#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF10L	55160	hgsc.bcm.edu	37	1	17981137	17981137	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:17981137G>T	ENST00000361221.3	+	23	2560	c.2401G>T	c.(2401-2403)Gcc>Tcc	p.A801S	ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.A762S|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.A762S|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.A574S|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.A796S|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.A504S	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	801						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GCAGCTTGGGGCCCTGGTCCA	0.582																																					p.A801S		Atlas-SNP	.											.	ARHGEF10L	219	.	0			c.G2401T						.						232.0	227.0	229.0					1																	17981137		2203	4300	6503	SO:0001583	missense	55160	exon23			CTTGGGGCCCTGG	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.2401G>T	chr1.hg19:g.17981137G>T	ENSP00000355060:p.Ala801Ser	35.0	0.0		33.0	24.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	hg19	CCDS182.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223476	0.39300	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32	4.49	3.46	0.39613	.	0.254366	0.38164	N	0.001799	T	0.06462	0.0166	L	0.41236	1.265	0.29015	N	0.886666	B;B;B;B;B;B;B	0.13594	0.005;0.008;0.002;0.001;0.004;0.008;0.001	B;B;B;B;B;B;B	0.15052	0.005;0.012;0.006;0.003;0.007;0.006;0.002	T	0.11842	-1.0571	10	0.29301	T	0.29	-15.8421	12.6564	0.56790	0.0:0.0:0.8227:0.1773	.	574;796;504;562;757;762;801	Q5VXI4;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	S	801;762;796;762;574;574;504	ENSP00000355060:A801S;ENSP00000399401:A762S;ENSP00000394621:A796S;ENSP00000364564:A762S;ENSP00000364557:A574S;ENSP00000167825:A504S	ENSP00000167825:A504S	A	+	1	0	ARHGEF10L	17853724	0.995000	0.38212	1.000000	0.80357	0.970000	0.65996	3.186000	0.50942	2.048000	0.60808	0.561000	0.74099	GCC	.	.		0.582	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
HSPG2	3339	hgsc.bcm.edu	37	1	22158249	22158249	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:22158249T>C	ENST00000374695.3	-	82	11327	c.11248A>G	c.(11248-11250)Aca>Gca	p.T3750A	HSPG2_ENST00000486901.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3750	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCCAGTGGTGTGGGATGGCGG	0.652																																					p.T3750A		Atlas-SNP	.											.	HSPG2	311	.	0			c.A11248G						.						60.0	64.0	63.0					1																	22158249		2203	4299	6502	SO:0001583	missense	3339	exon82			GTGGTGTGGGATG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.11248A>G	chr1.hg19:g.22158249T>C	ENSP00000363827:p.Thr3750Ala	301.0	1.0		224.0	171.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	t	17.64	3.440208	0.63067	.	.	ENSG00000142798	ENST00000374695	T	0.77098	-1.07	5.31	4.18	0.49190	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.182919	0.26387	N	0.024666	T	0.79736	0.4497	L	0.44542	1.39	0.36946	D	0.892625	P;D	0.71674	0.587;0.998	P;D	0.71414	0.479;0.973	T	0.76440	-0.2958	10	0.11485	T	0.65	.	10.0121	0.41992	0.0:0.0807:0.0:0.9193	.	1690;3750	Q59EG0;P98160	.;PGBM_HUMAN	A	3750	ENSP00000363827:T3750A	ENSP00000363827:T3750A	T	-	1	0	HSPG2	22030836	0.998000	0.40836	0.656000	0.29637	0.704000	0.40688	3.053000	0.49901	0.855000	0.35359	0.454000	0.30748	ACA	.	.		0.652	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
PCSK9	255738	hgsc.bcm.edu	37	1	55527047	55527047	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:55527047G>T	ENST00000302118.5	+	11	1971		c.e11-1		PCSK9_ENST00000490692.1_Splice_Site|PCSK9_ENST00000543384.1_Splice_Site	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9						apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						CTCTGCCCCAGGCTGCAGCTC	0.627																																					.	Pancreas(137;1454 1827 5886 22361 42375)	Atlas-SNP	.											.	PCSK9	76	.	0			c.1682-1G>T						.						18.0	19.0	18.0					1																	55527047		2200	4299	6499	SO:0001630	splice_region_variant	255738	exon11			GCCCCAGGCTGCA	AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.1682-1G>T	chr1.hg19:g.55527047G>T		285.0	0.0		199.0	99.0	NM_174936	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Splice_Site	SNP	ENST00000302118.5	hg19	CCDS603.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568138	0.45798	.	.	ENSG00000169174	ENST00000302118	.	.	.	3.68	2.65	0.31530	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6166	0.51094	0.0:0.0:0.8212:0.1788	.	.	.	.	.	-1	.	.	.	+	.	.	PCSK9	55299635	1.000000	0.71417	0.996000	0.52242	0.764000	0.43329	3.586000	0.53950	1.741000	0.51731	0.456000	0.33151	.	.	.		0.627	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1	NM_174936	Intron
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74833646	74833646	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:74833646A>T	ENST00000370899.3	+	15	1659	c.1622A>T	c.(1621-1623)aAa>aTa	p.K541I	TNNI3K_ENST00000370891.2_Missense_Mutation_p.K541I|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.K554I|TNNI3K_ENST00000326637.3_Missense_Mutation_p.K440I|RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.K541I	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		AGCATGACAAAAGGTACCTAT	0.289																																					p.K541I		Atlas-SNP	.											.	.	.	.	0			c.A1622T						.						60.0	62.0	62.0					1																	74833646		2203	4297	6500	SO:0001583	missense	100526835	exon15			TGACAAAAGGTAC			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1622A>T	chr1.hg19:g.74833646A>T	ENSP00000359936:p.Lys541Ile	358.0	0.0		289.0	94.0	NM_001112808		Missense_Mutation	SNP	ENST00000370899.3	hg19		.	.	.	.	.	.	.	.	.	.	A	31	5.092087	0.94149	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000534632;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.75938	-0.98;-0.69;-0.98;-0.98;-0.96	5.9	5.9	0.94986	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73567	0.3603	L	0.27053	0.805	0.58432	D	0.999999	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	P;D;D;D	0.71656	0.878;0.974;0.974;0.952	T	0.78056	-0.2353	10	0.56958	D	0.05	.	16.3155	0.82918	1.0:0.0:0.0:0.0	.	440;541;541;541	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	I	541;541;162;541;541;440	ENSP00000359936:K541I;ENSP00000359932:K541I;ENSP00000450895:K541I;ENSP00000359928:K541I;ENSP00000322251:K440I	ENSP00000322251:K440I	K	+	2	0	RP11-653A5.2;AC093158.1	74606234	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.558000	0.90704	2.260000	0.74910	0.528000	0.53228	AAA	.	.		0.289	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
INTS3	65123	hgsc.bcm.edu	37	1	153743174	153743174	+	Silent	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:153743174C>T	ENST00000318967.2	+	25	3085	c.2517C>T	c.(2515-2517)gcC>gcT	p.A839A	INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Silent_p.A839A|INTS3_ENST00000456435.1_Silent_p.A633A|INTS3_ENST00000512605.1_Silent_p.A633A	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	840					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ACCCAGAGGCCCTGTCCTGCC	0.537																																					p.A839A		Atlas-SNP	.											.	INTS3	83	.	0			c.C2517T						.						56.0	53.0	54.0					1																	153743174		2203	4300	6503	SO:0001819	synonymous_variant	65123	exon25			AGAGGCCCTGTCC	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2517C>T	chr1.hg19:g.153743174C>T		54.0	0.0		69.0	26.0	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Silent	SNP	ENST00000318967.2	hg19	CCDS1052.1																																																																																			.	.		0.537	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
LRRC71	149499	hgsc.bcm.edu	37	1	156899104	156899104	+	Silent	SNP	G	G	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:156899104G>C	ENST00000337428.7	+	10	1183	c.1029G>C	c.(1027-1029)acG>acC	p.T343T	LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	343										endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						ACTCCAAAACGGACCGTGAGA	0.557																																					p.T343T		Atlas-SNP	.											.	LRRC71	33	.	0			c.G1029C						.						57.0	57.0	57.0					1																	156899104		1977	4165	6142	SO:0001819	synonymous_variant	149499	exon10			CAAAACGGACCGT	BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.1029G>C	chr1.hg19:g.156899104G>C		125.0	0.0		167.0	20.0	NM_144702	Q96M24	Silent	SNP	ENST00000337428.7	hg19	CCDS44249.1																																																																																			.	.		0.557	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098961.1	NM_144702	
CTSE	1510	hgsc.bcm.edu	37	1	206319173	206319173	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:206319173T>C	ENST00000358184.2	+	3	416	c.298T>C	c.(298-300)Tcc>Ccc	p.S100P	CTSE_ENST00000361052.3_Missense_Mutation_p.S100P|CTSE_ENST00000432969.2_Missense_Mutation_p.S25P|CTSE_ENST00000360218.2_Missense_Mutation_p.S100P	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	100					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			CACTGGCTCCTCCAACCTCTG	0.567																																					p.S100P		Atlas-SNP	.											.	CTSE	72	.	0			c.T298C						.						120.0	107.0	111.0					1																	206319173		2203	4300	6503	SO:0001583	missense	1510	exon3			GGCTCCTCCAACC	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.298T>C	chr1.hg19:g.206319173T>C	ENSP00000350911:p.Ser100Pro	57.0	0.0		109.0	44.0	NM_001910	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	ENST00000358184.2	hg19	CCDS1462.1	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846146	0.71603	.	.	ENSG00000196188	ENST00000358184;ENST00000361052;ENST00000360218;ENST00000432969	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	4.78	3.65	0.41850	.	0.175329	0.40385	N	0.001108	D	0.82907	0.5139	M	0.90309	3.105	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.84679	0.0716	10	0.87932	D	0	.	10.3393	0.43868	0.0:0.0786:0.0:0.9214	.	25;100;100	B4DNU8;P14091-2;P14091-1	.;.;.	P	100;100;100;25	ENSP00000350911:S100P;ENSP00000354337:S100P;ENSP00000353350:S100P;ENSP00000394607:S25P	ENSP00000350911:S100P	S	+	1	0	CTSE	204485796	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	5.556000	0.67307	0.970000	0.38263	-0.256000	0.11100	TCC	.	.		0.567	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910	
DIEXF	27042	hgsc.bcm.edu	37	1	210010380	210010380	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:210010380G>A	ENST00000491415.2	+	6	943	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	296					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						GTTCTACCCGGAAAGGACTGC	0.488																																					p.E296K		Atlas-SNP	.											.	DIEXF	97	.	0			c.G886A						.						69.0	71.0	71.0					1																	210010380		2203	4300	6503	SO:0001583	missense	27042	exon6			TACCCGGAAAGGA	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.886G>A	chr1.hg19:g.210010380G>A	ENSP00000419005:p.Glu296Lys	130.0	0.0		213.0	104.0	NM_014388	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	hg19	CCDS1493.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206911	0.39003	.	.	ENSG00000117597	ENST00000491415	T	0.44881	0.91	5.81	4.9	0.64082	.	0.236438	0.50627	N	0.000118	T	0.34135	0.0887	L	0.55743	1.74	0.41738	D	0.989593	P	0.35411	0.5	B	0.29267	0.1	T	0.15867	-1.0422	10	0.08837	T	0.75	-23.1277	15.1781	0.72931	0.0674:0.0:0.9326:0.0	.	296	Q68CQ4	DIEXF_HUMAN	K	296	ENSP00000419005:E296K	ENSP00000419005:E296K	E	+	1	0	DIEXF	208077003	1.000000	0.71417	0.995000	0.50966	0.310000	0.27922	6.373000	0.73128	1.465000	0.48006	-0.126000	0.14955	GAA	.	.		0.488	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
ALLC	55821	hgsc.bcm.edu	37	2	3729266	3729266	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:3729266C>T	ENST00000252505.3	+	6	503	c.341C>T	c.(340-342)gCt>gTt	p.A114V		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	133					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		AGGACAGGAGCTGCAGCCACT	0.443										HNSCC(21;0.051)																											p.A114V		Atlas-SNP	.											.	ALLC	61	.	0			c.C341T						.						52.0	57.0	55.0					2																	3729266		1915	4126	6041	SO:0001583	missense	55821	exon6			CAGGAGCTGCAGC	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.341C>T	chr2.hg19:g.3729266C>T	ENSP00000252505:p.Ala114Val	110.0	0.0		83.0	35.0	NM_018436	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	hg19	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	C	4.162	0.028568	0.08054	.	.	ENSG00000151360	ENST00000252505	.	.	.	4.98	2.02	0.26589	Allantoicase domain (1);Galactose-binding domain-like (1);	0.630810	0.17333	N	0.178051	T	0.25269	0.0614	L	0.28115	0.83	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.12477	-1.0546	9	0.39692	T	0.17	-13.8322	4.6385	0.12536	0.0:0.6238:0.1812:0.195	.	133	Q8N6M5	ALLC_HUMAN	V	114	.	ENSP00000252505:A114V	A	+	2	0	ALLC	3707141	0.001000	0.12720	0.001000	0.08648	0.017000	0.09413	0.275000	0.18698	0.800000	0.34041	0.650000	0.86243	GCT	.	.		0.443	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
TUBA3E	112714	hgsc.bcm.edu	37	2	130951585	130951585	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:130951585G>T	ENST00000312988.7	-	4	930	c.830C>A	c.(829-831)tCa>tAa	p.S277*		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	277					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					CTTCTCAGCTGAGATGACTGG	0.597																																					p.S277X		Atlas-SNP	.											.	TUBA3E	73	.	0			c.C830A						.						118.0	103.0	108.0					2																	130951585		2203	4300	6503	SO:0001587	stop_gained	112714	exon4			TCAGCTGAGATGA	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.830C>A	chr2.hg19:g.130951585G>T	ENSP00000318197:p.Ser277*	113.0	0.0		77.0	4.0	NM_207312		Nonsense_Mutation	SNP	ENST00000312988.7	hg19	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	g	36	5.775866	0.96922	.	.	ENSG00000152086	ENST00000312988	.	.	.	2.92	2.92	0.33932	.	0.000000	0.45606	U	0.000359	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6717	0.51406	0.0:0.0:1.0:0.0	.	.	.	.	X	277	.	ENSP00000318197:S277X	S	-	2	0	TUBA3E	130668055	1.000000	0.71417	0.933000	0.37362	0.944000	0.59088	8.339000	0.90041	1.664000	0.50801	0.449000	0.29647	TCA	.	.		0.597	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802939	185802939	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:185802939G>A	ENST00000302277.6	+	4	3410	c.2816G>A	c.(2815-2817)aGa>aAa	p.R939K		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	939							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CACAAAGAAAGAAGTGAGAAT	0.378																																					p.R939K		Atlas-SNP	.											ZNF804A,mucosal,malignant_melanoma,0,1	ZNF804A	322	.	0			c.G2816A						.						79.0	77.0	78.0					2																	185802939		2203	4300	6503	SO:0001583	missense	91752	exon4			AAGAAAGAAGTGA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2816G>A	chr2.hg19:g.185802939G>A	ENSP00000303252:p.Arg939Lys	151.0	0.0		119.0	49.0	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	5.678	0.309723	0.10733	.	.	ENSG00000170396	ENST00000302277	T	0.04809	3.55	5.57	0.948	0.19561	.	0.765320	0.12203	N	0.490060	T	0.02727	0.0082	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.47649	-0.9101	10	0.05436	T	0.98	-1.8297	6.4963	0.22144	0.2835:0.1379:0.5786:0.0	.	939	Q7Z570	Z804A_HUMAN	K	939	ENSP00000303252:R939K	ENSP00000303252:R939K	R	+	2	0	ZNF804A	185511184	1.000000	0.71417	0.215000	0.23724	0.747000	0.42532	0.713000	0.25794	0.243000	0.21327	-0.218000	0.12543	AGA	.	.		0.378	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
GPR55	9290	hgsc.bcm.edu	37	2	231775507	231775507	+	Silent	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:231775507A>T	ENST00000392040.1	-	2	363	c.171T>A	c.(169-171)gcT>gcA	p.A57A	AC012507.4_ENST00000454890.1_RNA|GPR55_ENST00000392039.2_Silent_p.A57A	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	57					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		TGGAGGTGGCAGCATAATCGG	0.572																																					p.A57A		Atlas-SNP	.											.	GPR55	46	.	0			c.T171A						.						84.0	73.0	76.0					2																	231775507		2203	4300	6503	SO:0001819	synonymous_variant	9290	exon2			GGTGGCAGCATAA	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.171T>A	chr2.hg19:g.231775507A>T		229.0	0.0		171.0	61.0	NM_005683	Q8N580	Silent	SNP	ENST00000392040.1	hg19	CCDS2480.1																																																																																			.	.		0.572	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683	
NMUR1	10316	hgsc.bcm.edu	37	2	232393719	232393719	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:232393719A>C	ENST00000305141.4	-	2	146	c.13T>G	c.(13-15)Tgc>Ggc	p.C5G		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	5					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CAATTGAGGCAGAGAGGAGTC	0.567																																					p.C5G		Atlas-SNP	.											.	NMUR1	46	.	0			c.T13G						.						29.0	31.0	31.0					2																	232393719		2203	4299	6502	SO:0001583	missense	10316	exon2			TGAGGCAGAGAGG	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.13T>G	chr2.hg19:g.232393719A>C	ENSP00000305877:p.Cys5Gly	39.0	0.0		26.0	11.0	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	hg19	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	a	15.97	2.989963	0.54041	.	.	ENSG00000171596	ENST00000305141	T	0.67698	-0.28	5.2	-2.08	0.07254	.	1.424610	0.04518	N	0.384082	T	0.55641	0.1933	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.49890	-0.8891	10	0.87932	D	0	-13.7255	1.6405	0.02751	0.4389:0.2584:0.0844:0.2183	.	5	Q9HB89	NMUR1_HUMAN	G	5	ENSP00000305877:C5G	ENSP00000305877:C5G	C	-	1	0	NMUR1	232101963	0.083000	0.21467	0.338000	0.25549	0.832000	0.47134	1.743000	0.38258	0.258000	0.21686	0.449000	0.29647	TGC	.	.		0.567	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
TRPM8	79054	hgsc.bcm.edu	37	2	234863846	234863846	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:234863846G>T	ENST00000324695.4	+	11	1354	c.1314G>T	c.(1312-1314)caG>caT	p.Q438H	AC005538.5_ENST00000455991.1_RNA|TRPM8_ENST00000433712.2_Missense_Mutation_p.Q126H	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	438					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AGTGGAACCAGCTGGACTTAG	0.522																																					p.Q438H		Atlas-SNP	.											.	TRPM8	146	.	0			c.G1314T						.						109.0	101.0	104.0					2																	234863846		2203	4300	6503	SO:0001583	missense	79054	exon11			GAACCAGCTGGAC	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.1314G>T	chr2.hg19:g.234863846G>T	ENSP00000323926:p.Gln438His	127.0	0.0		107.0	40.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	hg19	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599666	0.66332	.	.	ENSG00000144481	ENST00000324695;ENST00000433712	T;T	0.35973	1.28;1.28	5.99	5.1	0.69264	.	0.000000	0.64402	D	0.000002	T	0.55800	0.1943	M	0.68317	2.08	0.39158	D	0.96234	D;D	0.71674	0.989;0.998	P;D	0.79784	0.804;0.993	T	0.62039	-0.6938	10	0.87932	D	0	-32.155	10.536	0.45004	0.1495:0.0:0.8505:0.0	.	126;438	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	H	438;126	ENSP00000323926:Q438H;ENSP00000404423:Q126H	ENSP00000323926:Q438H	Q	+	3	2	TRPM8	234528585	0.997000	0.39634	1.000000	0.80357	0.978000	0.69477	0.491000	0.22419	1.512000	0.48834	0.655000	0.94253	CAG	.	.		0.522	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
SRGAP3	9901	hgsc.bcm.edu	37	3	9094837	9094837	+	Silent	SNP	G	G	C	rs369059791		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr3:9094837G>C	ENST00000383836.3	-	9	1624	c.1197C>G	c.(1195-1197)tcC>tcG	p.S399S	SRGAP3_ENST00000360413.3_Silent_p.S399S|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	399	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GGAAGGCATCGGAGACATCAA	0.507			T	RAF1	pilocytic astrocytoma																																p.S399S		Atlas-SNP	.		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	SRGAP3	146	.	0			c.C1197G						.						146.0	119.0	128.0					3																	9094837		2203	4300	6503	SO:0001819	synonymous_variant	9901	exon9			GGCATCGGAGACA	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1197C>G	chr3.hg19:g.9094837G>C		104.0	0.0		104.0	9.0	NM_014850	Q8IX13|Q8IZV8	Silent	SNP	ENST00000383836.3	hg19	CCDS2572.1																																																																																			.	.		0.507	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
EOMES	8320	hgsc.bcm.edu	37	3	27763181	27763181	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr3:27763181G>T	ENST00000295743.4	-	1	808	c.605C>A	c.(604-606)cCa>cAa	p.P202Q	EOMES_ENST00000461503.1_Intron|EOMES_ENST00000449599.1_Missense_Mutation_p.P202Q|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	202	Gly-rich.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						CCTCCCGGGTGGGCACACAGC	0.771																																					p.P202Q		Atlas-SNP	.											.	EOMES	65	.	0			c.C605A						.						2.0	3.0	3.0					3																	27763181		1395	3181	4576	SO:0001583	missense	8320	exon1			CCGGGTGGGCACA	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.605C>A	chr3.hg19:g.27763181G>T	ENSP00000295743:p.Pro202Gln	60.0	0.0		80.0	35.0	NM_005442	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	ENST00000295743.4	hg19	CCDS2646.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608472	0.28623	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000535713	D;D	0.85411	-1.98;-1.98	4.39	3.49	0.39957	.	0.654196	0.15813	N	0.243379	D	0.83908	0.5356	L	0.47716	1.5	0.80722	D	1	P;P;P	0.47677	0.899;0.799;0.697	P;B;B	0.48227	0.571;0.282;0.146	T	0.81113	-0.1080	10	0.40728	T	0.16	.	12.4311	0.55575	0.0:0.1705:0.8295:0.0	.	202;202;202	F5H3K1;G3XAI5;O95936	.;.;EOMES_HUMAN	Q	202;202;67	ENSP00000295743:P202Q;ENSP00000388620:P202Q	ENSP00000295743:P202Q	P	-	2	0	EOMES	27738185	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	4.048000	0.57390	0.913000	0.36797	0.462000	0.41574	CCA	.	.		0.771	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,1	CTNNB1	4904	.	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	chr3.hg19:g.41266124A>G	ENSP00000344456:p.Thr41Ala	151.0	0.0		153.0	93.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SENP7	57337	hgsc.bcm.edu	37	3	101059023	101059023	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr3:101059023C>A	ENST00000394095.2	-	16	2326	c.2273G>T	c.(2272-2274)gGg>gTg	p.G758V	SENP7_ENST00000394094.2_Missense_Mutation_p.G693V|SENP7_ENST00000314261.7_Missense_Mutation_p.G692V|SENP7_ENST00000358203.3_Missense_Mutation_p.G594V|SENP7_ENST00000394091.1_Missense_Mutation_p.G594V|SENP7_ENST00000348610.3_Missense_Mutation_p.G725V	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	758						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TCCTAATCCCCCCTTAGTAGG	0.294																																					p.G758V		Atlas-SNP	.											.	SENP7	170	.	0			c.G2273T						.						53.0	49.0	51.0					3																	101059023		2201	4285	6486	SO:0001583	missense	57337	exon16			AATCCCCCCTTAG		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2273G>T	chr3.hg19:g.101059023C>A	ENSP00000377655:p.Gly758Val	437.0	0.0		567.0	152.0	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	hg19	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357131	0.82243	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.58495	0.2126	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.958	D;D;D;D	0.97110	1.0;1.0;1.0;0.953	T	0.62105	-0.6924	10	0.87932	D	0	-11.5671	18.8056	0.92035	0.0:1.0:0.0:0.0	.	594;692;725;758	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	V	758;693;692;594;594;725	ENSP00000377655:G758V;ENSP00000377654:G693V;ENSP00000313624:G692V;ENSP00000377651:G594V;ENSP00000350936:G594V;ENSP00000342159:G725V	ENSP00000313624:G692V	G	-	2	0	SENP7	102541713	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.875000	0.75551	2.606000	0.88127	0.563000	0.77884	GGG	.	.		0.294	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
N4BP2	55728	hgsc.bcm.edu	37	4	40122514	40122514	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr4:40122514A>T	ENST00000261435.6	+	9	3199	c.2783A>T	c.(2782-2784)gAg>gTg	p.E928V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	928					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ACAGCACATGAGGCCTGTTGG	0.418																																					p.E928V		Atlas-SNP	.											.	N4BP2	166	.	0			c.A2783T						.						59.0	57.0	58.0					4																	40122514		2203	4300	6503	SO:0001583	missense	55728	exon9			CACATGAGGCCTG	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2783A>T	chr4.hg19:g.40122514A>T	ENSP00000261435:p.Glu928Val	215.0	0.0		187.0	71.0	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.069|9.069	0.996371|0.996371	0.19043|0.19043	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000261435;ENST00000381804|ENST00000513269	T|.	0.19532|.	2.14|.	5.38|5.38	4.13|4.13	0.48395|0.48395	.|.	0.508000|.	0.21425|.	N|.	0.074754|.	T|.	0.43033|.	0.1229|.	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	D;P|.	0.76494|.	0.999;0.956|.	D;B|.	0.66351|.	0.943;0.444|.	T|.	0.36480|.	-0.9746|.	10|.	0.87932|.	D|.	0|.	-9.8925|-9.8925	5.1273|5.1273	0.14892|0.14892	0.7515:0.0:0.0881:0.1604|0.7515:0.0:0.0881:0.1604	.|.	928;928|.	Q86UW6-2;Q86UW6|.	.;N4BP2_HUMAN|.	V|C	928;848|574	ENSP00000261435:E928V|.	ENSP00000261435:E928V|.	E|X	+|+	2|3	0|0	N4BP2|N4BP2	39798909|39798909	0.880000|0.880000	0.30214|0.30214	0.739000|0.739000	0.30968|0.30968	0.068000|0.068000	0.16541|0.16541	1.291000|1.291000	0.33330|0.33330	2.175000|2.175000	0.68902|0.68902	0.533000|0.533000	0.62120|0.62120	GAG|TGA	.	.		0.418	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
MRPL1	65008	hgsc.bcm.edu	37	4	78830432	78830432	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr4:78830432G>T	ENST00000315567.8	+	7	1012	c.683G>T	c.(682-684)cGt>cTt	p.R228L	MRPL1_ENST00000506674.1_3'UTR	NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	228					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						TCCATTGGCCGTGACATCCCC	0.313																																					p.R228L		Atlas-SNP	.											.	MRPL1	37	.	0			c.G683T						.						91.0	99.0	96.0					4																	78830432		2203	4295	6498	SO:0001583	missense	65008	exon7			TTGGCCGTGACAT	AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.683G>T	chr4.hg19:g.78830432G>T	ENSP00000315017:p.Arg228Leu	550.0	0.0		447.0	162.0	NM_020236	A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Missense_Mutation	SNP	ENST00000315567.8	hg19	CCDS3583.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.618|7.618	0.676134|0.676134	0.14841|0.14841	.|.	.|.	ENSG00000169288|ENSG00000169288	ENST00000315567;ENST00000538314|ENST00000504901	T|.	0.40476|.	1.03|.	5.56|5.56	0.877|0.877	0.19145|0.19145	Ribosomal protein L1, 3-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);|.	0.628304|.	0.17011|.	N|.	0.190514|.	T|T	0.47857|0.47857	0.1468|0.1468	L|L	0.57536|0.57536	1.79|1.79	0.31798|0.31798	N|N	0.628815|0.628815	B;B|.	0.18461|.	0.015;0.028|.	B;B|.	0.17433|.	0.007;0.018|.	T|T	0.53251|0.53251	-0.8465|-0.8465	10|5	0.11485|.	T|.	0.65|.	-2.0923|-2.0923	8.2309|8.2309	0.31597|0.31597	0.4168:0.0:0.5832:0.0|0.4168:0.0:0.5832:0.0	.|.	206;228|.	A0PJ79;Q9BYD6|.	.;RM01_HUMAN|.	L|L	228;206|22	ENSP00000315017:R228L|.	ENSP00000315017:R228L|.	R|V	+|+	2|1	0|0	MRPL1|MRPL1	79049456|79049456	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.988000|0.988000	0.76386|0.76386	1.255000|1.255000	0.32909|0.32909	0.062000|0.062000	0.16340|0.16340	-0.150000|-0.150000	0.13652|0.13652	CGT|GTG	.	.		0.313	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252518.3	NM_020236	
VEGFC	7424	hgsc.bcm.edu	37	4	177650707	177650707	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr4:177650707T>A	ENST00000280193.2	-	2	756	c.341A>T	c.(340-342)tAt>tTt	p.Y114F	VEGFC_ENST00000507638.1_5'UTR	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	114					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		CTCTGTATTATAATGTGCTGC	0.378																																					p.Y114F		Atlas-SNP	.											.	VEGFC	94	.	0			c.A341T						.						133.0	121.0	125.0					4																	177650707		1858	4089	5947	SO:0001583	missense	7424	exon2			GTATTATAATGTG	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.341A>T	chr4.hg19:g.177650707T>A	ENSP00000280193:p.Tyr114Phe	75.0	0.0		50.0	19.0	NM_005429	B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	hg19	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	T	9.920	1.211881	0.22289	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.06	5.06	0.68205	.	0.137149	0.51477	D	0.000085	T	0.57917	0.2086	L	0.54323	1.7	0.40619	D	0.981748	B	0.12013	0.005	B	0.06405	0.002	T	0.56390	-0.7987	9	0.36615	T	0.2	-24.3868	15.1017	0.72284	0.0:0.0:0.0:1.0	.	114	P49767	VEGFC_HUMAN	F	114	.	ENSP00000280193:Y114F	Y	-	2	0	VEGFC	177887701	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	4.010000	0.57117	2.049000	0.60858	0.397000	0.26171	TAT	.	.		0.378	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
DNAH5	1767	hgsc.bcm.edu	37	5	13692162	13692162	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr5:13692162A>T	ENST00000265104.4	-	79	13910	c.13806T>A	c.(13804-13806)gaT>gaA	p.D4602E		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4602					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTGTCCTGAGATCCACAGCGG	0.502									Kartagener syndrome																												p.D4602E		Atlas-SNP	.											.	DNAH5	868	.	0			c.T13806A						.						122.0	111.0	115.0					5																	13692162		2203	4300	6503	SO:0001583	missense	1767	exon79	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CCTGAGATCCACA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13806T>A	chr5.hg19:g.13692162A>T	ENSP00000265104:p.Asp4602Glu	158.0	0.0		124.0	48.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291839	0.40594	.	.	ENSG00000039139	ENST00000265104	T	0.07908	3.15	5.76	1.97	0.26223	Dynein heavy chain (1);	0.104831	0.64402	N	0.000005	T	0.04724	0.0128	N	0.26162	0.8	0.54753	D	0.999987	B	0.06786	0.001	B	0.13407	0.009	T	0.44174	-0.9345	10	0.31617	T	0.26	.	1.7257	0.02921	0.3348:0.1467:0.3938:0.1247	.	4602	Q8TE73	DYH5_HUMAN	E	4602	ENSP00000265104:D4602E	ENSP00000265104:D4602E	D	-	3	2	DNAH5	13745162	0.854000	0.29725	0.998000	0.56505	0.831000	0.47069	-0.076000	0.11412	0.082000	0.17018	-0.128000	0.14901	GAT	.	.		0.502	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130938979	130938979	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr5:130938979T>C	ENST00000509018.1	-	3	387	c.182A>G	c.(181-183)aAt>aGt	p.N61S	RAPGEF6_ENST00000510071.1_Missense_Mutation_p.N61S|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.N61S|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.N61S|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.N111S|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.N61S|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.N61S	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	61					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GAGAACCTGATTGCCACTGTA	0.259																																					p.N61S	Melanoma(168;435 1955 13113 13877 23213)	Atlas-SNP	.											.	RAPGEF6	361	.	0			c.A182G						.						78.0	84.0	82.0					5																	130938979		2203	4292	6495	SO:0001583	missense	51735	exon3			ACCTGATTGCCAC	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.182A>G	chr5.hg19:g.130938979T>C	ENSP00000421684:p.Asn61Ser	458.0	0.0		384.0	113.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	hg19	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.423872	0.43020	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000308008;ENST00000510071;ENST00000514667	T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88	4.67	4.67	0.58626	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.000000	0.64402	D	0.000001	T	0.63698	0.2533	M	0.77103	2.36	0.80722	D	1	B;B;D;B;B;B	0.76494	0.02;0.011;0.999;0.011;0.034;0.004	B;B;D;B;B;B	0.85130	0.016;0.009;0.997;0.027;0.035;0.004	T	0.68224	-0.5465	10	0.72032	D	0.01	.	11.9104	0.52735	0.0:0.0:0.0:1.0	.	61;61;61;111;61;61	A3KN82;B7ZML2;Q8TEU7-2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;RPGF6_HUMAN	S	61;61;61;61;61;61;61;111	ENSP00000421684:N61S;ENSP00000309298:N61S;ENSP00000426081:N61S;ENSP00000296859:N61S;ENSP00000311419:N61S;ENSP00000425389:N61S;ENSP00000426948:N111S	ENSP00000426948:N111S	N	-	2	0	RAPGEF6;FNIP1	130966878	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.030000	0.70903	1.858000	0.53909	0.454000	0.30748	AAT	.	.		0.259	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
PCDHB1	29930	hgsc.bcm.edu	37	5	140432978	140432978	+	Silent	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr5:140432978G>A	ENST00000306549.3	+	1	2000	c.1923G>A	c.(1921-1923)ttG>ttA	p.L641L		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	641	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCAGAAATTGATCATTCTTG	0.448																																					p.L641L		Atlas-SNP	.											.	PCDHB1	148	.	0			c.G1923A						.						134.0	130.0	131.0					5																	140432978		2203	4300	6503	SO:0001819	synonymous_variant	29930	exon1			GAAATTGATCATT	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1923G>A	chr5.hg19:g.140432978G>A		86.0	0.0		91.0	37.0	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	hg19	CCDS4243.1																																																																																			.	.		0.448	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
SLIT3	6586	hgsc.bcm.edu	37	5	168727521	168727521	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr5:168727521G>T	ENST00000519560.1	-	1	612	c.193C>A	c.(193-195)Cgc>Agc	p.R65S	SLIT3_ENST00000332966.8_Missense_Mutation_p.R65S|SLIT3_ENST00000404867.3_Missense_Mutation_p.R65S|SLIT3_ENST00000521130.1_5'UTR	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	65					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTCACAGGCGCTCAGCGTTG	0.741																																					p.R65S	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.C193A						.						5.0	6.0	6.0					5																	168727521		1834	3651	5485	SO:0001583	missense	6586	exon1			ACAGGCGCTCAGC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.193C>A	chr5.hg19:g.168727521G>T	ENSP00000430333:p.Arg65Ser	120.0	0.0		90.0	35.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	hg19	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518591	0.64634	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.22743	1.94;1.94;1.94	3.85	3.85	0.44370	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.46758	D	0.000270	T	0.28665	0.0710	N	0.17764	0.52	0.44677	D	0.997661	D;D	0.89917	0.992;1.0	D;D	0.81914	0.969;0.995	T	0.06643	-1.0815	10	0.66056	D	0.02	.	11.2153	0.48823	0.0:0.0:1.0:0.0	.	65;65	O75094-2;O75094	.;SLIT3_HUMAN	S	65	ENSP00000430333:R65S;ENSP00000332164:R65S;ENSP00000384890:R65S	ENSP00000332164:R65S	R	-	1	0	SLIT3	168660099	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.109000	0.41863	1.995000	0.58328	0.555000	0.69702	CGC	.	.		0.741	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
HK3	3101	hgsc.bcm.edu	37	5	176318414	176318414	+	Silent	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr5:176318414G>A	ENST00000292432.5	-	3	325	c.234C>T	c.(232-234)taC>taT	p.Y78Y		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	78	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGACCCCACGTATGTAGGCA	0.602																																					p.Y78Y		Atlas-SNP	.											.	HK3	210	.	0			c.C234T						.						116.0	117.0	117.0					5																	176318414		2203	4300	6503	SO:0001819	synonymous_variant	3101	exon3			CCCCACGTATGTA		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.234C>T	chr5.hg19:g.176318414G>A		51.0	0.0		32.0	16.0	NM_002115	Q8N1E7	Silent	SNP	ENST00000292432.5	hg19	CCDS4407.1																																																																																			.	.		0.602	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
DOK3	79930	hgsc.bcm.edu	37	5	176930063	176930063	+	IGR	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr5:176930063T>A	ENST00000357198.4	-	0	1729				DOK3_ENST00000377112.4_Missense_Mutation_p.T224S|RP11-1334A24.6_ENST00000506025.1_RNA|DOK3_ENST00000312943.6_Missense_Mutation_p.T326S	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3						Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			gtgccaagggtgtgtgcagct	0.602																																					p.T326S		Atlas-SNP	.											.	DOK3	41	.	0			c.A976T						.						11.0	12.0	11.0					5																	176930063		692	1591	2283	SO:0001628	intergenic_variant	79930	exon6			CAAGGGTGTGTGC	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850		chr5.hg19:g.176930063T>A		62.0	0.0		49.0	22.0	NM_001144875	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	ENST00000357198.4	hg19	CCDS4426.1	.	.	.	.	.	.	.	.	.	.	T	12.65	2.001866	0.35320	.	.	ENSG00000146094	ENST00000312943;ENST00000377112	T;T	0.51071	0.77;0.72	1.7	-1.14	0.09741	.	.	.	.	.	T	0.21921	0.0528	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.14805	0.006;0.001;0.011	B;B;B	0.09377	0.002;0.001;0.004	T	0.17471	-1.0368	9	0.87932	D	0	.	1.6896	0.02849	0.2866:0.193:0.0:0.5203	.	224;326;212	E9PAT0;Q7L591-3;Q7L591-2	.;.;.	S	326;224	ENSP00000325174:T326S;ENSP00000366316:T224S	ENSP00000325174:T326S	T	-	1	0	DOK3	176862669	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	-0.207000	0.09384	-0.273000	0.09246	0.260000	0.18958	ACC	.	.		0.602	DOK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253420.4	NM_024872	
BTN3A1	11119	hgsc.bcm.edu	37	6	26413486	26413486	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:26413486G>T	ENST00000289361.6	+	10	1476	c.1108G>T	c.(1108-1110)Gat>Tat	p.D370Y	BTN3A1_ENST00000414912.2_Missense_Mutation_p.D318Y	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	370	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GGAGCCCCAGGATCTGCCAGA	0.517																																					p.D370Y		Atlas-SNP	.											.	BTN3A1	80	.	0			c.G1108T						.						142.0	156.0	151.0					6																	26413486		2203	4300	6503	SO:0001583	missense	11119	exon10			CCCCAGGATCTGC	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1108G>T	chr6.hg19:g.26413486G>T	ENSP00000289361:p.Asp370Tyr	204.0	0.0		288.0	52.0	NM_007048	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	hg19	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	12.40	1.927284	0.34002	.	.	ENSG00000026950	ENST00000289361;ENST00000414912	T;T	0.11495	2.77;2.77	2.96	-3.92	0.04155	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.04182	0.0116	L	0.51914	1.62	0.09310	N	1	P;P	0.52577	0.924;0.954	P;P	0.48952	0.478;0.596	T	0.10520	-1.0626	9	0.59425	D	0.04	.	1.8679	0.03202	0.5231:0.1471:0.1815:0.1482	.	318;370	E9PGB4;O00481	.;BT3A1_HUMAN	Y	370;318	ENSP00000289361:D370Y;ENSP00000406667:D318Y	ENSP00000289361:D370Y	D	+	1	0	BTN3A1	26521465	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.719000	0.01873	-0.938000	0.03714	0.609000	0.83330	GAT	.	.		0.517	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
HLA-A	3105	hgsc.bcm.edu	37	6	29910588	29910588	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:29910588A>T	ENST00000396634.1	+	4	469	c.128A>T	c.(127-129)gAg>gTg	p.E43V	HLA-A_ENST00000376809.5_Missense_Mutation_p.E43V|HLA-A_ENST00000376802.2_Missense_Mutation_p.E43V|HLA-A_ENST00000376806.5_Missense_Mutation_p.E43V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	43	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.R41fs*31(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GGCCGCGGGGAGCCCCGCTTC	0.701									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.E43V		Atlas-SNP	.											.	HLA-A	89	.	1	Deletion - Frameshift(1)	ovary(1)	c.A128T						.						24.0	22.0	23.0					6																	29910588		2198	4295	6493	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GCGGGGAGCCCCG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.128A>T	chr6.hg19:g.29910588A>T	ENSP00000379873:p.Glu43Val	129.0	0.0		195.0	63.0	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	hg19	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	14.89	2.670518	0.47781	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00009	9.48;9.48;9.48;9.48	3.57	0.876	0.19138	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	2.237780	0.03383	N	0.200671	T	0.00210	0.0006	H	0.96398	3.815	0.09310	N	1	D;B;D;D;D	0.76494	0.999;0.172;0.995;0.959;0.995	D;B;D;D;D	0.87578	0.998;0.362;0.995;0.986;0.995	T	0.48725	-0.9010	10	0.87932	D	0	.	7.8239	0.29303	0.5813:0.4187:0.0:0.0	.	43;43;43;43;43	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	V	43	ENSP00000379873:E43V;ENSP00000366002:E43V;ENSP00000366005:E43V;ENSP00000365998:E43V	ENSP00000348012:E43V	E	+	2	0	HLA-A	30018567	0.002000	0.14202	0.000000	0.03702	0.426000	0.31534	0.278000	0.18753	0.084000	0.17077	-0.689000	0.03729	GAG	.	.		0.701	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CCHCR1	54535	hgsc.bcm.edu	37	6	31122472	31122472	+	Missense_Mutation	SNP	C	C	A	rs576214578	byFrequency	TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:31122472C>A	ENST00000376266.5	-	4	457	c.335G>T	c.(334-336)cGg>cTg	p.R112L	CCHCR1_ENST00000480060.1_Intron|CCHCR1_ENST00000396263.2_Missense_Mutation_p.R112L|CCHCR1_ENST00000451521.2_Missense_Mutation_p.R165L|CCHCR1_ENST00000396268.3_Missense_Mutation_p.R201L	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	112					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R112Q(1)|p.R201Q(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						CGAGGTCTCCCGCAGGAGCCG	0.692																																					p.R201L		Atlas-SNP	.											CCHCR1_ENST00000396268,NS,carcinoma,0,3	CCHCR1	68	.	2	Substitution - Missense(2)	kidney(2)	c.G602T						.						41.0	50.0	47.0					6																	31122472		1507	2709	4216	SO:0001583	missense	54535	exon4			GTCTCCCGCAGGA	AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.335G>T	chr6.hg19:g.31122472C>A	ENSP00000365442:p.Arg112Leu	55.0	0.0		97.0	72.0	NM_001105564	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	ENST00000376266.5	hg19	CCDS4695.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023133	0.54683	.	.	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521;ENST00000448141;ENST00000508683;ENST00000448162;ENST00000513222;ENST00000503420;ENST00000515274;ENST00000507751;ENST00000455279;ENST00000412245;ENST00000503934;ENST00000426967;ENST00000502557;ENST00000507829	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.05199	3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48;3.48	4.8	3.03	0.35002	.	0.325746	0.22679	N	0.056980	T	0.09291	0.0229	M	0.70595	2.14	0.28550	N	0.911641	D;D;D;D;D	0.76494	0.998;0.998;0.998;0.999;0.998	D;D;D;D;D	0.75484	0.97;0.959;0.959;0.986;0.963	T	0.08249	-1.0731	10	0.42905	T	0.14	-22.6889	6.9406	0.24490	0.0:0.7948:0.0:0.2052	.	112;112;112;165;201	B4DIA2;A8K081;Q8TD31;E9PE84;Q8TD31-2	.;.;CCHCR_HUMAN;.;.	L	201;112;112;112;165;76;76;112;86;76;112;112;112;138;112;210;112;112	ENSP00000379566:R201L;ENSP00000365442:R112L;ENSP00000379561:R112L;ENSP00000401039:R165L;ENSP00000414323:R76L;ENSP00000421393:R76L;ENSP00000390027:R112L;ENSP00000425682:R86L;ENSP00000421992:R76L;ENSP00000420941:R112L;ENSP00000398715:R112L;ENSP00000425595:R112L;ENSP00000402432:R210L;ENSP00000425377:R112L;ENSP00000420911:R112L	ENSP00000365442:R112L	R	-	2	0	CCHCR1	31230451	0.977000	0.34250	0.949000	0.38748	0.511000	0.34104	0.523000	0.22925	0.646000	0.30693	-0.158000	0.13435	CGG	.	.		0.692	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076190.5	NM_019052	
LHFPL5	222662	hgsc.bcm.edu	37	6	35773575	35773575	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:35773575T>A	ENST00000373853.1	+	1	506	c.128T>A	c.(127-129)cTc>cAc	p.L43H	LHFPL5_ENST00000360215.1_Missense_Mutation_p.L43H			Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	43					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transport (GO:0006811)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)				endometrium(4)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|urinary_tract(1)	20						GTCATGGCCCTCTTCATCCAG	0.592																																					p.L43H		Atlas-SNP	.											.	LHFPL5	44	.	0			c.T128A						.						238.0	206.0	216.0					6																	35773575		2203	4300	6503	SO:0001583	missense	222662	exon1			TGGCCCTCTTCAT	BC028630	CCDS4812.1	6p21.31	2014-01-28				ENSG00000197753			21253	protein-coding gene	gene with protein product		609427	"""deafness, autosomal recessive 67"""	DFNB67		16459341	Standard	NM_182548		Approved	MGC33835, dJ510O8.8, Tmhs	uc003olg.1	Q8TAF8		ENST00000373853.1:c.128T>A	chr6.hg19:g.35773575T>A	ENSP00000362960:p.Leu43His	128.0	0.0		149.0	55.0	NM_182548	B3KX66	Missense_Mutation	SNP	ENST00000373853.1	hg19	CCDS4812.1	.	.	.	.	.	.	.	.	.	.	t	24.4	4.531413	0.85706	.	.	ENSG00000197753	ENST00000373853;ENST00000360215	T;T	0.72615	-0.67;-0.67	5.57	5.57	0.84162	.	0.192828	0.45606	D	0.000357	T	0.57902	0.2085	N	0.22421	0.69	0.26232	N	0.979002	D	0.63880	0.993	P	0.60173	0.87	T	0.59198	-0.7499	10	0.87932	D	0	-27.9671	8.4085	0.32629	0.0:0.116:0.0:0.884	.	43	Q8TAF8	TMHS_HUMAN	H	43	ENSP00000362960:L43H;ENSP00000353346:L43H	ENSP00000353346:L43H	L	+	2	0	LHFPL5	35881553	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	1.617000	0.36943	2.133000	0.65898	0.439000	0.28862	CTC	.	.		0.592	LHFPL5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040323.1	NM_182548	
DAAM2	23500	hgsc.bcm.edu	37	6	39851783	39851783	+	Missense_Mutation	SNP	G	G	C	rs376832339		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:39851783G>C	ENST00000398904.2	+	15	2073	c.1891G>C	c.(1891-1893)Gta>Cta	p.V631L	RP11-61I13.3_ENST00000607675.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.V631L|DAAM2_ENST00000274867.4_Missense_Mutation_p.V631L|RP11-61I13.3_ENST00000607215.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	631	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					TGACATGCAGGTATTTCGGAT	0.498																																					p.V631L		Atlas-SNP	.											.	DAAM2	101	.	0			c.G1891C						.						106.0	101.0	103.0					6																	39851783		1937	4133	6070	SO:0001583	missense	23500	exon15			ATGCAGGTATTTC	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1891G>C	chr6.hg19:g.39851783G>C	ENSP00000381876:p.Val631Leu	58.0	0.0		137.0	19.0	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	hg19	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629634	0.67015	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.16743	2.32;2.32;2.32	5.93	3.22	0.36961	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.188417	0.45126	D	0.000385	T	0.12008	0.0292	L	0.52011	1.625	0.80722	D	1	B;P	0.49185	0.026;0.92	B;P	0.54889	0.032;0.763	T	0.07328	-1.0778	10	0.12103	T	0.63	.	11.0471	0.47865	0.2011:0.0:0.7989:0.0	.	631;631	G5EA45;Q86T65	.;DAAM2_HUMAN	L	631	ENSP00000274867:V631L;ENSP00000381876:V631L;ENSP00000437808:V631L	ENSP00000274867:V631L	V	+	1	0	DAAM2	39959761	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	5.729000	0.68538	0.423000	0.26033	0.561000	0.74099	GTA	.	.		0.498	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
DLK2	65989	hgsc.bcm.edu	37	6	43419007	43419007	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:43419007G>A	ENST00000357338.3	-	6	1122	c.422C>T	c.(421-423)cCa>cTa	p.P141L	DLK2_ENST00000372488.3_Missense_Mutation_p.P141L|DLK2_ENST00000372485.1_Missense_Mutation_p.P135L|DLK2_ENST00000414245.1_Missense_Mutation_p.P135L	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	141	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			ATTGCGGCATGGGGAGCTGTG	0.587																																					p.P141L		Atlas-SNP	.											.	DLK2	22	.	0			c.C422T						.						46.0	33.0	37.0					6																	43419007		2203	4300	6503	SO:0001583	missense	65989	exon6			CGGCATGGGGAGC	AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.422C>T	chr6.hg19:g.43419007G>A	ENSP00000349893:p.Pro141Leu	99.0	0.0		181.0	53.0	NM_023932	B3KNZ7|Q5T3T8|Q9BQ54	Missense_Mutation	SNP	ENST00000357338.3	hg19	CCDS4897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.201332|4.201332	0.79015|0.79015	.|.	.|.	ENSG00000171462|ENSG00000171462	ENST00000430324|ENST00000372485;ENST00000372488;ENST00000357338;ENST00000414245	.|D;D;D;D	.|0.96104	.|-3.91;-3.91;-3.91;-3.91	4.51|4.51	4.51|4.51	0.55191|0.55191	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97420|0.97420	0.9156|0.9156	M|M	0.79614|0.79614	2.46|2.46	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	D|D	0.98016|0.98016	1.0368|1.0368	5|10	.|0.87932	.|D	.|0	.|.	17.7506|17.7506	0.88432|0.88432	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|141	.|Q6UY11	.|DLK2_HUMAN	Y|L	47|135;141;141;135	.|ENSP00000361563:P135L;ENSP00000361566:P141L;ENSP00000349893:P141L;ENSP00000398906:P135L	.|ENSP00000349893:P141L	H|P	-|-	1|2	0|0	DLK2|DLK2	43526985|43526985	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.665000|0.665000	0.39181|0.39181	7.209000|7.209000	0.77916|0.77916	2.507000|2.507000	0.84556|0.84556	0.455000|0.455000	0.32223|0.32223	CAT|CCA	.	.		0.587	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040618.1	NM_023932	
YIPF3	25844	hgsc.bcm.edu	37	6	43480851	43480851	+	Silent	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:43480851G>A	ENST00000372422.2	-	6	804	c.622C>T	c.(622-624)Ctg>Ttg	p.L208L	LRRC73_ENST00000372441.1_5'Flank|YIPF3_ENST00000506469.1_Silent_p.L214L	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	208					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GCGTTGCACAGGTAGGCAAGG	0.567																																					p.L208L		Atlas-SNP	.											.	YIPF3	20	.	0			c.C622T						.						135.0	135.0	135.0					6																	43480851		2203	4300	6503	SO:0001819	synonymous_variant	25844	exon6			TGCACAGGTAGGC	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.622C>T	chr6.hg19:g.43480851G>A		83.0	0.0		158.0	34.0	NM_015388	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Silent	SNP	ENST00000372422.2	hg19	CCDS4899.1																																																																																			.	.		0.567	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
HCRTR2	3062	hgsc.bcm.edu	37	6	55145187	55145187	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr6:55145187C>G	ENST00000370862.3	+	6	1386	c.1050C>G	c.(1048-1050)caC>caG	p.H350Q		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	350					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CCTTTTCACACTGGCTTGTAT	0.388																																					p.H350Q		Atlas-SNP	.											.	HCRTR2	112	.	0			c.C1050G						.						206.0	197.0	200.0					6																	55145187		2203	4300	6503	SO:0001583	missense	3062	exon6			TTCACACTGGCTT	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.1050C>G	chr6.hg19:g.55145187C>G	ENSP00000359899:p.His350Gln	119.0	0.0		186.0	44.0	NM_001526	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	hg19	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484514	0.63962	.	.	ENSG00000137252	ENST00000370862	T	0.36878	1.23	5.62	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.38268	0.1034	M	0.67569	2.06	0.54753	D	0.999983	D	0.56035	0.974	D	0.67548	0.952	T	0.17561	-1.0365	10	0.40728	T	0.16	.	8.7828	0.34802	0.0:0.6341:0.0:0.3659	.	350	O43614	OX2R_HUMAN	Q	350	ENSP00000359899:H350Q	ENSP00000359899:H350Q	H	+	3	2	HCRTR2	55253146	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.161000	0.31773	0.039000	0.15632	0.585000	0.79938	CAC	.	.		0.388	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
NPSR1	387129	hgsc.bcm.edu	37	7	34867102	34867102	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr7:34867102C>G	ENST00000360581.1	+	5	696	c.568C>G	c.(568-570)Ctg>Gtg	p.L190V	NPSR1_ENST00000359791.1_Missense_Mutation_p.L190V|NPSR1_ENST00000381539.3_Missense_Mutation_p.L190V|NPSR1_ENST00000531252.1_Missense_Mutation_p.L179V|NPSR1_ENST00000381542.1_Missense_Mutation_p.L124V	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	190						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	GAAGAGGACACTGTCCAACGG	0.542																																					p.L190V		Atlas-SNP	.											.	NPSR1	134	.	0			c.C568G						.						149.0	128.0	135.0					7																	34867102		2203	4300	6503	SO:0001583	missense	387129	exon5			AGGACACTGTCCA	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.568C>G	chr7.hg19:g.34867102C>G	ENSP00000353788:p.Leu190Val	120.0	0.0		108.0	61.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	hg19	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	3.992	-0.004284	0.07773	.	.	ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19	5.44	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.36026	0.0952	N	0.17248	0.465	0.45427	D	0.998401	D;D;D;B;D;B	0.76494	0.999;0.999;0.998;0.207;0.999;0.246	D;D;P;B;D;B	0.69307	0.944;0.963;0.875;0.219;0.96;0.326	T	0.14587	-1.0467	9	0.02654	T	1	-30.3633	13.0884	0.59154	0.0:0.9231:0.0:0.0769	.	124;179;124;190;190;190	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	V	190;124;190;179;190;53	ENSP00000353788:L190V;ENSP00000370953:L124V;ENSP00000352839:L190V;ENSP00000433258:L179V;ENSP00000370950:L190V	ENSP00000334093:L53V	L	+	1	2	NPSR1	34833627	0.997000	0.39634	0.224000	0.23877	0.485000	0.33311	3.919000	0.56439	1.298000	0.44778	0.655000	0.94253	CTG	.	.		0.542	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
TNS3	64759	hgsc.bcm.edu	37	7	47440024	47440024	+	Silent	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr7:47440024T>C	ENST00000398879.1	-	15	1251	c.885A>G	c.(883-885)gaA>gaG	p.E295E	TNS3_ENST00000311160.9_Silent_p.E295E|TNS3_ENST00000355730.3_Intron			Q68CZ2	TENS3_HUMAN	tensin 3	295	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						AGAAGACTAATTCAACCTTCC	0.438																																					p.E295E		Atlas-SNP	.											.	TNS3	140	.	0			c.A885G						.						76.0	75.0	76.0					7																	47440024		1985	4155	6140	SO:0001819	synonymous_variant	64759	exon15			GACTAATTCAACC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.885A>G	chr7.hg19:g.47440024T>C		230.0	0.0		216.0	56.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	ENST00000398879.1	hg19	CCDS5506.2																																																																																			.	.		0.438	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
ABCA13	154664	hgsc.bcm.edu	37	7	48413971	48413971	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr7:48413971C>A	ENST00000435803.1	+	34	11185	c.11161C>A	c.(11161-11163)Caa>Aaa	p.Q3721K		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3721					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CGCCTTTGGACAAGGGGTATT	0.408																																					p.Q3721K		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C11161A						.						84.0	78.0	80.0					7																	48413971		1893	4113	6006	SO:0001583	missense	154664	exon34			TTTGGACAAGGGG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11161C>A	chr7.hg19:g.48413971C>A	ENSP00000411096:p.Gln3721Lys	121.0	0.0		137.0	30.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699398	0.68501	.	.	ENSG00000179869	ENST00000435803	D	0.81499	-1.5	5.51	5.51	0.81932	.	0.000000	0.48767	D	0.000170	D	0.86772	0.6013	L	0.55481	1.735	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.69824	0.922;0.966	D	0.84576	0.0658	10	0.33940	T	0.23	.	16.9365	0.86204	0.0:1.0:0.0:0.0	.	1423;3721	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	K	3721	ENSP00000411096:Q3721K	ENSP00000411096:Q3721K	Q	+	1	0	ABCA13	48384517	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	4.841000	0.62824	2.736000	0.93811	0.655000	0.94253	CAA	.	.		0.408	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
CHCHD3	54927	hgsc.bcm.edu	37	7	132659975	132659975	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr7:132659975C>T	ENST00000262570.5	-	4	467	c.323G>A	c.(322-324)cGg>cAg	p.R108Q	CHCHD3_ENST00000542753.1_Missense_Mutation_p.R108Q|CHCHD3_ENST00000476546.1_5'UTR|CHCHD3_ENST00000448878.1_Missense_Mutation_p.R108Q	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	108					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						TATCCTCTCCCGAAGGATGGC	0.453																																					p.R108Q		Atlas-SNP	.											.	CHCHD3	21	.	0			c.G323A						.						91.0	83.0	86.0					7																	132659975		2203	4300	6503	SO:0001583	missense	54927	exon4			CTCTCCCGAAGGA	BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.323G>A	chr7.hg19:g.132659975C>T	ENSP00000262570:p.Arg108Gln	85.0	0.0		101.0	11.0	NM_017812		Missense_Mutation	SNP	ENST00000262570.5	hg19	CCDS5828.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471212	0.43942	.	.	ENSG00000106554	ENST00000262570;ENST00000448878;ENST00000542753	T;T;T	0.55760	0.5;0.5;0.5	5.77	-2.07	0.07276	.	0.307287	0.34676	N	0.003777	T	0.39963	0.1098	M	0.78637	2.42	0.19775	N	0.999951	P;B;B	0.35456	0.502;0.017;0.061	B;B;B	0.29267	0.1;0.008;0.036	T	0.29610	-1.0006	10	0.21014	T	0.42	1.7276	4.7098	0.12867	0.2211:0.4754:0.0:0.3036	.	108;108;108	G3V1K1;C9JRZ6;Q9NX63	.;.;CHCH3_HUMAN	Q	108	ENSP00000262570:R108Q;ENSP00000389297:R108Q;ENSP00000440267:R108Q	ENSP00000262570:R108Q	R	-	2	0	CHCHD3	132310515	0.474000	0.25886	0.008000	0.14137	0.745000	0.42441	1.238000	0.32707	-0.369000	0.08028	-0.140000	0.14226	CGG	.	.		0.453	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812	
TEX15	56154	hgsc.bcm.edu	37	8	30706087	30706087	+	Silent	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:30706087A>G	ENST00000256246.2	-	1	521	c.447T>C	c.(445-447)tgT>tgC	p.C149C	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	149					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.C149*(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTTGGTCCTTACATTGCCCTG	0.433																																					p.C149C		Atlas-SNP	.											TEX15,NS,carcinoma,0,1	TEX15	350	.	1	Substitution - Nonsense(1)	lung(1)	c.T447C						.						102.0	98.0	100.0					8																	30706087		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon1			GTCCTTACATTGC	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.447T>C	chr8.hg19:g.30706087A>G		113.0	0.0		56.0	28.0	NM_031271		Silent	SNP	ENST00000256246.2	hg19	CCDS6080.1																																																																																			.	.		0.433	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
POTEA	340441	hgsc.bcm.edu	37	8	43173614	43173614	+	RNA	SNP	C	C	T	rs547056757	byFrequency	TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:43173614C>T	ENST00000522175.2	+	0	900							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AGAAGAAATGCAGAAGCATGG	0.353													c|||	11	0.00219649	0.0	0.0	5008	,	,		18067	0.0		0.0	False		,,,				2504	0.0112				p.Q346X		Atlas-SNP	.											.	POTEA	87	.	0			c.C1036T						.						142.0	136.0	138.0					8																	43173614		2198	4297	6495			340441	exon9			GAAATGCAGAAGC	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		chr8.hg19:g.43173614C>T		268.0	1.0		129.0	94.0	NM_001005365	A6ND17|A6ND71|Q6S8J6	Nonsense_Mutation	SNP	ENST00000522175.2	hg19																																																																																				.	.		0.353	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920	
TPD52	7163	hgsc.bcm.edu	37	8	80954863	80954863	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:80954863T>A	ENST00000379097.3	-	5	909	c.547A>T	c.(547-549)Aac>Tac	p.N183Y	TPD52_ENST00000379096.5_Missense_Mutation_p.N143Y|TPD52_ENST00000448733.2_Missense_Mutation_p.N197Y|TPD52_ENST00000518937.1_Missense_Mutation_p.N166Y|TPD52_ENST00000523395.1_5'UTR|TPD52_ENST00000520527.1_Missense_Mutation_p.N206Y|TPD52_ENST00000519303.2_Missense_Mutation_p.N19Y|TPD52_ENST00000517427.1_Missense_Mutation_p.N192Y|TPD52_ENST00000537855.1_Missense_Mutation_p.N183Y	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	183					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			GCCTTTAAGTTTTCGACCTTT	0.308																																					p.N183Y		Atlas-SNP	.											.	TPD52	40	.	0			c.A547T						.						119.0	123.0	121.0					8																	80954863		2202	4299	6501	SO:0001583	missense	7163	exon5			TTAAGTTTTCGAC	U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.547A>T	chr8.hg19:g.80954863T>A	ENSP00000368391:p.Asn183Tyr	52.0	0.0		107.0	20.0	NM_001025252	B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Missense_Mutation	SNP	ENST00000379097.3	hg19	CCDS34912.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246044	0.80024	.	.	ENSG00000076554	ENST00000537855;ENST00000379096;ENST00000518937;ENST00000520527;ENST00000517427;ENST00000448733;ENST00000379097;ENST00000425513;ENST00000519303	T;T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.11	5.11	0.69529	.	0.260772	0.41938	D	0.000786	T	0.47619	0.1455	M	0.68952	2.095	0.80722	D	1	D;D;D	0.67145	0.983;0.958;0.996	P;P;D	0.65874	0.862;0.905;0.939	T	0.49688	-0.8913	10	0.87932	D	0	-32.0978	14.5302	0.67920	0.0:0.0:0.0:1.0	.	143;166;183	P55327-2;E5RKB4;P55327	.;.;TPD52_HUMAN	Y	183;143;166;206;192;197;183;143;19	ENSP00000438113:N183Y;ENSP00000368390:N143Y;ENSP00000429915:N166Y;ENSP00000429309:N206Y;ENSP00000429351:N192Y;ENSP00000410222:N197Y;ENSP00000368391:N183Y;ENSP00000428951:N19Y	ENSP00000368390:N143Y	N	-	1	0	TPD52	81117418	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.448000	0.60027	2.265000	0.75225	0.482000	0.46254	AAC	.	.		0.308	TPD52-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379539.2	NM_005079	
NECAB1	64168	hgsc.bcm.edu	37	8	91836943	91836943	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:91836943A>T	ENST00000417640.2	+	3	461		c.e3-1		NECAB1_ENST00000521954.1_Splice_Site|RP11-662G23.1_ENST00000517884.1_RNA	NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			TTGCCATTTCAGATGATGGAA	0.338																																					.		Atlas-SNP	.											.	NECAB1	31	.	0			c.125-2A>T						.						39.0	37.0	38.0					8																	91836943		1799	4035	5834	SO:0001630	splice_region_variant	64168	exon3			CATTTCAGATGAT	AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.125-1A>T	chr8.hg19:g.91836943A>T		179.0	0.0		328.0	44.0	NM_022351	Q6NUS7|Q96AZ7|Q9HBW8	Splice_Site	SNP	ENST00000417640.2	hg19	CCDS47889.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124726	0.77436	.	.	ENSG00000123119	ENST00000417640	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1072	0.65099	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NECAB1	91906119	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.187000	0.89708	1.981000	0.57761	0.533000	0.62120	.	.	.		0.338	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376728.1	NM_022351	Intron
TOP1MT	116447	hgsc.bcm.edu	37	8	144416922	144416922	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:144416922C>T	ENST00000329245.4	-	1	144	c.110G>A	c.(109-111)gGc>gAc	p.G37D	TOP1MT_ENST00000521193.1_Intron|TOP1MT_ENST00000519148.1_Intron|TOP1MT_ENST00000523676.1_5'UTR	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	37					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GGCTCCACTGCCCTTCTGCGT	0.741																																					p.G37D		Atlas-SNP	.											.	TOP1MT	63	.	0			c.G110A						.						15.0	20.0	19.0					8																	144416922		2200	4297	6497	SO:0001583	missense	116447	exon1			CCACTGCCCTTCT	AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.110G>A	chr8.hg19:g.144416922C>T	ENSP00000328835:p.Gly37Asp	150.0	0.0		256.0	85.0	NM_052963	B7ZAR5|E7ES89|Q86ST4|Q86V82	Missense_Mutation	SNP	ENST00000329245.4	hg19	CCDS6400.1	.	.	.	.	.	.	.	.	.	.	c	12.08	1.830877	0.32329	.	.	ENSG00000184428	ENST00000329245;ENST00000522043	T;T	0.62364	1.97;0.03	1.14	-2.28	0.06826	DNA topoisomerase I, DNA binding, eukaryotic-type (1);	.	.	.	.	T	0.33731	0.0873	N	0.14661	0.345	0.21220	N	0.99975	B	0.26002	0.139	B	0.19666	0.026	T	0.12400	-1.0549	9	0.18710	T	0.47	.	2.2928	0.04143	0.4091:0.3479:0.0:0.243	.	37	Q969P6	TOP1M_HUMAN	D	37	ENSP00000328835:G37D;ENSP00000428931:G37D	ENSP00000328835:G37D	G	-	2	0	TOP1MT	144488297	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-1.413000	0.02473	-1.510000	0.01796	-0.476000	0.04901	GGC	.	.		0.741	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963	
ZNF7	7553	hgsc.bcm.edu	37	8	146068419	146068419	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:146068419T>G	ENST00000528372.1	+	5	2167	c.1927T>G	c.(1927-1929)Ttt>Gtt	p.F643V	ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Missense_Mutation_p.F547V|ZNF7_ENST00000446747.2_Missense_Mutation_p.F654V|ZNF7_ENST00000325241.6_Missense_Mutation_p.F643V			P17097	ZNF7_HUMAN	zinc finger protein 7	643					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		TGAGAAGATATTTAGGTGGCG	0.418																																					p.F643V		Atlas-SNP	.											.	ZNF7	62	.	0			c.T1927G						.						75.0	79.0	78.0					8																	146068419		2203	4300	6503	SO:0001583	missense	7553	exon5			AAGATATTTAGGT	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1927T>G	chr8.hg19:g.146068419T>G	ENSP00000432724:p.Phe643Val	126.0	0.0		205.0	38.0	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Missense_Mutation	SNP	ENST00000528372.1	hg19	CCDS6435.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303009	0.81136	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	4.75	4.75	0.60458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000269	T	0.15696	0.0378	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64042	0.921;0.921	T	0.26121	-1.0112	9	.	.	.	-13.9987	13.363	0.60667	0.0:0.0:0.0:1.0	.	654;643	B4DT08;P17097	.;ZNF7_HUMAN	V	643;654;547;643	ENSP00000320627:F643V;ENSP00000393260:F654V;ENSP00000439424:F547V;ENSP00000432724:F643V	.	F	+	1	0	ZNF7	146039223	1.000000	0.71417	0.956000	0.39512	0.833000	0.47200	6.988000	0.76212	1.992000	0.58205	0.533000	0.62120	TTT	.	.		0.418	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
ZNF7	7553	hgsc.bcm.edu	37	8	146068438	146068438	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr8:146068438T>C	ENST00000528372.1	+	5	2186	c.1946T>C	c.(1945-1947)cTa>cCa	p.L649P	ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Missense_Mutation_p.L553P|ZNF7_ENST00000446747.2_Missense_Mutation_p.L660P|ZNF7_ENST00000325241.6_Missense_Mutation_p.L649P			P17097	ZNF7_HUMAN	zinc finger protein 7	649					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		CGTTCACACCTAATTATACAC	0.418																																					p.L649P		Atlas-SNP	.											.	ZNF7	62	.	0			c.T1946C						.						82.0	88.0	86.0					8																	146068438		2203	4300	6503	SO:0001583	missense	7553	exon5			CACACCTAATTAT	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1946T>C	chr8.hg19:g.146068438T>C	ENSP00000432724:p.Leu649Pro	139.0	0.0		215.0	34.0	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Missense_Mutation	SNP	ENST00000528372.1	hg19	CCDS6435.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.138063	0.56936	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	4.47	4.47	0.54385	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33772	N	0.004573	T	0.74951	0.3784	M	0.88031	2.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.79801	-0.1650	9	.	.	.	-9.9351	12.8614	0.57915	0.0:0.0:0.0:1.0	.	660;649	B4DT08;P17097	.;ZNF7_HUMAN	P	649;660;553;649	ENSP00000320627:L649P;ENSP00000393260:L660P;ENSP00000439424:L553P;ENSP00000432724:L649P	.	L	+	2	0	ZNF7	146039242	0.105000	0.21958	0.011000	0.14972	0.897000	0.52465	2.872000	0.48467	1.879000	0.54435	0.533000	0.62120	CTA	.	.		0.418	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
C9orf64	84267	hgsc.bcm.edu	37	9	86559849	86559849	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:86559849C>T	ENST00000376344.3	-	3	869	c.653G>A	c.(652-654)aGt>aAt	p.S218N	C9orf64_ENST00000314700.1_Missense_Mutation_p.S77N	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	218										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTCCAATACACTCCACGTATC	0.408																																					p.S218N		Atlas-SNP	.											.	C9orf64	28	.	0			c.G653A						.						111.0	93.0	99.0					9																	86559849		2203	4300	6503	SO:0001583	missense	84267	exon3			AATACACTCCACG	AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.653G>A	chr9.hg19:g.86559849C>T	ENSP00000365522:p.Ser218Asn	101.0	0.0		80.0	35.0	NM_032307	B2RPI6|Q8N2B1|Q9BT18	Missense_Mutation	SNP	ENST00000376344.3	hg19	CCDS6666.2	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374287	0.61735	.	.	ENSG00000165118	ENST00000376344;ENST00000314700	.	.	.	5.24	5.24	0.73138	.	0.166402	0.53938	D	0.000046	T	0.75774	0.3895	M	0.79926	2.475	0.80722	D	1	D	0.53312	0.959	P	0.53313	0.723	T	0.77819	-0.2446	9	0.48119	T	0.1	-8.3718	19.2094	0.93748	0.0:1.0:0.0:0.0	.	218	Q5T6V5	CI064_HUMAN	N	218;77	.	ENSP00000318375:S77N	S	-	2	0	C9orf64	85749669	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.759000	0.68785	2.614000	0.88457	0.655000	0.94253	AGT	.	.		0.408	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1	NM_032307	
ABCA1	19	hgsc.bcm.edu	37	9	107571793	107571793	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:107571793T>C	ENST00000374736.3	-	30	4622	c.4228A>G	c.(4228-4230)Aaa>Gaa	p.K1410E		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1410					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CCAGGGTCTTTGGTGAGGGCG	0.512																																					p.K1410E		Atlas-SNP	.											.	ABCA1	244	.	0			c.A4228G						.						110.0	106.0	107.0					9																	107571793		2203	4300	6503	SO:0001583	missense	19	exon30			GGTCTTTGGTGAG	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4228A>G	chr9.hg19:g.107571793T>C	ENSP00000363868:p.Lys1410Glu	144.0	0.0		114.0	37.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	hg19	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	T	3.114	-0.181970	0.06340	.	.	ENSG00000165029	ENST00000374736	D	0.93712	-3.27	5.68	3.18	0.36537	.	0.380726	0.34362	N	0.004021	T	0.75243	0.3823	N	0.01668	-0.77	0.33931	D	0.642116	B	0.02656	0.0	B	0.04013	0.001	T	0.68522	-0.5386	10	0.05351	T	0.99	.	5.7057	0.17907	0.0:0.2163:0.1315:0.6522	.	1410	O95477	ABCA1_HUMAN	E	1410	ENSP00000363868:K1410E	ENSP00000363868:K1410E	K	-	1	0	ABCA1	106611614	0.004000	0.15560	0.993000	0.49108	0.722000	0.41435	1.206000	0.32321	0.366000	0.24427	0.529000	0.55759	AAA	.	.		0.512	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
KIAA0368	23392	hgsc.bcm.edu	37	9	114187765	114187765	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:114187765A>G	ENST00000338205.5	-	11	1367	c.1148T>C	c.(1147-1149)aTc>aCc	p.I383T	KIAA0368_ENST00000259335.4_Missense_Mutation_p.I561T			Q5VYK3	ECM29_HUMAN	KIAA0368	389					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						CTTAATCTTGATTTCTGGACA	0.318																																					p.I561T		Atlas-SNP	.											.	KIAA0368	144	.	0			c.T1682C						.						50.0	47.0	48.0					9																	114187765		1824	4067	5891	SO:0001583	missense	23392	exon13			ATCTTGATTTCTG	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1148T>C	chr9.hg19:g.114187765A>G	ENSP00000339889:p.Ile383Thr	214.0	0.0		169.0	50.0	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	hg19		.	.	.	.	.	.	.	.	.	.	A	7.022	0.558863	0.13436	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.39997	1.05	5.42	5.42	0.78866	Armadillo-like helical (1);Armadillo-type fold (1);	0.226060	0.45126	D	0.000391	T	0.13927	0.0337	N	0.01352	-0.895	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19128	-1.0315	10	0.14252	T	0.57	-7.5133	6.723	0.23340	0.7131:0.2052:0.0818:0.0	.	389	Q5VYK3	ECM29_HUMAN	T	383;561	ENSP00000259335:I561T	ENSP00000259335:I561T	I	-	2	0	KIAA0368	113227586	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	2.651000	0.46674	2.186000	0.69663	0.459000	0.35465	ATC	.	.		0.318	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
OR1L4	254973	hgsc.bcm.edu	37	9	125486747	125486747	+	Missense_Mutation	SNP	G	G	A	rs370090548		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:125486747G>A	ENST00000259466.1	+	1	479	c.479G>A	c.(478-480)cGc>cAc	p.R160H		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						TCCCTGTTCCGCGTGCTACTT	0.478																																					p.R160H		Atlas-SNP	.											.	OR1L4	38	.	0			c.G479A						.	G	HIS/ARG	0,4406		0,0,2203	184.0	158.0	166.0		479	3.1	0.0	9		166	1,8593		0,1,4296	no	missense	OR1L4	NM_001005235.1	29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	160/312	125486747	1,12999	2203	4297	6500	SO:0001583	missense	254973	exon1			TGTTCCGCGTGCT		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.479G>A	chr9.hg19:g.125486747G>A	ENSP00000259466:p.Arg160His	130.0	0.0		89.0	24.0	NM_001005235	Q6IFN0|Q96R81	Missense_Mutation	SNP	ENST00000259466.1	hg19	CCDS35129.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.305906	0.00240	0.0	1.16E-4	ENSG00000136939	ENST00000259466	T	0.00017	9.1	4.01	3.11	0.35812	GPCR, rhodopsin-like superfamily (1);	0.352654	0.24645	N	0.036780	T	0.00039	0.0001	N	0.00055	-2.37	0.09310	N	1	B	0.18166	0.026	B	0.17098	0.017	T	0.43523	-0.9386	10	0.02654	T	1	-0.0046	3.5503	0.07844	0.2092:0.0:0.591:0.1998	.	160	Q8NGR5	OR1L4_HUMAN	H	160	ENSP00000259466:R160H	ENSP00000259466:R160H	R	+	2	0	OR1L4	124526568	0.000000	0.05858	0.015000	0.15790	0.384000	0.30261	0.187000	0.16998	0.914000	0.36822	0.298000	0.19748	CGC	.	.		0.478	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1		
SLC25A25	114789	hgsc.bcm.edu	37	9	130866085	130866085	+	Silent	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:130866085G>T	ENST00000373064.5	+	5	875	c.612G>T	c.(610-612)acG>acT	p.T204T	SLC25A25_ENST00000432073.2_Silent_p.T224T|SLC25A25_ENST00000373068.2_Silent_p.T238T|SLC25A25_ENST00000433501.1_Silent_p.T101T|SLC25A25_ENST00000373069.5_Silent_p.T250T|SLC25A25_ENST00000373066.5_Silent_p.T236T	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	204					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						GAACCTGCACGGCCCCCCTGG	0.647																																					p.T238T		Atlas-SNP	.											.	SLC25A25	119	.	0			c.G714T						.						40.0	44.0	43.0					9																	130866085		2203	4300	6503	SO:0001819	synonymous_variant	114789	exon5			CTGCACGGCCCCC	AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.612G>T	chr9.hg19:g.130866085G>T		87.0	0.0		60.0	23.0	NM_001006641	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Silent	SNP	ENST00000373064.5	hg19	CCDS6890.1	.	.	.	.	.	.	.	.	.	.	G	9.007	0.981594	0.18812	.	.	ENSG00000148339	ENST00000466983	.	.	.	5.52	-11.0	0.00169	.	.	.	.	.	T	0.30885	0.0779	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39333	-0.9619	4	.	.	.	-8.6159	1.2678	0.02015	0.1992:0.1865:0.3288:0.2855	.	.	.	.	C	29	.	.	G	+	1	0	SLC25A25	129905906	0.000000	0.05858	0.412000	0.26496	0.954000	0.61252	-3.386000	0.00489	-2.558000	0.00475	-1.148000	0.01847	GGC	.	.		0.647	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054407.1	NM_052901	
ANAPC2	29882	hgsc.bcm.edu	37	9	140075299	140075299	+	Silent	SNP	A	A	G	rs371943537		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:140075299A>G	ENST00000323927.2	-	8	1555	c.1551T>C	c.(1549-1551)aaT>aaC	p.N517N		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	517					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		AGCGGTACTCATTGATGAAGA	0.647																																					p.N517N		Atlas-SNP	.											.	ANAPC2	57	.	0			c.T1551C						.			2,4404	4.2+/-10.8	0,2,2201	98.0	84.0	88.0		1551	-4.8	0.8	9		88	0,8600		0,0,4300	no	coding-synonymous	ANAPC2	NM_013366.3		0,2,6501	GG,GA,AA		0.0,0.0454,0.0154		517/823	140075299	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	29882	exon8			GTACTCATTGATG	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1551T>C	chr9.hg19:g.140075299A>G		59.0	0.0		39.0	13.0	NM_013366	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Silent	SNP	ENST00000323927.2	hg19	CCDS7033.1																																																																																			.	.		0.647	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366	
ANAPC2	29882	hgsc.bcm.edu	37	9	140075345	140075345	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr9:140075345A>C	ENST00000323927.2	-	8	1509	c.1505T>G	c.(1504-1506)aTc>aGc	p.I502S		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	502					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CAGCAGGCTGATGATGTCCGA	0.637																																					p.I502S		Atlas-SNP	.											.	ANAPC2	57	.	0			c.T1505G						.						122.0	107.0	112.0					9																	140075345		2203	4300	6503	SO:0001583	missense	29882	exon8			AGGCTGATGATGT	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1505T>G	chr9.hg19:g.140075345A>C	ENSP00000314004:p.Ile502Ser	61.0	0.0		47.0	22.0	NM_013366	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	hg19	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.190008	0.78789	.	.	ENSG00000176248	ENST00000323927	T	0.76839	-1.05	5.41	5.41	0.78517	Cullin, N-terminal (1);Cullin homology (2);	0.046866	0.85682	D	0.000000	D	0.89301	0.6676	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	D	0.91188	0.4981	10	0.87932	D	0	-36.7872	13.3824	0.60775	1.0:0.0:0.0:0.0	.	502;499	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	S	502	ENSP00000314004:I502S	ENSP00000314004:I502S	I	-	2	0	ANAPC2	139195166	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	8.635000	0.91006	2.053000	0.61076	0.459000	0.35465	ATC	.	.		0.637	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366	
GDI2	2665	hgsc.bcm.edu	37	10	5836921	5836921	+	Silent	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:5836921A>T	ENST00000380191.4	-	4	605	c.315T>A	c.(313-315)acT>acA	p.T105T	GDI2_ENST00000380132.4_Silent_p.T109T|GDI2_ENST00000380181.3_Intron	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	105					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						AGCTCCCTTCAGTCACTTTAA	0.378																																					p.T105T		Atlas-SNP	.											.	GDI2	26	.	0			c.T315A						.						85.0	82.0	83.0					10																	5836921		2203	4300	6503	SO:0001819	synonymous_variant	2665	exon4			CCCTTCAGTCACT	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.315T>A	chr10.hg19:g.5836921A>T		143.0	0.0		166.0	83.0	NM_001494	O43928|Q5SX88|Q9UQM6	Silent	SNP	ENST00000380191.4	hg19	CCDS7071.1																																																																																			.	.		0.378	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	NM_001494	
SFMBT2	57713	hgsc.bcm.edu	37	10	7217971	7217971	+	Silent	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:7217971A>G	ENST00000361972.4	-	17	2055	c.1965T>C	c.(1963-1965)atT>atC	p.I655I	SFMBT2_ENST00000397167.1_Silent_p.I655I	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	655					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TTTTGGTATGAATGGAGCAGT	0.403																																					p.I655I		Atlas-SNP	.											.	SFMBT2	209	.	0			c.T1965C						.						183.0	181.0	182.0					10																	7217971		2203	4300	6503	SO:0001819	synonymous_variant	57713	exon17			GGTATGAATGGAG	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1965T>C	chr10.hg19:g.7217971A>G		77.0	0.0		92.0	49.0	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	hg19	CCDS31138.1																																																																																			.	.		0.403	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
RTKN2	219790	hgsc.bcm.edu	37	10	63958086	63958086	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:63958086C>G	ENST00000373789.3	-	12	1507	c.1411G>C	c.(1411-1413)Gcc>Ccc	p.A471P	RTKN2_ENST00000395265.1_Missense_Mutation_p.A492P|RTKN2_ENST00000315289.2_Missense_Mutation_p.A273P	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	471					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					AAGAGTGTGGCCCAAGGAGGT	0.388																																					p.A471P		Atlas-SNP	.											.	RTKN2	68	.	0			c.G1411C						.						117.0	118.0	118.0					10																	63958086		2203	4300	6503	SO:0001583	missense	219790	exon12			GTGTGGCCCAAGG	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.1411G>C	chr10.hg19:g.63958086C>G	ENSP00000362894:p.Ala471Pro	98.0	0.0		106.0	58.0	NM_145307	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	hg19	CCDS7263.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913051	0.52439	.	.	ENSG00000182010	ENST00000315289;ENST00000395265;ENST00000373789	T;T;T	0.50277	0.75;1.35;1.38	5.61	4.7	0.59300	.	0.109202	0.64402	D	0.000010	T	0.64692	0.2621	L	0.61218	1.895	0.58432	D	0.999994	D;D	0.89917	1.0;0.999	D;D	0.70227	0.968;0.95	T	0.67745	-0.5591	10	0.62326	D	0.03	-3.5932	14.2352	0.65922	0.0:0.9286:0.0:0.0713	.	273;471	Q5SVY4;Q8IZC4	.;RTKN2_HUMAN	P	273;492;471	ENSP00000325379:A273P;ENSP00000378682:A492P;ENSP00000362894:A471P	ENSP00000325379:A273P	A	-	1	0	RTKN2	63628092	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	2.675000	0.46875	1.377000	0.46286	0.655000	0.94253	GCC	.	.		0.388	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	NM_145307	
P4HA1	5033	hgsc.bcm.edu	37	10	74810812	74810812	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:74810812A>G	ENST00000307116.2	-	7	1015	c.899T>C	c.(898-900)aTg>aCg	p.M300T	P4HA1_ENST00000412021.2_Splice_Site_p.M300T|P4HA1_ENST00000373008.2_Splice_Site_p.M300T|P4HA1_ENST00000263556.3_Splice_Site_p.M300T|P4HA1_ENST00000394890.2_Splice_Site_p.M300T|P4HA1_ENST00000440381.1_Splice_Site_p.M300T			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	300					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCACTTTACCATTTTGATACC	0.403																																					p.M300T	Colon(147;367 2405 2662 52127)	Atlas-SNP	.											.	P4HA1	86	.	0			c.T899C						.						254.0	236.0	242.0					10																	74810812		2203	4300	6503	SO:0001630	splice_region_variant	5033	exon7			TTTACCATTTTGA		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.900+1T>C	chr10.hg19:g.74810812A>G		88.0	0.0		102.0	59.0	NM_001142596	C9JL12|Q15082|Q15083|Q5VSQ5	Missense_Mutation	SNP	ENST00000307116.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.89	3.500824	0.64298	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	T;T;T;T;T;T	0.42900	0.97;0.97;0.97;0.97;0.97;0.96	5.67	5.67	0.87782	.	0.036451	0.85682	D	0.000000	T	0.53384	0.1793	M	0.79926	2.475	0.80722	D	1	B;P;P	0.34892	0.161;0.474;0.474	B;B;B	0.40199	0.184;0.322;0.322	T	0.59037	-0.7529	10	0.66056	D	0.02	-1.2853	15.9045	0.79412	1.0:0.0:0.0:0.0	.	300;300;300	C9JL12;Q5VSQ6;P13674	.;.;P4HA1_HUMAN	T	300	ENSP00000307318:M300T;ENSP00000362099:M300T;ENSP00000411688:M300T;ENSP00000378353:M300T;ENSP00000263556:M300T;ENSP00000414464:M300T	ENSP00000263556:M300T	M	-	2	0	P4HA1	74480818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.933000	0.92911	2.157000	0.67596	0.455000	0.32223	ATG	.	.		0.403	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	NM_000917	Missense_Mutation
LOXL4	84171	hgsc.bcm.edu	37	10	100013487	100013487	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:100013487A>T	ENST00000260702.3	-	11	1808	c.1658T>A	c.(1657-1659)cTc>cAc	p.L553H	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	553	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		CAGCTGGCTGAGCGGGCGGTC	0.622																																					p.L553H		Atlas-SNP	.											.	LOXL4	60	.	0			c.T1658A						.						80.0	76.0	77.0					10																	100013487		2203	4300	6503	SO:0001583	missense	84171	exon11			TGGCTGAGCGGGC	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1658T>A	chr10.hg19:g.100013487A>T	ENSP00000260702:p.Leu553His	82.0	0.0		76.0	14.0	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	hg19	CCDS7473.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.601602	0.87055	.	.	ENSG00000138131	ENST00000260702	T	0.42513	0.97	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.67344	0.2883	M	0.85945	2.785	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.73714	-0.3896	10	0.87932	D	0	.	13.6238	0.62153	1.0:0.0:0.0:0.0	.	553	Q96JB6	LOXL4_HUMAN	H	553	ENSP00000260702:L553H	ENSP00000260702:L553H	L	-	2	0	LOXL4	100003477	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.139000	0.94554	2.052000	0.61016	0.402000	0.26972	CTC	.	.		0.622	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
MGEA5	10724	hgsc.bcm.edu	37	10	103557782	103557782	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:103557782T>A	ENST00000361464.3	-	10	2334	c.1939A>T	c.(1939-1941)Atc>Ttc	p.I647F	MGEA5_ENST00000357797.5_Missense_Mutation_p.I594F|MGEA5_ENST00000370094.3_Missense_Mutation_p.I647F|MGEA5_ENST00000482611.1_5'UTR|MGEA5_ENST00000439817.1_Missense_Mutation_p.I594F	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	647					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		ATACTCTTGATATCCCAAACA	0.388																																					p.I647F		Atlas-SNP	.											.	MGEA5	53	.	0			c.A1939T						.						131.0	118.0	122.0					10																	103557782		2203	4300	6503	SO:0001583	missense	10724	exon10			TCTTGATATCCCA	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1939A>T	chr10.hg19:g.103557782T>A	ENSP00000354850:p.Ile647Phe	90.0	0.0		70.0	37.0	NM_012215	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	ENST00000361464.3	hg19	CCDS7520.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.776037	0.90195	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797;ENST00000370094	T;T;T;T	0.36878	1.29;1.27;1.27;1.23	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	M	0.70595	2.14	0.80722	D	1	D;D;D;D	0.60160	0.972;0.987;0.981;0.982	P;P;P;P	0.62382	0.549;0.81;0.901;0.741	T	0.61811	-0.6986	10	0.72032	D	0.01	-11.181	15.8033	0.78473	0.0:0.0:0.0:1.0	.	594;594;647;647	E9PGF9;O60502-2;O60502-3;O60502	.;.;.;NCOAT_HUMAN	F	594;647;594;647	ENSP00000409973:I594F;ENSP00000354850:I647F;ENSP00000350445:I594F;ENSP00000359112:I647F	ENSP00000350445:I594F	I	-	1	0	MGEA5	103547772	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.036000	0.88901	2.133000	0.65898	0.533000	0.62120	ATC	.	.		0.388	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
ADAM12	8038	hgsc.bcm.edu	37	10	127753435	127753435	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr10:127753435A>G	ENST00000368679.4	-	14	1867	c.1558T>C	c.(1558-1560)Tac>Cac	p.Y520H	ADAM12_ENST00000368676.4_Missense_Mutation_p.Y520H|ADAM12_ENST00000467145.1_5'UTR	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	520	Cys-rich.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TTGTAGCAGTAGCCGTCCACA	0.612																																					p.Y520H		Atlas-SNP	.											.	ADAM12	388	.	0			c.T1558C						.						128.0	92.0	104.0					10																	127753435		2203	4300	6503	SO:0001583	missense	8038	exon14			AGCAGTAGCCGTC	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1558T>C	chr10.hg19:g.127753435A>G	ENSP00000357668:p.Tyr520His	63.0	0.0		51.0	13.0	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	hg19	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.757140	0.89843	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	T;T	0.26067	1.76;1.76	5.11	5.11	0.69529	ADAM, cysteine-rich (2);	0.000000	0.64402	D	0.000001	T	0.54078	0.1836	M	0.86740	2.835	0.80722	D	1	P;P;P;P;D	0.60575	0.875;0.849;0.849;0.849;0.988	P;P;P;P;D	0.63381	0.615;0.48;0.48;0.48;0.914	T	0.63620	-0.6596	10	0.87932	D	0	.	15.0789	0.72099	1.0:0.0:0.0:0.0	.	517;517;520;517;520	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	H	520	ENSP00000357668:Y520H;ENSP00000357665:Y520H	ENSP00000357665:Y520H	Y	-	1	0	ADAM12	127743425	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.015000	0.70791	2.145000	0.66743	0.528000	0.53228	TAC	.	.		0.612	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
WT1	7490	hgsc.bcm.edu	37	11	32456885	32456885	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr11:32456885C>T	ENST00000332351.3	-	1	291	c.7G>A	c.(7-9)Gac>Aac	p.D3N	WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1_ENST00000448076.3_Missense_Mutation_p.D3N|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000525436.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			GAAGCCGGGTCCTGCAGCAAG	0.716			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.D3N		Atlas-SNP	.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	744	.	0			c.G7A						.						1.0	1.0	1.0					11																	32456885		1027	2203	3230	SO:0001583	missense	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	CCGGGTCCTGCAG		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.7G>A	chr11.hg19:g.32456885C>T	ENSP00000331327:p.Asp3Asn	203.0	0.0		148.0	50.0	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000332351.3	hg19	CCDS7878.2	.	.	.	.	.	.	.	.	.	.	C	10.48	1.363313	0.24684	.	.	ENSG00000184937	ENST00000332351;ENST00000452863;ENST00000448076	T;T;T	0.13538	3.2;2.99;2.58	2.96	2.02	0.26589	.	.	.	.	.	T	0.07324	0.0185	N	0.08118	0	0.58432	D	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19353	-1.0308	9	0.72032	D	0.01	.	10.0525	0.42225	0.0:0.4563:0.5437:0.0	.	8;8	P19544-8;P19544-7	.;.	N	3	ENSP00000331327:D3N;ENSP00000415516:D3N;ENSP00000413452:D3N	ENSP00000331327:D3N	D	-	1	0	WT1	32413461	0.938000	0.31826	0.651000	0.29564	0.253000	0.25986	1.304000	0.33482	0.430000	0.26230	-0.556000	0.04195	GAC	.	.		0.716	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
CAT	847	hgsc.bcm.edu	37	11	34478274	34478274	+	Silent	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr11:34478274A>G	ENST00000241052.4	+	8	1055	c.966A>G	c.(964-966)ccA>ccG	p.P322P		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	322					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	ACCGGAATCCAGTTAATTACT	0.468																																					p.P322P		Atlas-SNP	.											.	CAT	42	.	0			c.A966G						.						132.0	119.0	123.0					11																	34478274		2202	4298	6500	SO:0001819	synonymous_variant	847	exon8			GAATCCAGTTAAT	AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.966A>G	chr11.hg19:g.34478274A>G		166.0	0.0		119.0	48.0	NM_001752	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Silent	SNP	ENST00000241052.4	hg19	CCDS7891.1																																																																																			.	.		0.468	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752	
SLC22A9	114571	hgsc.bcm.edu	37	11	63176251	63176251	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr11:63176251A>G	ENST00000279178.3	+	9	1750	c.1501A>G	c.(1501-1503)Atc>Gtc	p.I501V	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	501					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						GCCCTGGATCATCTATGGAGT	0.488																																					p.I501V		Atlas-SNP	.											.	SLC22A9	77	.	0			c.A1501G						.						149.0	135.0	140.0					11																	63176251		2201	4298	6499	SO:0001583	missense	114571	exon9			TGGATCATCTATG	AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.1501A>G	chr11.hg19:g.63176251A>G	ENSP00000279178:p.Ile501Val	147.0	0.0		111.0	38.0	NM_080866	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	hg19	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	A	9.008	0.981879	0.18812	.	.	ENSG00000149742	ENST00000279178	T	0.58506	0.33	2.63	0.0447	0.14227	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.368800	0.28403	N	0.015478	T	0.39682	0.1087	L	0.52266	1.64	0.80722	D	1	P	0.38167	0.621	B	0.33295	0.161	T	0.07770	-1.0755	10	0.27785	T	0.31	.	3.8701	0.09033	0.65:0.2174:0.1326:0.0	.	501	Q8IVM8	S22A9_HUMAN	V	501	ENSP00000279178:I501V	ENSP00000279178:I501V	I	+	1	0	SLC22A9	62932827	1.000000	0.71417	0.923000	0.36655	0.721000	0.41392	1.522000	0.35921	-0.107000	0.12088	0.172000	0.16884	ATC	.	.		0.488	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1	NM_080866	
RAB30	27314	hgsc.bcm.edu	37	11	82693383	82693383	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr11:82693383T>C	ENST00000533486.1	-	6	720	c.436A>G	c.(436-438)Atg>Gtg	p.M146V	RAB30_ENST00000534141.1_Silent_p.T144T|RAB30_ENST00000527633.1_Missense_Mutation_p.M146V|RAB30_ENST00000260056.2_Missense_Mutation_p.M146V|RP11-659G9.3_ENST00000527550.1_RNA	NM_014488.3	NP_055303.2	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	146					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cis-Golgi network (GO:0005801)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						AGATAATACATGTCCTGAGCT	0.438																																					p.M146V		Atlas-SNP	.											.	RAB30	28	.	0			c.A436G						.						119.0	108.0	112.0					11																	82693383		2203	4300	6503	SO:0001583	missense	27314	exon6			AATACATGTCCTG	U57092	CCDS8264.1	11q12-q14	2008-07-21				ENSG00000137502		"""RAB, member RAS oncogene"""	9770	protein-coding gene	gene with protein product		605693				8863739, 9792283	Standard	NM_014488		Approved		uc001ozu.3	Q15771		ENST00000533486.1:c.436A>G	chr11.hg19:g.82693383T>C	ENSP00000435189:p.Met146Val	82.0	0.0		77.0	30.0	NM_014488	Q6FGK1|Q6MZH2|Q96CI8	Missense_Mutation	SNP	ENST00000533486.1	hg19	CCDS8264.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.991444	0.54041	.	.	ENSG00000137502	ENST00000533486;ENST00000260056;ENST00000533014;ENST00000527633;ENST00000531021	T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19	5.96	5.96	0.96718	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.74658	0.3745	N	0.25825	0.765	0.80722	D	1	D	0.57257	0.979	P	0.50590	0.645	T	0.73805	-0.3867	9	.	.	.	.	16.4277	0.83824	0.0:0.0:0.0:1.0	.	146	Q15771	RAB30_HUMAN	V	146;146;110;146;146	ENSP00000435189:M146V;ENSP00000260056:M146V;ENSP00000433832:M110V;ENSP00000435089:M146V;ENSP00000434953:M146V	.	M	-	1	0	RAB30	82371031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.186000	0.72026	2.279000	0.76181	0.533000	0.62120	ATG	.	.		0.438	RAB30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392141.1	NM_014488	
ARHGEF12	23365	hgsc.bcm.edu	37	11	120350697	120350697	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr11:120350697A>T	ENST00000397843.2	+	38	3961	c.3795A>T	c.(3793-3795)caA>caT	p.Q1265H	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.Q1246H|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.Q1162H	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1265					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TGCTGGTGCAACAGCTAGGTT	0.453			T	MLL	AML																																p.Q1265H		Atlas-SNP	.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	133	.	0			c.A3795T						.						130.0	119.0	123.0					11																	120350697		1867	4099	5966	SO:0001583	missense	23365	exon38			GGTGCAACAGCTA	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.3795A>T	chr11.hg19:g.120350697A>T	ENSP00000380942:p.Gln1265His	114.0	0.0		108.0	40.0	NM_015313	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	hg19	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	A	10.97	1.502624	0.26949	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.70045	-0.35;-0.45;-0.33	5.5	-10.2	0.00374	.	0.295030	0.24343	N	0.039342	T	0.40473	0.1118	N	0.19112	0.55	0.22378	N	0.999159	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.03684	-1.1013	10	0.37606	T	0.19	-1.0513	11.5917	0.50949	0.2577:0.224:0.5183:0.0	.	1246;1265	Q9NZN5-2;Q9NZN5	.;ARHGC_HUMAN	H	1265;1246;1162	ENSP00000380942:Q1265H;ENSP00000349056:Q1246H;ENSP00000432984:Q1162H	ENSP00000349056:Q1246H	Q	+	3	2	ARHGEF12	119855907	0.216000	0.23585	0.028000	0.17463	0.555000	0.35460	-0.819000	0.04462	-2.528000	0.00493	-1.162000	0.01777	CAA	.	.		0.453	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
CLEC6A	93978	hgsc.bcm.edu	37	12	8612284	8612284	+	Silent	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:8612284A>G	ENST00000382073.3	+	3	399	c.213A>G	c.(211-213)acA>acG	p.T71T		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	71					defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					GTGAAGGGACAAAGGTGCCAG	0.383																																					p.T71T		Atlas-SNP	.											.	CLEC6A	19	.	0			c.A213G						.						120.0	116.0	117.0					12																	8612284		2203	4300	6503	SO:0001819	synonymous_variant	93978	exon3			AGGGACAAAGGTG	AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.213A>G	chr12.hg19:g.8612284A>G		82.0	0.0		63.0	18.0	NM_001007033	A2RUK3	Silent	SNP	ENST00000382073.3	hg19	CCDS31739.1																																																																																			.	.		0.383	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400562.1	NM_001007033	
ABCD2	225	hgsc.bcm.edu	37	12	40012907	40012907	+	Silent	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:40012907A>G	ENST00000308666.3	-	1	646	c.511T>C	c.(511-513)Ttg>Ctg	p.L171L		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	171	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						GCCAAAGCCAATTTGCATTCC	0.423																																					p.L171L		Atlas-SNP	.											.	ABCD2	127	.	0			c.T511C						.						110.0	108.0	109.0					12																	40012907		2203	4300	6503	SO:0001819	synonymous_variant	225	exon1			AAGCCAATTTGCA	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.511T>C	chr12.hg19:g.40012907A>G		263.0	0.0		223.0	96.0	NM_005164	B2RAM3|Q13210|Q2M3H9	Silent	SNP	ENST00000308666.3	hg19	CCDS8734.1																																																																																			.	.		0.423	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164	
HDAC7	51564	hgsc.bcm.edu	37	12	48179583	48179583	+	Silent	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:48179583G>T	ENST00000427332.2	-	23	2697	c.2541C>A	c.(2539-2541)gcC>gcA	p.A847A	HDAC7_ENST00000354334.3_Silent_p.A849A|HDAC7_ENST00000080059.7_Silent_p.A886A|AC004466.1_ENST00000599515.1_3'UTR|HDAC7_ENST00000552960.1_Silent_p.A869A|HDAC7_ENST00000380610.4_Silent_p.A903A			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	847	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		CGTCACAGATGGCTGTGAGGT	0.607																																					p.A886A		Atlas-SNP	.											.	HDAC7	71	.	0			c.C2658A						.						48.0	35.0	40.0					12																	48179583		2203	4300	6503	SO:0001819	synonymous_variant	51564	exon23			ACAGATGGCTGTG	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2541C>A	chr12.hg19:g.48179583G>T		189.0	0.0		135.0	53.0	NM_015401	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Silent	SNP	ENST00000427332.2	hg19		.	.	.	.	.	.	.	.	.	.	G	9.595	1.127083	0.20959	.	.	ENSG00000061273	ENST00000548080	.	.	.	4.25	3.36	0.38483	.	.	.	.	.	T	0.56688	0.2002	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52548	-0.8561	4	.	.	.	.	7.9374	0.29937	0.1906:0.0:0.8094:0.0	.	.	.	.	Q	279	.	.	P	-	2	0	HDAC7	46465850	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.513000	0.35823	1.179000	0.42884	-0.284000	0.09977	CCA	.	.		0.607	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
SYT1	6857	hgsc.bcm.edu	37	12	79837902	79837902	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:79837902G>T	ENST00000261205.4	+	10	1635	c.978G>T	c.(976-978)aaG>aaT	p.K326N	SYT1_ENST00000393240.3_Missense_Mutation_p.K326N|SYT1_ENST00000552744.1_Missense_Mutation_p.K326N|RP1-78O14.1_ENST00000550268.1_lincRNA|SYT1_ENST00000457153.2_Missense_Mutation_p.K323N	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	326	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						GGCTGAAGAAGAAAAAGACAA	0.338																																					p.K326N		Atlas-SNP	.											.	SYT1	70	.	0			c.G978T						.						148.0	134.0	139.0					12																	79837902		2203	4300	6503	SO:0001583	missense	6857	exon11			GAAGAAGAAAAAG		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.978G>T	chr12.hg19:g.79837902G>T	ENSP00000261205:p.Lys326Asn	142.0	0.0		93.0	31.0	NM_001135805	Q6AI31	Missense_Mutation	SNP	ENST00000261205.4	hg19	CCDS9017.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221238	0.79464	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552744	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.45	5.45	0.79879	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.85128	0.5626	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.87233	0.2261	10	0.87932	D	0	.	12.6052	0.56519	0.0756:0.0:0.9244:0.0	.	326;326	Q6AI31;P21579	.;SYT1_HUMAN	N	326;326;323;326	ENSP00000376932:K326N;ENSP00000261205:K326N;ENSP00000391056:K323N;ENSP00000447575:K326N	ENSP00000261205:K326N	K	+	3	2	SYT1	78362033	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.863000	0.69568	2.567000	0.86603	0.655000	0.94253	AAG	.	.		0.338	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259415.1	NM_005639	
OTOGL	283310	hgsc.bcm.edu	37	12	80707277	80707277	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:80707277A>G	ENST00000547103.1	+	30	3451	c.3445A>G	c.(3445-3447)Aaa>Gaa	p.K1149E	OTOGL_ENST00000458043.2_Missense_Mutation_p.K1149E			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1149					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTCTTTTGCCAAAAATTGTCA	0.348																																					p.K1149E		Atlas-SNP	.											.	OTOGL	235	.	0			c.A3445G						.						127.0	128.0	128.0					12																	80707277		2146	4277	6423	SO:0001583	missense	283310	exon30			TTTGCCAAAAATT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3445A>G	chr12.hg19:g.80707277A>G	ENSP00000447211:p.Lys1149Glu	115.0	0.0		98.0	34.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	A	26.0	4.695995	0.88830	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.75704	-0.96;-0.96	5.64	5.64	0.86602	.	.	.	.	.	T	0.62636	0.2444	N	0.17838	0.53	0.53005	D	0.999965	.	.	.	.	.	.	T	0.59621	-0.7420	7	0.05833	T	0.94	.	15.8614	0.79026	1.0:0.0:0.0:0.0	.	.	.	.	E	1149	ENSP00000447211:K1149E;ENSP00000400895:K1149E	ENSP00000400895:K1149E	K	+	1	0	OTOGL	79231408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.856000	0.92245	2.137000	0.66172	0.528000	0.53228	AAA	.	.		0.348	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
AMDHD1	144193	hgsc.bcm.edu	37	12	96360166	96360166	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:96360166C>G	ENST00000266736.2	+	8	1179	c.1073C>G	c.(1072-1074)tCc>tGc	p.S358C		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	358					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						ATGAGAATGTCCATGCCTGAG	0.488																																					p.S358C		Atlas-SNP	.											.	AMDHD1	56	.	0			c.C1073G						.						147.0	128.0	135.0					12																	96360166		2203	4300	6503	SO:0001583	missense	144193	exon8			GAATGTCCATGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.1073C>G	chr12.hg19:g.96360166C>G	ENSP00000266736:p.Ser358Cys	78.0	0.0		75.0	24.0	NM_152435	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	hg19	CCDS9057.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346021	0.82022	.	.	ENSG00000139344	ENST00000266736	T	0.72394	-0.65	5.62	5.62	0.85841	Amidohydrolase 3 (1);Metal-dependent hydrolase, composite domain (1);	0.105169	0.64402	D	0.000002	D	0.88621	0.6486	M	0.94063	3.49	0.58432	D	0.999998	D	0.76494	0.999	D	0.71656	0.974	D	0.91059	0.4884	10	0.87932	D	0	-1.1515	19.6523	0.95822	0.0:1.0:0.0:0.0	.	358	Q96NU7	HUTI_HUMAN	C	358	ENSP00000266736:S358C	ENSP00000266736:S358C	S	+	2	0	AMDHD1	94884297	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.733000	0.68571	2.650000	0.89964	0.561000	0.74099	TCC	.	.		0.488	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
HCAR2	338442	hgsc.bcm.edu	37	12	123187347	123187347	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:123187347G>T	ENST00000328880.5	-	1	543	c.484C>A	c.(484-486)Ctc>Atc	p.L162I	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	162					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	TTCTTCAGGAGGTGGACTGTC	0.547																																					p.L162I		Atlas-SNP	.											.	HCAR2	36	.	0			c.C484A						.						111.0	97.0	102.0					12																	123187347		2203	4300	6503	SO:0001583	missense	338442	exon1			TCAGGAGGTGGAC	AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.484C>A	chr12.hg19:g.123187347G>T	ENSP00000375066:p.Leu162Ile	109.0	0.0		145.0	27.0	NM_177551	A0PJL5|A7LGG3	Missense_Mutation	SNP	ENST00000328880.5	hg19	CCDS9235.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.421627	0.43020	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.38077	1.16	5.25	4.36	0.52297	GPCR, rhodopsin-like superfamily (1);	0.099186	0.41001	D	0.000970	T	0.39410	0.1077	L	0.40543	1.245	0.32175	N	0.581159	D	0.56746	0.977	D	0.63877	0.919	T	0.32322	-0.9911	10	0.12766	T	0.61	-41.3881	6.2038	0.20591	0.0911:0.0:0.7228:0.1861	.	162	Q8TDS4	HCAR2_HUMAN	I	162	ENSP00000375066:L162I	ENSP00000375066:L162I	L	-	1	0	HCAR2	121753300	1.000000	0.71417	0.996000	0.52242	0.349000	0.29174	1.434000	0.34958	2.894000	0.99253	0.655000	0.94253	CTC	.	.		0.547	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370202.1	NM_177551	
WASF3	10810	hgsc.bcm.edu	37	13	27255212	27255212	+	Silent	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr13:27255212G>A	ENST00000335327.5	+	8	916	c.738G>A	c.(736-738)acG>acA	p.T246T	WASF3_ENST00000361042.4_Silent_p.T243T	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	246					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CGGACGTTACGGATTACTCTT	0.498																																					p.T246T		Atlas-SNP	.											.	WASF3	68	.	0			c.G738A						.						87.0	97.0	94.0					13																	27255212		2203	4300	6503	SO:0001819	synonymous_variant	10810	exon8			CGTTACGGATTAC	AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.738G>A	chr13.hg19:g.27255212G>A		169.0	0.0		159.0	61.0	NM_006646	O94974|Q86VQ2	Silent	SNP	ENST00000335327.5	hg19	CCDS9318.1																																																																																			.	.		0.498	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
LINC00283	100874057	hgsc.bcm.edu	37	13	103393484	103393484	+	RNA	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr13:103393484T>C	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		AATATTCTCTTTATTCTGATA	0.303																																					p.K3188R		Atlas-SNP	.											.	.	.	.	0			c.A9563G						.						67.0	54.0	58.0					13																	103393484		692	1589	2281			643677	exon4			TTCTCTTTATTCT			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103393484T>C		107.0	0.0		74.0	31.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.303	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
ANG	283	hgsc.bcm.edu	37	14	21162046	21162046	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr14:21162046A>T	ENST00000336811.6	+	2	923	c.323A>T	c.(322-324)cAt>cTt	p.H108L	RNASE4_ENST00000555597.1_Intron|AL163636.6_ENST00000553909.1_Intron|ANG_ENST00000554073.1_Intron|ANG_ENST00000397990.4_Missense_Mutation_p.H108L|RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000304704.4_Intron|RNASE4_ENST00000555835.1_Intron|RNASE4_ENST00000397995.2_Intron	NM_001145.4	NP_001136.1	P03950	ANGI_HUMAN	angiogenin, ribonuclease, RNase A family, 5	108					actin filament polymerization (GO:0030041)|activation of phospholipase A2 activity (GO:0032431)|activation of phospholipase C activity (GO:0007202)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|cell communication (GO:0007154)|cell death (GO:0008219)|cell migration (GO:0016477)|diacylglycerol biosynthetic process (GO:0006651)|homeostatic process (GO:0042592)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|placenta development (GO:0001890)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein secretion (GO:0050714)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|RNA phosphodiester bond hydrolysis (GO:0090501)|rRNA transcription (GO:0009303)	angiogenin-PRI complex (GO:0032311)|basal lamina (GO:0005605)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	actin binding (GO:0003779)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|heparin binding (GO:0008201)|peptide binding (GO:0042277)|receptor binding (GO:0005102)|ribonuclease activity (GO:0004540)|rRNA binding (GO:0019843)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)	5	all_cancers(95;0.00387)	all_cancers(140;0.196)|all_epithelial(140;0.156)	Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	OV - Ovarian serous cystadenocarcinoma(311;3.25e-17)|GBM - Glioblastoma multiforme(265;5.56e-07)		TGCAAGCTACATGGAGGTTCC	0.498																																					p.H108L		Atlas-SNP	.											.	ANG	8	.	0			c.A323T						.						108.0	102.0	104.0					14																	21162046		2203	4300	6503	SO:0001583	missense	283	exon2			AGCTACATGGAGG		CCDS9554.1	14q11.1-q11.2	2014-09-17			ENSG00000214274	ENSG00000214274	3.1.27.-	"""Ribonucleases, RNase A"""	483	protein-coding gene	gene with protein product		105850				1978563	Standard	NM_001145		Approved	RNASE5	uc001vxw.4	P03950	OTTHUMG00000029576	ENST00000336811.6:c.323A>T	chr14.hg19:g.21162046A>T	ENSP00000336762:p.His108Leu	216.0	0.0		202.0	55.0	NM_001097577	Q05CV1|Q53X86|Q6P5T2|Q8WXE7	Missense_Mutation	SNP	ENST00000336811.6	hg19	CCDS9554.1	.	.	.	.	.	.	.	.	.	.	A	6.505	0.461358	0.12342	.	.	ENSG00000214274	ENST00000336811;ENST00000397990	T;T	0.72282	-0.64;-0.64	4.83	-9.65	0.00537	Ribonuclease A, domain (4);	3.935250	0.01972	U	0.044187	T	0.43433	0.1247	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.45366	-0.9266	10	0.45353	T	0.12	.	2.4464	0.04507	0.3474:0.2088:0.3407:0.1031	.	108	P03950	ANGI_HUMAN	L	108	ENSP00000336762:H108L;ENSP00000381077:H108L	ENSP00000336762:H108L	H	+	2	0	ANG	20231886	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.300000	0.00071	-4.334000	0.00056	-2.863000	0.00101	CAT	.	.		0.498	ANG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073731.3	NM_001097577	
RPGRIP1	57096	hgsc.bcm.edu	37	14	21790033	21790034	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr14:21790033_21790034GA>AT	ENST00000400017.2	+	13	1632_1633	c.1632_1633GA>AT	c.(1630-1635)atGAca>atATca	p.544_545MT>IS	RPGRIP1_ENST00000307974.4_5'Flank|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.186_187MT>IS|RPGRIP1_ENST00000553500.1_3'UTR|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.544_545MT>IS|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.517_518MT>IS|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.517_518MT>IS	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	544					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AGGCAATGATGACAAAAGCTGA	0.406																																					p.M544I|p.T545S		Atlas-SNP	.											.	RPGRIP1	213	.	0			c.G1632A|c.A1633T						.																																			SO:0001583	missense	57096	exon13			AATGATGACAAAA|ATGATGACAAAAG	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	Exception_encountered	chr14.hg19:g.21790033_21790034delinsAT	ENSP00000382895:p.M544_T545delinsIS	159.0|161.0	0.0		159.0|156.0	48.0|46.0	NM_020366	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	hg19	CCDS45080.1																																																																																			.	.		0.406	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
STXBP6	29091	hgsc.bcm.edu	37	14	25325147	25325147	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr14:25325147A>G	ENST00000323944.5	-	4	897	c.446T>C	c.(445-447)aTg>aCg	p.M149T	STXBP6_ENST00000546511.1_Missense_Mutation_p.M149T|STXBP6_ENST00000548724.1_Missense_Mutation_p.M149T|STXBP6_ENST00000550887.1_Missense_Mutation_p.M149T|STXBP6_ENST00000396700.1_Missense_Mutation_p.M149T|STXBP6_ENST00000358326.2_Missense_Mutation_p.M149T|STXBP6_ENST00000419632.2_Missense_Mutation_p.M149T			Q8NFX7	STXB6_HUMAN	syntaxin binding protein 6 (amisyn)	149					negative regulation of exocytosis (GO:0045920)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|large_intestine(3)	7				GBM - Glioblastoma multiforme(265;0.0296)		CTCACCTCCCATAATTTTGGA	0.418																																					p.M149T		Atlas-SNP	.											.	STXBP6	22	.	0			c.T446C						.						121.0	109.0	113.0					14																	25325147		2203	4299	6502	SO:0001583	missense	29091	exon4			CCTCCCATAATTT	AF161505	CCDS9634.1	14q11.2	2002-12-18			ENSG00000168952	ENSG00000168952			19666	protein-coding gene	gene with protein product		607958				12145319	Standard	NM_014178		Approved	amisyn, HSPC156	uc001wpu.3	Q8NFX7	OTTHUMG00000140186	ENST00000323944.5:c.446T>C	chr14.hg19:g.25325147A>G	ENSP00000324302:p.Met149Thr	93.0	0.0		101.0	25.0	NM_014178	D3DS78|Q8N3H1|Q8N8D5|Q96GF3|Q9P008	Missense_Mutation	SNP	ENST00000323944.5	hg19	CCDS9634.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201879	0.38905	.	.	ENSG00000168952	ENST00000396700;ENST00000548724;ENST00000323944;ENST00000419632;ENST00000546511;ENST00000550887;ENST00000358326	.	.	.	5.18	5.18	0.71444	.	0.219917	0.52532	D	0.000080	T	0.40297	0.1111	N	0.16478	0.41	0.43793	D	0.99633	B	0.02656	0.0	B	0.01281	0.0	T	0.23404	-1.0189	9	0.22706	T	0.39	-18.6291	12.9799	0.58557	1.0:0.0:0.0:0.0	.	149	Q8NFX7	STXB6_HUMAN	T	149	.	ENSP00000324302:M149T	M	-	2	0	STXBP6	24394987	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.330000	0.96422	1.961000	0.56991	0.477000	0.44152	ATG	.	.		0.418	STXBP6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409166.1		
ZFYVE26	23503	hgsc.bcm.edu	37	14	68257468	68257468	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr14:68257468T>A	ENST00000347230.4	-	15	2714	c.2576A>T	c.(2575-2577)aAg>aTg	p.K859M	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.K859M	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	859					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GGGTGAGGACTTCAGGTTGAA	0.512																																					p.K859M		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.A2576T						.						145.0	128.0	134.0					14																	68257468		2203	4300	6503	SO:0001583	missense	23503	exon15			GAGGACTTCAGGT	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2576A>T	chr14.hg19:g.68257468T>A	ENSP00000251119:p.Lys859Met	154.0	0.0		121.0	53.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386366	0.82902	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.31247	1.65;1.5	5.33	5.33	0.75918	.	0.350334	0.30714	N	0.009036	T	0.47857	0.1468	M	0.63428	1.95	0.43435	D	0.995601	D;D	0.62365	0.989;0.991	P;P	0.56474	0.799;0.747	T	0.51052	-0.8754	10	0.87932	D	0	-17.5849	15.6241	0.76840	0.0:0.0:0.0:1.0	.	859;859	G3V2D8;Q68DK2	.;ZFY26_HUMAN	M	859;838;859	ENSP00000251119:K859M;ENSP00000450603:K859M	ENSP00000251119:K859M	K	-	2	0	ZFYVE26	67327221	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.658000	0.68003	2.145000	0.66743	0.533000	0.62120	AAG	.	.		0.512	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
PTPN21	11099	hgsc.bcm.edu	37	14	88945839	88945839	+	Missense_Mutation	SNP	C	C	A	rs576261282	byFrequency	TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr14:88945839C>A	ENST00000556564.1	-	13	2220	c.1936G>T	c.(1936-1938)Ggc>Tgc	p.G646C	PTPN21_ENST00000328736.3_Missense_Mutation_p.G646C	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	646					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCCTCCAGGCCGTGGCTGAGC	0.726																																					p.G646C		Atlas-SNP	.											.	PTPN21	113	.	0			c.G1936T						.						17.0	20.0	19.0					14																	88945839		2178	4257	6435	SO:0001583	missense	11099	exon13			CCAGGCCGTGGCT	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1936G>T	chr14.hg19:g.88945839C>A	ENSP00000452414:p.Gly646Cys	33.0	0.0		33.0	12.0	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	hg19	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732608	0.48939	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.75477	-0.94;-0.94	5.17	-1.32	0.09201	.	0.194142	0.56097	N	0.000035	T	0.72708	0.3494	L	0.49126	1.545	0.09310	N	0.999998	D	0.61080	0.989	P	0.58077	0.832	T	0.65994	-0.6033	10	0.66056	D	0.02	.	4.5001	0.11860	0.24:0.4213:0.0:0.3387	.	646	Q16825	PTN21_HUMAN	C	646	ENSP00000330276:G646C;ENSP00000452414:G646C	ENSP00000330276:G646C	G	-	1	0	PTPN21	88015592	0.972000	0.33761	0.000000	0.03702	0.002000	0.02628	0.417000	0.21214	-0.953000	0.03645	-2.838000	0.00105	GGC	.	.		0.726	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
TTC8	123016	hgsc.bcm.edu	37	14	89336480	89336480	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr14:89336480C>G	ENST00000345383.5	+	10	1041	c.957C>G	c.(955-957)atC>atG	p.I319M	TTC8_ENST00000354441.6_Missense_Mutation_p.I64M|TTC8_ENST00000338104.6_Missense_Mutation_p.I345M|TTC8_ENST00000358622.5_Missense_Mutation_p.I131M|TTC8_ENST00000380656.2_Missense_Mutation_p.I329M|TTC8_ENST00000346301.4_Missense_Mutation_p.I289M|TTC8_ENST00000536576.1_Missense_Mutation_p.I90M	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	355					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TGGAAGCCATCGCATGCATTG	0.398																																					p.I329M		Atlas-SNP	.											.	TTC8	42	.	0			c.C987G						.						160.0	147.0	151.0					14																	89336480		2203	4300	6503	SO:0001583	missense	123016	exon11			AGCCATCGCATGC	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.957C>G	chr14.hg19:g.89336480C>G	ENSP00000339486:p.Ile319Met	142.0	0.0		110.0	44.0	NM_144596	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	hg19	CCDS9885.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.73|17.73|17.73	3.460692|3.460692|3.460692	0.63513|0.63513|0.63513	.|.|.	.|.|.	ENSG00000165533|ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000557580|ENST00000554686	T;T;T;T;T;T;T|.|.	0.53423|.|.	0.62;0.67;0.62;0.62;0.67;0.62;0.62|.|.	5.62|5.62|5.62	-6.01|-6.01|-6.01	0.02199|0.02199|0.02199	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.71341|0.71341|0.71341	0.3328|0.3328|0.3328	M|M|M	0.83223|0.83223|0.83223	2.63|2.63|2.63	0.58432|0.58432|0.58432	D|D|D	0.999994|0.999994|0.999994	D;D;D;D;D|.|.	0.89917|.|.	1.0;1.0;0.999;1.0;1.0|.|.	D;D;D;D;D|.|.	0.97110|.|.	1.0;0.992;0.995;0.997;0.997|.|.	T|T|T	0.75491|0.75491|0.75491	-0.3299|-0.3299|-0.3299	10|5|5	0.72032|.|.	D|.|.	0.01|.|.	-18.3264|-18.3264|-18.3264	13.3315|13.3315|13.3315	0.60490|0.60490|0.60490	0.0:0.476:0.0:0.524|0.0:0.476:0.0:0.524|0.0:0.476:0.0:0.524	.|.|.	64;90;355;299;329|.|.	Q8TAM2-2;B3KSL8;Q8TAM2;Q8TAM2-3;Q8TAM2-4|.|.	.;.;TTC8_HUMAN;.;.|.|.	M|G|W	319;90;289;345;64;329;131|118|279	ENSP00000339486:I319M;ENSP00000445067:I90M;ENSP00000298324:I289M;ENSP00000337653:I345M;ENSP00000346427:I64M;ENSP00000370031:I329M;ENSP00000351439:I131M|.|.	ENSP00000337653:I345M|.|.	I|R|S	+|+|+	3|1|2	3|0|0	TTC8|TTC8|TTC8	88406233|88406233|88406233	0.030000|0.030000|0.030000	0.19436|0.19436|0.19436	0.850000|0.850000|0.850000	0.33497|0.33497|0.33497	0.979000|0.979000|0.979000	0.70002|0.70002|0.70002	-0.899000|-0.899000|-0.899000	0.04101|0.04101|0.04101	-1.382000|-1.382000|-1.382000	0.02109|0.02109|0.02109	-1.090000|-1.090000|-1.090000	0.02178|0.02178|0.02178	ATC|CGC|TCG	.	.		0.398	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
TBC1D2B	23102	hgsc.bcm.edu	37	15	78305207	78305207	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr15:78305207G>T	ENST00000300584.3	-	9	2227	c.2228C>A	c.(2227-2229)tCc>tAc	p.S743Y	TBC1D2B_ENST00000409931.3_Missense_Mutation_p.S743Y	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	743	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						ATTCCGCCAGGAGAAGGCGAG	0.517																																					p.S743Y		Atlas-SNP	.											.	TBC1D2B	104	.	0			c.C2228A						.						115.0	95.0	102.0					15																	78305207		2196	4293	6489	SO:0001583	missense	23102	exon9			CGCCAGGAGAAGG	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2228C>A	chr15.hg19:g.78305207G>T	ENSP00000300584:p.Ser743Tyr	122.0	0.0		98.0	78.0	NM_144572	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	ENST00000300584.3	hg19	CCDS45314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.438236|4.438236	0.83885|0.83885	.|.	.|.	ENSG00000167202|ENSG00000167202	ENST00000418039|ENST00000409931;ENST00000300584	.|T;T	.|0.05513	.|3.43;3.43	5.47|5.47	5.47|5.47	0.80525|0.80525	.|Rab-GAP/TBC domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.41373|0.41373	0.1156|0.1156	H|H	0.96916|0.96916	3.905|3.905	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.993;0.999	T|T	0.60125|0.60125	-0.7324|-0.7324	5|10	.|0.87932	.|D	.|0	.|.	18.6826|18.6826	0.91551|0.91551	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|743;195;743	.|Q9UPU7-2;Q9UPU7-3;Q9UPU7	.|.;.;TBD2B_HUMAN	T|Y	625|743	.|ENSP00000387165:S743Y;ENSP00000300584:S743Y	.|ENSP00000300584:S743Y	P|S	-|-	1|2	0|0	TBC1D2B|TBC1D2B	76092262|76092262	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.755000|0.755000	0.42902|0.42902	7.676000|7.676000	0.84012|0.84012	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	CCT|TCC	.	.		0.517	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
PRSS21	10942	hgsc.bcm.edu	37	16	2867809	2867809	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr16:2867809C>A	ENST00000005995.3	+	3	141	c.99C>A	c.(97-99)tgC>tgA	p.C33*	PRSS21_ENST00000455114.1_Nonsense_Mutation_p.C33*|PRSS21_ENST00000450020.3_Nonsense_Mutation_p.C33*			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	33					spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						GAGGACCATGCGGCCGACGGG	0.677																																					p.C33X		Atlas-SNP	.											.	PRSS21	32	.	0			c.C99A						.						13.0	14.0	14.0					16																	2867809		2092	4107	6199	SO:0001587	stop_gained	10942	exon3			ACCATGCGGCCGA	AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.99C>A	chr16.hg19:g.2867809C>A	ENSP00000005995:p.Cys33*	95.0	0.0		60.0	8.0	NM_144957	Q9NS34|Q9P2V6	Nonsense_Mutation	SNP	ENST00000005995.3	hg19	CCDS10478.1	.	.	.	.	.	.	.	.	.	.	c	13.56	2.274441	0.40194	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	.	.	.	2.86	-5.72	0.02406	.	0.000000	0.34932	U	0.003570	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.136	0.59409	0.0:0.1957:0.0:0.8043	.	.	.	.	X	33	.	ENSP00000005995:C33X	C	+	3	2	PRSS21	2807810	0.001000	0.12720	0.000000	0.03702	0.081000	0.17604	-2.524000	0.00948	-2.370000	0.00602	-1.073000	0.02249	TGC	.	.		0.677	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	NM_006799	
RBFOX1	54715	hgsc.bcm.edu	37	16	7726804	7726804	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr16:7726804A>T	ENST00000550418.1	+	14	1947	c.959A>T	c.(958-960)cAg>cTg	p.Q320L	RBFOX1_ENST00000547372.1_Missense_Mutation_p.Q363L|RBFOX1_ENST00000311745.5_Missense_Mutation_p.Q341L|RBFOX1_ENST00000547338.1_Missense_Mutation_p.Q320L|RBFOX1_ENST00000553186.1_Missense_Mutation_p.Q293L|RBFOX1_ENST00000340209.4_Missense_Mutation_p.Q325L|RBFOX1_ENST00000535565.2_Missense_Mutation_p.Q277L|RBFOX1_ENST00000355637.4_Missense_Mutation_p.Q341L|RBFOX1_ENST00000552089.1_Missense_Mutation_p.Q337L|RBFOX1_ENST00000436368.2_Missense_Mutation_p.Q341L|RBFOX1_ENST00000422070.4_Missense_Mutation_p.Q363L	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	320					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CGCTACGCCCAGCCTACCCCT	0.517																																					p.Q341L	Ovarian(157;934 2567 15163 39509)	Atlas-SNP	.											.	RBFOX1	341	.	0			c.A1022T						.						175.0	125.0	142.0					16																	7726804		2197	4300	6497	SO:0001583	missense	54715	exon11			ACGCCCAGCCTAC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.959A>T	chr16.hg19:g.7726804A>T	ENSP00000450031:p.Gln320Leu	64.0	0.0		39.0	20.0	NM_145891	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	hg19	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082226	0.76528	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T	0.47528	1.1;1.33;0.84;1.35;1.1;1.3;1.49;1.27;1.11	5.43	4.35	0.52113	.	0.056469	0.64402	D	0.000001	T	0.62356	0.2421	M	0.68952	2.095	0.46798	D	0.999203	D;P;D;D;D;P;D;D	0.76494	0.998;0.949;0.999;0.994;0.998;0.859;0.969;0.998	D;P;D;D;D;B;P;D	0.85130	0.995;0.542;0.997;0.986;0.948;0.351;0.856;0.969	T	0.58891	-0.7556	10	0.22706	T	0.39	-7.511	10.8121	0.46553	0.9252:0.0:0.0748:0.0	.	314;277;363;341;341;341;293;320	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1	.;.;.;.;.;.;.;RFOX1_HUMAN	L	320;293;363;363;277;337;320;341;341;341;314;325	ENSP00000450031:Q320L;ENSP00000447753:Q293L;ENSP00000446842:Q363L;ENSP00000391269:Q363L;ENSP00000447717:Q320L;ENSP00000402745:Q341L;ENSP00000309117:Q341L;ENSP00000347855:Q341L;ENSP00000344196:Q325L	ENSP00000309117:Q341L	Q	+	2	0	RBFOX1	7666805	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.945000	0.75947	1.018000	0.39521	0.528000	0.53228	CAG	.	.		0.517	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
ORAI3	93129	hgsc.bcm.edu	37	16	30964577	30964577	+	Silent	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr16:30964577C>T	ENST00000318663.4	+	2	524	c.300C>T	c.(298-300)gcC>gcT	p.A100A	ORAI3_ENST00000566237.1_Silent_p.A100A|AC135048.13_ENST00000566056.1_RNA|ORAI3_ENST00000562699.1_Intron	NM_152288.2	NP_689501.1	Q9BRQ5	ORAI3_HUMAN	ORAI calcium release-activated calcium modulator 3	100					store-operated calcium entry (GO:0002115)	integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6						CCTTCAGTGCCTGCACCACCG	0.592											OREG0023742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A100A		Atlas-SNP	.											.	ORAI3	19	.	0			c.C300T						.						109.0	93.0	98.0					16																	30964577		2197	4300	6497	SO:0001819	synonymous_variant	93129	exon2			CAGTGCCTGCACC	BC006126	CCDS10697.1	16p11.2	2007-08-14	2007-08-14	2007-08-14	ENSG00000175938	ENSG00000175938		"""ORAI calcium release-activated calcium modulators"""	28185	protein-coding gene	gene with protein product		610930	"""transmembrane protein 142C"""	TMEM142C		16582901	Standard	NM_152288		Approved	MGC13024	uc002eac.3	Q9BRQ5	OTTHUMG00000132409	ENST00000318663.4:c.300C>T	chr16.hg19:g.30964577C>T		62.0	0.0	821	43.0	5.0	NM_152288	Q96BI8	Silent	SNP	ENST00000318663.4	hg19	CCDS10697.1																																																																																			.	.		0.592	ORAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255545.20	NM_152288	
YBX2	51087	hgsc.bcm.edu	37	17	7193784	7193784	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr17:7193784C>T	ENST00000007699.5	-	5	593	c.530G>A	c.(529-531)cGa>cAa	p.R177Q	YBX2_ENST00000570627.1_5'UTR	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	177					mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						GGACTTACGTCGGTTGGGGGC	0.627																																					p.R177Q		Atlas-SNP	.											.	YBX2	28	.	0			c.G530A						.						32.0	36.0	35.0					17																	7193784		2199	4291	6490	SO:0001583	missense	51087	exon5			TTACGTCGGTTGG	AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.530G>A	chr17.hg19:g.7193784C>T	ENSP00000007699:p.Arg177Gln	95.0	0.0		74.0	20.0	NM_015982	D3DTP1|Q8N4P0	Missense_Mutation	SNP	ENST00000007699.5	hg19	CCDS11098.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912445	0.92178	.	.	ENSG00000006047	ENST00000007699	T	0.29397	1.57	4.67	4.67	0.58626	.	0.151312	0.44097	D	0.000495	T	0.57344	0.2047	M	0.80508	2.5	0.43761	D	0.99627	D	0.76494	0.999	D	0.72625	0.978	T	0.63111	-0.6710	10	0.87932	D	0	-7.0809	15.478	0.75501	0.0:1.0:0.0:0.0	.	177	Q9Y2T7	YBOX2_HUMAN	Q	177	ENSP00000007699:R177Q	ENSP00000007699:R177Q	R	-	2	0	YBX2	7134508	0.999000	0.42202	0.999000	0.59377	0.943000	0.58893	3.256000	0.51492	2.613000	0.88420	0.561000	0.74099	CGA	.	.		0.627	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440172.2	NM_015982	
ZBTB4	57659	hgsc.bcm.edu	37	17	7366504	7366504	+	Silent	SNP	A	A	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr17:7366504A>C	ENST00000311403.4	-	4	2136	c.1797T>G	c.(1795-1797)ccT>ccG	p.P599P	ZBTB4_ENST00000380599.4_Silent_p.P599P	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	599					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		GACACAGTGGAGGTGGAGCCT	0.652																																					p.P599P		Atlas-SNP	.											.	ZBTB4	163	.	0			c.T1797G						.						23.0	20.0	21.0					17																	7366504		2203	4299	6502	SO:0001819	synonymous_variant	57659	exon4			CAGTGGAGGTGGA	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1797T>G	chr17.hg19:g.7366504A>C		22.0	0.0		26.0	9.0	NM_001128833	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Silent	SNP	ENST00000311403.4	hg19	CCDS11107.1																																																																																			.	.		0.652	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
NF1	4763	hgsc.bcm.edu	37	17	29586118	29586118	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr17:29586118T>A	ENST00000358273.4	+	33	4784	c.4401T>A	c.(4399-4401)ttT>ttA	p.F1467L	NF1_ENST00000356175.3_Missense_Mutation_p.F1446L	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1467					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCAATGATTTTGTGAAAAGCA	0.348			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.F1467L		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)	c.T4401A						.						53.0	48.0	49.0					17																	29586118		2201	4298	6499	SO:0001583	missense	4763	exon33	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TGATTTTGTGAAA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4401T>A	chr17.hg19:g.29586118T>A	ENSP00000351015:p.Phe1467Leu	132.0	0.0		114.0	5.0	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.671608	0.88348	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.84944	-1.92;-1.92;-1.92	5.78	4.71	0.59529	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (2);	0.000000	0.85682	D	0.000000	D	0.87402	0.6168	L	0.42487	1.325	0.80722	D	1	P;P;B	0.52577	0.717;0.954;0.209	B;D;B	0.66351	0.263;0.943;0.134	D	0.85716	0.1322	10	0.44086	T	0.13	.	9.3926	0.38383	0.0:0.1545:0.0:0.8455	.	496;1446;1467	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	L	1467;1446;1112	ENSP00000351015:F1467L;ENSP00000348498:F1446L;ENSP00000389907:F1112L	ENSP00000348498:F1446L	F	+	3	2	NF1	26610244	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.010000	0.49559	1.021000	0.39600	0.454000	0.30748	TTT	.	.		0.348	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666304	36666304	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr17:36666304A>G	ENST00000431231.2	+	24	3640	c.3572A>G	c.(3571-3573)gAc>gGc	p.D1191G	ARHGAP23_ENST00000437668.3_3'UTR|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.D1097G	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1191					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						AGCACCGACGACGACTCGGAG	0.751																																					p.D1191G		Atlas-SNP	.											.	ARHGAP23	48	.	0			c.A3572G						.						4.0	5.0	5.0					17																	36666304		628	1471	2099	SO:0001583	missense	57636	exon24			CCGACGACGACTC	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3572A>G	chr17.hg19:g.36666304A>G	ENSP00000393539:p.Asp1191Gly	32.0	0.0		24.0	5.0	NM_001199417		Missense_Mutation	SNP	ENST00000431231.2	hg19	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.287573	0.59976	.	.	ENSG00000225485	ENST00000431231;ENST00000443378	T;T	0.19394	2.17;2.15	3.53	3.53	0.40419	.	.	.	.	.	T	0.34745	0.0908	L	0.50333	1.59	0.35390	D	0.79071	D	0.67145	0.996	P	0.61722	0.893	T	0.48091	-0.9065	9	0.72032	D	0.01	.	11.04	0.47825	1.0:0.0:0.0:0.0	.	1191	Q9P227	RHG23_HUMAN	G	1191;1097	ENSP00000393539:D1191G;ENSP00000407333:D1097G	ENSP00000393539:D1191G	D	+	2	0	ARHGAP23	33919830	1.000000	0.71417	0.999000	0.59377	0.783000	0.44284	5.577000	0.67444	1.241000	0.43820	0.260000	0.18958	GAC	.	.		0.751	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
G6PC	2538	hgsc.bcm.edu	37	17	41063257	41063257	+	Silent	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr17:41063257C>G	ENST00000253801.2	+	5	967	c.888C>G	c.(886-888)ctC>ctG	p.L296L	G6PC_ENST00000592383.1_3'UTR|G6PC_ENST00000585489.1_3'UTR	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	296					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CATTCCGCCTCAGCTCTATTG	0.567																																					p.L296L		Atlas-SNP	.											.	G6PC	48	.	0			c.C888G						.						124.0	117.0	119.0					17																	41063257		2203	4300	6503	SO:0001819	synonymous_variant	2538	exon5			CCGCCTCAGCTCT	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.888C>G	chr17.hg19:g.41063257C>G		140.0	0.0		104.0	30.0	NM_000151	A1L4C0|B4E1C3|K7EL82	Silent	SNP	ENST00000253801.2	hg19	CCDS11446.1																																																																																			.	.		0.567	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151	
MRC2	9902	hgsc.bcm.edu	37	17	60742244	60742244	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr17:60742244C>T	ENST00000303375.5	+	2	856	c.454C>T	c.(454-456)Cag>Tag	p.Q152*		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	152	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GCGTGGTGACCAGACCCGCAG	0.652																																					p.Q152X		Atlas-SNP	.											.	MRC2	126	.	0			c.C454T						.						52.0	52.0	52.0					17																	60742244		2203	4300	6503	SO:0001587	stop_gained	9902	exon2			GGTGACCAGACCC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.454C>T	chr17.hg19:g.60742244C>T	ENSP00000307513:p.Gln152*	86.0	0.0		59.0	22.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Nonsense_Mutation	SNP	ENST00000303375.5	hg19	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	40	8.139523	0.98672	.	.	ENSG00000011028	ENST00000303375	.	.	.	5.23	5.23	0.72850	.	0.414724	0.25881	N	0.027682	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-15.947	18.8087	0.92048	0.0:1.0:0.0:0.0	.	.	.	.	X	152	.	ENSP00000307513:Q152X	Q	+	1	0	MRC2	58095976	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.718000	0.54919	2.450000	0.82876	0.561000	0.74099	CAG	.	.		0.652	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
OSBPL1A	114876	hgsc.bcm.edu	37	18	21948322	21948322	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr18:21948322T>C	ENST00000319481.3	-	3	342	c.136A>G	c.(136-138)Aac>Gac	p.N46D	RP11-621L6.2_ENST00000579347.1_RNA|OSBPL1A_ENST00000582618.1_5'UTR|OSBPL1A_ENST00000399441.4_Missense_Mutation_p.N46D	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	46	Interaction with RAB7A.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CAGCCCAAGTTAGACTTACTT	0.343																																					p.N46D		Atlas-SNP	.											.	OSBPL1A	94	.	0			c.A136G						.						95.0	92.0	93.0					18																	21948322		2203	4300	6503	SO:0001583	missense	114876	exon3			CCAAGTTAGACTT	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.136A>G	chr18.hg19:g.21948322T>C	ENSP00000320291:p.Asn46Asp	476.0	0.0		426.0	151.0	NM_080597	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	hg19	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.214442	0.79352	.	.	ENSG00000141447	ENST00000319481;ENST00000399441	T;T	0.57595	0.63;0.39	4.42	4.42	0.53409	Ankyrin repeat-containing domain (3);	0.000000	0.85682	U	0.000000	T	0.49372	0.1553	N	0.05031	-0.125	0.53688	D	0.999975	D	0.69078	0.997	D	0.79108	0.992	T	0.52837	-0.8522	10	0.30078	T	0.28	-26.6142	12.924	0.58249	0.0:0.0:0.0:1.0	.	46	Q9BXW6	OSBL1_HUMAN	D	46	ENSP00000320291:N46D;ENSP00000382370:N46D	ENSP00000320291:N46D	N	-	1	0	OSBPL1A	20202320	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.440000	0.73435	1.757000	0.51966	0.482000	0.46254	AAC	.	.		0.343	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
C19orf26	255057	hgsc.bcm.edu	37	19	1231033	1231033	+	Intron	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:1231033A>G	ENST00000382477.2	-	9	1489				C19orf26_ENST00000590083.1_Silent_p.P407P|C19orf26_ENST00000215376.6_Silent_p.P401P			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGCCGCCTAGGGGGGGGCG	0.706										HNSCC(14;0.022)																											p.P407P		Atlas-SNP	.											.,1	C19orf26	31	.	0			c.T1221C						.						11.0	15.0	13.0					19																	1231033		2160	4235	6395	SO:0001627	intron_variant	255057	exon9			CCGCCTAGGGGGG	BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.1214+66T>C	chr19.hg19:g.1231033A>G		103.0	1.0		59.0	28.0	NM_152769	O43385	Silent	SNP	ENST00000382477.2	hg19																																																																																				.	.		0.706	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_152769	
CNN1	1264	hgsc.bcm.edu	37	19	11660435	11660435	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:11660435C>T	ENST00000252456.2	+	7	930	c.719C>T	c.(718-720)aCg>aTg	p.T240M	CNN1_ENST00000544952.1_Missense_Mutation_p.T220M|CNN1_ENST00000535659.2_Missense_Mutation_p.T190M|CNN1_ENST00000592923.1_Missense_Mutation_p.T190M	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	240					actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						CACTGCGACACGCTCAATGTC	0.657																																					p.T240M		Atlas-SNP	.											.	CNN1	34	.	0			c.C719T						.						45.0	44.0	44.0					19																	11660435		2203	4300	6503	SO:0001583	missense	1264	exon7			GCGACACGCTCAA	U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.719C>T	chr19.hg19:g.11660435C>T	ENSP00000252456:p.Thr240Met	134.0	0.0		103.0	35.0	NM_001299	B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Missense_Mutation	SNP	ENST00000252456.2	hg19	CCDS12263.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961669	0.34659	.	.	ENSG00000130176	ENST00000252456;ENST00000535659;ENST00000544952	T;T;T	0.31247	1.5;1.5;1.5	4.78	0.18	0.15068	.	0.238555	0.40908	N	0.000991	T	0.22513	0.0543	L	0.47716	1.5	0.32339	N	0.559965	B	0.15930	0.015	B	0.08055	0.003	T	0.10200	-1.0640	10	0.72032	D	0.01	-20.5818	6.2798	0.21001	0.0:0.6384:0.1339:0.2277	.	240	P51911	CNN1_HUMAN	M	240;190;220	ENSP00000252456:T240M;ENSP00000442031:T190M;ENSP00000437470:T220M	ENSP00000252456:T240M	T	+	2	0	CNN1	11521435	0.001000	0.12720	0.314000	0.25224	0.986000	0.74619	-0.056000	0.11787	-0.008000	0.14320	0.542000	0.68232	ACG	.	.		0.657	CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458854.1	NM_001299	
RYR1	6261	hgsc.bcm.edu	37	19	39055621	39055621	+	Missense_Mutation	SNP	T	T	A	rs118192165|rs118192128		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:39055621T>A	ENST00000359596.3	+	91	12647	c.12647T>A	c.(12646-12648)tTc>tAc	p.F4216Y	RYR1_ENST00000355481.4_Missense_Mutation_p.F4211Y|RYR1_ENST00000360985.3_Missense_Mutation_p.F4211Y			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4216			Missing (in CCD).		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AAGCGCCAGTTCATCTTCGAC	0.632																																					p.F4216Y		Atlas-SNP	.											.	RYR1	708	.	0			c.T12647A						.						28.0	22.0	24.0					19																	39055621		2200	4296	6496	SO:0001583	missense	6261	exon91			GCCAGTTCATCTT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12647T>A	chr19.hg19:g.39055621T>A	ENSP00000352608:p.Phe4216Tyr	984.0	0.0		706.0	277.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812665	0.50527	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98150	-4.75;-4.75;-4.75	3.07	3.07	0.35406	.	0.000000	0.64402	U	0.000001	D	0.98435	0.9479	M	0.85777	2.775	0.48571	D	0.999676	D;D;D	0.61080	0.989;0.989;0.981	D;D;D	0.70487	0.953;0.969;0.931	D	0.98626	1.0669	10	0.62326	D	0.03	.	11.4175	0.49960	0.0:0.0:0.0:1.0	.	4211;4211;4216	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	Y	4216;4211;4211	ENSP00000352608:F4216Y;ENSP00000347667:F4211Y;ENSP00000354254:F4211Y	ENSP00000347667:F4211Y	F	+	2	0	RYR1	43747461	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.741000	0.84997	1.424000	0.47217	0.414000	0.27820	TTC	.	.		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PSG8	440533	hgsc.bcm.edu	37	19	43268178	43268178	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:43268178A>G	ENST00000306511.4	-	2	417	c.320T>C	c.(319-321)cTg>cCg	p.L107P	PSG8_ENST00000406636.3_Intron|PSG8_ENST00000401467.2_Missense_Mutation_p.L107P|PSG8_ENST00000404209.4_Missense_Mutation_p.L107P	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	107	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				CTGGATCAGCAGGGATGCATT	0.423																																					p.L107P		Atlas-SNP	.											.	PSG8	101	.	0			c.T320C						.						378.0	381.0	380.0					19																	43268178		2203	4299	6502	SO:0001583	missense	440533	exon2			ATCAGCAGGGATG	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.320T>C	chr19.hg19:g.43268178A>G	ENSP00000305005:p.Leu107Pro	113.0	0.0		69.0	23.0	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	hg19	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	a	12.24	1.879831	0.33162	.	.	ENSG00000124467	ENST00000404209;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T	0.09723	2.95;2.95;2.95	1.35	1.35	0.21983	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42787	0.1218	H	0.97940	4.11	0.26424	N	0.976049	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	T	0.23261	-1.0193	9	0.87932	D	0	.	4.8841	0.13694	1.0:0.0:0.0:0.0	.	107;107;107;107;107	B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.;.	P	107	ENSP00000385869:L107P;ENSP00000386090:L107P;ENSP00000305005:L107P	ENSP00000305005:L107P	L	-	2	0	PSG8	47960018	0.705000	0.27846	0.189000	0.23252	0.141000	0.21300	2.096000	0.41738	0.879000	0.35944	0.155000	0.16302	CTG	.	.		0.423	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
ZNF45	7596	hgsc.bcm.edu	37	19	44419099	44419099	+	Silent	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:44419099G>A	ENST00000269973.5	-	10	1579	c.489C>T	c.(487-489)ccC>ccT	p.P163P	ZNF45_ENST00000589703.1_Silent_p.P163P|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	163					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CTCCTTTGTAGGGTTTTTCAC	0.413																																					p.P163P		Atlas-SNP	.											.	ZNF45	51	.	0			c.C489T						.						132.0	127.0	128.0					19																	44419099		2203	4300	6503	SO:0001819	synonymous_variant	7596	exon10			TTTGTAGGGTTTT	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.489C>T	chr19.hg19:g.44419099G>A		71.0	0.0		76.0	28.0	NM_003425	P17016|P78472|Q9P1U9	Silent	SNP	ENST00000269973.5	hg19	CCDS12632.1																																																																																			.	.		0.413	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425	
EHD2	30846	hgsc.bcm.edu	37	19	48221838	48221838	+	Silent	SNP	G	G	A	rs369297316		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:48221838G>A	ENST00000263277.3	+	3	728	c.477G>A	c.(475-477)tcG>tcA	p.S159S	CTD-2571L23.8_ENST00000599924.1_lincRNA|EHD2_ENST00000538399.1_Silent_p.S23S	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	159	Dynamin-type G.				blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		GTATCCTGTCGGGTGCCAAGC	0.657																																					p.S159S		Atlas-SNP	.											.	EHD2	59	.	0			c.G477A						.						47.0	37.0	40.0					19																	48221838		2197	4293	6490	SO:0001819	synonymous_variant	30846	exon3			CCTGTCGGGTGCC	AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.477G>A	chr19.hg19:g.48221838G>A		56.0	0.0		55.0	21.0	NM_014601	B2RDH9|B4DNU6|Q96CB6	Silent	SNP	ENST00000263277.3	hg19	CCDS12704.1																																																																																			.	.		0.657	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465851.1		
POLD1	5424	hgsc.bcm.edu	37	19	50902183	50902183	+	Silent	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:50902183T>C	ENST00000440232.2	+	2	128	c.75T>C	c.(73-75)gaT>gaC	p.D25D	RN7SL324P_ENST00000577945.1_RNA|POLD1_ENST00000599857.1_Silent_p.D25D|POLD1_ENST00000595904.1_Silent_p.D25D	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	25					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		TCTGGGATGATGATGATGCAC	0.662								DNA polymerases (catalytic subunits)																													p.D25D		Atlas-SNP	.											.	POLD1	174	.	0			c.T75C						.						40.0	30.0	33.0					19																	50902183		2201	4299	6500	SO:0001819	synonymous_variant	5424	exon2			GGATGATGATGAT		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.75T>C	chr19.hg19:g.50902183T>C		117.0	0.0		78.0	20.0	NM_002691	Q8NER3|Q96H98	Silent	SNP	ENST00000440232.2	hg19	CCDS12795.1																																																																																			.	.		0.662	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1		
ZNF841	284371	hgsc.bcm.edu	37	19	52569046	52569046	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:52569046C>A	ENST00000426391.2	-	5	2292	c.1741G>T	c.(1741-1743)Gca>Tca	p.A581S	ZNF841_ENST00000594295.1_Missense_Mutation_p.A697S|ZNF841_ENST00000389534.4_Missense_Mutation_p.A697S|ZNF432_ENST00000598446.1_Intron|CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000359973.2_Intron			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						TGATATCTTGCAAGTTTTGAA	0.393																																					p.A697S		Atlas-SNP	.											.	ZNF841	183	.	0			c.G2089T						.						93.0	80.0	84.0					19																	52569046		692	1591	2283	SO:0001583	missense	284371	exon7			ATCTTGCAAGTTT	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.1741G>T	chr19.hg19:g.52569046C>A	ENSP00000415453:p.Ala581Ser	139.0	0.0		125.0	6.0	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	ENST00000426391.2	hg19		.	.	.	.	.	.	.	.	.	.	C	10.40	1.339452	0.24339	.	.	ENSG00000197608	ENST00000389534;ENST00000426391	T;T	0.15017	2.46;2.46	2.14	-0.208	0.13185	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07279	0.0184	N	0.20328	0.56	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.41627	-0.9498	9	0.07175	T	0.84	.	2.7349	0.05237	0.1995:0.2884:0.0:0.5121	.	697;581	Q6ZN19-3;Q6ZN19	.;ZN841_HUMAN	S	697;581	ENSP00000374185:A697S;ENSP00000415453:A581S	ENSP00000374185:A697S	A	-	1	0	ZNF841	57260858	0.000000	0.05858	0.000000	0.03702	0.130000	0.20726	-4.245000	0.00267	-0.277000	0.09193	0.313000	0.20887	GCA	.	.		0.393	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
EPS8L1	54869	hgsc.bcm.edu	37	19	55592156	55592156	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr19:55592156A>T	ENST00000201647.6	+	7	502	c.446A>T	c.(445-447)gAg>gTg	p.E149V	EPS8L1_ENST00000588359.1_Intron|EPS8L1_ENST00000540810.1_Missense_Mutation_p.E85V|EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000586329.1_Missense_Mutation_p.E131V|EPS8L1_ENST00000245618.5_Missense_Mutation_p.E22V	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	149					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CTGATCCGAGAGGACATCCAG	0.677																																					p.E149V	Ovarian(149;255 1863 3636 27051 29647)	Atlas-SNP	.											.	EPS8L1	122	.	0			c.A446T						.						18.0	24.0	22.0					19																	55592156		2193	4297	6490	SO:0001583	missense	54869	exon7			TCCGAGAGGACAT	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.446A>T	chr19.hg19:g.55592156A>T	ENSP00000201647:p.Glu149Val	210.0	0.0		179.0	73.0	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	ENST00000201647.6	hg19	CCDS12914.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.031882	0.75504	.	.	ENSG00000131037	ENST00000310075;ENST00000201647;ENST00000540810;ENST00000245618	T;T;T	0.32753	1.44;1.44;3.2	3.91	3.91	0.45181	Tensin phosphotyrosine-binding domain (1);	0.385142	0.24901	N	0.034699	T	0.43255	0.1239	L	0.50333	1.59	0.80722	D	1	B;D;B;B	0.64830	0.261;0.994;0.22;0.091	B;P;B;B	0.62014	0.078;0.897;0.07;0.043	T	0.34925	-0.9809	10	0.66056	D	0.02	-25.1616	9.4431	0.38681	1.0:0.0:0.0:0.0	.	85;131;22;149	B4DKV7;Q8TE68-3;Q8TE68-2;Q8TE68	.;.;.;ES8L1_HUMAN	V	131;149;85;22	ENSP00000201647:E149V;ENSP00000437541:E85V;ENSP00000245618:E22V	ENSP00000201647:E149V	E	+	2	0	EPS8L1	60283968	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.915000	0.39976	1.542000	0.49330	0.402000	0.26972	GAG	.	.		0.677	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
WISP2	8839	hgsc.bcm.edu	37	20	43353453	43353453	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr20:43353453A>T	ENST00000372868.2	+	4	695	c.352A>T	c.(352-354)Agc>Tgc	p.S118C	RP11-445H22.4_ENST00000445420.1_RNA|WISP2_ENST00000372865.4_Intron|WISP2_ENST00000190983.4_Missense_Mutation_p.S118C|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000471629.1_3'UTR			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	118	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GCCCCACTGCAGCATCCGCTG	0.682																																					p.S118C		Atlas-SNP	.											.	WISP2	28	.	0			c.A352T						.						30.0	24.0	26.0					20																	43353453		2198	4296	6494	SO:0001583	missense	8839	exon3			CACTGCAGCATCC	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.352A>T	chr20.hg19:g.43353453A>T	ENSP00000361959:p.Ser118Cys	155.0	0.0		150.0	37.0	NM_003881	B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	ENST00000372868.2	hg19	CCDS13336.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.956816	0.53293	.	.	ENSG00000064205	ENST00000372868;ENST00000190983	T;T	0.72615	-0.67;-0.67	4.66	2.27	0.28462	von Willebrand factor, type C (4);	0.388539	0.30723	N	0.009010	T	0.52901	0.1763	N	0.01705	-0.755	0.27939	N	0.937592	D	0.63046	0.992	P	0.52758	0.708	T	0.56798	-0.7919	10	0.54805	T	0.06	-13.8678	11.1912	0.48685	0.7064:0.2936:0.0:0.0	.	118	O76076	WISP2_HUMAN	C	118	ENSP00000361959:S118C;ENSP00000190983:S118C	ENSP00000190983:S118C	S	+	1	0	WISP2	42786867	0.998000	0.40836	0.803000	0.32268	0.312000	0.27988	0.974000	0.29436	0.141000	0.18875	0.374000	0.22700	AGC	.	.		0.682	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
BAGE2	85319	hgsc.bcm.edu	37	21	11058299	11058299	+	RNA	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr21:11058299C>G	ENST00000470054.1	-	0	348							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATAGTGGCTCCAAAGTGCTTA	0.398																																					p.L47F		Atlas-SNP	.											.	.	.	.	0			c.G141C						.						139.0	103.0	114.0					21																	11058299		692	1591	2283			85318	exon3			TGGCTCCAAAGTG	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		chr21.hg19:g.11058299C>G		346.0	0.0		225.0	12.0	NM_182481	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	hg19																																																																																				.	.		0.398	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
GRIK1	2897	hgsc.bcm.edu	37	21	31062249	31062249	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr21:31062249A>T	ENST00000399907.1	-	3	754	c.343T>A	c.(343-345)Tcc>Acc	p.S115T	GRIK1_ENST00000399913.1_Missense_Mutation_p.S115T|GRIK1_ENST00000389125.3_Missense_Mutation_p.S115T|GRIK1_ENST00000535441.1_Missense_Mutation_p.S115T|GRIK1_ENST00000399909.1_Missense_Mutation_p.S115T|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000399914.1_Missense_Mutation_p.S115T|GRIK1_ENST00000389124.2_Missense_Mutation_p.S115T|GRIK1_ENST00000309434.7_Missense_Mutation_p.S115T|GRIK1_ENST00000327783.4_Missense_Mutation_p.S115T	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	115					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	GCACTGACGGAGGAGCTATGG	0.542																																					p.S115T		Atlas-SNP	.											.	GRIK1	293	.	0			c.T343A						.						86.0	80.0	82.0					21																	31062249		2203	4300	6503	SO:0001583	missense	2897	exon3			TGACGGAGGAGCT		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.343T>A	chr21.hg19:g.31062249A>T	ENSP00000382791:p.Ser115Thr	130.0	0.0		93.0	43.0	NM_175611	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	hg19	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	A	12.66	2.005892	0.35415	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	D;D;D;D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.17	5.17	0.71159	Extracellular ligand-binding receptor (1);	0.058916	0.64402	D	0.000001	T	0.77731	0.4174	N	0.25144	0.715	0.80722	D	1	B;P;P;P;P	0.37441	0.413;0.595;0.595;0.595;0.54	B;B;B;B;B	0.40901	0.343;0.343;0.343;0.343;0.232	T	0.74665	-0.3589	10	0.15499	T	0.54	.	14.8479	0.70272	1.0:0.0:0.0:0.0	.	115;115;115;115;115	E7EPY9;E9PD61;B7Z3V7;P39086;P39086-2	.;.;.;GRIK1_HUMAN;.	T	115;115;115;115;115;59;115;115;115;115	ENSP00000327687:S115T;ENSP00000373777:S115T;ENSP00000382797:S115T;ENSP00000382798:S115T;ENSP00000446326:S115T;ENSP00000373776:S115T;ENSP00000382791:S115T;ENSP00000382793:S115T;ENSP00000311646:S115T	ENSP00000311646:S115T	S	-	1	0	GRIK1	29984120	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	8.660000	0.91121	2.158000	0.67659	0.533000	0.62120	TCC	.	.		0.542	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
DOPEY2	9980	hgsc.bcm.edu	37	21	37617730	37617730	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr21:37617730G>A	ENST00000399151.3	+	19	3537	c.3452G>A	c.(3451-3453)gGg>gAg	p.G1151E		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1151					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						ATCCCCATGGGGGGCAGGGCG	0.642																																					p.G1151E		Atlas-SNP	.											.	DOPEY2	184	.	0			c.G3452A						.						73.0	60.0	65.0					21																	37617730		2203	4300	6503	SO:0001583	missense	9980	exon19			CCATGGGGGGCAG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3452G>A	chr21.hg19:g.37617730G>A	ENSP00000382104:p.Gly1151Glu	80.0	0.0		70.0	25.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	hg19	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	G	0.064	-1.216088	0.01542	.	.	ENSG00000142197	ENST00000399151	T	0.26223	1.75	4.53	-2.48	0.06423	.	0.665291	0.15603	N	0.253787	T	0.13200	0.0320	L	0.46157	1.445	0.09310	N	1	B;P	0.43477	0.328;0.808	B;B	0.37267	0.079;0.245	T	0.37911	-0.9685	10	0.02654	T	1	.	6.6582	0.22998	0.1074:0.6127:0.1453:0.1346	.	1151;1151	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	E	1151	ENSP00000382104:G1151E	ENSP00000382104:G1151E	G	+	2	0	DOPEY2	36539600	0.001000	0.12720	0.000000	0.03702	0.186000	0.23388	-0.034000	0.12225	-0.329000	0.08527	0.650000	0.86243	GGG	.	.		0.642	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
PRMT2	3275	hgsc.bcm.edu	37	21	48064248	48064248	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr21:48064248A>T	ENST00000397637.1	+	4	1129	c.175A>T	c.(175-177)Atc>Ttc	p.I59F	PRMT2_ENST00000458387.2_Missense_Mutation_p.I59F|PRMT2_ENST00000355680.3_Missense_Mutation_p.I59F|PRMT2_ENST00000334494.4_Missense_Mutation_p.I59F|PRMT2_ENST00000397638.2_Missense_Mutation_p.I59F|PRMT2_ENST00000291705.6_Missense_Mutation_p.I59F|PRMT2_ENST00000397628.1_Missense_Mutation_p.I59F|PRMT2_ENST00000440086.1_Missense_Mutation_p.I59F|PRMT2_ENST00000451211.2_Missense_Mutation_p.I59F			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	59	Interaction with ESR1.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		AAAAATTCTTATCCTGAGACA	0.433																																					p.I59F		Atlas-SNP	.											.	PRMT2	48	.	0			c.A175T						.						60.0	64.0	63.0					21																	48064248		2203	4300	6503	SO:0001583	missense	3275	exon4			ATTCTTATCCTGA	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.175A>T	chr21.hg19:g.48064248A>T	ENSP00000380759:p.Ile59Phe	105.0	0.0		78.0	33.0	NM_001242864	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	ENST00000397637.1	hg19	CCDS13737.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.201670	0.58234	.	.	ENSG00000160310	ENST00000355680;ENST00000397638;ENST00000458387;ENST00000451211;ENST00000291705;ENST00000397637;ENST00000334494;ENST00000397628;ENST00000440086	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.4	0.326	0.15908	Src homology-3 domain (5);	0.246452	0.41097	D	0.000954	T	0.60143	0.2246	M	0.78916	2.43	0.39738	D	0.971718	B;D;B;D;P	0.67145	0.04;0.996;0.4;0.987;0.555	B;D;B;D;B	0.72982	0.034;0.919;0.113;0.979;0.178	T	0.57207	-0.7851	10	0.39692	T	0.17	-12.5495	5.5589	0.17131	0.5308:0.1432:0.3261:0.0	.	59;59;59;59;59	B7U632;B7U630;B7U631;Q498Y5;P55345	.;.;.;.;ANM2_HUMAN	F	59	ENSP00000347906:I59F;ENSP00000380760:I59F;ENSP00000407463:I59F;ENSP00000411984:I59F;ENSP00000291705:I59F;ENSP00000380759:I59F;ENSP00000335490:I59F;ENSP00000380752:I59F;ENSP00000397266:I59F	ENSP00000291705:I59F	I	+	1	0	PRMT2	46888676	0.836000	0.29430	0.962000	0.40283	0.998000	0.95712	0.956000	0.29202	0.114000	0.18032	0.482000	0.46254	ATC	.	.		0.433	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535	
NCF4	4689	hgsc.bcm.edu	37	22	37271978	37271978	+	Intron	SNP	C	C	T			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr22:37271978C>T	ENST00000248899.6	+	9	942				NCF4_ENST00000397147.4_Missense_Mutation_p.P304L	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	CATCAACGTCCAGGGTGGCCT	0.612																																					p.P304L		Atlas-SNP	.											.	NCF4	66	.	0			c.C911T						.						59.0	52.0	55.0					22																	37271978		2203	4300	6503	SO:0001627	intron_variant	4689	exon8			AACGTCCAGGGTG	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.759-93C>T	chr22.hg19:g.37271978C>T		178.0	0.0		112.0	35.0	NM_013416	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	ENST00000248899.6	hg19	CCDS13934.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320697	0.41096	.	.	ENSG00000100365	ENST00000397147	T	0.58652	0.32	2.95	1.91	0.25777	.	3.522020	0.01253	N	0.008929	T	0.42471	0.1204	.	.	.	0.09310	N	1	P	0.36065	0.535	B	0.31614	0.133	T	0.33266	-0.9875	8	.	.	.	1.9134	6.7144	0.23294	0.0:0.8552:0.0:0.1448	.	304	A8K4F9	.	L	304	ENSP00000380334:P304L	.	P	+	2	0	NCF4	35601924	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	1.185000	0.32065	0.551000	0.29008	-0.126000	0.14955	CCA	.	.		0.612	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631	
HDX	139324	hgsc.bcm.edu	37	X	83588776	83588777	+	Nonsense_Mutation	DNP	CA	CA	TC			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrX:83588776_83588777CA>TC	ENST00000297977.5	-	8	1925_1926	c.1814_1815TG>GA	c.(1813-1815)tTG>tGA	p.L605*	HDX_ENST00000373177.2_Nonsense_Mutation_p.L605*|HDX_ENST00000506585.2_Nonsense_Mutation_p.L547*	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	605						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CCTTATAATCCAAGAAAGAGTT	0.252																																					p.L605L|p.L605W	Pancreas(53;231 1169 36156 43751 51139)	Atlas-SNP	.											.	HDX	124	.	0			c.G1815A|c.T1814G						.																																			SO:0001587	stop_gained	139324	exon8			ATAATCCAAGAAA|TAATCCAAGAAAG	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1814_1815delinsTC	chrX.hg19:g.83588776_83588777delinsTC	ENSP00000297977:p.Leu605*	199.0	0.0		270.0|271.0	220.0|223.0	NM_144657	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent|Missense_Mutation	SNP	ENST00000297977.5	hg19	CCDS35342.1																																																																																			.	.		0.252	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
ARMCX2	9823	hgsc.bcm.edu	37	X	100911840	100911840	+	Silent	SNP	A	A	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrX:100911840A>G	ENST00000328766.5	-	5	1188	c.735T>C	c.(733-735)ccT>ccC	p.P245P	ARMCX2_ENST00000356824.4_Silent_p.P245P|ARMCX2_ENST00000330154.2_Silent_p.P245P|ARMCX2_ENST00000467416.1_5'Flank	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	245	Ala-rich.					integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						CCGCTGTTCTAGGGGAACCAG	0.612																																					p.P245P		Atlas-SNP	.											.	ARMCX2	75	.	0			c.T735C						.						46.0	45.0	45.0					X																	100911840		2203	4300	6503	SO:0001819	synonymous_variant	9823	exon5			TGTTCTAGGGGAA	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.735T>C	chrX.hg19:g.100911840A>G		52.0	0.0		75.0	4.0	NM_014782	O60267|Q5H9D9	Silent	SNP	ENST00000328766.5	hg19	CCDS14490.1																																																																																			.	.		0.612	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782	
AIFM1	9131	hgsc.bcm.edu	37	X	129265689	129265689	+	Missense_Mutation	SNP	T	T	C	rs369259253		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrX:129265689T>C	ENST00000287295.3	-	14	1764	c.1534A>G	c.(1534-1536)Act>Gct	p.T512A	AIFM1_ENST00000319908.3_Missense_Mutation_p.T508A|AIFM1_ENST00000460436.2_Missense_Mutation_p.T173A|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000440263.1_Missense_Mutation_p.T160A|AIFM1_ENST00000346424.2_Missense_Mutation_p.T225A	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	512					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	TCTTGTGCAGTTGCTTTTGCA	0.483													T|||	1	0.000264901	0.0	0.0	3775	,	,		15048	0.0		0.0	False		,,,				2504	0.001				p.T512A		Atlas-SNP	.											.	AIFM1	75	.	0			c.A1534G						.	T	ALA/THR,,ALA/THR,ALA/THR,ALA/THR	1,3834		0,1,1631,571	210.0	184.0	193.0		478,,1534,1522,673	4.6	1.0	X		193	0,6728		0,0,2428,1872	no	missense,utr-3,missense,missense,missense	AIFM1	NM_001130846.2,NM_001130847.3,NM_004208.3,NM_145812.2,NM_145813.2	58,,58,58,58	0,1,4059,2443	CC,CT,TT,T		0.0,0.0261,0.0095	benign,,benign,benign,benign	160/262,,512/614,508/610,225/327	129265689	1,10562	2203	4300	6503	SO:0001583	missense	9131	exon14			GTGCAGTTGCTTT	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1534A>G	chrX.hg19:g.129265689T>C	ENSP00000287295:p.Thr512Ala	94.0	0.0		115.0	97.0	NM_004208	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	hg19	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.979971	0.53827	2.61E-4	0.0	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000440263;ENST00000287295	T;T;D;T;T	0.83250	0.93;0.93;-1.7;0.94;-0.7	5.8	4.62	0.57501	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (1);	0.045678	0.85682	D	0.000000	T	0.80154	0.4571	M	0.64170	1.965	0.80722	D	1	B;B;B	0.13594	0.001;0.008;0.002	B;B;B	0.11329	0.004;0.006;0.002	T	0.74172	-0.3751	10	0.48119	T	0.1	-13.2794	11.4314	0.50043	0.1372:0.0:0.0:0.8628	.	225;508;512	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	A	173;225;508;160;512	ENSP00000431222:T173A;ENSP00000316320:T225A;ENSP00000315122:T508A;ENSP00000405879:T160A;ENSP00000287295:T512A	ENSP00000287295:T512A	T	-	1	0	AIFM1	129093370	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.760000	0.62235	0.787000	0.33731	0.486000	0.48141	ACT	.	.		0.483	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2		
ABCD1	215	hgsc.bcm.edu	37	X	153005587	153005587	+	Silent	SNP	C	C	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrX:153005587C>G	ENST00000218104.3	+	6	1929	c.1530C>G	c.(1528-1530)ggC>ggG	p.G510G	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	510	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCCCAATGGCTGCGGCAAGA	0.652																																					p.G510G		Atlas-SNP	.											.	ABCD1	59	.	0			c.C1530G						.						109.0	94.0	99.0					X																	153005587		2203	4300	6503	SO:0001819	synonymous_variant	215	exon6			CAATGGCTGCGGC	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1530C>G	chrX.hg19:g.153005587C>G		52.0	0.0		85.0	41.0	NM_000033	Q6GTZ2	Silent	SNP	ENST00000218104.3	hg19	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	C	6.282	0.420108	0.11928	.	.	ENSG00000101986	ENST00000443684	.	.	.	4.93	3.13	0.36017	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54221	-0.8326	4	.	.	.	-32.6616	8.6945	0.34287	0.0:0.8023:0.0:0.1977	.	.	.	.	G	178	.	.	A	+	2	0	ABCD1	152658781	0.996000	0.38824	1.000000	0.80357	0.616000	0.37450	0.494000	0.22467	1.074000	0.40909	0.429000	0.28392	GCT	.	.		0.652	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
MT-CO2	4513	hgsc.bcm.edu	37	M	7907	7907	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrM:7907T>C	ENST00000361739.1	+	1	322	c.322T>C	c.(322-324)Tac>Cac	p.Y108H	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	108					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						GGTACTGAACCTACGAGTACA	0.502																																					p.Y108H		Atlas-SNP	.											.	.	.	.	0			c.T322C						.																																			SO:0001583	missense	5743	exon1			TGAACCTACGAGT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.322T>C	chrM.hg19:g.7907T>C	ENSP00000354876:p.Tyr108His	18.0	0.0		117.0	19.0	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.		0.502	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
MT-ND4	4538	hgsc.bcm.edu	37	M	10827	10827	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrM:10827T>C	ENST00000361381.2	+	1	68	c.68T>C	c.(67-69)aTt>aCt	p.I23T	MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	23					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						AAAGCACATAATTTGAATCAA	0.373																																					p.I23T		Atlas-SNP	.											.	.	.	.	0			c.T68C						.																																			SO:0001583	missense	0	exon1			ACATAATTTGAAT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.68T>C	chrM.hg19:g.10827T>C	ENSP00000354961:p.Ile23Thr	12.0	0.0		119.0	15.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.373	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-CYB	4519	hgsc.bcm.edu	37	M	15431	15431	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chrM:15431G>A	ENST00000361789.2	+	1	685	c.685G>A	c.(685-687)Gcc>Acc	p.A229T	MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	229			A -> T (in dbSNP:rs2853509). {ECO:0000269|PubMed:11130070, ECO:0000269|PubMed:11553319, ECO:0000269|PubMed:7530363}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CAATCAAAGACGCCCTCGGCT	0.478											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.A229T		Atlas-SNP	.											.	.	.	.	0			c.G685A						.																																			SO:0001583	missense	0	exon1			AAAGACGCCCTCG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.685G>A	chrM.hg19:g.15431G>A	ENSP00000354554:p.Ala229Thr	14.0	0.0	585	108.0	102.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.478	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
TMEM81	388730	hgsc.bcm.edu	37	1	205052921	205052921	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr1:205052921delA	ENST00000367167.3	-	1	724	c.528delT	c.(526-528)tttfs	p.F176fs		NM_203376.1	NP_976310.1	Q6P7N7	TMM81_HUMAN	transmembrane protein 81	176						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCCTCAACCCAAAATAGAGCC	0.418																																					p.G177fs		Atlas-INDEL	.											.	TMEM81	23	.	0			c.529delG						.						78.0	80.0	79.0					1																	205052921		2203	4300	6503	SO:0001589	frameshift_variant	388730	exon1			.	BC061592	CCDS1450.1	1q32.1	2013-01-11			ENSG00000174529	ENSG00000174529		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32349	protein-coding gene	gene with protein product							Standard	NM_203376		Approved	UNQ2788, MGC75217, HC3107, KVLA2788	uc001hbt.3	Q6P7N7	OTTHUMG00000037103	ENST00000367167.3:c.528delT	chr1.hg19:g.205052921delA	ENSP00000356135:p.Phe176fs	148.0	0.0		253.0	104.0	NM_203376	Q6UVZ4	Frame_Shift_Del	DEL	ENST00000367167.3	hg19	CCDS1450.1																																																																																			.	.		0.418	TMEM81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090076.1	NM_203376	
APOB	338	hgsc.bcm.edu	37	2	21234820	21234821	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr2:21234820_21234821insG	ENST00000233242.1	-	26	5046_5047	c.4919_4920insC	c.(4918-4920)gctfs	p.A1640fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1640					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCGCCTTGTGAGCACCACTATT	0.45																																					p.A1640fs		Atlas-INDEL	.											.	APOB	761	.	0			c.4920_4921insC						.																																			SO:0001589	frameshift_variant	338	exon26			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4920dupC	chr2.hg19:g.21234821_21234821dupG	ENSP00000233242:p.Ala1640fs	56.0	0.0		62.0	26.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.450	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
DNM1L	10059	hgsc.bcm.edu	37	12	32883956	32883977	+	Frame_Shift_Del	DEL	GTGCTAGAATTTGTTATATTTT	GTGCTAGAATTTGTTATATTTT	-			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	GTGCTAGAATTTGTTATATTTT	GTGCTAGAATTTGTTATATTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:32883956_32883977delGTGCTAGAATTTGTTATATTTT	ENST00000549701.1	+	10	1162_1183	c.1088_1109delGTGCTAGAATTTGTTATATTTT	c.(1087-1110)ggtgctagaatttgttatattttcfs	p.GARICYIF363fs	DNM1L_ENST00000547312.1_Frame_Shift_Del_p.GARICYIF363fs|DNM1L_ENST00000414834.2_Frame_Shift_Del_p.GARICYIF160fs|DNM1L_ENST00000358214.5_Frame_Shift_Del_p.GARICYIF376fs|DNM1L_ENST00000266481.6_Frame_Shift_Del_p.GARICYIF363fs|DNM1L_ENST00000381000.4_Frame_Shift_Del_p.GARICYIF376fs|YARS2_ENST00000551673.1_Intron|DNM1L_ENST00000553257.1_Frame_Shift_Del_p.GARICYIF376fs|DNM1L_ENST00000452533.2_Frame_Shift_Del_p.GARICYIF363fs			O00429	DNM1L_HUMAN	dynamin 1-like	363	Middle domain.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AGATGCGGTGGTGCTAGAATTTGTTATATTTTCCATGAGACT	0.383																																					p.363_370del		Atlas-INDEL	.											.	DNM1L	52	.	0			c.1087_1108del						.																																			SO:0001589	frameshift_variant	10059	exon10			.	AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.1088_1109delGTGCTAGAATTTGTTATATTTT	chr12.hg19:g.32883956_32883977delGTGCTAGAATTTGTTATATTTT	ENSP00000450399:p.Gly363fs	120.0	0.0		87.0	13.0	NM_012062	A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Frame_Shift_Del	DEL	ENST00000549701.1	hg19	CCDS8729.1																																																																																			.	.		0.383	DNM1L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404124.1	NM_012062	
FREM2	341640	hgsc.bcm.edu	37	13	39265017	39265018	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr13:39265017_39265018insC	ENST00000280481.7	+	1	3752_3753	c.3536_3537insC	c.(3535-3540)ttccccfs	p.FP1179fs		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1179					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AGACAGTTCTTCCCCATTGTAA	0.416																																					p.F1179fs		Atlas-INDEL	.											.	FREM2	385	.	0			c.3536_3537insC						.																																			SO:0001589	frameshift_variant	341640	exon1			.	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3540dupC	chr13.hg19:g.39265021_39265021dupC	ENSP00000280481:p.Phe1179fs	142.0	0.0		101.0	40.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Frame_Shift_Ins	INS	ENST00000280481.7	hg19	CCDS31960.1																																																																																			.	.		0.416	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FAM71C	196472	hgsc.bcm.edu	37	12	100043076	100043076	+	Frame_Shift_Del	DEL	T	T	-	rs35488750		TCGA-DD-AAE9-01A-11D-A40R-10	TCGA-DD-AAE9-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	870e02bb-395f-439a-99fd-00d1054e69d9	864a2672-99b0-4252-9953-5feb85ff19d6	g.chr12:100043076delT	ENST00000324341.1	+	2	1048	c.626delT	c.(625-627)atgfs	p.M209fs	ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	209										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		GGATATGCCATGAAGTTTTGT	0.373																																					p.M209X		Atlas-INDEL	.											.	FAM71C	48	.	0			c.625delA						.						171.0	167.0	169.0					12																	100043076		2203	4300	6503	SO:0001589	frameshift_variant	196472	exon2			.		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.626delT	chr12.hg19:g.100043076delT	ENSP00000315247:p.Met209fs	93.0	0.0		65.0	19.0	NM_153364	B2R6Y6	Frame_Shift_Del	DEL	ENST00000324341.1	hg19	CCDS9072.1																																																																																			.	.		0.373	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
