139	T	0.78616	0.4311	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.70802	-0.4773	10	0.08837	T	0.75	-2.743	6.3586	0.21414	0.0:0.3972:0.2589:0.3439	.	232;283	B4E3S9;P29536	.;LMOD1_HUMAN	R	283;283;232	ENSP00000356257:K283R	ENSP00000356257:K283R	K	-	2	0	LMOD1	200135916	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.352000	0.07701	-0.899000	0.03901	-0.322000	0.08575	AAG	.	.		0.517	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087085.2		
NRXN1	9378	hgsc.bcm.edu	37	2	50318473	50318473	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:50318473G>A	ENST00000406316.2	-	19	5182	c.3706C>T	c.(3706-3708)Cgc>Tgc	p.R1236C	NRXN1_ENST00000402717.3_Missense_Mutation_p.R1228C|NRXN1_ENST00000405472.3_Missense_Mutation_p.R1228C|NRXN1_ENST00000401710.1_Missense_Mutation_p.R254C|NRXN1_ENST00000404971.1_Missense_Mutation_p.R1276C|NRXN1_ENST00000401669.2_Missense_Mutation_p.R1236C|NRXN1_ENST00000406859.3_Missense_Mutation_p.R1236C|NRXN1_ENST00000342183.5_Missense_Mutation_p.R201C	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1236	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCAGGGTAGCGCTCGATCACT	0.448																																					p.R1276C		Atlas-SNP	.											.	NRXN1	1118	.	0			c.C3826T						.						216.0	199.0	205.0					2																	50318473		2203	4300	6503	SO:0001583	missense	9378	exon20			GGTAGCGCTCGAT	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3706C>T	chr2.hg19:g.50318473G>A	ENSP00000384311:p.Arg1236Cys	69.0	0.0		79.0	9.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	hg19	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793215	0.90453	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.54	5.54	0.83059	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.56097	U	0.000034	D	0.88477	0.6447	M	0.79123	2.44	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.999;0.999	P;D;P;D	0.70487	0.701;0.969;0.853;0.913	D	0.88983	0.3409	10	0.62326	D	0.03	.	19.4609	0.94916	0.0:0.0:1.0:0.0	.	1276;201;1236;1228	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	C	201;155;254;1276;1236;1228;1236;1277;1228;1236	ENSP00000341184:R201C;ENSP00000385580:R254C;ENSP00000385142:R1276C;ENSP00000384311:R1236C;ENSP00000434015:R1228C;ENSP00000385017:R1236C;ENSP00000385434:R1228C;ENSP00000385681:R1236C	ENSP00000341184:R201C	R	-	1	0	NRXN1	50171977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.600000	0.87896	0.563000	0.77884	CGC	.	.		0.448	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
NRXN1	9378	hgsc.bcm.edu	37	2	50765499	50765499	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:50765499G>T	ENST00000406316.2	-	10	3511	c.2035C>A	c.(2035-2037)Ccg>Acg	p.P679T	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000402717.3_Missense_Mutation_p.P671T|NRXN1_ENST00000405472.3_Missense_Mutation_p.P671T|NRXN1_ENST00000404971.1_Missense_Mutation_p.P719T|NRXN1_ENST00000401669.2_Missense_Mutation_p.P679T|NRXN1_ENST00000406859.3_Missense_Mutation_p.P679T	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	679	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTAAGGCACGGTTTTGCTGTT	0.483																																					p.P719T		Atlas-SNP	.											.	NRXN1	1118	.	0			c.C2155A						.						322.0	323.0	323.0					2																	50765499		2137	4271	6408	SO:0001583	missense	9378	exon11			GGCACGGTTTTGC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2035C>A	chr2.hg19:g.50765499G>T	ENSP00000384311:p.Pro679Thr	160.0	0.0		152.0	41.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	hg19	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870957	0.72065	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78	5.16	5.16	0.70880	.	0.056804	0.64402	D	0.000001	T	0.67636	0.2914	L	0.37466	1.105	0.43203	D	0.995058	B;P;B	0.40638	0.352;0.725;0.354	B;B;B	0.37198	0.236;0.243;0.129	T	0.71984	-0.4427	10	0.56958	D	0.05	.	18.8479	0.92215	0.0:0.0:1.0:0.0	.	719;679;671	Q9ULB1-3;F8WB18;A7E294	.;.;.	T	719;679;671;679;720;671;679	ENSP00000385142:P719T;ENSP00000384311:P679T;ENSP00000434015:P671T;ENSP00000385017:P679T;ENSP00000385434:P671T;ENSP00000385681:P679T	ENSP00000385017:P679T	P	-	1	0	NRXN1	50619003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.682000	0.91365	0.585000	0.79938	CCG	.	.		0.483	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
CD8B	926	hgsc.bcm.edu	37	2	87085479	87085479	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:87085479T>A	ENST00000390655.6	-	2	162	c.104A>T	c.(103-105)aAg>aTg	p.K35M	CD8B_ENST00000393759.2_Missense_Mutation_p.K35M|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000349455.3_Missense_Mutation_p.K35M|CD8B_ENST00000393761.2_Missense_Mutation_p.K35M|CD8B_ENST00000331469.2_Missense_Mutation_p.K35M	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	35	Ig-like V-type.				immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						CATCACCATCTTGTTGGTTTG	0.512																																					p.K35M		Atlas-SNP	.											.	CD8B	37	.	0			c.A104T						.						77.0	68.0	71.0					2																	87085479		2203	4298	6501	SO:0001583	missense	926	exon2			ACCATCTTGTTGG		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.104A>T	chr2.hg19:g.87085479T>A	ENSP00000375070:p.Lys35Met	235.0	0.0		289.0	92.0	NM_004931	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	ENST00000390655.6	hg19	CCDS1997.1	.	.	.	.	.	.	.	.	.	.	T	9.560	1.118239	0.20877	.	.	ENSG00000172116	ENST00000393761;ENST00000393759;ENST00000349455;ENST00000331469;ENST00000390655;ENST00000445248	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	4.49	0.375	0.16188	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.042940	0.07459	N	0.900284	T	0.42877	0.1222	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.31893	0.345;0.22;0.22;0.131;0.161;0.184	B;B;B;B;B;B	0.27076	0.055;0.076;0.055;0.015;0.034;0.045	T	0.39683	-0.9602	10	0.87932	D	0	3.5803	1.1103	0.01703	0.1874:0.1069:0.1942:0.5116	.	35;35;35;35;35;35	Q496E2;Q53QL8;P10966;P10966-3;P10966-2;P10966-6	.;.;CD8B_HUMAN;.;.;.	M	35	ENSP00000377358:K35M;ENSP00000377356:K35M;ENSP00000340592:K35M;ENSP00000331172:K35M;ENSP00000375070:K35M	ENSP00000331172:K35M	K	-	2	0	CD8B	86938990	0.000000	0.05858	0.004000	0.12327	0.013000	0.08279	-0.260000	0.08708	0.132000	0.18615	0.533000	0.62120	AAG	.	.		0.512	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
CNGA3	1261	hgsc.bcm.edu	37	2	99012463	99012463	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:99012463G>A	ENST00000272602.2	+	7	869	c.830G>A	c.(829-831)cGc>cAc	p.R277H	CNGA3_ENST00000393504.1_Missense_Mutation_p.R277H|CNGA3_ENST00000409937.1_Missense_Mutation_p.R281H|CNGA3_ENST00000436404.2_Missense_Mutation_p.R259H			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	277			R -> C (in ACHM2; also found in patients with cone-rod dystrophy). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:15712225, ECO:0000269|PubMed:18521937, ECO:0000269|PubMed:24903488}.|R -> H (in ACHM2; also found in patients with cone-rod dystrophy; does not form functional homomeric or heteromeric channels). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:24903488}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AGGTTCAACCGCCTACTGAAG	0.498																																					p.R277H		Atlas-SNP	.											.	CNGA3	118	.	0			c.G830A	GRCh37	CM014539	CNGA3	M		.						89.0	81.0	84.0					2																	99012463		2203	4300	6503	SO:0001583	missense	1261	exon8			TCAACCGCCTACT	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.830G>A	chr2.hg19:g.99012463G>A	ENSP00000272602:p.Arg277His	182.0	0.0		176.0	12.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	hg19	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577406	0.86645	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.99353	-5.77;-5.77;-5.77;-5.77	5.15	5.15	0.70609	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99645	0.9869	H	0.96777	3.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.97631	1.0142	10	0.87932	D	0	.	17.5731	0.87940	0.0:0.0:1.0:0.0	.	281;259;277	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	H	277;259;277;281	ENSP00000377140:R277H;ENSP00000410070:R259H;ENSP00000272602:R277H;ENSP00000386761:R281H	ENSP00000272602:R277H	R	+	2	0	CNGA3	98378895	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.487000	0.81328	2.677000	0.91161	0.563000	0.77884	CGC	.	.		0.498	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
MAP4K4	9448	hgsc.bcm.edu	37	2	102501674	102501674	+	Silent	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:102501674G>A	ENST00000347699.4	+	26	3111	c.3111G>A	c.(3109-3111)ctG>ctA	p.L1037L	MAP4K4_ENST00000302217.5_Silent_p.L840L|MAP4K4_ENST00000324219.4_Silent_p.L1118L|MAP4K4_ENST00000350198.4_Silent_p.L956L|MAP4K4_ENST00000456652.1_Silent_p.L836L|MAP4K4_ENST00000413150.2_Silent_p.L952L|MAP4K4_ENST00000425019.1_Silent_p.L1070L|MAP4K4_ENST00000350878.4_Silent_p.L1077L	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	1037	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.|Mediates interaction with RAP2A.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TCAAATTTCTGGTGATTGCTT	0.353																																					p.L1071L		Atlas-SNP	.											.	MAP4K4	111	.	0			c.G3213A						.						68.0	64.0	65.0					2																	102501674		1828	4082	5910	SO:0001819	synonymous_variant	9448	exon27			ATTTCTGGTGATT	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.3111G>A	chr2.hg19:g.102501674G>A		104.0	0.0		84.0	19.0	NM_145686	O75172|Q9NST7	Silent	SNP	ENST00000347699.4	hg19	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	G	9.283	1.048565	0.19827	.	.	ENSG00000071054	ENST00000421882	.	.	.	6.02	3.08	0.35506	.	.	.	.	.	T	0.54727	0.1876	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44832	-0.9302	4	.	.	.	.	6.4263	0.21772	0.1423:0.0:0.6076:0.25	.	.	.	.	S	854	.	.	G	+	1	0	MAP4K4	101868106	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.900000	0.48687	0.341000	0.23771	0.650000	0.86243	GGT	.	.		0.353	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	
STK39	27347	hgsc.bcm.edu	37	2	168986082	168986082	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:168986082C>A	ENST00000355999.4	-	10	1763	c.1058G>T	c.(1057-1059)aGa>aTa	p.R353I		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	353					cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						GTCTGGTGTTCTTGTAAGCAG	0.388																																					p.R353I		Atlas-SNP	.											.	STK39	95	.	0			c.G1058T						.						316.0	287.0	296.0					2																	168986082		1898	4115	6013	SO:0001583	missense	27347	exon10			GGTGTTCTTGTAA	AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.1058G>T	chr2.hg19:g.168986082C>A	ENSP00000348278:p.Arg353Ile	194.0	0.0		194.0	52.0	NM_013233	O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Missense_Mutation	SNP	ENST00000355999.4	hg19	CCDS42770.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249524	0.59212	.	.	ENSG00000198648	ENST00000355999	T	0.21191	2.02	5.8	5.8	0.92144	Protein kinase-like domain (1);	0.173414	0.56097	D	0.000023	T	0.12774	0.0310	N	0.14661	0.345	0.54753	D	0.999983	B	0.09022	0.002	B	0.14023	0.01	T	0.10683	-1.0619	10	0.34782	T	0.22	-20.6608	10.4529	0.44533	0.0:0.8559:0.0:0.1441	.	353	Q9UEW8	STK39_HUMAN	I	353	ENSP00000348278:R353I	ENSP00000348278:R353I	R	-	2	0	STK39	168694328	0.994000	0.37717	0.998000	0.56505	0.997000	0.91878	2.329000	0.43876	2.746000	0.94184	0.563000	0.77884	AGA	.	.		0.388	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258112.2	NM_013233	
SMARCAL1	50485	hgsc.bcm.edu	37	2	217293425	217293425	+	Silent	SNP	A	A	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:217293425A>C	ENST00000357276.4	+	7	1584	c.1254A>C	c.(1252-1254)ccA>ccC	p.P418P	SMARCAL1_ENST00000479008.1_3'UTR|SMARCAL1_ENST00000358207.5_Silent_p.P418P	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	418					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GTCTCACGCCAGATGTCCCAG	0.547									Schimke Immuno-Osseous Dysplasia																												p.P418P		Atlas-SNP	.											.	SMARCAL1	93	.	0			c.A1254C						.						158.0	142.0	148.0					2																	217293425		2203	4300	6503	SO:0001819	synonymous_variant	50485	exon7	Familial Cancer Database	SIOD	CACGCCAGATGTC	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1254A>C	chr2.hg19:g.217293425A>C		74.0	0.0		78.0	18.0	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	hg19	CCDS2403.1																																																																																			.	.		0.547	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
TCAIM	285343	hgsc.bcm.edu	37	3	44442703	44442703	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr3:44442703A>T	ENST00000342649.4	+	10	1554	c.1127A>T	c.(1126-1128)tAt>tTt	p.Y376F	TCAIM_ENST00000417237.1_Missense_Mutation_p.Y376F	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	376						mitochondrion (GO:0005739)											AGTGACAGATATGCTCCAAGC	0.393																																					p.Y376F		Atlas-SNP	.											.	.	.	.	0			c.A1127T						.						140.0	133.0	135.0					3																	44442703		2203	4300	6503	SO:0001583	missense	285343	exon10			ACAGATATGCTCC		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.1127A>T	chr3.hg19:g.44442703A>T	ENSP00000341539:p.Tyr376Phe	95.0	0.0		74.0	18.0	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	hg19	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	A	5.609	0.297042	0.10622	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.42900	0.96;0.96	5.61	5.61	0.85477	.	0.114845	0.64402	D	0.000008	T	0.26846	0.0657	L	0.31294	0.92	0.32416	N	0.550034	B	0.18461	0.028	B	0.14578	0.011	T	0.24977	-1.0145	10	0.06099	T	0.92	.	10.963	0.47395	0.8605:0.0:0.0:0.1394	.	376	Q8N3R3	CC023_HUMAN	F	376	ENSP00000402581:Y376F;ENSP00000341539:Y376F	ENSP00000341539:Y376F	Y	+	2	0	C3orf23	44417707	0.892000	0.30473	0.956000	0.39512	0.983000	0.72400	1.947000	0.40293	2.138000	0.66242	0.459000	0.35465	TAT	.	.		0.393	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
ARGFX	503582	hgsc.bcm.edu	37	3	121305241	121305241	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr3:121305241C>T	ENST00000334384.3	+	4	752	c.742C>T	c.(742-744)Cac>Tac	p.H248Y		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		CTCTTCTTTCCACTGTCTGTA	0.473																																					p.H248Y		Atlas-SNP	.											.	ARGFX	36	.	0			c.C742T						.						104.0	102.0	102.0					3																	121305241		2203	4300	6503	SO:0001583	missense	503582	exon5			TCTTTCCACTGTC		CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.742C>T	chr3.hg19:g.121305241C>T	ENSP00000335578:p.His248Tyr	90.0	0.0		85.0	22.0	NM_001012659		Missense_Mutation	SNP	ENST00000334384.3	hg19	CCDS33834.1	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.332787	0.01298	.	.	ENSG00000186103	ENST00000334384	D	0.88664	-2.41	2.97	-3.08	0.05347	.	1.692040	0.03378	N	0.199968	T	0.75488	0.3856	N	0.12182	0.205	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.60047	-0.7339	10	0.56958	D	0.05	0.8731	0.4001	0.00424	0.2049:0.2543:0.1657:0.3751	.	248	A6NJG6	ARGFX_HUMAN	Y	248	ENSP00000335578:H248Y	ENSP00000335578:H248Y	H	+	1	0	ARGFX	122787931	0.000000	0.05858	0.000000	0.03702	0.401000	0.30781	-0.619000	0.05572	-0.771000	0.04608	0.561000	0.74099	CAC	.	.		0.473	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659	
ACAP2	23527	hgsc.bcm.edu	37	3	195102681	195102681	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr3:195102681T>C	ENST00000326793.6	-	3	412	c.182A>G	c.(181-183)aAt>aGt	p.N61S		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	61	BAR.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TCGAATCCCATTCATGAACTG	0.318																																					p.N61S		Atlas-SNP	.											.	ACAP2	72	.	0			c.A182G						.						83.0	86.0	85.0					3																	195102681		2203	4300	6503	SO:0001583	missense	23527	exon3			ATCCCATTCATGA		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.182A>G	chr3.hg19:g.195102681T>C	ENSP00000324287:p.Asn61Ser	254.0	0.0		262.0	90.0	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	hg19	CCDS33924.1	.	.	.	.	.	.	.	.	.	.	T	5.957	0.360627	0.11296	.	.	ENSG00000114331	ENST00000326793;ENST00000439666	T;T	0.03951	3.75;3.75	5.39	5.39	0.77823	.	0.087672	0.85682	D	0.000000	T	0.03695	0.0105	N	0.21240	0.645	0.42291	D	0.992139	B;B	0.21753	0.06;0.003	B;B	0.20184	0.028;0.006	T	0.28267	-1.0049	10	0.06494	T	0.89	.	13.3588	0.60644	0.0:0.0:0.0:1.0	.	17;61	C9J8L1;Q15057	.;ACAP2_HUMAN	S	61;17	ENSP00000324287:N61S;ENSP00000411336:N17S	ENSP00000324287:N61S	N	-	2	0	ACAP2	196583970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.093000	0.41710	2.029000	0.59856	0.460000	0.39030	AAT	.	.		0.318	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	
MUC4	4585	hgsc.bcm.edu	37	3	195474197	195474197	+	Silent	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr3:195474197G>A	ENST00000346145.4	-	24	3420	c.3381C>T	c.(3379-3381)agC>agT	p.S1127S	MUC4_ENST00000475231.1_Silent_p.S5311S|MUC4_ENST00000463781.3_Silent_p.S5363S|MUC4_ENST00000349607.4_Silent_p.S1076S	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	2120					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGAGTTTCATGCTCAGGTGCT	0.627																																					p.S5363S		Atlas-SNP	.											.	MUC4	1505	.	0			c.C16089T						.						74.0	62.0	66.0					3																	195474197		2203	4300	6503	SO:0001819	synonymous_variant	4585	exon25			TTTCATGCTCAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.3381C>T	chr3.hg19:g.195474197G>A		241.0	0.0		286.0	18.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000346145.4	hg19	CCDS3310.1																																																																																			.	.		0.627	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
RGS12	6002	hgsc.bcm.edu	37	4	3318452	3318452	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr4:3318452T>A	ENST00000344733.5	+	2	1459	c.555T>A	c.(553-555)agT>agA	p.S185R	RGS12_ENST00000382788.3_Missense_Mutation_p.S185R|RGS12_ENST00000336727.3_Missense_Mutation_p.S185R|RGS12_ENST00000543385.1_Missense_Mutation_p.S185R	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	185					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GACATGAAAGTATAAATAATC	0.393																																					p.S185R		Atlas-SNP	.											.	RGS12	128	.	0			c.T555A						.						61.0	64.0	63.0					4																	3318452		2203	4300	6503	SO:0001583	missense	6002	exon2			TGAAAGTATAAAT	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.555T>A	chr4.hg19:g.3318452T>A	ENSP00000339381:p.Ser185Arg	93.0	0.0		87.0	16.0	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	hg19	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	T	7.811	0.715629	0.15306	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.32272	1.46;1.58;1.58;1.58	3.86	-1.72	0.08107	.	0.885835	0.09810	U	0.752875	T	0.24198	0.0586	M	0.63428	1.95	0.09310	N	1	B;B;B	0.28584	0.026;0.138;0.216	B;B;B	0.32864	0.005;0.074;0.154	T	0.35126	-0.9801	10	0.21540	T	0.41	2.0E-4	0.9439	0.01361	0.1541:0.2791:0.1586:0.4082	.	185;185;185	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	R	185	ENSP00000440566:S185R;ENSP00000339381:S185R;ENSP00000338509:S185R;ENSP00000372238:S185R	ENSP00000338509:S185R	S	+	3	2	RGS12	3288250	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	0.330000	0.19715	-0.345000	0.08325	0.402000	0.26972	AGT	.	.		0.393	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
YTHDC1	91746	hgsc.bcm.edu	37	4	69179827	69179827	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr4:69179827T>G	ENST00000344157.4	-	17	2509	c.2174A>C	c.(2173-2175)tAt>tCt	p.Y725S	YTHDC1_ENST00000579690.1_Missense_Mutation_p.Y733S|YTHDC1_ENST00000355665.3_Missense_Mutation_p.Y707S	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	725	Arg-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						TTATCTTCTATATCGACCTCT	0.373																																					p.Y725S		Atlas-SNP	.											.	YTHDC1	81	.	0			c.A2174C						.						63.0	65.0	65.0					4																	69179827		2203	4300	6503	SO:0001583	missense	91746	exon17			CTTCTATATCGAC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.2174A>C	chr4.hg19:g.69179827T>G	ENSP00000339245:p.Tyr725Ser	104.0	0.0		62.0	21.0	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	hg19	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.874690	0.51695	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.33216	1.42;1.44	5.69	5.69	0.88448	.	0.057323	0.64402	D	0.000001	T	0.42810	0.1219	N	0.24115	0.695	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.969	T	0.44034	-0.9354	10	0.87932	D	0	.	15.6236	0.76829	0.0:0.0:0.0:1.0	.	707;725	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	S	725;707	ENSP00000339245:Y725S;ENSP00000347888:Y707S	ENSP00000339245:Y725S	Y	-	2	0	YTHDC1	68862422	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.512000	0.73737	2.167000	0.68274	0.460000	0.39030	TAT	.	.		0.373	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
ALB	213	hgsc.bcm.edu	37	4	74272394	74272394	+	De_novo_Start_InFrame	SNP	T	T	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr4:74272394T>G	ENST00000503124.1	+	0	155				ALB_ENST00000295897.4_Missense_Mutation_p.D62E|ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000509063.1_Missense_Mutation_p.D62E			Q8TES7	FBF1_HUMAN	albumin						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CATTTGAAGATCATGTAAAAT	0.318																																					p.D62E		Atlas-SNP	.											.	ALB	132	.	0			c.T186G						.						127.0	121.0	123.0					4																	74272394		2203	4300	6503			213	exon3			TGAAGATCATGTA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919		chr4.hg19:g.74272394T>G		70.0	0.0		45.0	12.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.	.	.	.	.	.	.	.	.	.	T	0	-2.813415	0.00073	.	.	ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000329326;ENST00000509063;ENST00000430202	T;T;T	0.69306	-0.39;-0.39;-0.39	5.39	-10.8	0.00216	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.549222	0.17976	N	0.155712	T	0.17152	0.0412	N	0.00801	-1.175	0.38421	D	0.946194	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.67868	-0.5559	10	0.02654	T	1	-4.162	0.7623	0.01009	0.2903:0.2133:0.1284:0.3681	.	62;62	A6NBZ8;P02768	.;ALBU_HUMAN	E	64;62;62;62;71	ENSP00000392541:D64E;ENSP00000295897:D62E;ENSP00000422784:D62E	ENSP00000295897:D62E	D	+	3	2	ALB	74491258	0.000000	0.05858	0.000000	0.03702	0.151000	0.21798	-7.643000	0.00032	-5.202000	0.00019	-1.280000	0.01385	GAT	.	.		0.318	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
DCHS2	54798	hgsc.bcm.edu	37	4	155157584	155157584	+	Silent	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr4:155157584G>T	ENST00000357232.4	-	25	6854	c.6855C>A	c.(6853-6855)gtC>gtA	p.V2285V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2285	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGAAGCTTGGACAGTTAAGG	0.353																																					p.V2285V		Atlas-SNP	.											.	DCHS2	594	.	0			c.C6855A						.						79.0	80.0	80.0					4																	155157584		2203	4300	6503	SO:0001819	synonymous_variant	54798	exon25			AGCTTGGACAGTT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6855C>A	chr4.hg19:g.155157584G>T		196.0	0.0		159.0	71.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	hg19	CCDS3785.1																																																																																			.	.		0.353	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
IRX1	79192	hgsc.bcm.edu	37	5	3599701	3599701	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr5:3599701C>G	ENST00000302006.3	+	2	691	c.639C>G	c.(637-639)gaC>gaG	p.D213E	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	213					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CCGAGGGCGACCCGGAGAAGG	0.627																																					p.D213E		Atlas-SNP	.											.	IRX1	106	.	0			c.C639G						.						66.0	59.0	61.0					5																	3599701		2203	4300	6503	SO:0001583	missense	79192	exon2			GGGCGACCCGGAG	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.639C>G	chr5.hg19:g.3599701C>G	ENSP00000305244:p.Asp213Glu	179.0	0.0		225.0	61.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	hg19	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	9.464	1.093783	0.20471	.	.	ENSG00000170549	ENST00000302006	T	0.58940	0.3	4.65	3.76	0.43208	.	0.098933	0.64402	D	0.000002	T	0.43010	0.1228	L	0.31065	0.9	0.51767	D	0.999939	B	0.17667	0.023	B	0.17098	0.017	T	0.28202	-1.0051	10	0.17832	T	0.49	.	13.0819	0.59119	0.0:0.9198:0.0:0.0802	.	213	P78414	IRX1_HUMAN	E	213	ENSP00000305244:D213E	ENSP00000305244:D213E	D	+	3	2	IRX1	3652701	0.891000	0.30450	1.000000	0.80357	0.802000	0.45316	0.981000	0.29526	2.089000	0.63090	0.609000	0.83330	GAC	.	.		0.627	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
FAM174A	345757	hgsc.bcm.edu	37	5	99871534	99871534	+	Silent	SNP	C	C	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr5:99871534C>T	ENST00000312637.4	+	1	526	c.300C>T	c.(298-300)gcC>gcT	p.A100A	CTD-2001C12.1_ENST00000499025.1_lincRNA	NM_198507.1	NP_940909.1	Q8TBP5	F174A_HUMAN	family with sequence similarity 174, member A	100						integral component of membrane (GO:0016021)				breast(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GAGGGAAGGCCGGGGAAGGCT	0.706																																					p.A100A		Atlas-SNP	.											.	FAM174A	13	.	0			c.C300T						.						20.0	22.0	21.0					5																	99871534		2201	4296	6497	SO:0001819	synonymous_variant	345757	exon1			GAAGGCCGGGGAA	AY359108	CCDS4090.1	5q21.1	2008-06-19	2008-06-19	2008-06-19	ENSG00000174132	ENSG00000174132			24943	protein-coding gene	gene with protein product			"""transmembrane protein 157"""	TMEM157		12975309	Standard	NM_198507		Approved	UNQ1912	uc003knj.1	Q8TBP5	OTTHUMG00000128726	ENST00000312637.4:c.300C>T	chr5.hg19:g.99871534C>T		81.0	0.0		116.0	39.0	NM_198507	A8K0H4	Silent	SNP	ENST00000312637.4	hg19	CCDS4090.1																																																																																			.	.		0.706	FAM174A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000250631.2	NM_198507	
TRPC7	57113	hgsc.bcm.edu	37	5	135551937	135551937	+	Silent	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr5:135551937T>C	ENST00000513104.1	-	11	2652	c.2370A>G	c.(2368-2370)agA>agG	p.R790R	TRPC7-AS1_ENST00000514459.1_RNA|TRPC7_ENST00000355180.3_Silent_p.R729R|TRPC7_ENST00000426057.2_Silent_p.R674R	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	790					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCAGGACGTATCTTTTTATGA	0.473																																					p.R790R		Atlas-SNP	.											.	TRPC7	126	.	0			c.A2370G						.						104.0	103.0	103.0					5																	135551937		1912	4134	6046	SO:0001819	synonymous_variant	57113	exon11			GACGTATCTTTTT	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.2370A>G	chr5.hg19:g.135551937T>C		53.0	0.0		75.0	17.0	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Silent	SNP	ENST00000513104.1	hg19	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	T	9.056	0.993367	0.19043	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	4.92	2.46	0.29980	.	.	.	.	.	T	0.54175	0.1842	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44034	-0.9354	4	.	.	.	-15.8113	6.0593	0.19828	0.0:0.2146:0.1278:0.6575	.	.	.	.	V	674;729;735	.	.	I	-	1	0	TRPC7	135579836	0.909000	0.30893	1.000000	0.80357	0.899000	0.52679	-0.057000	0.11768	0.424000	0.26061	0.459000	0.35465	ATA	.	.		0.473	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
C6orf47	57827	hgsc.bcm.edu	37	6	31627256	31627256	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:31627256A>G	ENST00000375911.1	-	1	1293	c.469T>C	c.(469-471)Tgg>Cgg	p.W157R	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	157						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						CCCCGCAGCCAGCCCAACAGC	0.642																																					p.W157R		Atlas-SNP	.											.	C6orf47	15	.	0			c.T469C						.						62.0	73.0	69.0					6																	31627256		1508	2708	4216	SO:0001583	missense	57827	exon1			GCAGCCAGCCCAA	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.469T>C	chr6.hg19:g.31627256A>G	ENSP00000365076:p.Trp157Arg	85.0	0.0		91.0	7.0	NM_021184	B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Missense_Mutation	SNP	ENST00000375911.1	hg19	CCDS34399.1	.	.	.	.	.	.	.	.	.	.	A	19.10	3.761382	0.69763	.	.	ENSG00000204439	ENST00000375911;ENST00000538106	T	0.52983	0.64	5.79	5.79	0.91817	.	0.000000	0.46758	D	0.000276	T	0.56485	0.1988	M	0.62723	1.935	0.34156	D	0.668055	D	0.89917	1.0	D	0.91635	0.999	T	0.65709	-0.6102	10	0.87932	D	0	-11.1174	12.5142	0.56024	1.0:0.0:0.0:0.0	.	157	O95873	CF047_HUMAN	R	157	ENSP00000365076:W157R	ENSP00000365076:W157R	W	-	1	0	C6orf47	31735235	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	4.241000	0.58707	2.208000	0.71279	0.533000	0.62120	TGG	.	.		0.642	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184	
C6orf47	57827	hgsc.bcm.edu	37	6	31627264	31627264	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:31627264A>G	ENST00000375911.1	-	1	1285	c.461T>C	c.(460-462)cTg>cCg	p.L154P	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	154						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						CCAGCCCAACAGCTTCTCACG	0.637																																					p.L154P		Atlas-SNP	.											.	C6orf47	15	.	0			c.T461C						.						62.0	74.0	70.0					6																	31627264		1508	2708	4216	SO:0001583	missense	57827	exon1			CCCAACAGCTTCT	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.461T>C	chr6.hg19:g.31627264A>G	ENSP00000365076:p.Leu154Pro	78.0	0.0		83.0	6.0	NM_021184	B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Missense_Mutation	SNP	ENST00000375911.1	hg19	CCDS34399.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699565	0.68501	.	.	ENSG00000204439	ENST00000375911;ENST00000538106	T	0.51817	0.69	5.79	5.79	0.91817	.	0.000000	0.47093	D	0.000245	T	0.57388	0.2050	M	0.62723	1.935	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.63567	-0.6608	10	0.87932	D	0	-6.3093	12.5142	0.56024	1.0:0.0:0.0:0.0	.	154	O95873	CF047_HUMAN	P	154	ENSP00000365076:L154P	ENSP00000365076:L154P	L	-	2	0	C6orf47	31735243	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	4.485000	0.60279	2.208000	0.71279	0.533000	0.62120	CTG	.	.		0.637	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184	
GPR115	221393	hgsc.bcm.edu	37	6	47681900	47681900	+	Silent	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:47681900T>C	ENST00000283303.2	+	6	1177	c.919T>C	c.(919-921)Ttg>Ctg	p.L307L	RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Silent_p.L364L|GPR115_ENST00000327753.3_Silent_p.L307L	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	307					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						AGAAGCCCACTTGCAAAATGT	0.468																																					p.L307L	GBM(22;431 510 9010 26644 32828)	Atlas-SNP	.											.	GPR115	140	.	0			c.T919C						.						61.0	65.0	64.0					6																	47681900		2203	4300	6503	SO:0001819	synonymous_variant	221393	exon6			GCCCACTTGCAAA	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.919T>C	chr6.hg19:g.47681900T>C		110.0	0.0		109.0	9.0	NM_153838	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Silent	SNP	ENST00000283303.2	hg19	CCDS4922.2																																																																																			.	.		0.468	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
IBTK	25998	hgsc.bcm.edu	37	6	82941527	82941527	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:82941527T>C	ENST00000306270.7	-	4	1000	c.451A>G	c.(451-453)Aca>Gca	p.T151A	IBTK_ENST00000503631.1_Missense_Mutation_p.T151A|IBTK_ENST00000510291.1_Missense_Mutation_p.T151A	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	151					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GTAAAATTTGTATTATCGCCC	0.313																																					p.T151A		Atlas-SNP	.											.	IBTK	128	.	0			c.A451G						.						96.0	93.0	94.0					6																	82941527		2203	4300	6503	SO:0001583	missense	25998	exon4			AATTTGTATTATC	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.451A>G	chr6.hg19:g.82941527T>C	ENSP00000305721:p.Thr151Ala	94.0	0.0		82.0	26.0	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	hg19	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.819758	0.50633	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	D;D;D	0.85013	-1.93;-1.93;-1.93	5.92	3.6	0.41247	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.263184	0.43579	D	0.000555	T	0.71316	0.3325	L	0.59436	1.845	0.39687	D	0.970992	B;B;P;P	0.38729	0.309;0.097;0.644;0.549	B;B;B;B	0.40134	0.197;0.056;0.307;0.32	T	0.68750	-0.5326	10	0.14656	T	0.56	-18.7484	8.7601	0.34669	0.0:0.188:0.0:0.812	.	151;151;151;151	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	A	151	ENSP00000305721:T151A;ENSP00000422762:T151A;ENSP00000426405:T151A	ENSP00000305721:T151A	T	-	1	0	IBTK	82998246	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.580000	0.46068	2.260000	0.74910	0.528000	0.53228	ACA	.	.		0.313	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
PNRC1	10957	hgsc.bcm.edu	37	6	89793582	89793582	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:89793582A>C	ENST00000336032.3	+	2	768	c.651A>C	c.(649-651)aaA>aaC	p.K217N	PNRC1_ENST00000354922.3_Missense_Mutation_p.K32N|PNRC1_ENST00000369472.1_Missense_Mutation_p.K32N	NM_006813.2	NP_006804.1	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		AGAAAAGCAAATATAACTTGC	0.388										Multiple Myeloma(7;0.094)																											p.K217N		Atlas-SNP	.											.	PNRC1	17	.	0			c.A651C						.						68.0	69.0	69.0					6																	89793582		2203	4300	6503	SO:0001583	missense	10957	exon2			AAGCAAATATAAC	U03105	CCDS5018.1	6q16.1	2008-02-05	2003-09-25	2003-09-26	ENSG00000146278	ENSG00000146278			17278	protein-coding gene	gene with protein product		606714	"""proline rich 2"""	PROL2		7578250	Standard	NM_006813		Approved	B4-2, PRR2	uc003pmv.3	Q12796	OTTHUMG00000015191	ENST00000336032.3:c.651A>C	chr6.hg19:g.89793582A>C	ENSP00000336931:p.Lys217Asn	363.0	0.0		343.0	25.0	NM_006813	B2R6Q0|E1P515|Q5T7J6|Q7Z5N0	Missense_Mutation	SNP	ENST00000336032.3	hg19	CCDS5018.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924607	0.52653	.	.	ENSG00000146278	ENST00000369472;ENST00000336032;ENST00000354922	T;T;T	0.67865	0.07;-0.29;0.07	5.73	3.39	0.38822	.	0.343196	0.32120	N	0.006558	T	0.62344	0.2420	M	0.71581	2.175	0.29316	N	0.867716	D	0.55800	0.973	P	0.59546	0.859	T	0.60234	-0.7303	10	0.66056	D	0.02	-3.3194	4.7301	0.12961	0.6592:0.0:0.2088:0.132	.	217	Q12796	PNRC1_HUMAN	N	32;217;32	ENSP00000358484:K32N;ENSP00000336931:K217N;ENSP00000347000:K32N	ENSP00000336931:K217N	K	+	3	2	PNRC1	89850301	1.000000	0.71417	0.930000	0.37139	0.980000	0.70556	2.630000	0.46494	0.995000	0.38917	0.533000	0.62120	AAA	.	.		0.388	PNRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041471.1	NM_006813	
CEP57L1	285753	hgsc.bcm.edu	37	6	109484145	109484145	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:109484145G>A	ENST00000517392.1	+	11	1781	c.1355G>A	c.(1354-1356)aGa>aAa	p.R452K	CEP57L1_ENST00000359793.3_Missense_Mutation_p.R452K|CEP57L1_ENST00000523787.1_Missense_Mutation_p.R455K|CEP57L1_ENST00000368968.2_3'UTR|CEP57L1_ENST00000368970.2_Missense_Mutation_p.R469K|CEP57L1_ENST00000521522.1_Missense_Mutation_p.R399K|CEP57L1_ENST00000336977.4_Missense_Mutation_p.R352K|C6orf183_ENST00000417143.3_RNA|CEP57L1_ENST00000407272.1_Missense_Mutation_p.R452K|CEP57L1_ENST00000520883.1_Missense_Mutation_p.R352K	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	452					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.R452I(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						ATGAAATTGAGAAGAGATGAT	0.333																																					p.R452K		Atlas-SNP	.											CEP57L1,NS,carcinoma,0,1	CEP57L1	24	.	1	Substitution - Missense(1)	kidney(1)	c.G1355A						.						56.0	57.0	57.0					6																	109484145		2203	4300	6503	SO:0001583	missense	285753	exon11			AATTGAGAAGAGA	AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.1355G>A	chr6.hg19:g.109484145G>A	ENSP00000427844:p.Arg452Lys	321.0	0.0		331.0	92.0	NM_173830	G5E992	Missense_Mutation	SNP	ENST00000517392.1	hg19	CCDS5071.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275551	0.40294	.	.	ENSG00000183137	ENST00000517392;ENST00000407272;ENST00000336977;ENST00000521522;ENST00000368970;ENST00000520883;ENST00000523787;ENST00000359793	T;T;T;T;T;T;T;T	0.44482	1.0;1.0;0.97;0.92;1.03;0.97;1.0;1.0	5.68	5.68	0.88126	.	0.273372	0.36482	N	0.002568	T	0.21801	0.0525	L	0.49350	1.555	0.36381	D	0.861913	B	0.15930	0.015	B	0.11329	0.006	T	0.04796	-1.0926	10	0.28530	T	0.3	-8.2543	11.0829	0.48070	0.0848:0.0:0.9152:0.0	.	452	Q8IYX8	CE57L_HUMAN	K	452;452;352;399;469;352;455;452	ENSP00000427844:R452K;ENSP00000383936:R452K;ENSP00000337392:R352K;ENSP00000428344:R399K;ENSP00000357966:R469K;ENSP00000430011:R352K;ENSP00000430529:R455K;ENSP00000352841:R452K	ENSP00000337392:R352K	R	+	2	0	CEP57L1	109590838	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.884000	0.56175	2.838000	0.97847	0.591000	0.81541	AGA	.	.		0.333	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041734.4	NM_173830	
TBC1D32	221322	hgsc.bcm.edu	37	6	121563446	121563446	+	Silent	SNP	A	A	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr6:121563446A>G	ENST00000398212.2	-	18	2107	c.2058T>C	c.(2056-2058)caT>caC	p.H686H	TBC1D32_ENST00000275159.6_Silent_p.H686H	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	686					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TGGCAGCAAAATGTAGTAAAT	0.328																																					p.H686H		Atlas-SNP	.											.,1	C6orf170	146	.	0			c.T2058C						.						91.0	87.0	88.0					6																	121563446		1834	4088	5922	SO:0001819	synonymous_variant	221322	exon18			AGCAAAATGTAGT	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2058T>C	chr6.hg19:g.121563446A>G		154.0	0.0		125.0	10.0	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	hg19	CCDS43501.1																																																																																			.	.		0.328	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
PRKAR2B	5577	hgsc.bcm.edu	37	7	106799922	106799922	+	Silent	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr7:106799922T>C	ENST00000265717.4	+	11	1411	c.1152T>C	c.(1150-1152)ctT>ctC	p.L384L		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	384					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						TTGAAAGGCTTCTGGGACCTT	0.363																																					p.L384L		Atlas-SNP	.											.	PRKAR2B	34	.	0			c.T1152C						.						102.0	93.0	96.0					7																	106799922		2203	4300	6503	SO:0001819	synonymous_variant	5577	exon11			AAGGCTTCTGGGA		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.1152T>C	chr7.hg19:g.106799922T>C		92.0	0.0		97.0	9.0	NM_002736	A4D0R9	Silent	SNP	ENST00000265717.4	hg19	CCDS5740.1																																																																																			.	.		0.363	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1		
TEX15	56154	hgsc.bcm.edu	37	8	30695229	30695229	+	Silent	SNP	C	C	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr8:30695229C>A	ENST00000256246.2	-	3	7496	c.7422G>T	c.(7420-7422)ggG>ggT	p.G2474G		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2474					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GCAAAAGCGTCCCATGGTCTG	0.398																																					p.G2474G		Atlas-SNP	.											.	TEX15	350	.	0			c.G7422T						.						101.0	104.0	103.0					8																	30695229		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon3			AAGCGTCCCATGG	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.7422G>T	chr8.hg19:g.30695229C>A		129.0	0.0		90.0	34.0	NM_031271		Silent	SNP	ENST00000256246.2	hg19	CCDS6080.1																																																																																			.	.		0.398	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
PRDM14	63978	hgsc.bcm.edu	37	8	70971011	70971011	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr8:70971011T>G	ENST00000276594.2	-	6	1451	c.1250A>C	c.(1249-1251)aAg>aCg	p.K417T		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	417					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CTTGAGGTGCTTATCTCTGTA	0.468																																					p.K417T	NSCLC(129;99 1813 5906 40656 46114)	Atlas-SNP	.											.	PRDM14	102	.	0			c.A1250C						.						114.0	101.0	105.0					8																	70971011		2203	4300	6503	SO:0001583	missense	63978	exon6			AGGTGCTTATCTC	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1250A>C	chr8.hg19:g.70971011T>G	ENSP00000276594:p.Lys417Thr	111.0	0.0		112.0	21.0	NM_024504	Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	hg19	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.688167	0.88639	.	.	ENSG00000147596	ENST00000276594	T	0.41758	0.99	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.49592	0.1566	N	0.17278	0.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53535	-0.8425	10	0.48119	T	0.1	-31.1781	16.0233	0.80516	0.0:0.0:0.0:1.0	.	417	Q9GZV8	PRD14_HUMAN	T	417	ENSP00000276594:K417T	ENSP00000276594:K417T	K	-	2	0	PRDM14	71133565	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.550000	0.82173	2.186000	0.69663	0.533000	0.62120	AAG	.	.		0.468	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	41.0	1.0		35.0	5.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
SPATA31C2	645961	hgsc.bcm.edu	37	9	90747470	90747470	+	IGR	SNP	G	G	T	rs200958103		TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr9:90747470G>T								U6 (134220 upstream) : U3 (241713 downstream)																							TCGAGGATCCGGGGAAGCTAA	0.612																																					p.P161Q		Atlas-SNP	.											.	.	.	.	0			c.C482A						.	G	GLN/PRO	1,1383		0,1,691	51.0	63.0	59.0		482	0.4	0.0	9		59	2,3180		0,2,1589	no	missense	FAM75C2	NM_001166137.1	76	0,3,2280	TT,TG,GG		0.0629,0.0723,0.0657	possibly-damaging	161/1135	90747470	3,4563	692	1591	2283	SO:0001628	intergenic_variant	645961	exon4			GGATCCGGGGAAG																													chr9.hg19:g.90747470G>T		122.0	0.0		99.0	47.0	NM_001166137		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.612								
WNK2	65268	hgsc.bcm.edu	37	9	96054796	96054796	+	Silent	SNP	T	T	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr9:96054796T>A	ENST00000297954.4	+	23	5160	c.5160T>A	c.(5158-5160)ccT>ccA	p.P1720P	WNK2_ENST00000395477.2_Silent_p.P1683P|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000349097.3_Silent_p.P1332P|WNK2_ENST00000356055.3_Silent_p.P47P|WNK2_ENST00000427277.2_Silent_p.P1295P	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1720					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TTGTGAGACCTGCACGTGTGG	0.592																																					p.P1683P		Atlas-SNP	.											.	WNK2	277	.	0			c.T5049A						.						62.0	55.0	57.0					9																	96054796		2203	4298	6501	SO:0001819	synonymous_variant	65268	exon22			GAGACCTGCACGT	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.5160T>A	chr9.hg19:g.96054796T>A		104.0	0.0		80.0	8.0	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.043|5.043	0.193652|0.193652	0.09599|0.09599	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000432730;ENST00000448251;ENST00000453718	.|.	.|.	.|.	4.39|4.39	0.576|0.576	0.17380|0.17380	.|.	.|.	.|.	.|.	.|.	T|T	0.21631|0.21631	0.0521|0.0521	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999996|0.999996	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.22487|0.22487	-1.0215|-1.0215	4|4	.|.	.|.	.|.	.|.	2.5405|2.5405	0.04724|0.04724	0.289:0.2622:0.0:0.4488|0.289:0.2622:0.0:0.4488	.|.	.|.	.|.	.|.	S|Q	1287|1679;480;205	.|.	.|.	C|L	+|+	1|2	0|0	WNK2|WNK2	95094617|95094617	0.000000|0.000000	0.05858|0.05858	0.092000|0.092000	0.20876|0.20876	0.006000|0.006000	0.05464|0.05464	0.028000|0.028000	0.13644|0.13644	0.341000|0.341000	0.23771|0.23771	0.459000|0.459000	0.35465|0.35465	TGC|CTG	.	.		0.592	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
ZNF248	57209	hgsc.bcm.edu	37	10	38121809	38121809	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr10:38121809C>G	ENST00000395867.3	-	6	1024	c.474G>C	c.(472-474)aaG>aaC	p.K158N	ZNF248_ENST00000357328.4_Missense_Mutation_p.K158N|ZNF248_ENST00000494133.1_Intron|ZNF248_ENST00000374648.3_Intron|AL135791.1_ENST00000583461.1_RNA	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						TGGAACAGTTCTTTTTACTAA	0.323																																					p.K158N		Atlas-SNP	.											.	ZNF248	61	.	0			c.G474C						.						47.0	50.0	49.0					10																	38121809		2200	4296	6496	SO:0001583	missense	57209	exon6			ACAGTTCTTTTTA	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.474G>C	chr10.hg19:g.38121809C>G	ENSP00000379208:p.Lys158Asn	206.0	0.0		298.0	27.0	NM_001267597	Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	hg19	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256033	0.39896	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.05139	3.49;3.49	4.86	-0.193	0.13244	.	0.000000	0.49916	D	0.000135	T	0.05914	0.0154	L	0.60455	1.87	0.32198	N	0.578258	B	0.15930	0.015	B	0.17433	0.018	T	0.09840	-1.0656	10	0.37606	T	0.19	.	3.3566	0.07171	0.1787:0.4351:0.0:0.3862	.	158	Q8NDW4	ZN248_HUMAN	N	158	ENSP00000379208:K158N;ENSP00000349882:K158N	ENSP00000349882:K158N	K	-	3	2	ZNF248	38161815	0.778000	0.28640	0.989000	0.46669	0.974000	0.67602	0.814000	0.27239	0.076000	0.16826	-0.311000	0.09066	AAG	.	.		0.323	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045	
DUSP8	1850	hgsc.bcm.edu	37	11	1578679	1578679	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr11:1578679G>A	ENST00000397374.3	-	7	1074	c.947C>T	c.(946-948)aCg>aTg	p.T316M	DUSP8_ENST00000528778.1_5'Flank|DUSP8_ENST00000331588.4_Missense_Mutation_p.T316M	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	316	Pro-rich.|Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		AGGCTCCGGCGTCCCTGAGGG	0.716																																					p.T316M		Atlas-SNP	.											.	DUSP8	22	.	0			c.C947T						.						5.0	7.0	6.0					11																	1578679		1833	3744	5577	SO:0001583	missense	1850	exon7			TCCGGCGTCCCTG		CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.947C>T	chr11.hg19:g.1578679G>A	ENSP00000380530:p.Thr316Met	26.0	0.0		29.0	11.0	NM_004420	Q86SS8	Missense_Mutation	SNP	ENST00000397374.3	hg19	CCDS7724.1	.	.	.	.	.	.	.	.	.	.	G	5.970	0.362915	0.11296	.	.	ENSG00000184545	ENST00000397374;ENST00000331588	T;T	0.02258	4.37;4.37	3.03	2.1	0.27182	.	1.007410	0.08009	U	0.989974	T	0.01124	0.0037	N	0.03608	-0.345	0.09310	N	1	B	0.31435	0.323	B	0.18871	0.023	T	0.48139	-0.9061	10	0.33940	T	0.23	.	4.9888	0.14203	0.1111:0.0:0.5524:0.3365	.	316	Q13202	DUS8_HUMAN	M	316	ENSP00000380530:T316M;ENSP00000329539:T316M	ENSP00000329539:T316M	T	-	2	0	DUSP8	1535255	0.000000	0.05858	0.336000	0.25522	0.521000	0.34408	0.586000	0.23894	0.474000	0.27392	0.306000	0.20318	ACG	.	.		0.716	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257178.3	NM_004420	
RRM1	6240	hgsc.bcm.edu	37	11	4159583	4159583	+	Silent	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr11:4159583T>C	ENST00000300738.5	+	19	2553	c.2349T>C	c.(2347-2349)aaT>aaC	p.N783N	RRM1_ENST00000537197.1_Silent_p.N445N|RRM1_ENST00000534285.1_Silent_p.N561N|RRM1-AS1_ENST00000529323.1_RNA|RRM1_ENST00000423050.2_Silent_p.N686N	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	783					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	CTTTGGAGAATAGAGATGAAT	0.413																																					p.N783N	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	Atlas-SNP	.											.	RRM1	31	.	0			c.T2349C						.						74.0	74.0	74.0					11																	4159583		2201	4298	6499	SO:0001819	synonymous_variant	6240	exon19			GGAGAATAGAGAT	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.2349T>C	chr11.hg19:g.4159583T>C		95.0	0.0		70.0	14.0	NM_001033	Q9UNN2	Silent	SNP	ENST00000300738.5	hg19	CCDS7750.1																																																																																			.	.		0.413	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	
MRGPRF	116535	hgsc.bcm.edu	37	11	68772956	68772956	+	Silent	SNP	G	G	A	rs144312357		TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr11:68772956G>A	ENST00000309099.6	-	3	1204	c.822C>T	c.(820-822)taC>taT	p.Y274Y	RP11-554A11.5_ENST00000562506.1_RNA|MRGPRF_ENST00000441623.1_Silent_p.Y274Y	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	274						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGTCAGTGACGTACTCGGGGA	0.617																																					p.Y274Y		Atlas-SNP	.											MRGPRF,NS,carcinoma,0,2	MRGPRF	22	.	0			c.C822T						.	G	,	0,4392		0,0,2196	38.0	28.0	31.0		822,822	-0.0	1.0	11	dbSNP_134	31	1,8579		0,1,4289	no	coding-synonymous,coding-synonymous	MRGPRF	NM_001098515.1,NM_145015.4	,	0,1,6485	AA,AG,GG		0.0117,0.0,0.0077	,	274/344,274/344	68772956	1,12971	2196	4290	6486	SO:0001819	synonymous_variant	116535	exon3			AGTGACGTACTCG	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.822C>T	chr11.hg19:g.68772956G>A		104.0	0.0		116.0	28.0	NM_001098515	B3KV43|Q8NBK8	Silent	SNP	ENST00000309099.6	hg19	CCDS8188.1																																																																																			.	G|1.000;A|0.000		0.617	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396875.1	NM_145015	
ZBTB16	7704	hgsc.bcm.edu	37	11	113934393	113934393	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr11:113934393C>A	ENST00000335953.4	+	2	751	c.371C>A	c.(370-372)aCc>aAc	p.T124N	ZBTB16_ENST00000392996.2_Missense_Mutation_p.T124N	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	124					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		ATGCTGGAGACCATCCAGGCC	0.602																																					p.T124N		Atlas-SNP	.											.	ZBTB16	101	.	0			c.C371A						.						45.0	45.0	45.0					11																	113934393		2201	4296	6497	SO:0001583	missense	7704	exon2			TGGAGACCATCCA	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.371C>A	chr11.hg19:g.113934393C>A	ENSP00000338157:p.Thr124Asn	76.0	0.0		109.0	20.0	NM_006006	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	hg19	CCDS8367.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052114	0.75960	.	.	ENSG00000109906	ENST00000335953;ENST00000535700;ENST00000392996;ENST00000310883	T;T;T	0.67345	-0.26;-0.26;-0.26	5.53	5.53	0.82687	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.72803	0.3506	N	0.20445	0.575	0.80722	D	1	D;D	0.64830	0.994;0.992	D;P	0.77004	0.989;0.86	T	0.74876	-0.3515	10	0.52906	T	0.07	-16.029	19.827	0.96621	0.0:1.0:0.0:0.0	.	124;129	Q05516;Q59H43	ZBT16_HUMAN;.	N	124	ENSP00000338157:T124N;ENSP00000443013:T124N;ENSP00000376721:T124N	ENSP00000309507:T124N	T	+	2	0	ZBTB16	113439603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.939000	0.70179	2.759000	0.94783	0.561000	0.74099	ACC	.	.		0.602	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
TPI1	7167	hgsc.bcm.edu	37	12	6978268	6978268	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr12:6978268G>C	ENST00000229270.4	+	3	693	c.356G>C	c.(355-357)gGc>gCc	p.G119A	TPI1_ENST00000488464.2_5'UTR|TPI1_ENST00000535434.1_5'UTR|TPI1_ENST00000396705.5_Missense_Mutation_p.G82A	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	119					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)			endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						TTTAGCCCTGGCATGATCAAA	0.567											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G119A		Atlas-SNP	.											.	TPI1	64	.	0			c.G356C						.						107.0	110.0	109.0					12																	6978268		2203	4300	6503	SO:0001583	missense	7167	exon3			GCCCTGGCATGAT		CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.356G>C	chr12.hg19:g.6978268G>C	ENSP00000229270:p.Gly119Ala	75.0	0.0	638	78.0	6.0	NM_001159287	B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Missense_Mutation	SNP	ENST00000229270.4	hg19	CCDS53740.1	.	.	.	.	.	.	.	.	.	.	G	9.129	1.010965	0.19277	.	.	ENSG00000111669	ENST00000229270;ENST00000396705	D;D	0.93604	-3.25;-3.25	4.77	3.86	0.44501	Aldolase-type TIM barrel (1);	0.065597	0.64402	U	0.000012	T	0.69269	0.3092	N	0.00057	-2.355	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.71768	-0.4493	10	0.10636	T	0.68	.	11.4754	0.50295	0.0:0.4588:0.5412:0.0	.	119	P60174	TPIS_HUMAN	A	119;82	ENSP00000229270:G119A;ENSP00000379933:G82A	ENSP00000229270:G119A	G	+	2	0	TPI1	6848529	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.564000	0.73969	2.187000	0.69744	0.462000	0.41574	GGC	.	.		0.567	TPI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258252.1	NM_000365	
SLC2A13	114134	hgsc.bcm.edu	37	12	40153944	40153944	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr12:40153944T>C	ENST00000280871.4	-	10	1881	c.1831A>G	c.(1831-1833)Aac>Gac	p.N611D		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	611					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				CATAGCCTGTTGTCAAAGAGT	0.403										HNSCC(50;0.14)																											p.N611D		Atlas-SNP	.											.	SLC2A13	91	.	0			c.A1831G						.						114.0	108.0	110.0					12																	40153944		2203	4300	6503	SO:0001583	missense	114134	exon10			GCCTGTTGTCAAA	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1831A>G	chr12.hg19:g.40153944T>C	ENSP00000280871:p.Asn611Asp	76.0	0.0		88.0	14.0	NM_052885	Q17S07	Missense_Mutation	SNP	ENST00000280871.4	hg19	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	T	13.16	2.155546	0.38021	.	.	ENSG00000151229	ENST00000280871	D	0.81499	-1.5	5.33	1.43	0.22495	.	0.353469	0.31949	N	0.006806	T	0.64283	0.2584	N	0.19112	0.55	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.49881	-0.8892	10	0.13470	T	0.59	-5.5145	12.7848	0.57498	0.0:0.0:0.4091:0.5908	.	611	Q96QE2	MYCT_HUMAN	D	611	ENSP00000280871:N611D	ENSP00000280871:N611D	N	-	1	0	SLC2A13	38440211	0.968000	0.33430	0.999000	0.59377	0.987000	0.75469	0.979000	0.29500	-0.000000	0.14550	-0.429000	0.05907	AAC	.	.		0.403	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
NFYB	4801	hgsc.bcm.edu	37	12	104519915	104519915	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr12:104519915T>G	ENST00000240055.3	-	4	435	c.208A>C	c.(208-210)Aat>Cat	p.N70H	RNA5SP370_ENST00000362545.1_RNA|NFYB_ENST00000551727.1_Missense_Mutation_p.N70H	NM_006166.3	NP_006157.1	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	70	B domain.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	6						GGTATGGCATTTTTCATTATC	0.368																																					p.N70H		Atlas-SNP	.											.	NFYB	11	.	0			c.A208C						.						200.0	180.0	187.0					12																	104519915		2203	4300	6503	SO:0001583	missense	4801	exon4			TGGCATTTTTCAT		CCDS9098.1	12q22-q23	2008-11-11				ENSG00000120837			7805	protein-coding gene	gene with protein product		189904				1774067, 9612081	Standard	NM_006166		Approved	CBF-A, HAP3, NF-YB	uc001tkl.1	P25208	OTTHUMG00000170176	ENST00000240055.3:c.208A>C	chr12.hg19:g.104519915T>G	ENSP00000240055:p.Asn70His	65.0	0.0		55.0	14.0	NM_006166	A8K7B9|Q96IY8	Missense_Mutation	SNP	ENST00000240055.3	hg19	CCDS9098.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628087	0.66901	.	.	ENSG00000120837	ENST00000240055;ENST00000551727;ENST00000551446	T;T;T	0.44482	1.91;1.91;0.92	5.63	5.63	0.86233	Histone-fold (2);Transcription factor CBF/NF-Y/archaeal histone (1);	0.000000	0.85682	D	0.000000	T	0.44030	0.1274	M	0.78637	2.42	0.80722	D	1	P	0.39940	0.696	B	0.32090	0.14	T	0.51601	-0.8685	10	0.49607	T	0.09	3.4802	15.87	0.79108	0.0:0.0:0.0:1.0	.	70	P25208	NFYB_HUMAN	H	70;70;71	ENSP00000240055:N70H;ENSP00000447486:N70H;ENSP00000448250:N71H	ENSP00000240055:N70H	N	-	1	0	NFYB	103044045	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.145000	0.66743	0.533000	0.62120	AAT	.	.		0.368	NFYB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407786.1		
LPAR6	10161	hgsc.bcm.edu	37	13	48986448	48986448	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr13:48986448C>A	ENST00000378434.4	-	7	1736	c.112G>T	c.(112-114)Gcc>Tcc	p.A38S	RB1_ENST00000267163.4_Intron|LPAR6_ENST00000345941.2_Missense_Mutation_p.A38S	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						ATGTATATGGCAACACAATTG	0.378																																					p.A38S		Atlas-SNP	.											.	LPAR6	38	.	19	Whole gene deletion(15)|Unknown(4)	bone(10)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.G112T						.						94.0	90.0	92.0					13																	48986448		2203	4300	6503	SO:0001583	missense	10161	exon5			ATATGGCAACACA	AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.112G>T	chr13.hg19:g.48986448C>A	ENSP00000367691:p.Ala38Ser	107.0	0.0		64.0	5.0	NM_001162497	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Missense_Mutation	SNP	ENST00000378434.4	hg19	CCDS9410.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969835	0.74246	.	.	ENSG00000139679	ENST00000378434;ENST00000345941	T;T	0.72835	-0.69;-0.69	6.17	6.17	0.99709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	L	0.37466	1.105	0.80722	D	1	P	0.47191	0.891	P	0.49276	0.605	T	0.69371	-0.5163	10	0.41790	T	0.15	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	38	P43657	LPAR6_HUMAN	S	38	ENSP00000367691:A38S;ENSP00000344353:A38S	ENSP00000344353:A38S	A	-	1	0	LPAR6	47884449	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCC	.	.		0.378	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
SLITRK5	26050	hgsc.bcm.edu	37	13	88328839	88328839	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr13:88328839A>T	ENST00000325089.6	+	2	1415	c.1196A>T	c.(1195-1197)gAg>gTg	p.E399V	SLITRK5_ENST00000400028.3_Missense_Mutation_p.E158V	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	399	LRRNT.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CGAAAGATCGAGAGCATCGCT	0.552																																					p.E399V		Atlas-SNP	.											.	SLITRK5	192	.	0			c.A1196T						.						89.0	74.0	79.0					13																	88328839		2203	4300	6503	SO:0001583	missense	26050	exon2			AGATCGAGAGCAT	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1196A>T	chr13.hg19:g.88328839A>T	ENSP00000366283:p.Glu399Val	44.0	0.0		47.0	11.0	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	hg19	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825140	0.32237	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.50813	0.73;0.73	5.75	5.75	0.90469	Leucine-rich repeat-containing N-terminal (1);	0.057183	0.64402	D	0.000002	T	0.41236	0.1150	L	0.39898	1.24	0.44579	D	0.997543	B;B	0.26081	0.141;0.054	B;B	0.29862	0.108;0.044	T	0.22977	-1.0201	9	.	.	.	-18.4966	14.007	0.64470	1.0:0.0:0.0:0.0	.	158;399	B4DSH5;O94991	.;SLIK5_HUMAN	V	399;158	ENSP00000366283:E399V;ENSP00000442244:E158V	.	E	+	2	0	SLITRK5	87126840	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.327000	0.79147	2.192000	0.70111	0.459000	0.35465	GAG	.	.		0.552	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
EFNB2	1948	hgsc.bcm.edu	37	13	107164955	107164955	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr13:107164955A>T	ENST00000245323.4	-	2	477	c.328T>A	c.(328-330)Ttc>Atc	p.F110I		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	110	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TTGATGGTGAATTTGATATCT	0.338																																					p.F110I		Atlas-SNP	.											.	EFNB2	39	.	0			c.T328A						.						142.0	141.0	142.0					13																	107164955		2203	4300	6503	SO:0001583	missense	1948	exon2			TGGTGAATTTGAT	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.328T>A	chr13.hg19:g.107164955A>T	ENSP00000245323:p.Phe110Ile	167.0	0.0		207.0	16.0	NM_004093	Q5JV56	Missense_Mutation	SNP	ENST00000245323.4	hg19	CCDS9507.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347526	0.82022	.	.	ENSG00000125266	ENST00000245323	D	0.94537	-3.45	5.41	5.41	0.78517	Ephrin, conserved site (1);Cupredoxin (2);	0.045114	0.85682	D	0.000000	D	0.96713	0.8927	M	0.70903	2.155	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.96638	0.9472	10	0.48119	T	0.1	.	15.7499	0.77976	1.0:0.0:0.0:0.0	.	110	P52799	EFNB2_HUMAN	I	110	ENSP00000245323:F110I	ENSP00000245323:F110I	F	-	1	0	EFNB2	105962956	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.910000	0.92685	2.188000	0.69820	0.533000	0.62120	TTC	.	.		0.338	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
NID2	22795	hgsc.bcm.edu	37	14	52534630	52534630	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr14:52534630C>A	ENST00000216286.5	-	2	479	c.480G>T	c.(478-480)tgG>tgT	p.W160C	NID2_ENST00000541773.1_Missense_Mutation_p.W107C	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	160	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CTACCTGCTCCCAGGTGGCCA	0.662																																					p.W160C		Atlas-SNP	.											.	NID2	201	.	0			c.G480T						.						62.0	76.0	71.0					14																	52534630		2167	4268	6435	SO:0001583	missense	22795	exon2			CTGCTCCCAGGTG	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.480G>T	chr14.hg19:g.52534630C>A	ENSP00000216286:p.Trp160Cys	103.0	0.0		126.0	42.0	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	hg19	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	C	34	5.306368	0.95629	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	T;T	0.23552	1.9;1.9	5.58	5.58	0.84498	Nidogen, extracellular domain (2);	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.93507	3.425	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.993	P;D;P	0.66351	0.891;0.943;0.72	T	0.73310	-0.4023	10	0.87932	D	0	.	19.579	0.95458	0.0:1.0:0.0:0.0	.	107;162;160	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	C	160;107;162	ENSP00000216286:W160C;ENSP00000443730:W107C	ENSP00000216286:W160C	W	-	3	0	NID2	51604380	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.199000	0.77831	2.626000	0.88956	0.563000	0.77884	TGG	.	.		0.662	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
PLD4	122618	hgsc.bcm.edu	37	14	105395137	105395137	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr14:105395137C>A	ENST00000392593.4	+	4	504	c.336C>A	c.(334-336)agC>agA	p.S112R	PLD4_ENST00000540372.1_Missense_Mutation_p.S119R	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	112					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			CAGCCGGCAGCCCCTCTGCCC	0.667																																					p.S112R		Atlas-SNP	.											.	PLD4	46	.	0			c.C336A						.						30.0	33.0	32.0					14																	105395137		1941	4142	6083	SO:0001583	missense	122618	exon4			CGGCAGCCCCTCT		CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.336C>A	chr14.hg19:g.105395137C>A	ENSP00000376372:p.Ser112Arg	104.0	0.0		94.0	31.0	NM_138790	Q6UWD2	Missense_Mutation	SNP	ENST00000392593.4	hg19	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	C	8.806	0.934056	0.18206	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.24538	1.89;1.89;1.85	4.23	1.02	0.19986	.	0.421043	0.26428	N	0.024422	T	0.22627	0.0546	M	0.67397	2.05	0.09310	N	1	B;B	0.18013	0.025;0.015	B;B	0.23574	0.047;0.021	T	0.17961	-1.0352	10	0.40728	T	0.16	-1.0E-4	4.1871	0.10404	0.1578:0.5939:0.1539:0.0944	.	119;112	F5H2B5;Q96BZ4	.;PLD4_HUMAN	R	119;112;110	ENSP00000438677:S119R;ENSP00000376372:S112R;ENSP00000451278:S110R	ENSP00000376372:S112R	S	+	3	2	PLD4	104466182	0.000000	0.05858	0.277000	0.24703	0.599000	0.36880	-0.055000	0.11807	0.340000	0.23745	0.645000	0.84053	AGC	.	.		0.667	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2	NM_138790	
BRF1	2972	hgsc.bcm.edu	37	14	105766805	105766805	+	Silent	SNP	C	C	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr14:105766805C>T	ENST00000546474.1	-	1	15121	c.162G>A	c.(160-162)gtG>gtA	p.V54V	BRF1_ENST00000440513.3_Intron|BRF1_ENST00000379937.2_Silent_p.V54V|PACS2_ENST00000430725.2_5'Flank|BRF1_ENST00000548421.1_Silent_p.V54V|BRF1_ENST00000327359.3_Intron	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	54					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CGAACTGGCCCACGGCCGAGG	0.721																																					p.V54V		Atlas-SNP	.											.	BRF1	102	.	0			c.G162A						.						14.0	14.0	14.0					14																	105766805		1857	3518	5375	SO:0001819	synonymous_variant	2972	exon1			CTGGCCCACGGCC	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.162G>A	chr14.hg19:g.105766805C>T		63.0	0.0		46.0	18.0	NM_001519	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Silent	SNP	ENST00000546474.1	hg19	CCDS10001.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373683	0.24857	.	.	ENSG00000185024	ENST00000546417	.	.	.	3.18	0.917	0.19380	.	.	.	.	.	T	0.51787	0.1695	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38993	-0.9635	4	.	.	.	.	5.6411	0.17565	0.2007:0.3686:0.4307:0.0	.	.	.	.	R	1	.	.	G	-	1	0	BRF1	104837850	0.861000	0.29849	0.993000	0.49108	0.612000	0.37316	-0.224000	0.09164	0.267000	0.21916	0.455000	0.32223	GGG	.	.		0.721	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519	
FAN1	22909	hgsc.bcm.edu	37	15	31203039	31203039	+	Intron	SNP	A	A	G	rs373034831		TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr15:31203039A>G	ENST00000362065.4	+	4	1868				FAN1_ENST00000561607.1_Missense_Mutation_p.Q533R|FAN1_ENST00000561594.1_Missense_Mutation_p.Q533R|FAN1_ENST00000565466.1_Missense_Mutation_p.Q533R	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1						DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						CTATTGTTACAGTAAAAACAT	0.328								Direct reversal of damage																													p.Q533R		Atlas-SNP	.											.	FAN1	77	.	0			c.A1598G						.						47.0	47.0	47.0					15																	31203039		2202	4300	6502	SO:0001627	intron_variant	22909	exon4			TGTTACAGTAAAA		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.1577+21A>G	chr15.hg19:g.31203039A>G		104.0	0.0		123.0	35.0	NM_001146095	A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	hg19	CCDS32186.1																																																																																			.	.		0.328	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967	
NDUFAF1	51103	hgsc.bcm.edu	37	15	41688875	41688875	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr15:41688875C>G	ENST00000260361.4	-	2	764	c.383G>C	c.(382-384)cGg>cCg	p.R128P		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	128					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		TTCTTTCCCCCGGAATTGCCA	0.463																																					p.R128P		Atlas-SNP	.											.	NDUFAF1	39	.	0			c.G383C						.						95.0	91.0	92.0					15																	41688875		2203	4300	6503	SO:0001583	missense	51103	exon2			TTCCCCCGGAATT	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.383G>C	chr15.hg19:g.41688875C>G	ENSP00000260361:p.Arg128Pro	123.0	0.0		140.0	29.0	NM_016013	Q9BVZ5	Missense_Mutation	SNP	ENST00000260361.4	hg19	CCDS10075.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748483	0.69533	.	.	ENSG00000137806	ENST00000260361	T	0.76968	-1.06	4.7	4.7	0.59300	NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (1);Galactose-binding domain-like (1);	0.098554	0.64402	D	0.000003	D	0.87830	0.6276	M	0.74881	2.28	0.54753	D	0.99998	D	0.89917	1.0	D	0.80764	0.994	D	0.89298	0.3624	10	0.66056	D	0.02	-24.0484	18.0656	0.89389	0.0:1.0:0.0:0.0	.	128	Q9Y375	CIA30_HUMAN	P	128	ENSP00000260361:R128P	ENSP00000260361:R128P	R	-	2	0	NDUFAF1	39476167	1.000000	0.71417	0.988000	0.46212	0.754000	0.42855	4.491000	0.60326	2.334000	0.79466	0.449000	0.29647	CGG	.	.		0.463	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252692.2	NM_016013	
EEF2K	29904	hgsc.bcm.edu	37	16	22291589	22291589	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr16:22291589G>A	ENST00000263026.5	+	17	2434	c.1960G>A	c.(1960-1962)Ggt>Agt	p.G654S		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	654					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		TGATGAGGGCGGTGAGTACGA	0.607																																					p.G654S	NSCLC(195;1411 2157 20319 27471 51856)	Atlas-SNP	.											.	EEF2K	142	.	0			c.G1960A						.						107.0	83.0	91.0					16																	22291589		2197	4300	6497	SO:0001583	missense	29904	exon17			GAGGGCGGTGAGT	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1960G>A	chr16.hg19:g.22291589G>A	ENSP00000263026:p.Gly654Ser	108.0	0.0		56.0	21.0	NM_013302	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	hg19	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931551	0.73442	.	.	ENSG00000103319	ENST00000263026	T	0.09630	2.96	5.58	5.58	0.84498	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.31670	0.0804	M	0.79475	2.455	0.80722	D	1	D	0.69078	0.997	P	0.56398	0.797	T	0.03354	-1.1045	10	0.72032	D	0.01	-16.8331	19.563	0.95380	0.0:0.0:1.0:0.0	.	654	O00418	EF2K_HUMAN	S	654	ENSP00000263026:G654S	ENSP00000263026:G654S	G	+	1	0	EEF2K	22199090	1.000000	0.71417	0.197000	0.23402	0.018000	0.09664	9.439000	0.97543	2.630000	0.89119	0.561000	0.74099	GGT	.	.		0.607	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
VAC14	55697	hgsc.bcm.edu	37	16	70731096	70731096	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr16:70731096G>C	ENST00000261776.5	-	16	2161	c.1901C>G	c.(1900-1902)tCc>tGc	p.S634C	VAC14_ENST00000536184.2_Missense_Mutation_p.S66C	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	634					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GAAGCAGAGGGACACCGTGGT	0.602																																					p.S634C		Atlas-SNP	.											.	VAC14	65	.	0			c.C1901G						.						197.0	133.0	155.0					16																	70731096		2198	4300	6498	SO:0001583	missense	55697	exon16			CAGAGGGACACCG	AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1901C>G	chr16.hg19:g.70731096G>C	ENSP00000261776:p.Ser634Cys	151.0	0.0		135.0	8.0	NM_018052	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	ENST00000261776.5	hg19	CCDS10896.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983283	0.93044	.	.	ENSG00000103043	ENST00000261776;ENST00000536184	T	0.66995	-0.24	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80752	0.4683	M	0.64080	1.96	0.80722	D	1	D;P	0.89917	1.0;0.848	D;P	0.75020	0.985;0.549	T	0.81409	-0.0946	10	0.62326	D	0.03	-30.2626	19.4185	0.94710	0.0:0.0:1.0:0.0	.	564;634	B4DMP4;Q08AM6	.;VAC14_HUMAN	C	634;66	ENSP00000261776:S634C	ENSP00000261776:S634C	S	-	2	0	VAC14	69288597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.396000	0.97270	2.601000	0.87937	0.555000	0.69702	TCC	.	.		0.602	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268973.3	NM_018052	
CMTR2	55783	hgsc.bcm.edu	37	16	71317949	71317949	+	Silent	SNP	T	T	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr16:71317949T>C	ENST00000338099.5	-	3	2211	c.1875A>G	c.(1873-1875)ttA>ttG	p.L625L	CMTR2_ENST00000434935.2_Silent_p.L625L			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	625					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										AGTCCAAAAATAAACGCTGGT	0.403																																					p.L625L		Atlas-SNP	.											.	FTSJD1	70	.	0			c.A1875G						.						63.0	64.0	63.0					16																	71317949		2198	4300	6498	SO:0001819	synonymous_variant	55783	exon3			CAAAAATAAACGC	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.1875A>G	chr16.hg19:g.71317949T>C		101.0	0.0		73.0	36.0	NM_018348	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Silent	SNP	ENST00000338099.5	hg19	CCDS10898.1																																																																																			.	.		0.403	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348	
DNAH9	1770	hgsc.bcm.edu	37	17	11539972	11539972	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr17:11539972C>T	ENST00000262442.4	+	9	1725	c.1657C>T	c.(1657-1659)Ctc>Ttc	p.L553F	DNAH9_ENST00000454412.2_Missense_Mutation_p.L553F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	553	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGCAGGAAACCTCCTTGAAAG	0.433																																					p.L553F		Atlas-SNP	.											.	DNAH9	695	.	0			c.C1657T						.						96.0	93.0	94.0					17																	11539972		2203	4300	6503	SO:0001583	missense	1770	exon9			GGAAACCTCCTTG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1657C>T	chr17.hg19:g.11539972C>T	ENSP00000262442:p.Leu553Phe	87.0	0.0		125.0	8.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410967	0.62399	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.66460	-0.21;-0.21	5.69	5.69	0.88448	Dynein heavy chain, domain-1 (1);	0.161907	0.41097	D	0.000959	T	0.68540	0.3012	M	0.66506	2.035	0.80722	D	1	B	0.31730	0.337	B	0.41036	0.346	T	0.64993	-0.6276	10	0.32370	T	0.25	.	11.1031	0.48186	0.0:0.9154:0.0:0.0846	.	553	Q9NYC9	DYH9_HUMAN	F	553	ENSP00000262442:L553F;ENSP00000414874:L553F	ENSP00000262442:L553F	L	+	1	0	DNAH9	11480697	0.993000	0.37304	0.943000	0.38184	0.978000	0.69477	2.266000	0.43320	2.844000	0.97970	0.650000	0.86243	CTC	.	.		0.433	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SPHK1	8877	hgsc.bcm.edu	37	17	74383560	74383560	+	Missense_Mutation	SNP	G	G	A	rs55648239		TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr17:74383560G>A	ENST00000545180.1	+	8	1857	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M	SPHK1_ENST00000323374.4_Missense_Mutation_p.V436M|SPHK1_ENST00000392496.3_Missense_Mutation_p.V350M|SPHK1_ENST00000590959.1_Missense_Mutation_p.V364M|SPHK1_ENST00000592299.1_Missense_Mutation_p.V350M			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	350					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	TAGCGAGGCCGTGCAGGGCCA	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18780	0.0		0.0	False		,,,				2504	0.001				p.V436M	GBM(90;966 1307 27369 33775 44498)	Atlas-SNP	.											.	SPHK1	24	.	0			c.G1306A						.						62.0	65.0	64.0					17																	74383560		2203	4300	6503	SO:0001583	missense	8877	exon6			GAGGCCGTGCAGG	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.1048G>A	chr17.hg19:g.74383560G>A	ENSP00000440970:p.Val350Met	63.0	0.0		67.0	19.0	NM_182965	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	ENST00000545180.1	hg19	CCDS45785.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751713	0.69533	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.16743	2.32;2.32;2.32	5.08	5.08	0.68730	.	0.284658	0.33199	N	0.005162	T	0.25865	0.0630	L	0.58428	1.81	0.38261	D	0.941897	D;P;D	0.61697	0.988;0.956;0.99	P;P;P	0.48400	0.576;0.475;0.556	T	0.09207	-1.0685	10	0.72032	D	0.01	-34.4439	14.1781	0.65557	0.0:0.1498:0.8502:0.0	rs55648239	436;364;350	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	M	350;436;350;349	ENSP00000440970:V350M;ENSP00000313681:V436M;ENSP00000376285:V350M	ENSP00000313681:V436M	V	+	1	0	SPHK1	71895155	0.999000	0.42202	0.982000	0.44146	0.863000	0.49368	2.875000	0.48491	2.355000	0.79922	0.456000	0.33151	GTG	.	.		0.617	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
SPTBN4	57731	hgsc.bcm.edu	37	19	41073990	41073990	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr19:41073990A>T	ENST00000352632.3	+	31	6844	c.6758A>T	c.(6757-6759)gAg>gTg	p.E2253V	SPTBN4_ENST00000392025.1_Missense_Mutation_p.E996V|SPTBN4_ENST00000598249.1_Missense_Mutation_p.E2253V			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2253					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGCGGCAAGAGTCAGTCGAT	0.731																																					p.E2253V		Atlas-SNP	.											.	SPTBN4	213	.	0			c.A6758T						.						13.0	12.0	13.0					19																	41073990		2116	4152	6268	SO:0001583	missense	57731	exon31			GGCAAGAGTCAGT	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6758A>T	chr19.hg19:g.41073990A>T	ENSP00000263373:p.Glu2253Val	149.0	0.0		137.0	7.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.769493	0.31320	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.76839	-1.05;0.28	3.53	2.4	0.29515	.	0.115012	0.35040	U	0.003483	T	0.57607	0.2065	N	0.14661	0.345	0.36186	D	0.849761	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.59752	-0.7395	10	0.45353	T	0.12	.	7.2997	0.26413	0.8031:0.0:0.0:0.1969	.	996;2253	C9JY79;Q9H254	.;SPTN4_HUMAN	V	2253;2253;996	ENSP00000263373:E2253V;ENSP00000375879:E996V	ENSP00000263373:E2253V	E	+	2	0	SPTBN4	45765830	1.000000	0.71417	0.973000	0.42090	0.037000	0.13140	2.288000	0.43514	1.592000	0.50018	0.459000	0.35465	GAG	.	.		0.731	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
TRAPPC6A	79090	hgsc.bcm.edu	37	19	45668161	45668161	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr19:45668161A>G	ENST00000585934.1	-	3	238	c.220T>C	c.(220-222)Tgg>Cgg	p.W74R	TRAPPC6A_ENST00000592647.1_Missense_Mutation_p.V65A|TRAPPC6A_ENST00000588062.1_Missense_Mutation_p.V51A|TRAPPC6A_ENST00000006275.4_Missense_Mutation_p.W88R	NM_001270891.1	NP_001257820.1	O75865	TPC6A_HUMAN	trafficking protein particle complex 6A	74					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	8		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00872)|GBM - Glioblastoma multiforme(486;0.233)		ACCGCCACCCACAGGTCTTTG	0.647																																					p.W88R		Atlas-SNP	.											.	TRAPPC6A	16	.	0			c.T262C						.						85.0	84.0	84.0					19																	45668161		2203	4300	6503	SO:0001583	missense	79090	exon3			CCACCCACAGGTC	AF161407	CCDS12655.1, CCDS59395.1, CCDS59396.1, CCDS59397.1	19q13.32	2012-10-02				ENSG00000007255		"""Trafficking protein particle complex"""	23069	protein-coding gene	gene with protein product		610396					Standard	NM_024108		Approved	TRS33, MGC2650, HSPC289	uc002pav.4	O75865		ENST00000585934.1:c.220T>C	chr19.hg19:g.45668161A>G	ENSP00000468612:p.Trp74Arg	69.0	0.0		82.0	27.0	NM_024108	K7ERB1|K7ERQ4|Q9BQ45|Q9P092	Missense_Mutation	SNP	ENST00000585934.1	hg19	CCDS59397.1	.	.	.	.	.	.	.	.	.	.	a	18.85	3.711218	0.68730	.	.	ENSG00000007255	ENST00000006275	T	0.68624	-0.34	4.51	4.51	0.55191	NO signalling/Golgi transport  ligand-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	M	0.92367	3.3	0.25430	N	0.988195	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77474	-0.2574	10	0.87932	D	0	-7.9562	10.2163	0.43170	1.0:0.0:0.0:0.0	.	74;88	O75865;O75865-2	TPC6A_HUMAN;.	R	88	ENSP00000006275:W88R	ENSP00000006275:W88R	W	-	1	0	TRAPPC6A	50360001	1.000000	0.71417	0.902000	0.35471	0.910000	0.53928	7.344000	0.79328	1.671000	0.50874	0.460000	0.39030	TGG	.	.		0.647	TRAPPC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457556.1	NM_024108	
GGTLC1	92086	hgsc.bcm.edu	37	20	23965975	23965975	+	Silent	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr20:23965975G>T	ENST00000335694.4	-	6	760	c.556C>A	c.(556-558)Cgg>Agg	p.R186R	GGTLC1_ENST00000278765.4_Silent_p.R186R|GGTLC1_ENST00000286890.4_Silent_p.R186R	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	186					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						TGATGGTGCCGGGTCTCCAGG	0.637																																					p.R186R		Atlas-SNP	.											.	GGTLC1	37	.	0			c.C556A						.						75.0	78.0	77.0					20																	23965975		2203	4300	6503	SO:0001819	synonymous_variant	92086	exon6			GGTGCCGGGTCTC	AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.556C>A	chr20.hg19:g.23965975G>T		143.0	0.0		135.0	7.0	NM_178311	D3DW43|Q08246	Silent	SNP	ENST00000335694.4	hg19	CCDS13163.1																																																																																			.	.		0.637	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078366.2	NM_178311.2	
ELMO2	63916	hgsc.bcm.edu	37	20	45002045	45002045	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr20:45002045A>T	ENST00000290246.6	-	16	1603	c.1409T>A	c.(1408-1410)tTc>tAc	p.F470Y	ELMO2_ENST00000488853.1_5'Flank|ELMO2_ENST00000352077.2_Missense_Mutation_p.F468Y|ELMO2_ENST00000454865.2_Missense_Mutation_p.F202Y|ELMO2_ENST00000396391.1_Missense_Mutation_p.F470Y|ELMO2_ENST00000445496.2_Missense_Mutation_p.F287Y|ELMO2_ENST00000372176.1_Missense_Mutation_p.F382Y|ELMO2_ENST00000439931.2_Missense_Mutation_p.F482Y	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	470	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				GACCTTGTTGAAGTCCTCTGC	0.547																																					p.F470Y		Atlas-SNP	.											.	ELMO2	51	.	0			c.T1409A						.						145.0	111.0	123.0					20																	45002045		2203	4300	6503	SO:0001583	missense	63916	exon15			TTGTTGAAGTCCT	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.1409T>A	chr20.hg19:g.45002045A>T	ENSP00000290246:p.Phe470Tyr	56.0	0.0		65.0	13.0	NM_182764	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	ENST00000290246.6	hg19	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	A	31	5.100124	0.94197	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000452857;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077;ENST00000425546	T;T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	4.91	4.91	0.64330	Engulfment/cell motility, ELMO (2);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	M	0.61703	1.905	0.80722	D	1	B;D;P;D;P	0.89917	0.097;1.0;0.635;0.988;0.494	B;D;P;D;P	0.77557	0.14;0.99;0.612;0.934;0.457	T	0.63161	-0.6699	10	0.56958	D	0.05	-25.6017	13.8983	0.63787	1.0:0.0:0.0:0.0	.	482;202;470;287;470	B4DRL5;B4DZ20;E9PBG2;B7Z1S8;Q96JJ3	.;.;.;.;ELMO2_HUMAN	Y	470;382;37;470;482;287;202;468;258	ENSP00000290246:F470Y;ENSP00000361249:F382Y;ENSP00000414329:F37Y;ENSP00000379673:F470Y;ENSP00000396519:F482Y;ENSP00000409920:F287Y;ENSP00000415641:F202Y;ENSP00000326172:F468Y;ENSP00000388962:F258Y	ENSP00000290246:F470Y	F	-	2	0	ELMO2	44435452	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.139000	0.94554	2.056000	0.61249	0.459000	0.35465	TTC	.	.		0.547	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1	NM_022086	
ITGB2	3689	hgsc.bcm.edu	37	21	46314957	46314957	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr21:46314957G>T	ENST00000397850.2	-	10	1464	c.1012C>A	c.(1012-1014)Ccc>Acc	p.P338T	ITGB2_ENST00000397852.1_Missense_Mutation_p.P338T|ITGB2_ENST00000397857.1_Missense_Mutation_p.P338T|ITGB2_ENST00000397854.3_Missense_Mutation_p.P281T|ITGB2_ENST00000355153.4_Missense_Mutation_p.P338T|ITGB2_ENST00000302347.5_Missense_Mutation_p.P338T			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	338	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GCTGACTTGGGGATGATCTCG	0.577																																					p.P338T		Atlas-SNP	.											.	ITGB2	107	.	0			c.C1012A						.						113.0	93.0	100.0					21																	46314957		2203	4300	6503	SO:0001583	missense	3689	exon9			ACTTGGGGATGAT	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1012C>A	chr21.hg19:g.46314957G>T	ENSP00000380948:p.Pro338Thr	64.0	0.0		48.0	8.0	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	hg19	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055104	0.75960	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414	T;T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51;-0.51	5.28	5.28	0.74379	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	.	.	.	.	D	0.86569	0.5964	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.89087	0.3480	9	0.87932	D	0	.	16.4453	0.83925	0.0:0.0:1.0:0.0	.	281;338	A8MYE6;P05107	.;ITB2_HUMAN	T	338;338;281;338;338;338;281	ENSP00000380950:P338T;ENSP00000380955:P338T;ENSP00000380952:P281T;ENSP00000347279:P338T;ENSP00000380948:P338T;ENSP00000303242:P338T	ENSP00000303242:P338T	P	-	1	0	ITGB2	45139385	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	8.978000	0.93450	2.482000	0.83794	0.585000	0.79938	CCC	.	.		0.577	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
PMM1	5372	hgsc.bcm.edu	37	22	41973917	41973917	+	Silent	SNP	G	G	A			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr22:41973917G>A	ENST00000216259.7	-	7	645	c.561C>T	c.(559-561)atC>atT	p.I187I		NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	187					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						CGTCAAAGCTGATCATGCCTC	0.552																																					p.I187I		Atlas-SNP	.											.	PMM1	21	.	0			c.C561T						.						102.0	79.0	87.0					22																	41973917		2203	4300	6503	SO:0001819	synonymous_variant	5372	exon7			AAAGCTGATCATG		CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.561C>T	chr22.hg19:g.41973917G>A		68.0	0.0		104.0	18.0	NM_002676	A8K003|Q92586	Silent	SNP	ENST00000216259.7	hg19	CCDS14020.1																																																																																			.	.		0.552	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320711.3	NM_002676	
RPS6KA6	27330	hgsc.bcm.edu	37	X	83419338	83419338	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chrX:83419338G>T	ENST00000262752.2	-	2	146	c.139C>A	c.(139-141)Cat>Aat	p.H47N	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.H47N	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	47					axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						ATACTTACATGACAAGAATCT	0.303																																					p.H47N		Atlas-SNP	.											.	RPS6KA6	116	.	0			c.C139A						.						95.0	86.0	89.0					X																	83419338		2203	4296	6499	SO:0001583	missense	27330	exon2			TTACATGACAAGA	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.139C>A	chrX.hg19:g.83419338G>T	ENSP00000262752:p.His47Asn	327.0	0.0		288.0	34.0	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	hg19	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	G	7.384	0.629350	0.14257	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.68765	-0.35;-0.34	4.22	3.34	0.38264	.	0.978140	0.08447	N	0.944571	T	0.48874	0.1524	N	0.14661	0.345	0.22666	N	0.99888	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32188	-0.9916	10	0.24483	T	0.36	.	9.651	0.39897	0.0:0.0:0.6253:0.3747	.	47;47	B7ZL90;Q9UK32	.;KS6A6_HUMAN	N	47	ENSP00000262752:H47N;ENSP00000440830:H47N	ENSP00000262752:H47N	H	-	1	0	RPS6KA6	83305994	1.000000	0.71417	0.053000	0.19242	0.980000	0.70556	1.583000	0.36579	0.757000	0.33036	0.429000	0.28392	CAT	.	.		0.303	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
ARMCX1	51309	hgsc.bcm.edu	37	X	100808335	100808335	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chrX:100808335G>C	ENST00000372829.3	+	4	793	c.422G>C	c.(421-423)aGt>aCt	p.S141T		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	141						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						CTTGCACCGAGTTTACCCTGC	0.617																																					p.S141T		Atlas-SNP	.											.	ARMCX1	67	.	0			c.G422C						.						64.0	61.0	62.0					X																	100808335		2203	4300	6503	SO:0001583	missense	51309	exon4			CACCGAGTTTACC	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.422G>C	chrX.hg19:g.100808335G>C	ENSP00000361917:p.Ser141Thr	76.0	0.0		94.0	60.0	NM_016608	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	ENST00000372829.3	hg19	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	g	8.347	0.829975	0.16749	.	.	ENSG00000126947	ENST00000372829	T	0.28069	1.63	3.86	3.86	0.44501	.	0.364574	0.24786	N	0.035612	T	0.14056	0.0340	N	0.19112	0.55	0.27632	N	0.948019	P	0.35155	0.487	B	0.27380	0.079	T	0.12993	-1.0526	10	0.07030	T	0.85	-3.9483	10.1908	0.43026	0.0:0.0:1.0:0.0	.	141	Q9P291	ARMX1_HUMAN	T	141	ENSP00000361917:S141T	ENSP00000361917:S141T	S	+	2	0	ARMCX1	100694991	0.999000	0.42202	0.988000	0.46212	0.876000	0.50452	3.785000	0.55424	2.160000	0.67779	0.556000	0.70494	AGT	.	.		0.617	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
ANAPC1	64682	hgsc.bcm.edu	37	2	112560035	112560035	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr2:112560035delG	ENST00000341068.3	-	33	4963	c.4191delC	c.(4189-4191)gacfs	p.D1397fs		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1397					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GCTTCACAAAGTCCAACAAAT	0.433																																					p.F1398fs		Atlas-INDEL	.											.	ANAPC1	116	.	0			c.4192delT						.						14.0	13.0	13.0					2																	112560035		2194	4269	6463	SO:0001589	frameshift_variant	64682	exon33			.	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.4191delC	chr2.hg19:g.112560035delG	ENSP00000339109:p.Asp1397fs	919.0	0.0		951.0	145.0	NM_022662	Q2M3H8|Q9BSE6|Q9H8D0	Frame_Shift_Del	DEL	ENST00000341068.3	hg19	CCDS2093.1																																																																																			.	.		0.433	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
TP53	7157	hgsc.bcm.edu	37	17	7577023	7577033	+	Frame_Shift_Del	DEL	CTTAGTGCTCC	CTTAGTGCTCC	-	rs587782654|rs587782391		TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	CTTAGTGCTCC	CTTAGTGCTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr17:7577023_7577033delCTTAGTGCTCC	ENST00000269305.4	-	8	1094_1104	c.905_915delGGAGCACTAAG	c.(904-915)gggagcactaagfs	p.GSTK302fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.GSTK302fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.GSTK302fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.GSTK302fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.GSTK302fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	302	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		G -> A (in a sporadic cancer; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in a sporadic cancer; somatic mutation).|G -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K305*(19)|p.0?(8)|p.K305N(3)|p.G302E(3)|p.G302G(3)|p.?(3)|p.S303N(3)|p.S303T(3)|p.K305R(2)|p.T304I(2)|p.T304A(2)|p.S303C(2)|p.T304fs*41(2)|p.K305K(1)|p.K305E(1)|p.G293fs*1(1)|p.K305T(1)|p.T304N(1)|p.T304T(1)|p.H296_S303delHHELPPGS(1)|p.P301_S303delPGS(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.S303fs*42(1)|p.G302fs*2(1)|p.K305fs*32(1)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTTACCTCGCTTAGTGCTCCCTGGGGGCAG	0.555		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.302_306del	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,adenocarcinoma,0,166	TP53	33396	.	69	Substitution - Missense(23)|Substitution - Nonsense(19)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - coding silent(5)|Deletion - In frame(3)|Unknown(3)|Insertion - Frameshift(2)	upper_aerodigestive_tract(14)|urinary_tract(7)|lung(7)|breast(7)|oesophagus(7)|large_intestine(6)|haematopoietic_and_lymphoid_tissue(6)|bone(5)|central_nervous_system(3)|stomach(2)|soft_tissue(1)|skin(1)|pancreas(1)|prostate(1)|liver(1)	c.906_916del	GRCh37	CM942123	TP53	M		.																																			SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.905_915delGGAGCACTAAG	chr17.hg19:g.7577023_7577033delCTTAGTGCTCC	ENSP00000269305:p.Gly302fs	71.0	0.0		73.0	22.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.555	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
EBF4	57593	hgsc.bcm.edu	37	20	2733101	2733133	+	In_Frame_Del	DEL	GGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	GGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	-			TCGA-DD-AAE8-01A-11D-A40R-10	TCGA-DD-AAE8-10A-01D-A40U-10	GGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	GGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0b6c61a-a389-4f78-a06a-a7cb308657de	bce559c8-f5e9-41a2-8339-05113ef1a254	g.chr20:2733101_2733133delGGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	ENST00000609451.1	+	14	1522_1554	c.1450_1482delGGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	c.(1450-1482)ggcggctacggcgcgccgggcgtggccggcctcdel	p.GGYGAPGVAGL484del	EBF4_ENST00000380648.4_In_Frame_Del_p.GGYGAPGVAGL480del			Q9BQW3	COE4_HUMAN	early B-cell factor 4	484					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AGCTGGCCTGGGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTCGGCGTGCCTG	0.777																																					p.479_490del		Atlas-INDEL	.											.	.	.	.	0			c.1437_1469del						.																																			SO:0001651	inframe_deletion	57593	exon15			.	BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.1450_1482delGGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	chr20.hg19:g.2733101_2733133delGGCGGCTACGGCGCGCCGGGCGTGGCCGGCCTC	ENSP00000477023:p.Gly484_Leu494del	24.0	0.0		66.0	25.0	NM_001110514	Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	In_Frame_Del	DEL	ENST00000609451.1	hg19																																																																																				.	.		0.777	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471930.1	XM_938882	
