#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AKR7A2	8574	hgsc.bcm.edu	37	1	19630807	19630807	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:19630807T>G	ENST00000235835.3	-	7	1013	c.992A>C	c.(991-993)gAg>gCg	p.E331A	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	331					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCCTTCCTCTGTTGCTGC	0.607																																					p.E331A		Atlas-SNP	.											.	AKR7A2	19	.	0			c.A992C						.						69.0	72.0	71.0					1																	19630807		2203	4300	6503	SO:0001583	missense	8574	exon7			CCTTCCTCTGTTG	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.992A>C	chr1.hg19:g.19630807T>G	ENSP00000235835:p.Glu331Ala	202.0	0.0		203.0	20.0	NM_003689	O75749|Q5TG63	Missense_Mutation	SNP	ENST00000235835.3	hg19	CCDS194.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.223387	0.39300	.	.	ENSG00000053371	ENST00000235835;ENST00000330072;ENST00000489286	T;T	0.04551	3.6;3.6	4.63	4.63	0.57726	NADP-dependent oxidoreductase domain (3);	0.119152	0.56097	D	0.000022	T	0.05227	0.0139	L	0.35341	1.055	0.40110	D	0.976475	B	0.11235	0.004	B	0.14578	0.011	T	0.31833	-0.9929	10	0.49607	T	0.09	.	12.3172	0.54964	0.0:0.0:0.0:1.0	.	331	O43488	ARK72_HUMAN	A	331;286;193	ENSP00000235835:E331A;ENSP00000339084:E286A	ENSP00000235835:E331A	E	-	2	0	AKR7A2	19503394	1.000000	0.71417	0.986000	0.45419	0.702000	0.40608	5.094000	0.64523	2.056000	0.61249	0.533000	0.62120	GAG	.	.		0.607	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
C1orf94	84970	hgsc.bcm.edu	37	1	34643459	34643459	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:34643459G>C	ENST00000488417.1	+	1	189	c.69G>C	c.(67-69)agG>agC	p.R23S	C1orf94_ENST00000373374.3_Intron|AC115286.1_ENST00000408126.1_RNA	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	23										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				AGAGGAGGAGGATGGCCAGCG	0.617																																					p.R23S		Atlas-SNP	.											.	C1orf94	156	.	0			c.G69C						.						25.0	28.0	27.0					1																	34643459		692	1591	2283	SO:0001583	missense	84970	exon1			GAGGAGGATGGCC	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.69G>C	chr1.hg19:g.34643459G>C	ENSP00000435634:p.Arg23Ser	49.0	0.0		80.0	29.0	NM_001134734	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000488417.1	hg19	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604682	0.28623	.	.	ENSG00000142698	ENST00000488417	T	0.47528	0.84	5.07	4.16	0.48862	.	.	.	.	.	T	0.40909	0.1136	L	0.44542	1.39	0.30511	N	0.7694	B	0.16396	0.017	B	0.12156	0.007	T	0.45249	-0.9274	9	0.62326	D	0.03	-3.9473	10.9488	0.47317	0.0:0.22:0.78:0.0	.	23	Q6P1W5	CA094_HUMAN	S	23	ENSP00000435634:R23S	ENSP00000435634:R23S	R	+	3	2	C1orf94	34416046	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.866000	0.56040	1.349000	0.45751	0.561000	0.74099	AGG	.	.		0.617	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	
STIL	6491	hgsc.bcm.edu	37	1	47717255	47717255	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:47717255C>T	ENST00000360380.3	-	18	3780	c.3417G>A	c.(3415-3417)gaG>gaA	p.E1139E	STIL_ENST00000396221.2_Silent_p.E1122E|STIL_ENST00000337817.5_Silent_p.E1139E|STIL_ENST00000371877.3_Silent_p.E1140E|STIL_ENST00000243182.6_Silent_p.E1139E	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	1139					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				CGGGAGGTTCCTCTTCATCTT	0.388																																					p.E1140E		Atlas-SNP	.											.	STIL	91	.	0			c.G3420A						.						168.0	168.0	168.0					1																	47717255		2203	4300	6503	SO:0001819	synonymous_variant	6491	exon17			AGGTTCCTCTTCA	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.3417G>A	chr1.hg19:g.47717255C>T		110.0	0.0		118.0	51.0	NM_001048166	Q5T0C5|Q68CN9	Silent	SNP	ENST00000360380.3	hg19	CCDS548.1																																																																																			.	.		0.388	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
VAV3	10451	hgsc.bcm.edu	37	1	108247593	108247593	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:108247593C>G	ENST00000370056.4	-	16	1867	c.1593G>C	c.(1591-1593)caG>caC	p.Q531H	VAV3_ENST00000527011.1_Missense_Mutation_p.Q531H|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000371846.4_Missense_Mutation_p.Q466H	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	531					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TCAGGAGCATCTGGCAGACTT	0.418																																					p.Q531H		Atlas-SNP	.											.	VAV3	176	.	0			c.G1593C						.						96.0	85.0	89.0					1																	108247593		2203	4300	6503	SO:0001583	missense	10451	exon16			GAGCATCTGGCAG	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1593G>C	chr1.hg19:g.108247593C>G	ENSP00000359073:p.Gln531His	91.0	0.0		103.0	51.0	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	hg19	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.69|12.69	2.013166|2.013166	0.35511|0.35511	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000529809;ENST00000490388	D;D;D|.	0.87650|.	-2.28;-2.28;-2.28|.	6.16|6.16	5.24|5.24	0.73138|0.73138	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);|.	0.055211|.	0.85682|.	D|.	0.000000|.	T|T	0.31295|0.31295	0.0792|0.0792	N|N	0.16098|0.16098	0.37|0.37	0.48632|0.48632	D|D	0.999682|0.999682	B;B;B;B|.	0.06786|.	0.0;0.0;0.001;0.001|.	B;B;B;B|.	0.10450|.	0.001;0.0;0.005;0.005|.	T|T	0.27739|0.27739	-1.0065|-1.0065	10|5	0.37606|.	T|.	0.19|.	.|.	13.7877|13.7877	0.63119|0.63119	0.0:0.8718:0.0:0.1282|0.0:0.8718:0.0:0.1282	.|.	531;531;466;531|.	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4|.	.;.;.;VAV3_HUMAN|.	H|T	531;531;466|83;526	ENSP00000359073:Q531H;ENSP00000432540:Q531H;ENSP00000360912:Q466H|.	ENSP00000359073:Q531H|.	Q|R	-|-	3|2	2|0	VAV3|VAV3	108049116|108049116	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.794000|1.794000	0.38774|0.38774	1.595000|1.595000	0.50050|0.50050	0.650000|0.650000	0.86243|0.86243	CAG|AGA	.	.		0.418	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
LRRN2	10446	hgsc.bcm.edu	37	1	204588798	204588798	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:204588798G>A	ENST00000367175.1	-	1	2535	c.323C>T	c.(322-324)gCc>gTc	p.A108V	LRRN2_ENST00000367177.3_Missense_Mutation_p.A108V|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Missense_Mutation_p.A108V			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	108					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ACAGTCTCGGGCATCCGAAAA	0.607																																					p.A108V		Atlas-SNP	.											.	LRRN2	81	.	0			c.C323T						.						104.0	103.0	103.0					1																	204588798		2203	4300	6503	SO:0001583	missense	10446	exon3			TCTCGGGCATCCG	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.323C>T	chr1.hg19:g.204588798G>A	ENSP00000356143:p.Ala108Val	164.0	0.0		286.0	79.0	NM_006338	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	hg19	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	G	0.820	-0.749002	0.03065	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.22336	1.96;1.96;1.96	5.67	5.67	0.87782	.	0.169234	0.27956	N	0.017166	T	0.07863	0.0197	N	0.03304	-0.355	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.37753	-0.9692	10	0.08381	T	0.77	.	7.8425	0.29406	0.195:0.0:0.805:0.0	.	108	O75325	LRRN2_HUMAN	V	108	ENSP00000356144:A108V;ENSP00000356145:A108V;ENSP00000356143:A108V	ENSP00000356143:A108V	A	-	2	0	LRRN2	202855421	0.245000	0.23899	0.644000	0.29465	0.745000	0.42441	3.593000	0.54001	2.684000	0.91462	0.650000	0.86243	GCC	.	.		0.607	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338	
MTR	4548	hgsc.bcm.edu	37	1	236973846	236973846	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:236973846G>T	ENST00000366577.5	+	5	847	c.453G>T	c.(451-453)aaG>aaT	p.K151N	MTR_ENST00000418145.2_Missense_Mutation_p.K207N|MTR_ENST00000535889.1_Missense_Mutation_p.K151N	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	151	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CGACTAATAAGACACTCTCTG	0.438																																					p.K151N		Atlas-SNP	.											.	MTR	127	.	0			c.G453T						.						139.0	148.0	145.0					1																	236973846		2203	4300	6503	SO:0001583	missense	4548	exon5			TAATAAGACACTC	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.453G>T	chr1.hg19:g.236973846G>T	ENSP00000355536:p.Lys151Asn	155.0	1.0		205.0	133.0	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	hg19	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069063	0.76301	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000418145;ENST00000535889	T;T;T	0.12361	2.69;2.69;2.69	5.95	5.04	0.67666	Homocysteine S-methyltransferase (4);	0.048709	0.85682	D	0.000000	T	0.42698	0.1214	M	0.91920	3.255	0.42328	D	0.992289	D;D;D	0.53619	0.961;0.961;0.961	P;P;P	0.62298	0.9;0.9;0.9	T	0.54437	-0.8294	10	0.87932	D	0	-24.5432	12.8382	0.57786	0.1344:0.0:0.8656:0.0	.	151;151;151	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	N	151;151;207;151	ENSP00000355536:K151N;ENSP00000402255:K207N;ENSP00000441845:K151N	ENSP00000355536:K151N	K	+	3	2	MTR	235040469	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.281000	0.43452	1.530000	0.49136	0.655000	0.94253	AAG	.	.		0.438	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
OR2G2	81470	hgsc.bcm.edu	37	1	247752346	247752346	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:247752346T>A	ENST00000320065.1	+	1	685	c.685T>A	c.(685-687)Ttg>Atg	p.L229M	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CCACGCAGTGTTGAGGATTAA	0.478																																					p.L229M		Atlas-SNP	.											.	OR2G2	88	.	0			c.T685A						.						155.0	147.0	150.0					1																	247752346		2203	4300	6503	SO:0001583	missense	81470	exon1			GCAGTGTTGAGGA	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.685T>A	chr1.hg19:g.247752346T>A	ENSP00000326349:p.Leu229Met	127.0	0.0		227.0	65.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	hg19	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	T	9.317	1.057110	0.19907	.	.	ENSG00000177489	ENST00000320065	T	0.00309	8.16	4.29	-6.15	0.02105	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29884	U	0.010954	T	0.00384	0.0012	M	0.68728	2.09	0.09310	N	1	P	0.51791	0.948	P	0.57057	0.812	T	0.02683	-1.1124	10	0.48119	T	0.1	.	16.7803	0.85562	0.0:0.7499:0.0:0.2501	.	229	Q8NGZ5	OR2G2_HUMAN	M	229	ENSP00000326349:L229M	ENSP00000326349:L229M	L	+	1	2	OR2G2	245818969	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.132000	0.01309	-1.267000	0.02443	-0.391000	0.06502	TTG	.	.		0.478	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
CAPN13	92291	hgsc.bcm.edu	37	2	30993238	30993238	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:30993238C>T	ENST00000295055.8	-	5	641	c.465G>A	c.(463-465)gtG>gtA	p.V155V	CAPN13_ENST00000534090.2_Silent_p.V155V|CAPN13_ENST00000465960.2_5'UTR	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	155	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					GGCGAGGACGCACAAAGAGGC	0.552																																					p.V155V		Atlas-SNP	.											.	CAPN13	70	.	0			c.G465A						.						186.0	195.0	192.0					2																	30993238		2135	4250	6385	SO:0001819	synonymous_variant	92291	exon5			AGGACGCACAAAG		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.465G>A	chr2.hg19:g.30993238C>T		109.0	0.0		135.0	49.0	NM_144575	Q17RF0|Q580X1|Q8TE80	Silent	SNP	ENST00000295055.8	hg19	CCDS46252.1																																																																																			.	.		0.552	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
EML6	400954	hgsc.bcm.edu	37	2	55056571	55056571	+	Silent	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:55056571A>G	ENST00000356458.6	+	6	1324	c.804A>G	c.(802-804)ccA>ccG	p.P268P		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	268						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						ATTTCAAACCAATAACCAAAA	0.408																																					p.P268P		Atlas-SNP	.											.	EML6	85	.	0			c.A804G						.						209.0	169.0	181.0					2																	55056571		692	1591	2283	SO:0001819	synonymous_variant	400954	exon6			CAAACCAATAACC		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.804A>G	chr2.hg19:g.55056571A>G		69.0	0.0		88.0	26.0	NM_001039753	A8MUB5|B6ZDG7	Silent	SNP	ENST00000356458.6	hg19	CCDS46286.1																																																																																			.	.		0.408	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
GMCL1	64395	hgsc.bcm.edu	37	2	70106092	70106092	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:70106092A>G	ENST00000282570.3	+	14	1755	c.1504A>G	c.(1504-1506)Atc>Gtc	p.I502V		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	502					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						CCCTTTATATATCTGCTGTAA	0.328																																					p.I502V		Atlas-SNP	.											.	GMCL1	50	.	0			c.A1504G						.						123.0	128.0	126.0					2																	70106092		2203	4300	6503	SO:0001583	missense	64395	exon14			TTATATATCTGCT	AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.1504A>G	chr2.hg19:g.70106092A>G	ENSP00000282570:p.Ile502Val	217.0	0.0		230.0	90.0	NM_178439	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	hg19	CCDS1895.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.325326	0.24080	.	.	ENSG00000087338	ENST00000282570	T	0.55413	0.52	4.77	4.77	0.60923	.	0.118444	0.64402	N	0.000018	T	0.26774	0.0655	N	0.04669	-0.19	0.42308	D	0.992204	B	0.19073	0.033	B	0.17098	0.017	T	0.15723	-1.0427	10	0.06757	T	0.87	-21.456	12.5551	0.56248	1.0:0.0:0.0:0.0	.	502	Q96IK5	GMCL1_HUMAN	V	502	ENSP00000282570:I502V	ENSP00000282570:I502V	I	+	1	0	GMCL1	69959596	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.279000	0.65597	2.117000	0.64856	0.455000	0.32223	ATC	.	.		0.328	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
ITGB6	3694	hgsc.bcm.edu	37	2	161052880	161052880	+	Missense_Mutation	SNP	G	G	A	rs369726068		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:161052880G>A	ENST00000283249.2	-	3	430	c.193C>T	c.(193-195)Ctt>Ttt	p.L65F	ITGB6_ENST00000428609.2_Missense_Mutation_p.L23F|ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409872.1_Missense_Mutation_p.L65F|ITGB6_ENST00000409967.2_Missense_Mutation_p.L65F	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	65					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TTAGCTAAAAGGTTTGCTGGG	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		19276	0.001		0.0	False		,,,				2504	0.0				p.L65F		Atlas-SNP	.											.	ITGB6	68	.	0			c.C193T						.						147.0	160.0	156.0					2																	161052880		2203	4300	6503	SO:0001583	missense	3694	exon3			CTAAAAGGTTTGC		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.193C>T	chr2.hg19:g.161052880G>A	ENSP00000283249:p.Leu65Phe	99.0	0.0		117.0	39.0	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	hg19	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875122	0.72180	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56	5.67	4.78	0.61160	Integrin beta subunit, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97539	0.9194	M	0.90309	3.105	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97804	1.0246	10	0.62326	D	0.03	.	14.8945	0.70633	0.0697:0.0:0.9303:0.0	.	23;65	E9PEE8;P18564	.;ITB6_HUMAN	F	65;23;65;65	ENSP00000283249:L65F;ENSP00000408024:L23F;ENSP00000386828:L65F;ENSP00000386367:L65F	ENSP00000283249:L65F	L	-	1	0	ITGB6	160761126	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	5.600000	0.67599	2.670000	0.90874	0.655000	0.94253	CTT	.	.		0.348	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
TTN	7273	hgsc.bcm.edu	37	2	179456870	179456870	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:179456870T>C	ENST00000591111.1	-	252	55062	c.54838A>G	c.(54838-54840)Agc>Ggc	p.S18280G	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S19921G|TTN_ENST00000342992.6_Missense_Mutation_p.S17353G|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S11048G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S10981G|TTN_ENST00000460472.2_Missense_Mutation_p.S10856G			Q8WZ42	TITIN_HUMAN	titin	18280	Fibronectin type-III 32. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTGGGCGCTGGCAACATCT	0.448																																					p.S19921G		Atlas-SNP	.											.	TTN	18412	.	0			c.A59761G						.						75.0	72.0	73.0					2																	179456870		1929	4158	6087	SO:0001583	missense	7273	exon302			GGGCGCTGGCAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.54838A>G	chr2.hg19:g.179456870T>C	ENSP00000465570:p.Ser18280Gly	87.0	0.0		97.0	37.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	8.776	0.927045	0.18056	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	6.03	4.88	0.63580	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45895	0.1365	L	0.52011	1.625	0.21220	N	0.999752	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.004;0.004;0.004	T	0.45041	-0.9288	9	0.87932	D	0	.	7.1235	0.25458	0.1603:0.0721:0.0:0.7677	.	10856;10981;11048;18280	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	17353;10856;11048;10981;10854	ENSP00000343764:S17353G;ENSP00000434586:S10856G;ENSP00000340554:S11048G;ENSP00000352154:S10981G	ENSP00000340554:S11048G	S	-	1	0	TTN	179165116	0.965000	0.33210	0.973000	0.42090	0.952000	0.60782	1.748000	0.38308	1.107000	0.41642	0.455000	0.32223	AGC	.	.		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NDUFS1	4719	hgsc.bcm.edu	37	2	206991519	206991519	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:206991519C>A	ENST00000233190.6	-	17	2200	c.1934G>T	c.(1933-1935)aGa>aTa	p.R645I	NDUFS1_ENST00000455934.2_Missense_Mutation_p.R659I|NDUFS1_ENST00000457011.1_Missense_Mutation_p.R529I|NDUFS1_ENST00000440274.1_Missense_Mutation_p.R609I|NDUFS1_ENST00000449699.1_Missense_Mutation_p.R645I|NDUFS1_ENST00000423725.1_Missense_Mutation_p.R588I|NDUFS1_ENST00000432169.1_Missense_Mutation_p.R534I	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	645					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTCTTCCAATCTGTTCCTTAC	0.383																																					p.R659I		Atlas-SNP	.											.	NDUFS1	82	.	0			c.G1976T						.						143.0	144.0	144.0					2																	206991519		2203	4300	6503	SO:0001583	missense	4719	exon17			TCCAATCTGTTCC		CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.1934G>T	chr2.hg19:g.206991519C>A	ENSP00000233190:p.Arg645Ile	164.0	0.0		177.0	68.0	NM_001199984	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	hg19	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	C	32	5.173952	0.94807	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.94574	0.8252	M	0.92691	3.335	0.80722	D	1	P;D;D;D	0.89917	0.913;1.0;1.0;1.0	P;D;D;D	0.97110	0.788;0.999;1.0;0.999	D	0.95170	0.8289	10	0.72032	D	0.01	-17.9482	19.7635	0.96333	0.0:1.0:0.0:0.0	.	534;609;659;645	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	I	645;588;529;609;659;645;534	ENSP00000233190:R645I;ENSP00000397760:R588I;ENSP00000400976:R529I;ENSP00000409766:R609I;ENSP00000392709:R659I;ENSP00000399912:R645I;ENSP00000409689:R534I	ENSP00000233190:R645I	R	-	2	0	NDUFS1	206699764	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.487000	0.81328	2.682000	0.91365	0.555000	0.69702	AGA	.	.		0.383	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
DAW1	164781	hgsc.bcm.edu	37	2	228767773	228767773	+	Missense_Mutation	SNP	C	C	A	rs145956341	byFrequency	TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:228767773C>A	ENST00000309931.2	+	7	679	c.596C>A	c.(595-597)aCa>aAa	p.T199K	DAW1_ENST00000373666.2_Missense_Mutation_p.T199K|DAW1_ENST00000545118.1_Missense_Mutation_p.T184K	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	199						cilium (GO:0005929)											AGTATGGACACAACAGCCAAA	0.358													C|||	21	0.00419329	0.0	0.0	5008	,	,		20239	0.001		0.0	False		,,,				2504	0.0204				p.T199K		Atlas-SNP	.											.	.	.	.	0			c.C596A						.						144.0	134.0	137.0					2																	228767773		2203	4300	6503	SO:0001583	missense	164781	exon7			TGGACACAACAGC		CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.596C>A	chr2.hg19:g.228767773C>A	ENSP00000311899:p.Thr199Lys	222.0	0.0		246.0	15.0	NM_178821	Q6ZRY1|Q8N776	Missense_Mutation	SNP	ENST00000309931.2	hg19	CCDS2470.1	.	.	.	.	.	.	.	.	.	.	C	9.969	1.224947	0.22457	.	.	ENSG00000123977	ENST00000373666;ENST00000309931;ENST00000545118	T;T;T	0.57273	0.41;1.7;1.7	4.54	2.68	0.31781	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.277673	0.34879	N	0.003605	T	0.21468	0.0517	N	0.00823	-1.155	0.41910	D	0.990467	B	0.30211	0.273	B	0.39068	0.289	T	0.29941	-0.9995	10	0.02654	T	1	.	9.8463	0.41028	0.158:0.6897:0.1522:0.0	.	199	Q8N136	WDR69_HUMAN	K	199;199;184	ENSP00000362770:T199K;ENSP00000311899:T199K;ENSP00000437887:T184K	ENSP00000311899:T199K	T	+	2	0	WDR69	228476017	1.000000	0.71417	0.900000	0.35374	0.823000	0.46562	5.010000	0.64004	0.337000	0.23665	0.306000	0.20318	ACA	.	.		0.358	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1	NM_178821	
ATP2B2	491	hgsc.bcm.edu	37	3	10384457	10384457	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:10384457T>C	ENST00000352432.4	-	18	2965	c.2896A>G	c.(2896-2898)Atc>Gtc	p.I966V	ATP2B2_ENST00000383800.4_Missense_Mutation_p.I921V|ATP2B2_ENST00000360273.2_Missense_Mutation_p.I966V|ATP2B2_ENST00000343816.4_Missense_Mutation_p.I952V|ATP2B2_ENST00000397077.1_Missense_Mutation_p.I921V			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	966					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						AGGGTGAAGATGAGGGCAAGC	0.612																																					p.I966V	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.A2896G						.						149.0	118.0	128.0					3																	10384457		2203	4300	6503	SO:0001583	missense	491	exon19			TGAAGATGAGGGC	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2896A>G	chr3.hg19:g.10384457T>C	ENSP00000324172:p.Ile966Val	66.0	0.0		62.0	29.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	hg19	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	t	15.63	2.891071	0.52014	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39;-2.39	4.0	4.0	0.46444	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	L	0.37850	1.14	0.80722	D	1	P;B;B	0.44090	0.826;0.002;0.003	P;B;B	0.57009	0.811;0.006;0.015	D	0.87201	0.2241	10	0.30078	T	0.28	-28.4506	13.1955	0.59736	0.0:0.0:0.0:1.0	.	901;933;966	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	V	966;921;921;966;952;901;155;822;966	ENSP00000324172:I966V;ENSP00000373311:I921V;ENSP00000380267:I921V;ENSP00000353414:I966V;ENSP00000344677:I952V;ENSP00000414854:I822V	ENSP00000342954:I966V	I	-	1	0	ATP2B2	10359457	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	6.016000	0.70798	1.575000	0.49775	0.255000	0.18592	ATC	.	.		0.612	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
KCNH8	131096	hgsc.bcm.edu	37	3	19554546	19554546	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:19554546G>T	ENST00000328405.2	+	13	2430	c.2164G>T	c.(2164-2166)Gag>Tag	p.E722*		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	722	Poly-Glu.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						gggggaggaagaggaggCAGT	0.507																																					p.E722X	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											.	KCNH8	189	.	0			c.G2164T						.						60.0	50.0	53.0					3																	19554546		2203	4300	6503	SO:0001587	stop_gained	131096	exon13			GAGGAAGAGGAGG	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2164G>T	chr3.hg19:g.19554546G>T	ENSP00000328813:p.Glu722*	167.0	0.0		240.0	96.0	NM_144633	B7Z2I7|Q59GQ6	Nonsense_Mutation	SNP	ENST00000328405.2	hg19	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	41	8.787511	0.98954	.	.	ENSG00000183960	ENST00000328405	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4503	0.87590	0.0:0.0:1.0:0.0	.	.	.	.	X	722	.	.	E	+	1	0	KCNH8	19529550	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	5.057000	0.64294	2.559000	0.86315	0.585000	0.79938	GAG	.	.		0.507	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
TCAIM	285343	hgsc.bcm.edu	37	3	44449133	44449133	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:44449133T>C	ENST00000342649.4	+	11	1877	c.1450T>C	c.(1450-1452)Tgt>Cgt	p.C484R	TCAIM_ENST00000417237.1_Missense_Mutation_p.C484R	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	484						mitochondrion (GO:0005739)											TGGAGACCTTTGTATTCCTTG	0.333																																					p.C484R		Atlas-SNP	.											.	.	.	.	0			c.T1450C						.						82.0	87.0	85.0					3																	44449133		2203	4300	6503	SO:0001583	missense	285343	exon11			GACCTTTGTATTC		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.1450T>C	chr3.hg19:g.44449133T>C	ENSP00000341539:p.Cys484Arg	248.0	0.0		268.0	96.0	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	hg19	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.850371	0.91277	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.53423	0.62;0.62	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.71517	0.3349	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75428	-0.3321	10	0.87932	D	0	.	16.6288	0.85011	0.0:0.0:0.0:1.0	.	484	Q8N3R3	CC023_HUMAN	R	484	ENSP00000402581:C484R;ENSP00000341539:C484R	ENSP00000341539:C484R	C	+	1	0	C3orf23	44424137	1.000000	0.71417	0.993000	0.49108	0.999000	0.98932	7.282000	0.78630	2.326000	0.78906	0.533000	0.62120	TGT	.	.		0.333	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
SETD2	29072	hgsc.bcm.edu	37	3	47084191	47084191	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:47084191C>A	ENST00000409792.3	-	17	7141		c.e17-1			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCATTTCAGACTACAAAGAAA	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																.		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.7099-1G>T						.						99.0	99.0	99.0					3																	47084191		2203	4300	6503	SO:0001630	splice_region_variant	29072	exon18			TTCAGACTACAAA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7099-1G>T	chr3.hg19:g.47084191C>A		108.0	0.0		104.0	37.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154189	0.78114	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7322	0.91739	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47059195	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.386000	0.52492	2.650000	0.89964	0.655000	0.94253	.	.	.		0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Intron
MGLL	11343	hgsc.bcm.edu	37	3	127441310	127441310	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:127441310T>C	ENST00000434178.2	-	4	1228	c.332A>G	c.(331-333)tAc>tGc	p.Y111C	MGLL_ENST00000398104.1_Missense_Mutation_p.Y111C|MGLL_ENST00000398101.3_Missense_Mutation_p.Y85C|MGLL_ENST00000265052.5_Missense_Mutation_p.Y121C|MGLL_ENST00000453507.2_Missense_Mutation_p.Y121C			Q99685	MGLL_HUMAN	monoglyceride lipase	111					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						AAGCCCAGGGTAGTCTTTCTG	0.557																																					p.Y121C		Atlas-SNP	.											.	MGLL	19	.	0			c.A362G						.						97.0	103.0	101.0					3																	127441310		1992	4184	6176	SO:0001583	missense	11343	exon4			CCAGGGTAGTCTT	BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.332A>G	chr3.hg19:g.127441310T>C	ENSP00000402798:p.Tyr111Cys	110.0	0.0		105.0	42.0	NM_007283	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Missense_Mutation	SNP	ENST00000434178.2	hg19	CCDS43148.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.143032	0.77888	.	.	ENSG00000074416	ENST00000434178;ENST00000265052;ENST00000398104;ENST00000398101;ENST00000487473;ENST00000536024;ENST00000453507;ENST00000484451;ENST00000493611	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	4.69	4.69	0.59074	.	0.345575	0.31427	N	0.007667	D	0.87838	0.6278	M	0.85777	2.775	0.58432	D	0.999991	D;D;D;D;D	0.65815	0.992;0.98;0.979;0.992;0.995	P;P;D;D;D	0.70716	0.797;0.705;0.935;0.97;0.963	D	0.88382	0.3002	10	0.44086	T	0.13	-24.7539	13.1775	0.59635	0.0:0.0:0.0:1.0	.	121;111;111;121;85	B7Z9D1;B2ZGL7;Q99685;B3KRC2;E7EWX8	.;.;MGLL_HUMAN;.;.	C	111;121;111;85;35;121;121;35;48	ENSP00000402798:Y111C;ENSP00000265052:Y121C;ENSP00000381176:Y111C;ENSP00000381173:Y85C	ENSP00000265052:Y121C	Y	-	2	0	MGLL	128924000	1.000000	0.71417	0.966000	0.40874	0.966000	0.64601	7.241000	0.78201	1.762000	0.52044	0.254000	0.18369	TAC	.	.		0.557	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356637.2	NM_007283	
MGLL	11343	hgsc.bcm.edu	37	3	127540591	127540591	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:127540591T>G	ENST00000434178.2	-	2	967	c.71A>C	c.(70-72)aAt>aCt	p.N24T	MGLL_ENST00000398104.1_Missense_Mutation_p.N24T|MGLL_ENST00000265052.5_Missense_Mutation_p.N34T|MGLL_ENST00000453507.2_Missense_Mutation_p.N34T			Q99685	MGLL_HUMAN	monoglyceride lipase	24					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						TCCGTCTGCATTGACCAGGTG	0.582																																					p.N34T		Atlas-SNP	.											.	MGLL	19	.	0			c.A101C						.						119.0	124.0	122.0					3																	127540591		1905	4112	6017	SO:0001583	missense	11343	exon2			TCTGCATTGACCA	BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.71A>C	chr3.hg19:g.127540591T>G	ENSP00000402798:p.Asn24Thr	95.0	0.0		90.0	32.0	NM_007283	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Missense_Mutation	SNP	ENST00000434178.2	hg19	CCDS43148.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762030	0.69763	.	.	ENSG00000074416	ENST00000434178;ENST00000265052;ENST00000398104;ENST00000536024;ENST00000453507;ENST00000494830	T;T;T	0.74526	-0.85;-0.85;-0.85	5.12	5.12	0.69794	.	0.100765	0.64402	D	0.000005	T	0.81772	0.4893	L	0.60455	1.87	0.47584	D	0.999466	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.992;0.992;0.992;0.992	T	0.78529	-0.2169	10	0.19590	T	0.45	0.2073	13.5166	0.61543	0.0:0.0:0.0:1.0	.	34;24;24;34	B7Z9D1;B2ZGL7;Q99685;B3KRC2	.;.;MGLL_HUMAN;.	T	24;34;24;34;34;24	ENSP00000402798:N24T;ENSP00000265052:N34T;ENSP00000381176:N24T	ENSP00000265052:N34T	N	-	2	0	MGLL	129023281	1.000000	0.71417	0.897000	0.35233	0.725000	0.41563	6.184000	0.72008	1.934000	0.56057	0.482000	0.46254	AAT	.	.		0.582	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356637.2	NM_007283	
NPHP3	27031	hgsc.bcm.edu	37	3	132413781	132413781	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:132413781T>C	ENST00000337331.5	-	16	2286	c.2200A>G	c.(2200-2202)Atc>Gtc	p.I734V	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	734					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGATGAAGGATTTTATCTAAA	0.378																																					p.I734V		Atlas-SNP	.											.	NPHP3	110	.	0			c.A2200G						.						120.0	120.0	120.0					3																	132413781		2203	4300	6503	SO:0001583	missense	27031	exon16			GAAGGATTTTATC	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2200A>G	chr3.hg19:g.132413781T>C	ENSP00000338766:p.Ile734Val	93.0	0.0		95.0	34.0	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	hg19	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.335983	0.24253	.	.	ENSG00000113971	ENST00000393144;ENST00000337331	T	0.65916	-0.18	5.56	1.96	0.26148	.	0.432765	0.28125	N	0.016520	T	0.31327	0.0793	N	0.03115	-0.41	0.21020	N	0.999802	B	0.02656	0.0	B	0.01281	0.0	T	0.18304	-1.0341	10	0.13470	T	0.59	-1.2643	7.8324	0.29351	0.0:0.2319:0.0:0.7681	.	734	Q7Z494	NPHP3_HUMAN	V	14;734	ENSP00000338766:I734V	ENSP00000338766:I734V	I	-	1	0	NPHP3	133896471	0.995000	0.38212	0.066000	0.19879	0.992000	0.81027	1.870000	0.39529	0.403000	0.25479	0.460000	0.39030	ATC	.	.		0.378	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
MED12L	116931	hgsc.bcm.edu	37	3	151105931	151105931	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:151105931C>T	ENST00000474524.1	+	35	5355	c.5317C>T	c.(5317-5319)Cgc>Tgc	p.R1773C	MED12L_ENST00000273432.4_Missense_Mutation_p.R1633C	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1773						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGGAAGGAAGCGCAAGACGAA	0.433																																					p.R1773C		Atlas-SNP	.											.	MED12L	271	.	0			c.C5317T						.						55.0	52.0	53.0					3																	151105931		2203	4300	6503	SO:0001583	missense	116931	exon35			AGGAAGCGCAAGA	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5317C>T	chr3.hg19:g.151105931C>T	ENSP00000417235:p.Arg1773Cys	19.0	0.0		21.0	9.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	hg19	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891221	0.72524	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.62364	0.22;0.03	5.81	5.81	0.92471	.	0.171350	0.51477	D	0.000084	T	0.66268	0.2772	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;P;P	0.83275	0.996;0.649;0.799	T	0.69632	-0.5093	10	0.87932	D	0	-17.84	12.6448	0.56728	0.2059:0.7941:0.0:0.0	.	1633;1772;1773	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	C	1773;1633	ENSP00000417235:R1773C;ENSP00000273432:R1633C	ENSP00000273432:R1633C	R	+	1	0	MED12L	152588621	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	1.329000	0.33770	2.746000	0.94184	0.655000	0.94253	CGC	.	.		0.433	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
KNG1	3827	hgsc.bcm.edu	37	3	186459957	186459957	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:186459957T>A	ENST00000265023.4	+	10	1984	c.1772T>A	c.(1771-1773)aTc>aAc	p.I591N	KNG1_ENST00000447445.1_Intron|RP11-573D15.8_ENST00000599314.1_RNA|RP11-573D15.8_ENST00000596329.1_RNA|RP11-573D15.8_ENST00000609726.1_RNA|KNG1_ENST00000287611.2_Intron|RP11-573D15.8_ENST00000596632.1_RNA|RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000354642.2_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	591					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		ATCCCTGATATCCAGATAGAC	0.453																																					p.I591N		Atlas-SNP	.											.	KNG1	129	.	0			c.T1772A						.						144.0	135.0	138.0					3																	186459957		1932	4127	6059	SO:0001583	missense	3827	exon10			CTGATATCCAGAT		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1772T>A	chr3.hg19:g.186459957T>A	ENSP00000265023:p.Ile591Asn	133.0	0.0		150.0	63.0	NM_001102416	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	hg19	CCDS43183.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.692278	0.30052	.	.	ENSG00000113889	ENST00000265023	T	0.30448	1.53	5.4	5.4	0.78164	.	0.330322	0.22608	N	0.057874	T	0.45418	0.1341	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	T	0.29243	-1.0018	9	.	.	.	-6.5395	12.1266	0.53920	0.0:0.0:0.0:1.0	.	591	P01042	KNG1_HUMAN	N	591	ENSP00000265023:I591N	.	I	+	2	0	KNG1	187942651	0.171000	0.23029	0.710000	0.30468	0.135000	0.20990	4.195000	0.58400	2.190000	0.69967	0.533000	0.62120	ATC	.	.		0.453	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
RNF168	165918	hgsc.bcm.edu	37	3	196199524	196199524	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:196199524T>C	ENST00000318037.3	-	6	1476	c.882A>G	c.(880-882)atA>atG	p.I294M	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	294					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		TAGGGGACTCTATTGAAGAAT	0.458																																					p.I294M		Atlas-SNP	.											.	RNF168	49	.	0			c.A882G						.						130.0	124.0	126.0					3																	196199524		2203	4300	6503	SO:0001583	missense	165918	exon6			GGACTCTATTGAA	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.882A>G	chr3.hg19:g.196199524T>C	ENSP00000320898:p.Ile294Met	115.0	0.0		148.0	51.0	NM_152617	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	hg19	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	T	5.880	0.346572	0.11126	.	.	ENSG00000163961	ENST00000318037	T	0.07567	3.18	5.86	-2.49	0.06403	.	2.505920	0.01098	N	0.005301	T	0.05318	0.0141	N	0.12182	0.205	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.36841	-0.9731	10	0.34782	T	0.22	1.2268	6.5101	0.22216	0.0:0.3888:0.134:0.4772	.	294	Q8IYW5	RN168_HUMAN	M	294	ENSP00000320898:I294M	ENSP00000320898:I294M	I	-	3	3	RNF168	197683921	0.231000	0.23751	0.001000	0.08648	0.001000	0.01503	0.101000	0.15251	-0.687000	0.05162	-1.039000	0.02377	ATA	.	.		0.458	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
RNF168	165918	hgsc.bcm.edu	37	3	196199527	196199527	+	Silent	SNP	T	T	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:196199527T>G	ENST00000318037.3	-	6	1473	c.879A>C	c.(877-879)tcA>tcC	p.S293S	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	293					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		GGGACTCTATTGAAGAATCTG	0.453																																					p.S293S		Atlas-SNP	.											.	RNF168	49	.	0			c.A879C						.						124.0	119.0	120.0					3																	196199527		2203	4300	6503	SO:0001819	synonymous_variant	165918	exon6			CTCTATTGAAGAA	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.879A>C	chr3.hg19:g.196199527T>G		117.0	0.0		145.0	51.0	NM_152617	Q8NA67|Q96NS4	Silent	SNP	ENST00000318037.3	hg19	CCDS3317.1																																																																																			.	.		0.453	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
ZAR1	326340	hgsc.bcm.edu	37	4	48496259	48496259	+	Nonstop_Mutation	SNP	T	T	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr4:48496259T>G	ENST00000327939.4	+	4	1313	c.1273T>G	c.(1273-1275)Tag>Gag	p.*425E		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	0					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						ATACATCATTTAGGTGAAAGT	0.498																																					p.X425E		Atlas-SNP	.											.	ZAR1	15	.	0			c.T1273G						.						87.0	90.0	89.0					4																	48496259		2203	4300	6503	SO:0001578	stop_lost	326340	exon4			ATCATTTAGGTGA	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.1273T>G	chr4.hg19:g.48496259T>G	ENSP00000329803:p.*425Gluext*13	65.0	0.0		49.0	16.0	NM_175619		Missense_Mutation	SNP	ENST00000327939.4	hg19	CCDS3483.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.454401	0.26161	.	.	ENSG00000182223	ENST00000327939	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1659	0.81754	0.0:0.0:0.0:1.0	.	.	.	.	E	425	.	.	X	+	1	0	ZAR1	48191016	1.000000	0.71417	0.969000	0.41365	0.076000	0.17211	7.671000	0.83941	2.221000	0.72209	0.383000	0.25322	TAG	.	.		0.498	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
PPAT	5471	hgsc.bcm.edu	37	4	57261620	57261620	+	Silent	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr4:57261620A>G	ENST00000264220.2	-	11	1589	c.1452T>C	c.(1450-1452)gaT>gaC	p.D484D	RP11-646I6.6_ENST00000602749.1_lincRNA	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	484					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	GGATCATAATATCGTGCTTTT	0.358																																					p.D484D		Atlas-SNP	.											.	PPAT	41	.	0			c.T1452C						.						107.0	101.0	103.0					4																	57261620		2203	4300	6503	SO:0001819	synonymous_variant	5471	exon11			CATAATATCGTGC		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.1452T>C	chr4.hg19:g.57261620A>G		298.0	1.0		322.0	116.0	NM_002703		Silent	SNP	ENST00000264220.2	hg19	CCDS3505.1																																																																																			.	.		0.358	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
PAICS	10606	hgsc.bcm.edu	37	4	57312971	57312971	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr4:57312971C>T	ENST00000512576.1	+	3	486	c.325C>T	c.(325-327)Ctc>Ttc	p.L109F	PAICS_ENST00000399688.3_Missense_Mutation_p.L116F|PAICS_ENST00000264221.2_Missense_Mutation_p.L109F|PAICS_ENST00000514888.1_Missense_Mutation_p.L17F	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	109	SAICAR synthetase.				'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	TGGTTCTTTTCTCAAAAGAAA	0.388																																					p.L116F	GBM(53;429 1144 8755 40726)	Atlas-SNP	.											.	PAICS	21	.	0			c.C346T						.						44.0	43.0	44.0					4																	57312971		1840	4082	5922	SO:0001583	missense	10606	exon4			TCTTTTCTCAAAA	X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.325C>T	chr4.hg19:g.57312971C>T	ENSP00000421096:p.Leu109Phe	244.0	0.0		264.0	114.0	NM_001079525	E9PDH9|Q68CQ5	Missense_Mutation	SNP	ENST00000512576.1	hg19	CCDS47061.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468674	0.84533	.	.	ENSG00000128050	ENST00000514888;ENST00000264221;ENST00000505164;ENST00000399688;ENST00000512576	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.43	5.43	0.79202	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.71247	0.3317	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.994;0.995	T	0.75634	-0.3250	10	0.72032	D	0.01	-10.9649	12.9038	0.58141	0.0:0.9254:0.0:0.0746	.	109;116;109	E9PBS1;P22234-2;P22234	.;.;PUR6_HUMAN	F	17;109;109;116;109	ENSP00000424907:L17F;ENSP00000264221:L109F;ENSP00000424053:L109F;ENSP00000382595:L116F;ENSP00000421096:L109F	ENSP00000264221:L109F	L	+	1	0	PAICS	57007728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.064000	0.57506	2.718000	0.92993	0.585000	0.79938	CTC	.	.		0.388	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363136.2	NM_006452	
PTPN13	5783	hgsc.bcm.edu	37	4	87643469	87643469	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr4:87643469G>T	ENST00000411767.2	+	10	1553	c.1490G>T	c.(1489-1491)aGa>aTa	p.R497I	PTPN13_ENST00000316707.6_Missense_Mutation_p.R497I|PTPN13_ENST00000511467.1_Missense_Mutation_p.R497I|PTPN13_ENST00000427191.2_Missense_Mutation_p.R497I|PTPN13_ENST00000436978.1_Missense_Mutation_p.R497I			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	497					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ATGGCCCTTAGACAGTCTCGG	0.443																																					p.R497I		Atlas-SNP	.											.	PTPN13	203	.	0			c.G1490T						.						125.0	118.0	120.0					4																	87643469		1929	4135	6064	SO:0001583	missense	5783	exon10			CCCTTAGACAGTC		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1490G>T	chr4.hg19:g.87643469G>T	ENSP00000407249:p.Arg497Ile	382.0	0.0		408.0	163.0	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	hg19	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141864	0.57044	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	4.92	4.92	0.64577	.	0.000000	0.49916	D	0.000129	T	0.60534	0.2276	M	0.67953	2.075	0.54753	D	0.999989	D;D;D;D	0.89917	0.994;1.0;1.0;1.0	D;D;D;D	0.97110	0.963;1.0;0.999;0.999	T	0.64672	-0.6352	10	0.87932	D	0	.	18.4798	0.90807	0.0:0.0:1.0:0.0	.	497;497;497;497	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	I	497;497;497;497;497;465	ENSP00000408368:R497I;ENSP00000394794:R497I;ENSP00000322675:R497I;ENSP00000407249:R497I;ENSP00000426626:R497I	ENSP00000322675:R497I	R	+	2	0	PTPN13	87862493	1.000000	0.71417	0.365000	0.25901	0.144000	0.21451	7.103000	0.77014	2.444000	0.82710	0.655000	0.94253	AGA	.	.		0.443	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
SLC25A31	83447	hgsc.bcm.edu	37	4	128689945	128689945	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr4:128689945C>T	ENST00000281154.4	+	5	840	c.672C>T	c.(670-672)gtC>gtT	p.V224V		NM_031291.2	NP_112581.1	Q9H0C2	ADT4_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31	224					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|nucleus (GO:0005634)	transporter activity (GO:0005215)			NS(1)|breast(1)|large_intestine(10)|lung(8)|skin(2)	22						CATTTCTTGTCTCCTTTTTCA	0.323																																					p.V224V		Atlas-SNP	.											.	SLC25A31	42	.	0			c.C672T						.						118.0	109.0	112.0					4																	128689945		2203	4299	6502	SO:0001819	synonymous_variant	83447	exon5			TCTTGTCTCCTTT	AL136857	CCDS3733.1	4q28	2013-05-22			ENSG00000151475	ENSG00000151475		"""Solute carriers"""	25319	protein-coding gene	gene with protein product		610796				15670820	Standard	NM_031291		Approved	DKFZP434N1235, ANT4	uc003ifl.3	Q9H0C2	OTTHUMG00000133300	ENST00000281154.4:c.672C>T	chr4.hg19:g.128689945C>T		85.0	0.0		99.0	32.0	NM_031291		Silent	SNP	ENST00000281154.4	hg19	CCDS3733.1																																																																																			.	.		0.323	SLC25A31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257094.2	NM_031291	
SNX25	83891	hgsc.bcm.edu	37	4	186244738	186244738	+	Silent	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr4:186244738A>G	ENST00000504273.1	+	9	1335	c.1041A>G	c.(1039-1041)aaA>aaG	p.K347K	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Silent_p.K347K			Q9H3E2	SNX25_HUMAN	sorting nexin 25	347	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TGGAGAGCAAAGAAATATCTG	0.313																																					p.K347K		Atlas-SNP	.											.	SNX25	100	.	0			c.A1041G						.						49.0	55.0	53.0					4																	186244738		2202	4295	6497	SO:0001819	synonymous_variant	83891	exon9			GAGCAAAGAAATA	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1041A>G	chr4.hg19:g.186244738A>G		202.0	0.0		106.0	5.0	NM_031953	Q3ZT30|Q8N6K3	Silent	SNP	ENST00000504273.1	hg19	CCDS34116.1																																																																																			.	.		0.313	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
TERT	7015	hgsc.bcm.edu	37	5	1294122	1294122	+	Silent	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr5:1294122G>T	ENST00000310581.5	-	2	936	c.879C>A	c.(877-879)cgC>cgA	p.R293R	TERT_ENST00000296820.5_Silent_p.R293R|TERT_ENST00000334602.6_Silent_p.R293R|TERT_ENST00000522877.1_5'Flank|TERT_ENST00000508104.2_Silent_p.R293R	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	293	Linker.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	GGTGGGAGTGGCGCGTGCCAG	0.697									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.R293R		Atlas-SNP	.											.	TERT	2594	.	0			c.C879A						.						21.0	20.0	20.0					5																	1294122		2171	4268	6439	SO:0001819	synonymous_variant	7015	exon2	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	GGAGTGGCGCGTG	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.879C>A	chr5.hg19:g.1294122G>T		91.0	0.0		102.0	47.0	NM_001193376	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Silent	SNP	ENST00000310581.5	hg19	CCDS3861.2																																																																																			.	.		0.697	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
NNT	23530	hgsc.bcm.edu	37	5	43650682	43650682	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr5:43650682C>T	ENST00000264663.5	+	12	1931	c.1710C>T	c.(1708-1710)aaC>aaT	p.N570N	NNT_ENST00000344920.4_Silent_p.N570N|NNT_ENST00000512996.2_Silent_p.N439N	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	570					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CCTCTGTCAACATTGCAGGTA	0.413																																					p.N570N		Atlas-SNP	.											.	NNT	92	.	0			c.C1710T						.						164.0	143.0	150.0					5																	43650682		2203	4300	6503	SO:0001819	synonymous_variant	23530	exon12			TGTCAACATTGCA	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.1710C>T	chr5.hg19:g.43650682C>T		72.0	0.0		77.0	30.0	NM_182977	Q16796|Q2TB60|Q8N3V4	Silent	SNP	ENST00000264663.5	hg19	CCDS3949.1																																																																																			.	.		0.413	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
HEXB	3074	hgsc.bcm.edu	37	5	74009421	74009421	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr5:74009421G>T	ENST00000261416.7	+	7	979	c.862G>T	c.(862-864)Gaa>Taa	p.E288*	HEXB_ENST00000511181.1_Nonsense_Mutation_p.E63*	NM_000521.3	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B (beta polypeptide)	288					astrocyte cell migration (GO:0043615)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|ganglioside catabolic process (GO:0006689)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|lipid storage (GO:0019915)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|male courtship behavior (GO:0008049)|myelination (GO:0042552)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|oogenesis (GO:0048477)|penetration of zona pellucida (GO:0007341)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(3)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		AGTCCTGCCAGAATTTGATAC	0.363																																					p.E288X	Melanoma(66;841 1270 13391 18706 27225)	Atlas-SNP	.											.	HEXB	34	.	0			c.G862T						.						137.0	135.0	135.0					5																	74009421		2203	4300	6503	SO:0001587	stop_gained	3074	exon7			CTGCCAGAATTTG	M13519	CCDS4022.1	5q13.3	2012-10-02			ENSG00000049860	ENSG00000049860	3.2.1.52		4879	protein-coding gene	gene with protein product		606873				2579389, 3013851	Standard	NM_000521		Approved		uc003kdf.4	P07686	OTTHUMG00000102057	ENST00000261416.7:c.862G>T	chr5.hg19:g.74009421G>T	ENSP00000261416:p.Glu288*	121.0	0.0		160.0	57.0	NM_000521		Nonsense_Mutation	SNP	ENST00000261416.7	hg19	CCDS4022.1	.	.	.	.	.	.	.	.	.	.	G	46	12.895377	0.99704	.	.	ENSG00000049860	ENST00000511181;ENST00000261416	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.8421	19.5902	0.95508	0.0:0.0:1.0:0.0	.	.	.	.	X	63;288	.	ENSP00000261416:E288X	E	+	1	0	HEXB	74045177	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	9.869000	0.99810	2.629000	0.89072	0.555000	0.69702	GAA	.	.		0.363	HEXB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219859.6	NM_000521	
PCDHA13	56136	hgsc.bcm.edu	37	5	140264085	140264085	+	Silent	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr5:140264085G>T	ENST00000289272.2	+	1	2232	c.2232G>T	c.(2230-2232)gcG>gcT	p.A744A	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Silent_p.A744A|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	744	6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCAGCGCGGCAGGGAGTT	0.682																																					p.A744A	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.G2232T						.						50.0	55.0	53.0					5																	140264085		2203	4299	6502	SO:0001819	synonymous_variant	56136	exon1			CAGCGCGGCAGGG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2232G>T	chr5.hg19:g.140264085G>T		166.0	0.0		188.0	76.0	NM_031865	O75277	Silent	SNP	ENST00000289272.2	hg19	CCDS4240.1																																																																																			.	.		0.682	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
GPLD1	2822	hgsc.bcm.edu	37	6	24466935	24466935	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:24466935G>T	ENST00000230036.1	-	10	904	c.794C>A	c.(793-795)aCa>aAa	p.T265K	GPLD1_ENST00000474784.1_5'UTR	NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	265					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						CATGAAGCTTGTTAGATGGTA	0.408																																					p.T265K		Atlas-SNP	.											.	GPLD1	91	.	0			c.C794A						.						58.0	54.0	55.0					6																	24466935		2203	4300	6503	SO:0001583	missense	2822	exon10			AAGCTTGTTAGAT	L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.794C>A	chr6.hg19:g.24466935G>T	ENSP00000230036:p.Thr265Lys	141.0	0.0		137.0	51.0	NM_001503	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	ENST00000230036.1	hg19	CCDS4553.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.251025	0.39797	.	.	ENSG00000112293	ENST00000230036	T	0.66638	-0.22	5.65	2.92	0.33932	.	0.476791	0.22098	N	0.064656	T	0.46678	0.1405	M	0.67953	2.075	0.42996	D	0.994506	B	0.33583	0.418	B	0.35607	0.206	T	0.41161	-0.9524	10	0.25106	T	0.35	-3.7026	9.7057	0.40214	0.2289:0.0:0.7711:0.0	.	265	P80108	PHLD_HUMAN	K	265	ENSP00000230036:T265K	ENSP00000230036:T265K	T	-	2	0	GPLD1	24574914	0.067000	0.21026	0.060000	0.19600	0.962000	0.63368	0.732000	0.26072	0.756000	0.33013	0.638000	0.83543	ACA	.	.		0.408	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	
TRIM39	56658	hgsc.bcm.edu	37	6	30303626	30303626	+	Silent	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:30303626G>A	ENST00000396547.1	+	4	814	c.654G>A	c.(652-654)gaG>gaA	p.E218E	TRIM39_ENST00000376659.5_Silent_p.E218E|TRIM39-RPP21_ENST00000513556.1_Silent_p.E130E|TRIM39_ENST00000396551.3_Silent_p.E218E|TRIM39_ENST00000396548.1_Silent_p.E218E|TRIM39_ENST00000540416.1_Silent_p.E218E|TRIM39_ENST00000376656.4_Silent_p.E218E			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	218					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						TGGAAGAAGAGGAACAGGACA	0.567																																					p.E218E		Atlas-SNP	.											.	TRIM39	56	.	0			c.G654A						.						64.0	62.0	62.0					6																	30303626		1511	2709	4220	SO:0001819	synonymous_variant	56658	exon5			AGAAGAGGAACAG	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.654G>A	chr6.hg19:g.30303626G>A		109.0	0.0		149.0	66.0	NM_172016	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Silent	SNP	ENST00000396547.1	hg19	CCDS34377.1	.	.	.	.	.	.	.	.	.	.	G	8.069	0.769844	0.15983	.	.	ENSG00000204599	ENST00000420746	.	.	.	5.33	-0.575	0.11734	.	.	.	.	.	T	0.40423	0.1116	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35301	-0.9794	4	.	.	.	.	9.3148	0.37928	0.487:0.0:0.513:0.0	.	.	.	.	K	148	.	.	R	+	2	0	TRIM39	30411605	0.960000	0.32886	0.983000	0.44433	0.825000	0.46686	0.011000	0.13264	-0.329000	0.08527	-0.827000	0.03088	AGG	.	.		0.567	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016	
TRAM2	9697	hgsc.bcm.edu	37	6	52369497	52369497	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:52369497T>A	ENST00000182527.3	-	10	930	c.931A>T	c.(931-933)Atc>Ttc	p.I311F	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	311	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					TGGGAGTGGATGAAGCGCCAC	0.637																																					p.I311F		Atlas-SNP	.											.	TRAM2	27	.	0			c.A931T						.						34.0	31.0	32.0					6																	52369497		2203	4300	6503	SO:0001583	missense	9697	exon10			AGTGGATGAAGCG	D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.931A>T	chr6.hg19:g.52369497T>A	ENSP00000182527:p.Ile311Phe	39.0	0.0		47.0	24.0	NM_012288	A8K6T6	Missense_Mutation	SNP	ENST00000182527.3	hg19	CCDS34477.1	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457253	0.63401	.	.	ENSG00000065308	ENST00000182527	D	0.86164	-2.08	5.15	5.15	0.70609	TRAM/LAG1/CLN8 homology domain (3);	0.045343	0.85682	D	0.000000	T	0.78136	0.4236	L	0.55743	1.74	0.80722	D	1	B	0.25235	0.121	B	0.26094	0.066	T	0.76255	-0.3026	10	0.29301	T	0.29	.	15.274	0.73728	0.0:0.0:0.0:1.0	.	311	Q15035	TRAM2_HUMAN	F	311	ENSP00000182527:I311F	ENSP00000182527:I311F	I	-	1	0	TRAM2	52477456	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.585000	0.67497	2.074000	0.62210	0.459000	0.35465	ATC	.	.		0.637	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040910.1	NM_012288	
EYS	346007	hgsc.bcm.edu	37	6	65612046	65612046	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:65612046G>A	ENST00000370621.3	-	18	3332	c.2806C>T	c.(2806-2808)Cct>Tct	p.P936S	EYS_ENST00000503581.1_Missense_Mutation_p.P936S|EYS_ENST00000370616.2_Missense_Mutation_p.P936S			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	936	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTTTTGCAAGGTTCAGAGGAA	0.313																																					p.P936S		Atlas-SNP	.											.	EYS	527	.	0			c.C2806T						.						122.0	109.0	113.0					6																	65612046		692	1591	2283	SO:0001583	missense	346007	exon18			TGCAAGGTTCAGA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2806C>T	chr6.hg19:g.65612046G>A	ENSP00000359655:p.Pro936Ser	311.0	0.0		367.0	15.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	G	15.31	2.796491	0.50208	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.95238	-3.65;-3.65;-3.65	4.51	2.71	0.32032	.	.	.	.	.	D	0.95335	0.8486	M	0.90595	3.13	0.80722	D	1	P	0.50943	0.94	P	0.56434	0.798	D	0.94057	0.7323	9	0.56958	D	0.05	.	8.331	0.32187	0.1857:0.0:0.8143:0.0	.	936	Q5T1H1-1	.	S	936	ENSP00000424243:P936S;ENSP00000359655:P936S;ENSP00000359650:P936S	ENSP00000359650:P936S	P	-	1	0	EYS	65668767	0.983000	0.35010	0.596000	0.28811	0.844000	0.47949	1.804000	0.38873	0.457000	0.26962	0.591000	0.81541	CCT	.	.		0.313	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
COL12A1	1303	hgsc.bcm.edu	37	6	75860905	75860905	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:75860905T>C	ENST00000322507.8	-	21	4408	c.4099A>G	c.(4099-4101)Ata>Gta	p.I1367V	COL12A1_ENST00000416123.2_Missense_Mutation_p.I1367V|COL12A1_ENST00000345356.6_Missense_Mutation_p.I203V|COL12A1_ENST00000483888.2_Missense_Mutation_p.I1367V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1367	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCATCCACTATCCTGGAGAGT	0.413																																					p.I1367V		Atlas-SNP	.											.	COL12A1	385	.	0			c.A4099G						.						166.0	163.0	164.0					6																	75860905		1904	4129	6033	SO:0001583	missense	1303	exon21			CCACTATCCTGGA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4099A>G	chr6.hg19:g.75860905T>C	ENSP00000325146:p.Ile1367Val	75.0	0.0		94.0	33.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.2|23.2	4.389657|4.389657	0.82902|0.82902	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|D;D;D;D	.|0.84223	.|-1.82;-1.82;-1.82;-1.82	5.6|5.6	5.6|5.6	0.85130|0.85130	.|von Willebrand factor, type A (3);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.87148|0.87148	0.6105|0.6105	L|L	0.51422|0.51422	1.61|1.61	0.49915|0.49915	D|D	0.99983|0.99983	.|P;D	.|0.59767	.|0.742;0.986	.|P;D	.|0.68943	.|0.784;0.961	D|D	0.86577|0.86577	0.1851|0.1851	5|10	.|0.37606	.|T	.|0.19	.|.	15.7728|15.7728	0.78184|0.78184	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|203;1367	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	G|V	108|1367;1367;203;1367;1367	.|ENSP00000325146:I1367V;ENSP00000305147:I203V;ENSP00000412864:I1367V;ENSP00000421216:I1367V	.|ENSP00000325146:I1367V	D|I	-|-	2|1	0|0	COL12A1|COL12A1	75917625|75917625	1.000000|1.000000	0.71417|0.71417	0.811000|0.811000	0.32455|0.32455	0.957000|0.957000	0.61999|0.61999	7.698000|7.698000	0.84413|0.84413	2.125000|2.125000	0.65367|0.65367	0.533000|0.533000	0.62120|0.62120	GAT|ATA	.	.		0.413	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
IGF2R	3482	hgsc.bcm.edu	37	6	160468364	160468364	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:160468364A>G	ENST00000356956.1	+	16	2373	c.2225A>G	c.(2224-2226)tAt>tGt	p.Y742C		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	742					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TTCCCTGAATATCAGGTAGGA	0.512																																					p.Y742C		Atlas-SNP	.											.	IGF2R	251	.	0			c.A2225G						.						63.0	61.0	62.0					6																	160468364		2203	4300	6503	SO:0001583	missense	3482	exon16			CTGAATATCAGGT	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.2225A>G	chr6.hg19:g.160468364A>G	ENSP00000349437:p.Tyr742Cys	25.0	0.0		39.0	11.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	A	17.13	3.310131	0.60414	.	.	ENSG00000197081	ENST00000356956	T	0.02258	4.37	5.6	5.6	0.85130	Mannose-6-phosphate receptor, binding (1);	0.112785	0.64402	D	0.000007	T	0.08935	0.0221	M	0.85859	2.78	0.48571	D	0.999675	D	0.89917	1.0	D	0.65773	0.938	T	0.00998	-1.1486	10	0.72032	D	0.01	-10.5289	16.0863	0.81056	1.0:0.0:0.0:0.0	.	742	P11717	MPRI_HUMAN	C	742	ENSP00000349437:Y742C	ENSP00000349437:Y742C	Y	+	2	0	IGF2R	160388354	1.000000	0.71417	0.261000	0.24466	0.502000	0.33828	5.255000	0.65462	2.251000	0.74343	0.528000	0.53228	TAT	.	.		0.512	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
TNRC18	84629	hgsc.bcm.edu	37	7	5352635	5352635	+	Silent	SNP	T	T	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:5352635T>G	ENST00000430969.1	-	27	8235	c.7887A>C	c.(7885-7887)tcA>tcC	p.S2629S	TNRC18_ENST00000399537.4_Silent_p.S2629S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2629	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aagaggaggatgaggaggagg	0.642																																					p.S2629S		Atlas-SNP	.											.	TNRC18	311	.	0			c.A7887C						.						5.0	8.0	7.0					7																	5352635		1423	3213	4636	SO:0001819	synonymous_variant	84629	exon27			GGAGGATGAGGAG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7887A>C	chr7.hg19:g.5352635T>G		2.0	0.0		5.0	4.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	N	0.020	-1.445364	0.01089	.	.	ENSG00000182095	ENST00000399544	.	.	.	3.4	-6.8	0.01709	.	1.000120	0.08080	N	1.000000	T	0.52853	0.1760	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60979	-0.7155	6	0.87932	D	0	.	3.168	0.06542	0.3128:0.3903:0.1985:0.0984	.	.	.	.	P	1142	.	ENSP00000382459:H1142P	H	-	2	0	TNRC18	5319161	0.989000	0.36119	0.000000	0.03702	0.001000	0.01503	-1.429000	0.02437	-4.431000	0.00049	-3.452000	0.00036	CAT	.	.		0.642	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
LIMK1	3984	hgsc.bcm.edu	37	7	73520215	73520215	+	Missense_Mutation	SNP	G	G	T	rs406970		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:73520215G>T	ENST00000336180.2	+	6	670	c.619G>T	c.(619-621)Ggc>Tgc	p.G207C	LIMK1_ENST00000491052.1_3'UTR|LIMK1_ENST00000538333.3_Missense_Mutation_p.G173C|LIMK1_ENST00000418310.1_Missense_Mutation_p.G237C	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	207	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	AGTGGATCCGGGCTGCATGAG	0.597																																					p.G207C		Atlas-SNP	.											.	LIMK1	55	.	0			c.G619T						.						59.0	53.0	55.0					7																	73520215		2202	4300	6502	SO:0001583	missense	3984	exon6			GATCCGGGCTGCA	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.619G>T	chr7.hg19:g.73520215G>T	ENSP00000336740:p.Gly207Cys	61.0	0.0		93.0	24.0	NM_002314	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	ENST00000336180.2	hg19	CCDS5563.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399386	0.62177	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000423685;ENST00000538333	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.35	4.35	0.52113	PDZ/DHR/GLGF (4);	0.105138	0.64402	D	0.000006	T	0.37812	0.1017	N	0.08118	0	0.35415	D	0.792771	P;P	0.52170	0.951;0.917	P;P	0.56343	0.796;0.796	T	0.53294	-0.8459	10	0.44086	T	0.13	-37.2885	14.4796	0.67573	0.0:0.0:1.0:0.0	.	173;207	B7Z6I8;P53667	.;LIMK1_HUMAN	C	237;207;207;173;173	ENSP00000409717:G237C;ENSP00000336740:G207C;ENSP00000396480:G173C;ENSP00000444452:G173C	ENSP00000336740:G207C	G	+	1	0	LIMK1	73158151	1.000000	0.71417	0.975000	0.42487	0.788000	0.44548	5.137000	0.64789	2.283000	0.76528	0.644000	0.83932	GGC	.	G|1.000;|0.000		0.597	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
STYXL1	51657	hgsc.bcm.edu	37	7	75659739	75659739	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:75659739C>T	ENST00000248600.1	-	2	445	c.103G>A	c.(103-105)Gat>Aat	p.D35N	STYXL1_ENST00000340062.5_Splice_Site_p.D35N|STYXL1_ENST00000460184.2_5'UTR|STYXL1_ENST00000360591.3_Splice_Site_p.D35N|STYXL1_ENST00000451157.1_Splice_Site_p.D35N|STYXL1_ENST00000359697.3_Splice_Site_p.D35N|STYXL1_ENST00000431581.1_Splice_Site_p.D35N	NM_016086.2	NP_057170.1	Q9Y6J8	STYL1_HUMAN	serine/threonine/tyrosine interacting-like 1	35	Rhodanese.				intracellular signal transduction (GO:0035556)|protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	10						AAGTACTTACCCAATAAACAG	0.428																																					p.D35N		Atlas-SNP	.											.	STYXL1	35	.	0			c.G103A						.						115.0	100.0	105.0					7																	75659739		2203	4300	6503	SO:0001630	splice_region_variant	51657	exon2			ACTTACCCAATAA	AF069762	CCDS5580.1	7q11.23	2011-06-09	2005-09-22	2005-09-22	ENSG00000127952	ENSG00000127952		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	18165	protein-coding gene	gene with protein product			"""dual specificity phosphatase 24 (putative)"""	DUSP24		9757831	Standard	NM_016086		Approved	MK-STYX	uc003uel.3	Q9Y6J8	OTTHUMG00000130459	ENST00000248600.1:c.103+1G>A	chr7.hg19:g.75659739C>T		90.0	0.0		162.0	57.0	NM_016086	Q9UBP1|Q9UK06|Q9UK07|Q9UKG2|Q9UKG3	Missense_Mutation	SNP	ENST00000248600.1	hg19	CCDS5580.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490331	0.84962	.	.	ENSG00000127952	ENST00000248600;ENST00000359697;ENST00000340062;ENST00000404050;ENST00000360591;ENST00000431581;ENST00000451157	T;T;D;D;T;T	0.82081	-1.0;-1.0;-1.57;-1.57;-1.0;-1.0	5.5	5.5	0.81552	Rhodanese-like (4);	0.111999	0.64402	D	0.000014	D	0.90645	0.7066	M	0.74881	2.28	0.50039	D	0.999845	D;D;D;D	0.89917	0.999;0.987;1.0;0.999	D;P;D;D	0.83275	0.981;0.843;0.996;0.978	D	0.90290	0.4322	9	.	.	.	-14.8446	16.8745	0.86048	0.0:1.0:0.0:0.0	.	35;35;35;35	C9J4H0;Q9Y6J8-2;Q9Y6J8-4;Q9Y6J8	.;.;.;STYL1_HUMAN	N	35	ENSP00000248600:D35N;ENSP00000352726:D35N;ENSP00000343383:D35N;ENSP00000353798:D35N;ENSP00000392221:D35N;ENSP00000411812:D35N	.	D	-	1	0	STYXL1	75497675	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	4.972000	0.63756	2.586000	0.87340	0.637000	0.83480	GAT	.	.		0.428	STYXL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344825.1	NM_016086	Missense_Mutation
SEMA3A	10371	hgsc.bcm.edu	37	7	83610698	83610698	+	Silent	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:83610698G>T	ENST00000265362.4	-	14	1905	c.1591C>A	c.(1591-1593)Cga>Aga	p.R531R	SEMA3A_ENST00000436949.1_Silent_p.R531R	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	531					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TAAGGGTCTCGGGCGAGGCAA	0.458																																					p.R531R		Atlas-SNP	.											.	SEMA3A	121	.	0			c.C1591A						.						77.0	71.0	73.0					7																	83610698		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon14			GGTCTCGGGCGAG	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1591C>A	chr7.hg19:g.83610698G>T		147.0	0.0		261.0	73.0	NM_006080		Silent	SNP	ENST00000265362.4	hg19	CCDS5599.1																																																																																			.	.		0.458	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
FAM185A	222234	hgsc.bcm.edu	37	7	102448814	102448814	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:102448814C>A	ENST00000413034.2	+	8	1144	c.1144C>A	c.(1144-1146)Caa>Aaa	p.Q382K	FAM185A_ENST00000409231.3_Missense_Mutation_p.Q265K	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	382										kidney(1)	1						TTTTAGAAGGCAAAGTTGGTT	0.358																																					p.Q382K		Atlas-SNP	.											.	FAM185A	10	.	0			c.C1144A						.						168.0	153.0	158.0					7																	102448814		692	1591	2283	SO:0001583	missense	222234	exon8			AGAAGGCAAAGTT	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.1144C>A	chr7.hg19:g.102448814C>A	ENSP00000395340:p.Gln382Lys	81.0	0.0		144.0	38.0	NM_001145268	A8MUR7|B4DQD3|C9IZ91	Missense_Mutation	SNP	ENST00000413034.2	hg19	CCDS47676.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101141	0.76983	.	.	ENSG00000222011	ENST00000409231;ENST00000413034	T;T	0.50277	0.88;0.75	5.72	5.72	0.89469	.	.	.	.	.	T	0.62011	0.2393	M	0.70275	2.135	0.51767	D	0.999938	P;D	0.54772	0.734;0.968	P;P	0.55577	0.519;0.779	T	0.60586	-0.7234	9	0.44086	T	0.13	.	15.7345	0.77831	0.0:1.0:0.0:0.0	.	265;382	Q8N0U4-3;Q8N0U4	.;F185A_HUMAN	K	265;382	ENSP00000387066:Q265K;ENSP00000395340:Q382K	ENSP00000387066:Q265K	Q	+	1	0	FAM185A	102236050	1.000000	0.71417	0.980000	0.43619	0.993000	0.82548	4.061000	0.57485	2.865000	0.98341	0.655000	0.94253	CAA	.	.		0.358	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349482.1	NM_001145268	
TRPV5	56302	hgsc.bcm.edu	37	7	142605860	142605860	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:142605860C>T	ENST00000265310.1	-	15	2358	c.2010G>A	c.(2008-2010)ggG>ggA	p.G670G		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	670					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CACTCTCAGCCCCAGAGGGCT	0.567																																					p.G670G		Atlas-SNP	.											.	TRPV5	164	.	0			c.G2010A						.						63.0	61.0	62.0					7																	142605860		2203	4300	6503	SO:0001819	synonymous_variant	56302	exon15			CTCAGCCCCAGAG	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.2010G>A	chr7.hg19:g.142605860C>T		68.0	0.0		104.0	65.0	NM_019841	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	hg19	CCDS5875.1																																																																																			.	.		0.567	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
EZH2	2146	hgsc.bcm.edu	37	7	148506446	148506446	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:148506446A>C	ENST00000460911.1	-	18	2139	c.2051T>G	c.(2050-2052)aTt>aGt	p.I684S	EZH2_ENST00000350995.2_Missense_Mutation_p.I645S|EZH2_ENST00000476773.1_Missense_Mutation_p.I633S|EZH2_ENST00000478654.1_Missense_Mutation_p.I633S|EZH2_ENST00000483967.1_Missense_Mutation_p.I675S|EZH2_ENST00000320356.2_Missense_Mutation_p.I689S|EZH2_ENST00000541220.1_Missense_Mutation_p.I633S			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	684	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TGCAAAACGAATTTTGTTACC	0.378			Mis		DLBCL																																p.I689S		Atlas-SNP	.		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	EZH2	823	.	0			c.T2066G						.						117.0	116.0	116.0					7																	148506446		2203	4300	6503	SO:0001583	missense	2146	exon18			AAACGAATTTTGT		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.2051T>G	chr7.hg19:g.148506446A>C	ENSP00000419711:p.Ile684Ser	86.0	0.0		137.0	45.0	NM_004456	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	hg19	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	a	24.9	4.579903	0.86645	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	T;D;D;D;T;T;D	0.84298	-1.45;-1.83;-1.83;-1.83;-1.45;-1.45;-1.83	5.13	5.13	0.70059	SET domain (3);	0.000000	0.85682	D	0.000000	T	0.78104	0.4231	N	0.00754	-1.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;0.999	D;D;D;D;D	0.97110	0.996;0.997;1.0;0.967;0.996	T	0.82478	-0.0437	10	0.25106	T	0.35	.	14.9541	0.71098	1.0:0.0:0.0:0.0	.	675;633;684;645;689	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	S	633;689;684;645;633;633;675	ENSP00000417062:I633S;ENSP00000320147:I689S;ENSP00000419711:I684S;ENSP00000223193:I645S;ENSP00000443219:I633S;ENSP00000419050:I633S;ENSP00000419856:I675S	ENSP00000320147:I689S	I	-	2	0	EZH2	148137379	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.042000	0.93793	1.925000	0.55765	0.533000	0.62120	ATT	.	.		0.378	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456	
ABCB8	11194	hgsc.bcm.edu	37	7	150731818	150731818	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr7:150731818A>G	ENST00000297504.6	+	6	784	c.718A>G	c.(718-720)Atc>Gtc	p.I240V	ABCB8_ENST00000477092.1_Missense_Mutation_p.I223V|ABCB8_ENST00000356058.4_Missense_Mutation_p.I260V|ABCB8_ENST00000542328.1_Missense_Mutation_p.I135V|ABCB8_ENST00000477719.1_Missense_Mutation_p.I223V|ABCB8_ENST00000498578.1_Missense_Mutation_p.I223V|ABCB8_ENST00000358849.4_Missense_Mutation_p.I223V			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	240	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CAGACAAGACATCACCTTCTT	0.517																																					p.I223V		Atlas-SNP	.											.	ABCB8	65	.	0			c.A667G						.						126.0	105.0	112.0					7																	150731818		2203	4300	6503	SO:0001583	missense	11194	exon5			CAAGACATCACCT	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.718A>G	chr7.hg19:g.150731818A>G	ENSP00000297504:p.Ile240Val	56.0	0.0		114.0	30.0	NM_007188	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	hg19		.	.	.	.	.	.	.	.	.	.	A	10.63	1.403478	0.25291	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	5.06	5.06	0.68205	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.131141	0.52532	D	0.000068	T	0.79695	0.4490	N	0.11673	0.155	0.48135	D	0.999597	B;B;B;B;B;P;P	0.36683	0.042;0.106;0.072;0.173;0.042;0.565;0.565	B;B;B;B;B;B;B	0.42882	0.075;0.163;0.047;0.208;0.075;0.401;0.401	T	0.76806	-0.2823	10	0.29301	T	0.29	-0.4999	7.55	0.27790	0.905:0.0:0.095:0.0	.	135;223;53;240;223;223;260	G3XAP3;A5D8W3;B3KND2;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;.;.;ABCB8_HUMAN;.;.;.	V	223;206;240;135;223;260;223;223	ENSP00000351717:I223V;ENSP00000297504:I240V;ENSP00000438776:I135V;ENSP00000418271:I223V;ENSP00000348353:I260V;ENSP00000419891:I223V;ENSP00000419558:I223V	ENSP00000297504:I240V	I	+	1	0	ABCB8	150362751	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	4.210000	0.58500	1.919000	0.55581	0.533000	0.62120	ATC	.	.		0.517	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	
TOX	9760	hgsc.bcm.edu	37	8	59750854	59750854	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:59750854T>C	ENST00000361421.1	-	5	930	c.710A>G	c.(709-711)aAg>aGg	p.K237R		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	237						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GGCAGGCCGCTTCTCTCCACC	0.433																																					p.K237R	Pancreas(161;610 1969 17913 21374 22725)	Atlas-SNP	.											.	TOX	83	.	0			c.A710G						.						51.0	60.0	57.0					8																	59750854		2199	4296	6495	SO:0001583	missense	9760	exon5			GGCCGCTTCTCTC		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.710A>G	chr8.hg19:g.59750854T>C	ENSP00000354842:p.Lys237Arg	46.0	0.0		74.0	23.0	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	hg19	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	T	19.11	3.764642	0.69878	.	.	ENSG00000198846	ENST00000361421	T	0.18810	2.19	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.38639	0.1048	M	0.80422	2.495	0.80722	D	1	P	0.51057	0.941	P	0.49332	0.607	T	0.30504	-0.9976	9	.	.	.	.	16.1304	0.81428	0.0:0.0:0.0:1.0	.	237	O94900	TOX_HUMAN	R	237	ENSP00000354842:K237R	.	K	-	2	0	TOX	59913408	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.202000	0.70862	0.482000	0.46254	AAG	.	.		0.433	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
C8orf34	116328	hgsc.bcm.edu	37	8	69728153	69728153	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:69728153T>A	ENST00000539993.1	+	13	1873	c.1324T>A	c.(1324-1326)Tct>Act	p.S442T	C8orf34_ENST00000518698.1_Missense_Mutation_p.S528T|C8orf34_ENST00000337103.4_Missense_Mutation_p.S417T			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	442										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CGTTCCATGCTCTTCTTGTCC	0.443																																					p.S528T		Atlas-SNP	.											.	C8orf34	170	.	0			c.T1582A						.						367.0	317.0	334.0					8																	69728153		2203	4300	6503	SO:0001583	missense	116328	exon13			CCATGCTCTTCTT	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.1324T>A	chr8.hg19:g.69728153T>A	ENSP00000438159:p.Ser442Thr	85.0	0.0		133.0	77.0	NM_052958	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.63	2.891728	0.52014	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103	T;T;T	0.52295	0.67;0.79;0.78	4.2	4.2	0.49525	.	0.471455	0.20720	N	0.086937	T	0.45736	0.1357	N	0.14661	0.345	0.25942	N	0.982865	P	0.52577	0.954	D	0.63597	0.916	T	0.25398	-1.0133	9	.	.	.	-1.1301	10.0033	0.41942	0.0:0.0:0.0:1.0	.	442	Q49A92	CH034_HUMAN	T	528;442;417	ENSP00000427820:S528T;ENSP00000438159:S442T;ENSP00000337174:S417T	.	S	+	1	0	C8orf34	69890707	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.683000	0.37638	2.132000	0.65825	0.529000	0.55759	TCT	.	.		0.443	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75926334	75926334	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:75926334C>T	ENST00000262207.4	+	5	1091	c.623C>T	c.(622-624)cCa>cTa	p.P208L	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.P20L|CRISPLD1_ENST00000517786.1_Intron	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	208					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			AATTACTCCCCAAAGTGAGTA	0.393																																					p.P208L		Atlas-SNP	.											.	CRISPLD1	94	.	0			c.C623T						.						109.0	91.0	97.0					8																	75926334		2203	4300	6503	SO:0001583	missense	83690	exon5			ACTCCCCAAAGTG	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.623C>T	chr8.hg19:g.75926334C>T	ENSP00000262207:p.Pro208Leu	67.0	0.0		112.0	65.0	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	hg19	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955841	0.92726	.	.	ENSG00000121005	ENST00000262207;ENST00000523524	T;T	0.81415	2.26;-1.49	4.85	4.85	0.62838	Allergen V5/Tpx-1-related, conserved site (1);CAP domain (2);	0.000000	0.85682	D	0.000000	D	0.88104	0.6347	M	0.64404	1.975	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.89229	0.3576	10	0.72032	D	0.01	.	18.164	0.89719	0.0:1.0:0.0:0.0	.	208	Q9H336	CRLD1_HUMAN	L	208;20	ENSP00000262207:P208L;ENSP00000430105:P20L	ENSP00000262207:P208L	P	+	2	0	CRISPLD1	76088889	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.551000	0.82182	2.505000	0.84491	0.650000	0.86243	CCA	.	.		0.393	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
SLC26A7	115111	hgsc.bcm.edu	37	8	92346676	92346676	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:92346676G>T	ENST00000276609.3	+	6	1034		c.e6+1		SLC26A7_ENST00000309536.2_Splice_Site|SLC26A7_ENST00000523719.1_Splice_Site	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TTTAGTTTTGGTAAGTATAAA	0.358																																					.		Atlas-SNP	.											.	SLC26A7	207	.	0			c.795+1G>T						.						81.0	78.0	79.0					8																	92346676		2202	4298	6500	SO:0001630	splice_region_variant	115111	exon6			GTTTTGGTAAGTA	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.795+1G>T	chr8.hg19:g.92346676G>T		56.0	0.0		76.0	48.0	NM_134266		Splice_Site	SNP	ENST00000276609.3	hg19	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151745	0.78001	.	.	ENSG00000147606	ENST00000523719;ENST00000276609;ENST00000309536;ENST00000520818	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC26A7	92415852	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.417000	0.73337	2.854000	0.98071	0.655000	0.94253	.	.	.		0.358	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		Intron
INTS8	55656	hgsc.bcm.edu	37	8	95861725	95861725	+	Silent	SNP	A	A	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:95861725A>T	ENST00000523731.1	+	11	1429	c.1296A>T	c.(1294-1296)tcA>tcT	p.S432S	INTS8_ENST00000447247.1_Silent_p.S432S	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	432					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					AAAAAGCTTCAGAGTCTTTGA	0.259																																					p.S432S		Atlas-SNP	.											.	INTS8	92	.	0			c.A1296T						.						58.0	67.0	64.0					8																	95861725		2198	4287	6485	SO:0001819	synonymous_variant	55656	exon11			AGCTTCAGAGTCT	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.1296A>T	chr8.hg19:g.95861725A>T		490.0	1.0		792.0	190.0	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Silent	SNP	ENST00000523731.1	hg19	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	A	9.929	1.214251	0.22289	.	.	ENSG00000164941	ENST00000520526	.	.	.	5.55	1.86	0.25419	.	.	.	.	.	T	0.43986	0.1272	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25363	-1.0134	4	.	.	.	-25.0914	2.564	0.04778	0.6105:0.1273:0.1396:0.1226	.	.	.	.	L	254	.	.	Q	+	2	0	INTS8	95930901	0.942000	0.31987	1.000000	0.80357	0.991000	0.79684	0.036000	0.13819	0.462000	0.27095	-0.250000	0.11733	CAG	.	.		0.259	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
CSMD3	114788	hgsc.bcm.edu	37	8	114186141	114186141	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:114186141C>A	ENST00000297405.5	-	4	763	c.519G>T	c.(517-519)ttG>ttT	p.L173F	CSMD3_ENST00000519485.1_5'Flank|CSMD3_ENST00000455883.2_Missense_Mutation_p.L173F|CSMD3_ENST00000352409.3_Missense_Mutation_p.L173F|CSMD3_ENST00000343508.3_Missense_Mutation_p.L133F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	173	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGCTACTCTGCAATTCTATTA	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.L173F		Atlas-SNP	.											.	CSMD3	2325	.	0			c.G519T						.						58.0	57.0	57.0					8																	114186141		2203	4300	6503	SO:0001583	missense	114788	exon4			ACTCTGCAATTCT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.519G>T	chr8.hg19:g.114186141C>A	ENSP00000297405:p.Leu173Phe	63.0	0.0		112.0	24.0	NM_052900	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951014	0.53186	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.26957	2.02;2.0;1.7;2.0	5.1	-0.126	0.13515	CUB (3);	0.000000	0.42294	U	0.000738	T	0.27134	0.0665	N	0.21373	0.66	0.27105	N	0.962523	D;D;B;P	0.76494	0.999;0.999;0.0;0.954	D;D;B;P	0.87578	0.996;0.998;0.001;0.812	T	0.22591	-1.0212	10	0.15952	T	0.53	.	8.1197	0.30963	0.0:0.2861:0.0:0.7139	.	173;173;173;133	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	F	133;173;173;173	ENSP00000345799:L133F;ENSP00000297405:L173F;ENSP00000412263:L173F;ENSP00000343124:L173F	ENSP00000297405:L173F	L	-	3	2	CSMD3	114255317	1.000000	0.71417	0.999000	0.59377	0.916000	0.54674	0.942000	0.29017	0.102000	0.17638	0.655000	0.94253	TTG	.	.		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
DEPTOR	64798	hgsc.bcm.edu	37	8	120940716	120940716	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:120940716A>G	ENST00000286234.5	+	2	329	c.199A>G	c.(199-201)Aaa>Gaa	p.K67E	DEPTOR_ENST00000523492.1_Intron	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	67	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						TTTTGTCGCAAAAGAACTGAT	0.413																																					p.K67E		Atlas-SNP	.											.	DEPTOR	41	.	0			c.A199G						.						124.0	119.0	121.0					8																	120940716		2203	4300	6503	SO:0001583	missense	64798	exon2			GTCGCAAAAGAAC		CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.199A>G	chr8.hg19:g.120940716A>G	ENSP00000286234:p.Lys67Glu	102.0	0.0		175.0	46.0	NM_022783	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	ENST00000286234.5	hg19	CCDS6331.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.426830	0.83667	.	.	ENSG00000155792	ENST00000286234	T	0.24350	1.86	5.95	5.95	0.96441	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	L	0.47190	1.495	0.58432	D	0.999999	P	0.51791	0.948	P	0.53102	0.718	T	0.02307	-1.1179	10	0.32370	T	0.25	-28.3344	16.397	0.83610	1.0:0.0:0.0:0.0	.	67	Q8TB45	DPTOR_HUMAN	E	67	ENSP00000286234:K67E	ENSP00000286234:K67E	K	+	1	0	DEPTOR	121009897	1.000000	0.71417	0.940000	0.37924	0.997000	0.91878	8.679000	0.91220	2.275000	0.75901	0.459000	0.35465	AAA	.	.		0.413	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783	
SLA	6503	hgsc.bcm.edu	37	8	134052339	134052339	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr8:134052339G>A	ENST00000338087.5	-	8	1340	c.521C>T	c.(520-522)cCc>cTc	p.P174L	SLA_ENST00000517648.1_Missense_Mutation_p.P147L|SLA_ENST00000524345.1_Missense_Mutation_p.P66L|TG_ENST00000220616.4_Intron|TG_ENST00000377869.1_Intron|SLA_ENST00000395352.3_Missense_Mutation_p.P191L|TG_ENST00000542445.1_Intron|TG_ENST00000519543.1_Intron|SLA_ENST00000427060.2_Missense_Mutation_p.P214L	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	174	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			TGTCAGGCAGGGCGTGGTGAG	0.637																																					p.P214L		Atlas-SNP	.											SLA_ENST00000427060,right_upper_lobe,carcinoma,0,2	SLA	63	.	0			c.C641T						.						66.0	41.0	50.0					8																	134052339		2189	4280	6469	SO:0001583	missense	6503	exon6			AGGCAGGGCGTGG		CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.521C>T	chr8.hg19:g.134052339G>A	ENSP00000337548:p.Pro174Leu	62.0	0.0		121.0	35.0	NM_006748	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	ENST00000338087.5	hg19	CCDS6370.1	.	.	.	.	.	.	.	.	.	.	G	33	5.285789	0.95517	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000524345;ENST00000517648	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.38	5.77	5.77	0.91146	SH2 motif (2);	0.000000	0.85682	D	0.000000	T	0.77725	0.4173	H	0.96777	3.88	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	D	0.84993	0.0895	10	0.87932	D	0	-37.8829	18.5671	0.91120	0.0:0.0:1.0:0.0	.	147;174;174;174	B7Z4J2;Q6FI01;Q5TZW1;Q13239	.;.;.;SLAP1_HUMAN	L	174;214;191;66;147	ENSP00000337548:P174L;ENSP00000394049:P214L;ENSP00000378759:P191L;ENSP00000427928:P66L;ENSP00000428559:P147L	ENSP00000337548:P174L	P	-	2	0	SLA	134121521	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.541000	0.90644	2.727000	0.93392	0.650000	0.86243	CCC	.	.		0.637	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378771.1		
ABCA1	19	hgsc.bcm.edu	37	9	107562206	107562206	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr9:107562206T>C	ENST00000374736.3	-	36	5231	c.4837A>G	c.(4837-4839)Att>Gtt	p.I1613V		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1613					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GCCCGGAGAATGGCATTGTTG	0.478																																					p.I1613V		Atlas-SNP	.											.	ABCA1	244	.	0			c.A4837G						.						139.0	126.0	131.0					9																	107562206		2203	4300	6503	SO:0001583	missense	19	exon36			GGAGAATGGCATT	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4837A>G	chr9.hg19:g.107562206T>C	ENSP00000363868:p.Ile1613Val	67.0	0.0		108.0	39.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	hg19	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.731046	0.48939	.	.	ENSG00000165029	ENST00000374736	D	0.87571	-2.27	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.85097	0.5619	L	0.46614	1.455	0.80722	D	1	B	0.20368	0.044	B	0.26693	0.072	T	0.81583	-0.0866	10	0.52906	T	0.07	.	16.3979	0.83621	0.0:0.0:0.0:1.0	.	1613	O95477	ABCA1_HUMAN	V	1613	ENSP00000363868:I1613V	ENSP00000363868:I1613V	I	-	1	0	ABCA1	106602027	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.203000	0.58453	2.333000	0.79357	0.533000	0.62120	ATT	.	.		0.478	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
CEL	1056	hgsc.bcm.edu	37	9	135947089	135947089	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr9:135947089G>C	ENST00000372080.4	+	11	2225	c.2209G>C	c.(2209-2211)Gcc>Ccc	p.A737P	CEL_ENST00000351304.7_Missense_Mutation_p.A668P	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	734	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CTCTGAGGCTGCCCCTGTGCC	0.667																																					p.A737P		Atlas-SNP	.											.	CEL	71	.	0			c.G2209C						.						17.0	20.0	19.0					9																	135947089		1846	4080	5926	SO:0001583	missense	1056	exon11			GAGGCTGCCCCTG	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2209G>C	chr9.hg19:g.135947089G>C	ENSP00000361151:p.Ala737Pro	463.0	0.0		506.0	183.0	NM_001807	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	hg19	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	g	6.623	0.483286	0.12581	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.71817	-0.39;-0.6	2.5	-1.98	0.07480	.	.	.	.	.	T	0.45316	0.1336	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.30297	-0.9983	9	0.07030	T	0.85	.	4.1192	0.10098	0.3445:0.3354:0.3201:0.0	.	734	P19835	CEL_HUMAN	P	737;668;703	ENSP00000361151:A737P;ENSP00000342217:A668P	ENSP00000304021:A703P	A	+	1	0	CEL	134936910	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.508000	0.06344	-0.476000	0.06842	-0.360000	0.07572	GCC	.	.		0.667	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
ADAMTS13	11093	hgsc.bcm.edu	37	9	136310099	136310099	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr9:136310099C>T	ENST00000371929.3	+	20	2980	c.2536C>T	c.(2536-2538)Cct>Tct	p.P846S	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.P815S|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.P846S|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000536611.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	846	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GACTGAGGGGCCTGGCTCCGT	0.652																																					p.P846S		Atlas-SNP	.											.	ADAMTS13	113	.	0			c.C2536T						.						73.0	58.0	63.0					9																	136310099		2203	4300	6503	SO:0001583	missense	11093	exon20			GAGGGGCCTGGCT	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2536C>T	chr9.hg19:g.136310099C>T	ENSP00000360997:p.Pro846Ser	41.0	0.0		49.0	21.0	NM_139027	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	hg19	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	C	8.176	0.792842	0.16327	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.67171	-0.23;-0.25;-0.23	5.55	3.68	0.42216	.	.	.	.	.	T	0.51652	0.1687	M	0.62723	1.935	0.09310	N	0.999999	P;P;P	0.42010	0.768;0.529;0.762	B;B;B	0.33454	0.164;0.164;0.164	T	0.41448	-0.9508	9	0.15066	T	0.55	.	3.3496	0.07147	0.1457:0.5739:0.1414:0.1391	.	846;815;846	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	S	846;846;815	ENSP00000360997:P846S;ENSP00000347927:P846S;ENSP00000348997:P815S	ENSP00000347927:P846S	P	+	1	0	ADAMTS13	135299920	0.001000	0.12720	0.059000	0.19551	0.009000	0.06853	0.571000	0.23669	1.326000	0.45319	0.561000	0.74099	CCT	.	.		0.652	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
WDFY4	57705	hgsc.bcm.edu	37	10	50014124	50014124	+	Silent	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:50014124G>A	ENST00000325239.5	+	26	4749	c.4722G>A	c.(4720-4722)ctG>ctA	p.L1574L	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1574						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						ACGGAGCCCTGGACCCTTCCC	0.577																																					p.L1574L		Atlas-SNP	.											.	WDFY4	205	.	0			c.G4722A						.						152.0	125.0	133.0					10																	50014124		692	1591	2283	SO:0001819	synonymous_variant	57705	exon27			AGCCCTGGACCCT	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.4722G>A	chr10.hg19:g.50014124G>A		59.0	0.0		73.0	23.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	hg19	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	G	9.789	1.177337	0.21787	.	.	ENSG00000128815	ENST00000312002;ENST00000374161	.	.	.	5.45	1.52	0.23074	.	.	.	.	.	T	0.32436	0.0829	.	.	.	0.24654	N	0.993508	.	.	.	.	.	.	T	0.23619	-1.0183	4	.	.	.	.	7.2938	0.26380	0.3465:0.0:0.6535:0.0	.	.	.	.	R	665;121	.	.	G	+	1	0	WDFY4	49684130	0.198000	0.23374	0.046000	0.18839	0.588000	0.36517	0.381000	0.20619	0.682000	0.31407	-0.150000	0.13652	GGA	.	.		0.577	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
DNAJB12	54788	hgsc.bcm.edu	37	10	74100799	74100799	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:74100799G>A	ENST00000444643.2	-	4	919	c.587C>T	c.(586-588)gCc>gTc	p.A196V	DNAJB12_ENST00000394903.2_Missense_Mutation_p.A230V|DNAJB12_ENST00000461919.1_5'UTR|DNAJB12_ENST00000338820.3_Missense_Mutation_p.A230V			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	196						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						GGAGATGTCGGCCTCAAAGCC	0.597																																					p.A230V		Atlas-SNP	.											.	DNAJB12	22	.	0			c.C689T						.						61.0	55.0	57.0					10																	74100799		2203	4300	6503	SO:0001583	missense	54788	exon4			ATGTCGGCCTCAA	AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.587C>T	chr10.hg19:g.74100799G>A	ENSP00000403313:p.Ala196Val	68.0	0.0		81.0	31.0	NM_017626	B7Z7I3|Q9H6H0	Missense_Mutation	SNP	ENST00000444643.2	hg19		.	.	.	.	.	.	.	.	.	.	G	24.9	4.586388	0.86851	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.72942	-0.7;-0.7;-0.7	5.66	5.66	0.87406	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84188	0.5417	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.72338	0.977;0.906	D	0.85152	0.0987	10	0.87932	D	0	-11.5344	19.8154	0.96566	0.0:0.0:1.0:0.0	.	196;196	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	V	230;230;196	ENSP00000345575:A230V;ENSP00000378363:A230V;ENSP00000403313:A196V	ENSP00000345575:A230V	A	-	2	0	DNAJB12	73770805	1.000000	0.71417	0.969000	0.41365	0.964000	0.63967	9.869000	0.99810	2.683000	0.91414	0.650000	0.86243	GCC	.	.		0.597	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048581.2		
SCD	6319	hgsc.bcm.edu	37	10	102114194	102114194	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:102114194A>G	ENST00000370355.2	+	4	833	c.452A>G	c.(451-453)tAt>tGt	p.Y151C		NM_005063.4	NP_005054.3	O00767	ACOD_HUMAN	stearoyl-CoA desaturase (delta-9-desaturase)	151					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|large_intestine(3)|lung(5)	9		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		AATGATGTCTATGAATGGGCT	0.498																																					p.Y151C	Colon(67;260 1459 9574 11663)	Atlas-SNP	.											.	SCD	25	.	0			c.A452G						.						104.0	94.0	97.0					10																	102114194		2203	4300	6503	SO:0001583	missense	6319	exon4			ATGTCTATGAATG	AF097514	CCDS7493.1	10q23-q24	2013-01-25			ENSG00000099194	ENSG00000099194	1.14.19.1	"""Fatty acid desaturases"""	10571	protein-coding gene	gene with protein product	"""acyl-CoA desaturase"", ""fatty acid desaturase"", ""delta-9-desaturase"""	604031	"""stearoyl-CoA desaturase opposite strand"""	SCDOS		7909540, 10229681	Standard	NM_005063		Approved	FADS5	uc001kqy.3	O00767	OTTHUMG00000018906	ENST00000370355.2:c.452A>G	chr10.hg19:g.102114194A>G	ENSP00000359380:p.Tyr151Cys	45.0	0.0		42.0	15.0	NM_005063	B2R5U0|D3DR68|Q16150|Q53GR9|Q5W037|Q5W038|Q6GSS4|Q96KF6|Q9BS07|Q9Y695	Missense_Mutation	SNP	ENST00000370355.2	hg19	CCDS7493.1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.187639	0.57909	.	.	ENSG00000099194	ENST00000423840;ENST00000370355	T	0.13538	2.58	5.31	-10.6	0.00265	Fatty acid desaturase, type 1 (1);	0.539943	0.18230	N	0.147605	T	0.35595	0.0937	M	0.91090	3.175	0.27497	N	0.952095	D	0.63880	0.993	D	0.64410	0.925	T	0.60622	-0.7227	10	0.87932	D	0	-3.7665	17.4691	0.87641	0.2111:0.0:0.0:0.7889	.	151	O00767	ACOD_HUMAN	C	151	ENSP00000359380:Y151C	ENSP00000359380:Y151C	Y	+	2	0	SCD	102104184	0.000000	0.05858	0.010000	0.14722	0.891000	0.51852	-0.188000	0.09642	-1.909000	0.01085	-0.728000	0.03583	TAT	.	.		0.498	SCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049857.2	NM_005063	
C10orf32-ASMT	100528007	hgsc.bcm.edu	37	10	104620107	104620107	+	Silent	SNP	C	C	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:104620107C>A	ENST00000299353.6	+	2	175	c.160C>A	c.(160-162)Cga>Aga	p.R54R	C10orf32_ENST00000369883.3_Silent_p.R54R|C10orf32_ENST00000339834.5_Silent_p.R54R					C10orf32-ASMT readthrough (NMD candidate)																		TCAGGCAGCTCGAAACATGGT	0.383																																					p.R54R		Atlas-SNP	.											.	C10orf32	3	.	0			c.C160A						.						131.0	133.0	132.0					10																	104620107		2203	4300	6503	SO:0001819	synonymous_variant	119032	exon2			GCAGCTCGAAACA			10q24.32	2013-09-25			ENSG00000270316	ENSG00000270316			49183	other	readthrough							Standard	NR_037644		Approved				OTTHUMG00000184175	ENST00000299353.6:c.160C>A	chr10.hg19:g.104620107C>A		74.0	0.0		79.0	37.0	NM_001136200		Silent	SNP	ENST00000299353.6	hg19	CCDS7542.2																																																																																			.	.		0.383	C10orf32-ASMT-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000468206.2		
GSTO1	9446	hgsc.bcm.edu	37	10	106019401	106019401	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:106019401C>G	ENST00000369713.5	+	3	405	c.211C>G	c.(211-213)Ctg>Gtg	p.L71V	GSTO1_ENST00000539281.1_Missense_Mutation_p.L43V|GSTO1_ENST00000493946.1_3'UTR|GSTO1_ENST00000369710.4_Missense_Mutation_p.L71V	NM_004832.2	NP_004823.1	P78417	GSTO1_HUMAN	glutathione S-transferase omega 1	71	GST N-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014810)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)			large_intestine(1)|lung(1)|stomach(1)	3		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)|Vitamin E(DB00163)	TCCCTTTGGTCTGGTGCCAGT	0.458																																					p.L71V		Atlas-SNP	.											.	GSTO1	14	.	0			c.C211G						.						87.0	87.0	87.0					10																	106019401		2203	4300	6503	SO:0001583	missense	9446	exon3			TTTGGTCTGGTGC	AF212303	CCDS7555.1, CCDS53572.1, CCDS53573.1	10q25.1	2012-06-21			ENSG00000148834	ENSG00000148834	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	13312	protein-coding gene	gene with protein product		605482				10783391, 12618591	Standard	NM_004832		Approved	GSTTLp28, P28	uc001kya.3	P78417	OTTHUMG00000019001	ENST00000369713.5:c.211C>G	chr10.hg19:g.106019401C>G	ENSP00000358727:p.Leu71Val	72.0	0.0		96.0	41.0	NM_001191002	D3DRA3|F5H7H0|Q5TA03|Q7Z3T2	Missense_Mutation	SNP	ENST00000369713.5	hg19	CCDS7555.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446825	0.43429	.	.	ENSG00000148834	ENST00000539281;ENST00000369710;ENST00000369713;ENST00000445155;ENST00000432659	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	5.53	3.67	0.42095	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.213069	0.40469	N	0.001091	T	0.34803	0.0910	L	0.56199	1.76	0.53688	D	0.999979	P	0.36171	0.541	B	0.42555	0.391	T	0.14008	-1.0488	10	0.59425	D	0.04	-12.4927	11.4764	0.50300	0.0:0.8059:0.1261:0.068	.	71	P78417	GSTO1_HUMAN	V	43;71;71;43;43	ENSP00000441488:L43V;ENSP00000358724:L71V;ENSP00000358727:L71V;ENSP00000406708:L43V;ENSP00000405325:L43V	ENSP00000358724:L71V	L	+	1	2	GSTO1	106009391	0.305000	0.24481	0.723000	0.30687	0.926000	0.56050	0.717000	0.25851	0.806000	0.34183	-0.300000	0.09419	CTG	.	.		0.458	GSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050193.1	NM_004832	
CFAP46	54777	hgsc.bcm.edu	37	10	134705879	134705879	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:134705879C>T	ENST00000368586.5	-	25	3362	c.3262G>A	c.(3262-3264)Gac>Aac	p.D1088N	TTC40_ENST00000368582.2_Missense_Mutation_p.D1088N	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CCCTGGAAGTCGGCCGTGGGC	0.512																																					p.D1088N		Atlas-SNP	.											.	TTC40	100	.	0			c.G3262A						.																																			SO:0001583	missense	54777	exon25			GGAAGTCGGCCGT																												ENST00000368586.5:c.3262G>A	chr10.hg19:g.134705879C>T	ENSP00000357575:p.Asp1088Asn	74.0	0.0		78.0	38.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938160	0.52972	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.49432	2.76;0.78	4.34	4.34	0.51931	.	.	.	.	.	T	0.53674	0.1811	.	.	.	0.26230	N	0.979037	.	.	.	.	.	.	T	0.50268	-0.8848	6	0.54805	T	0.06	.	14.1676	0.65488	0.0:1.0:0.0:0.0	.	.	.	.	N	1088	ENSP00000357575:D1088N;ENSP00000357571:D1088N	ENSP00000357571:D1088N	D	-	1	0	C10orf93	134555869	0.986000	0.35501	0.835000	0.33067	0.013000	0.08279	3.511000	0.53400	2.143000	0.66587	0.655000	0.94253	GAC	.	.		0.512	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
OR5R1	219479	hgsc.bcm.edu	37	11	56185036	56185036	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:56185036T>C	ENST00000312253.1	-	1	672	c.673A>G	c.(673-675)Atc>Gtc	p.I225V		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					ATCCTTAGGATAGCGGCAATA	0.438																																					p.I225V		Atlas-SNP	.											.	OR5R1	83	.	0			c.A673G						.						125.0	112.0	116.0					11																	56185036		2201	4296	6497	SO:0001583	missense	219479	exon1			TTAGGATAGCGGC	AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.673A>G	chr11.hg19:g.56185036T>C	ENSP00000308595:p.Ile225Val	147.0	0.0		168.0	69.0	NM_001004744		Missense_Mutation	SNP	ENST00000312253.1	hg19	CCDS31530.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469564	0.43839	.	.	ENSG00000174942	ENST00000312253	T	0.00024	8.98	5.53	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33327	U	0.005038	T	0.00178	0.0005	L	0.38531	1.155	0.09310	N	0.999999	P	0.40578	0.722	P	0.48400	0.576	T	0.38672	-0.9650	10	0.56958	D	0.05	-12.1393	9.3702	0.38250	0.0:0.1498:0.0:0.8502	.	225	Q8NH85	OR5R1_HUMAN	V	225	ENSP00000308595:I225V	ENSP00000308595:I225V	I	-	1	0	OR5R1	55941612	0.093000	0.21703	0.543000	0.28128	0.763000	0.43281	0.314000	0.19432	0.927000	0.37143	0.472000	0.43445	ATC	.	.		0.438	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744	
ANO1	55107	hgsc.bcm.edu	37	11	70033927	70033927	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:70033927G>T	ENST00000355303.5	+	26	3083	c.2778G>T	c.(2776-2778)gaG>gaT	p.E926D	ANO1_ENST00000525494.1_3'UTR|ANO1_ENST00000538023.1_Missense_Mutation_p.E926D|ANO1_ENST00000530676.1_Missense_Mutation_p.E780D|ANO1_ENST00000398543.2_Missense_Mutation_p.E780D|ANO1-AS1_ENST00000524987.1_RNA|ANO1_ENST00000531349.1_Missense_Mutation_p.E635D	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	926					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	TCCACAAGGAGAAGGTGCTCA	0.577																																					p.E926D		Atlas-SNP	.											.	ANO1	156	.	0			c.G2778T						.						40.0	48.0	45.0					11																	70033927		2126	4235	6361	SO:0001583	missense	55107	exon26			CAAGGAGAAGGTG	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.2778G>T	chr11.hg19:g.70033927G>T	ENSP00000347454:p.Glu926Asp	96.0	0.0		78.0	32.0	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	hg19	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977738	0.92982	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000530676;ENST00000531349;ENST00000539321	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.75117	0.3806	M	0.77616	2.38	0.80722	D	1	P;P	0.51057	0.941;0.941	P;P	0.55011	0.651;0.766	T	0.77892	-0.2418	9	.	.	.	.	17.3129	0.87214	0.0:0.0:1.0:0.0	.	635;926	E9PNA7;Q5XXA6	.;ANO1_HUMAN	D	926;926;780;684;780;635;253	ENSP00000347454:E926D;ENSP00000444689:E926D;ENSP00000381551:E780D;ENSP00000435797:E780D;ENSP00000432843:E635D	.	E	+	3	2	ANO1	69711575	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.263000	0.65507	2.099000	0.63709	0.462000	0.41574	GAG	.	.		0.577	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
MYO7A	4647	hgsc.bcm.edu	37	11	76867076	76867076	+	Missense_Mutation	SNP	A	A	T	rs376016858		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:76867076A>T	ENST00000409709.3	+	5	681	c.409A>T	c.(409-411)Att>Ttt	p.I137F	MYO7A_ENST00000458637.2_Missense_Mutation_p.I137F|MYO7A_ENST00000409893.1_Missense_Mutation_p.I137F|MYO7A_ENST00000409619.2_Missense_Mutation_p.I126F	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	137	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CATCTTTGCCATTGCTGACAA	0.567																																					p.I137F		Atlas-SNP	.											.	MYO7A	164	.	0			c.A409T						.						55.0	57.0	56.0					11																	76867076		2069	4206	6275	SO:0001583	missense	4647	exon5			TTTGCCATTGCTG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.409A>T	chr11.hg19:g.76867076A>T	ENSP00000386331:p.Ile137Phe	67.0	0.0		74.0	41.0	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	a	17.89	3.500552	0.64298	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64	5.1	5.1	0.69264	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.96725	0.8931	H	0.96489	3.83	0.80722	D	1	D;P;P	0.58620	0.983;0.692;0.848	D;P;P	0.71184	0.972;0.795;0.875	D	0.97900	1.0302	10	0.72032	D	0.01	.	15.05	0.71862	1.0:0.0:0.0:0.0	.	137;137;137	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	F	137;137;137;126;136;136;136;136	ENSP00000386331:I137F;ENSP00000386689:I137F;ENSP00000392185:I137F;ENSP00000386635:I126F	ENSP00000345075:I136F	I	+	1	0	MYO7A	76544724	1.000000	0.71417	0.980000	0.43619	0.397000	0.30659	6.163000	0.71880	2.149000	0.67028	0.478000	0.44815	ATT	.	.		0.567	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
PRCP	5547	hgsc.bcm.edu	37	11	82536148	82536148	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:82536148G>T	ENST00000313010.3	-	9	1485	c.1291C>A	c.(1291-1293)Ccc>Acc	p.P431T	PRCP_ENST00000525772.1_5'UTR|PRCP_ENST00000393399.2_Missense_Mutation_p.P452T|PRCP_ENST00000535099.1_Missense_Mutation_p.P326T	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	431					angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						CCTGACCAGGGGTCTAGTTCA	0.428																																					p.P452T		Atlas-SNP	.											.	PRCP	69	.	0			c.C1354A						.						65.0	60.0	62.0					11																	82536148		2203	4300	6503	SO:0001583	missense	5547	exon10			ACCAGGGGTCTAG	BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.1291C>A	chr11.hg19:g.82536148G>T	ENSP00000317362:p.Pro431Thr	87.0	0.0		90.0	32.0	NM_199418	A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	ENST00000313010.3	hg19	CCDS8262.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531771	0.85706	.	.	ENSG00000137509	ENST00000313010;ENST00000393399;ENST00000535099	T;T;T	0.35789	1.29;1.29;1.29	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.73976	0.3656	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82721	-0.0317	9	.	.	.	-15.0747	19.2129	0.93765	0.0:0.0:1.0:0.0	.	431;452	P42785;A8MU24	PCP_HUMAN;.	T	431;452;326	ENSP00000317362:P431T;ENSP00000377055:P452T;ENSP00000442077:P326T	.	P	-	1	0	PRCP	82213796	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.190000	0.89714	2.629000	0.89072	0.467000	0.42956	CCC	.	.		0.428	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391792.1	NM_005040	
DSCAML1	57453	hgsc.bcm.edu	37	11	117375715	117375715	+	Silent	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:117375715G>A	ENST00000321322.6	-	10	2287	c.2286C>T	c.(2284-2286)atC>atT	p.I762I	DSCAML1_ENST00000527706.1_Silent_p.I492I	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	702	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTTTGCCGTAGATGCCATCCT	0.562																																					p.I762I		Atlas-SNP	.											.	DSCAML1	286	.	0			c.C2286T						.						106.0	90.0	95.0					11																	117375715		2201	4296	6497	SO:0001819	synonymous_variant	57453	exon10			GCCGTAGATGCCA		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2286C>T	chr11.hg19:g.117375715G>A		64.0	0.0		65.0	25.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	hg19	CCDS8384.1																																																																																			.	.		0.562	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
SLC6A12	6539	hgsc.bcm.edu	37	12	301686	301686	+	Missense_Mutation	SNP	G	G	T	rs138858909		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:301686G>T	ENST00000428720.1	-	15	2402	c.1659C>A	c.(1657-1659)ttC>ttA	p.F553L	RP11-283I3.1_ENST00000544067.1_RNA|SLC6A12_ENST00000536824.1_Missense_Mutation_p.F553L|SLC6A12_ENST00000424061.2_Missense_Mutation_p.F553L|SLC6A12_ENST00000397296.2_Missense_Mutation_p.F553L|SLC6A12_ENST00000359674.4_Missense_Mutation_p.F553L	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	553					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			TGATGACGACGAAGAGTGGGA	0.562																																					p.F553L		Atlas-SNP	.											.	SLC6A12	60	.	0			c.C1659A						.						109.0	110.0	110.0					12																	301686		2203	4300	6503	SO:0001583	missense	6539	exon15			GACGACGAAGAGT	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1659C>A	chr12.hg19:g.301686G>T	ENSP00000388184:p.Phe553Leu	103.0	0.0		123.0	57.0	NM_001122848	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	ENST00000428720.1	hg19	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	G	4.047	0.006307	0.07866	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75	4.49	1.05	0.20165	.	0.277462	0.35936	N	0.002881	T	0.60090	0.2242	L	0.42008	1.315	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.47407	-0.9120	10	0.37606	T	0.19	.	4.5752	0.12230	0.3054:0.1556:0.5389:0.0	.	553	P48065	S6A12_HUMAN	L	553	ENSP00000352702:F553L;ENSP00000380464:F553L;ENSP00000388184:F553L;ENSP00000399136:F553L;ENSP00000444268:F553L	ENSP00000352702:F553L	F	-	3	2	SLC6A12	171947	0.001000	0.12720	0.045000	0.18777	0.006000	0.05464	-0.012000	0.12699	0.085000	0.17107	-0.175000	0.13238	TTC	.	G|1.000;A|0.000		0.562	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2	NM_003044	
GPR162	27239	hgsc.bcm.edu	37	12	6933886	6933886	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:6933886C>T	ENST00000311268.3	+	2	1609	c.822C>T	c.(820-822)agC>agT	p.S274S	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						ACTTGGTCAGCGCCATCGTCT	0.597																																					p.S274S		Atlas-SNP	.											GPR162,NS,carcinoma,0,1	GPR162	55	.	0			c.C822T						.						63.0	63.0	63.0					12																	6933886		2203	4300	6503	SO:0001819	synonymous_variant	27239	exon2			GGTCAGCGCCATC	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.822C>T	chr12.hg19:g.6933886C>T		46.0	1.0		49.0	20.0	NM_019858	Q16664|Q59EH5|Q66K56	Silent	SNP	ENST00000311268.3	hg19	CCDS8563.1																																																																																			.	.		0.597	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
NACA	4666	hgsc.bcm.edu	37	12	57107416	57107416	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:57107416T>C	ENST00000454682.1	-	6	6156	c.5875A>G	c.(5875-5877)Atc>Gtc	p.I1959V	NACA_ENST00000546392.1_Missense_Mutation_p.I96V|NACA_ENST00000552540.1_Missense_Mutation_p.I96V|NACA_ENST00000393891.4_Missense_Mutation_p.I96V|NACA_ENST00000550952.1_Missense_Mutation_p.I806V|NACA_ENST00000551793.1_5'Flank|NACA_ENST00000548563.1_Missense_Mutation_p.I17V|NACA_ENST00000356769.3_Missense_Mutation_p.I96V	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1959	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GATTTCCGGATAGTGACTCTA	0.423			T	BCL6	NHL																																p.I806V		Atlas-SNP	.		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	.	NACA	131	.	0			c.A2416G						.						156.0	160.0	159.0					12																	57107416		2203	4300	6503	SO:0001583	missense	4666	exon8			TCCGGATAGTGAC	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5875A>G	chr12.hg19:g.57107416T>C	ENSP00000403817:p.Ile1959Val	71.0	0.0		100.0	37.0	NM_001113203		Missense_Mutation	SNP	ENST00000454682.1	hg19		.	.	.	.	.	.	.	.	.	.	T	20.4	3.976022	0.74360	.	.	ENSG00000196531	ENST00000550920;ENST00000454682;ENST00000550952;ENST00000356769;ENST00000552540;ENST00000393891;ENST00000548563;ENST00000546392;ENST00000549259;ENST00000552055;ENST00000546862;ENST00000549855	T;T;T;T;T;T;T;T;T;T	0.55930	0.75;0.57;0.49;0.74;0.74;0.74;0.74;0.75;0.63;0.6	5.15	5.15	0.70609	Nascent polypeptide-associated complex NAC (2);	0.000000	0.85682	D	0.000000	T	0.70701	0.3254	M	0.77103	2.36	0.54753	D	0.999986	P;D;P	0.64830	0.949;0.994;0.76	D;D;P	0.66084	0.94;0.941;0.484	T	0.73496	-0.3964	10	0.49607	T	0.09	.	13.9523	0.64126	0.0:0.0:0.0:1.0	.	1959;806;96	E9PAV3;F8VU71;Q13765	.;.;NACA_HUMAN	V	94;1959;806;96;96;96;17;96;96;92;17;96	ENSP00000448039:I94V;ENSP00000403817:I1959V;ENSP00000448035:I806V;ENSP00000349212:I96V;ENSP00000447821:I96V;ENSP00000377469:I96V;ENSP00000446801:I96V;ENSP00000447133:I96V;ENSP00000450383:I92V;ENSP00000447764:I96V	ENSP00000349212:I96V	I	-	1	0	NACA	55393683	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.972000	0.88022	1.950000	0.56595	0.455000	0.32223	ATC	.	.		0.423	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	
SYT1	6857	hgsc.bcm.edu	37	12	79611325	79611325	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:79611325C>G	ENST00000261205.4	+	4	683	c.26C>G	c.(25-27)gCc>gGc	p.A9G	SYT1_ENST00000393240.3_Missense_Mutation_p.A9G|SYT1_ENST00000552744.1_Missense_Mutation_p.A9G|SYT1_ENST00000457153.2_Missense_Mutation_p.A9G	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	9					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						CACCATGAGGCCCTGGCAGCC	0.532																																					p.A9G		Atlas-SNP	.											.	SYT1	70	.	0			c.C26G						.						43.0	44.0	44.0					12																	79611325		2203	4300	6503	SO:0001583	missense	6857	exon5			ATGAGGCCCTGGC		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.26C>G	chr12.hg19:g.79611325C>G	ENSP00000261205:p.Ala9Gly	43.0	0.0		27.0	8.0	NM_001135805	Q6AI31	Missense_Mutation	SNP	ENST00000261205.4	hg19	CCDS9017.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207659	0.58343	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552074;ENST00000547046;ENST00000549671;ENST00000551304;ENST00000552744;ENST00000552624;ENST00000446242	T;T;T;T;T;T	0.61040	0.16;0.16;0.14;0.16;1.74;2.34	5.51	5.51	0.81932	.	0.119371	0.56097	D	0.000029	T	0.51483	0.1677	L	0.55990	1.75	0.58432	D	0.999994	B;B	0.30193	0.272;0.272	B;B	0.26770	0.073;0.073	T	0.51140	-0.8743	10	0.41790	T	0.15	.	12.7221	0.57147	0.0:0.9246:0.0:0.0754	.	9;9	Q6AI31;P21579	.;SYT1_HUMAN	G	9	ENSP00000376932:A9G;ENSP00000261205:A9G;ENSP00000391056:A9G;ENSP00000447575:A9G;ENSP00000448861:A9G;ENSP00000401559:A9G	ENSP00000261205:A9G	A	+	2	0	SYT1	78135456	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.299000	0.59073	2.583000	0.87209	0.643000	0.83706	GCC	.	.		0.532	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259415.1	NM_005639	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85518023	85518023	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:85518023C>T	ENST00000393217.2	+	17	3794	c.3733C>T	c.(3733-3735)Caa>Taa	p.Q1245*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1245										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CAGCACTCTGCAAAATGGAGT	0.478																																					p.Q1245X		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.C3733T						.						100.0	103.0	102.0					12																	85518023		2203	4300	6503	SO:0001587	stop_gained	84125	exon17			ACTCTGCAAAATG	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3733C>T	chr12.hg19:g.85518023C>T	ENSP00000376910:p.Gln1245*	80.0	0.0		97.0	39.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	hg19	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	37	6.591134	0.97688	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.61	4.7	0.59300	.	0.983063	0.08264	N	0.972481	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	9.7991	0.40753	0.1392:0.5589:0.3019:0.0	.	.	.	.	X	1245;1220;1245	.	ENSP00000256007:Q1245X	Q	+	1	0	LRRIQ1	84042154	1.000000	0.71417	0.017000	0.16124	0.004000	0.04260	1.420000	0.34804	1.320000	0.45209	0.585000	0.79938	CAA	.	.		0.478	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
ATP2B1	490	hgsc.bcm.edu	37	12	90035972	90035972	+	Silent	SNP	G	G	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:90035972G>C	ENST00000428670.3	-	3	825	c.369C>G	c.(367-369)ggC>ggG	p.G123G	ATP2B1_ENST00000261173.2_Silent_p.G123G|ATP2B1_ENST00000359142.3_Silent_p.G123G|ATP2B1_ENST00000348959.3_Silent_p.G123G			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	123					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						AAAAAGAAAGGCCCAATGATA	0.358																																					p.G123G		Atlas-SNP	.											.	ATP2B1	191	.	0			c.C369G						.						139.0	155.0	149.0					12																	90035972		2203	4299	6502	SO:0001819	synonymous_variant	490	exon2			AGAAAGGCCCAAT	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.369C>G	chr12.hg19:g.90035972G>C		83.0	0.0		92.0	33.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	ENST00000428670.3	hg19	CCDS9035.1																																																																																			.	.		0.358	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
CORO1C	23603	hgsc.bcm.edu	37	12	109051082	109051083	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:109051082_109051083GA>TT	ENST00000261401.3	-	6	919_920	c.747_748TC>AA	c.(745-750)aaTCcg>aaAAcg	p.249_250NP>KT	CORO1C_ENST00000549772.1_Missense_Mutation_p.255_256NP>KT|CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000421578.2_Missense_Mutation_p.144_145NP>KT|CORO1C_ENST00000420959.2_Missense_Mutation_p.302_303NP>KT|CORO1C_ENST00000541050.1_Missense_Mutation_p.249_250NP>KT	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	249					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						GGGCGTACCGGATTCCAGAGAG	0.535																																					p.M250M|p.F249L		Atlas-SNP	.											.	CORO1C	53	.	0			c.A748A|c.C747A						.																																			SO:0001583	missense	23603	exon6			GTACCGGATTCCA|TACCGGATTCCAG	BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.747_748delinsTT	chr12.hg19:g.109051082_109051083delinsTT	ENSP00000261401:p.N249_P250delinsKT	67.0	0.0		42.0	12.0	NM_014325	A7MAP0|A7MAP1|B3KU12|Q9NSK5	Silent|Missense_Mutation	SNP	ENST00000261401.3	hg19	CCDS9120.1																																																																																			.	.		0.535	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403802.1	NM_014325	
ZNF268	10795	hgsc.bcm.edu	37	12	133780200	133780200	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:133780200A>G	ENST00000536435.2	+	6	2258	c.1928A>G	c.(1927-1929)aAt>aGt	p.N643S	ZNF268_ENST00000228289.5_Missense_Mutation_p.N643S|ZNF268_ENST00000537565.1_Missense_Mutation_p.N482S|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000541009.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	643					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TATAGTTGTAATGAATGTGGA	0.383																																					p.N643S		Atlas-SNP	.											.	ZNF268	71	.	0			c.A1928G						.						77.0	69.0	71.0					12																	133780200		692	1591	2283	SO:0001583	missense	10795	exon6			GTTGTAATGAATG	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1928A>G	chr12.hg19:g.133780200A>G	ENSP00000444412:p.Asn643Ser	8.0	0.0		13.0	6.0	NM_001165881	Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	ENST00000536435.2	hg19	CCDS45012.1	.	.	.	.	.	.	.	.	.	.	A	6.362	0.434851	0.12045	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.07216	3.21;3.21	4.28	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02688	0.0081	N	0.02403	-0.565	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.47598	-0.9105	8	.	.	.	.	4.2469	0.10675	0.399:0.1692:0.4318:0.0	.	643;482	Q14587;Q14587-2	ZN268_HUMAN;.	S	643;643;482;482	ENSP00000228289:N643S;ENSP00000445713:N482S	.	N	+	2	0	ZNF268	.	0.000000	0.05858	0.916000	0.36221	0.976000	0.68499	-3.011000	0.00647	0.415000	0.25817	-0.242000	0.12053	AAT	.	.		0.383	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2	NM_152943	
NHLRC3	387921	hgsc.bcm.edu	37	13	39613820	39613820	+	Silent	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr13:39613820A>G	ENST00000379600.3	+	3	679	c.357A>G	c.(355-357)caA>caG	p.Q119Q	PROSER1_ENST00000352251.3_5'Flank|PROSER1_ENST00000350125.3_5'Flank|NHLRC3_ENST00000470258.1_5'UTR|NHLRC3_ENST00000379599.2_Silent_p.Q119Q	NM_001012754.3	NP_001012772.1	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3	119						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|skin(2)	11		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		TATATGAACAATCCGTCTGGA	0.368																																					p.Q119Q		Atlas-SNP	.											.	NHLRC3	35	.	0			c.A357G						.						89.0	88.0	88.0					13																	39613820		2203	4300	6503	SO:0001819	synonymous_variant	387921	exon3			TGAACAATCCGTC		CCDS31961.1, CCDS31962.1	13q13.3	2007-12-18			ENSG00000188811	ENSG00000188811			33751	protein-coding gene	gene with protein product							Standard	NM_001017370		Approved		uc001uxc.4	Q5JS37	OTTHUMG00000016765	ENST00000379600.3:c.357A>G	chr13.hg19:g.39613820A>G		87.0	0.0		124.0	43.0	NM_001012754	B2RTZ2|B4DTL0|Q69YI9	Silent	SNP	ENST00000379600.3	hg19	CCDS31961.1																																																																																			.	.		0.368	NHLRC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044616.2	NM_001012754	
RASA3	22821	hgsc.bcm.edu	37	13	114778624	114778624	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr13:114778624G>T	ENST00000334062.7	-	15	1627	c.1506C>A	c.(1504-1506)caC>caA	p.H502Q	RASA3_ENST00000389544.4_Missense_Mutation_p.H470Q	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	502	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCACCGTGTGGTGCGGCGTGA	0.642																																					p.H502Q		Atlas-SNP	.											.	RASA3	83	.	0			c.C1506A						.						91.0	71.0	78.0					13																	114778624		2203	4300	6503	SO:0001583	missense	22821	exon15			CGTGTGGTGCGGC		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1506C>A	chr13.hg19:g.114778624G>T	ENSP00000335029:p.His502Gln	55.0	0.0		61.0	20.0	NM_007368	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	hg19	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.643944	0.29246	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.79033	-1.23;-1.23	5.0	1.83	0.25207	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	T	0.76026	0.3930	L	0.50847	1.595	0.80722	D	1	B	0.30686	0.29	P	0.46975	0.533	T	0.66893	-0.5808	9	.	.	.	.	5.4691	0.16660	0.5661:0.0:0.4339:0.0	.	502	Q14644	RASA3_HUMAN	Q	502;470	ENSP00000335029:H502Q;ENSP00000374195:H470Q	.	H	-	3	2	RASA3	113796726	1.000000	0.71417	0.998000	0.56505	0.380000	0.30137	0.536000	0.23129	0.516000	0.28340	0.491000	0.48974	CAC	.	.		0.642	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
CRIP2	1397	hgsc.bcm.edu	37	14	105945139	105945139	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr14:105945139C>T	ENST00000329146.4	+	4	981	c.268C>T	c.(268-270)Ccc>Tcc	p.P90S	CRIP2_ENST00000548989.1_3'UTR|CRIP2_ENST00000483017.3_Missense_Mutation_p.P164S	NM_001312.3	NP_001303.1	P52943	CRIP2_HUMAN	cysteine-rich protein 2	90					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	cell cortex (GO:0005938)	zinc ion binding (GO:0008270)			lung(2)	2		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.235)		GGTCACCGGCCCCATCGAGGT	0.761																																					p.P164S		Atlas-SNP	.											.	CRIP2	7	.	0			c.C490T						.						1.0	1.0	1.0					14																	105945139		732	1540	2272	SO:0001583	missense	1397	exon4			ACCGGCCCCATCG		CCDS10003.1, CCDS59246.1	14q32.3	2008-08-11			ENSG00000182809	ENSG00000182809			2361	protein-coding gene	gene with protein product		601183				8843343, 10681529	Standard	NM_001312		Approved	CRP2, ESP1	uc031qqr.1	P52943	OTTHUMG00000029906	ENST00000329146.4:c.268C>T	chr14.hg19:g.105945139C>T	ENSP00000328521:p.Pro90Ser	23.0	0.0		40.0	10.0	NM_001270837	A1A4U1|B7Z6C0|E9PD13	Missense_Mutation	SNP	ENST00000329146.4	hg19	CCDS10003.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	11.18|11.18	1.562887|1.562887	0.27915|0.27915	.|.	.|.	ENSG00000182809|ENSG00000182809	ENST00000538259|ENST00000483017;ENST00000329146	.|T;T	.|0.71341	.|-0.56;-0.23	3.46|3.46	3.46|3.46	0.39613|0.39613	.|.	51.284300|51.284300	0.00783|0.00783	U|U	0.001289|0.001289	T|T	0.56426|0.56426	0.1984|0.1984	N|N	0.14661|0.14661	0.345|0.345	0.43351|0.43351	D|D	0.995413|0.995413	.|B;B;B	.|0.26081	.|0.141;0.141;0.002	.|B;B;B	.|0.20767	.|0.012;0.031;0.001	T|T	0.24728|0.24728	-1.0152|-1.0152	6|10	.|0.07990	.|T	.|0.79	-0.1639|-0.1639	13.6859|13.6859	0.62515|0.62515	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|164;90;90	.|B7Z6C0;Q53FN1;P52943	.|.;.;CRIP2_HUMAN	L|S	73|164;90	.|ENSP00000426119:P164S;ENSP00000328521:P90S	.|ENSP00000328521:P90S	P|P	+|+	2|1	0|0	CRIP2|CRIP2	105016184|105016184	0.512000|0.512000	0.26186|0.26186	1.000000|1.000000	0.80357|0.80357	0.880000|0.880000	0.50808|0.50808	1.502000|1.502000	0.35704|0.35704	1.787000|1.787000	0.52448|0.52448	0.282000|0.282000	0.19409|0.19409	CCC|CCC	.	.		0.761	CRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074597.3	NM_001312	
NDN	4692	hgsc.bcm.edu	37	15	23931788	23931788	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr15:23931788T>G	ENST00000331837.4	-	1	662	c.577A>C	c.(577-579)Atg>Ctg	p.M193L		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	193	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CTCAGGATCATGAGCAGGAGG	0.652									Prader-Willi syndrome																												p.M193L		Atlas-SNP	.											.	NDN	79	.	0			c.A577C						.						26.0	25.0	25.0					15																	23931788		2202	4292	6494	SO:0001583	missense	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	GGATCATGAGCAG	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.577A>C	chr15.hg19:g.23931788T>G	ENSP00000332643:p.Met193Leu	61.0	0.0		98.0	44.0	NM_002487	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	hg19	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.686539	0.47991	.	.	ENSG00000182636	ENST00000331837	T	0.03860	3.78	3.22	3.22	0.36961	.	0.059288	0.64402	D	0.000003	T	0.01695	0.0054	N	0.00885	-1.115	0.29880	N	0.826124	B	0.20988	0.05	B	0.31290	0.127	T	0.42982	-0.9419	10	0.12766	T	0.61	.	8.2254	0.31566	0.0:0.0:0.0:1.0	.	193	Q99608	NECD_HUMAN	L	193	ENSP00000332643:M193L	ENSP00000332643:M193L	M	-	1	0	NDN	21482881	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.268000	0.33062	1.720000	0.51447	0.459000	0.35465	ATG	.	.		0.652	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
USP3	9960	hgsc.bcm.edu	37	15	63881201	63881201	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr15:63881201A>G	ENST00000380324.3	+	14	1517	c.1388A>G	c.(1387-1389)cAt>cGt	p.H463R	USP3-AS1_ENST00000559737.1_RNA|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000559357.1_RNA|USP3-AS1_ENST00000561191.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000268049.7_Missense_Mutation_p.H441R|USP3_ENST00000558285.1_Missense_Mutation_p.H446R|USP3_ENST00000559711.1_Missense_Mutation_p.H374R|USP3-AS1_ENST00000560350.1_RNA|USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000558831.1_RNA|USP3-AS1_ENST00000561256.1_RNA|USP3_ENST00000539772.1_Missense_Mutation_p.H214R|USP3_ENST00000540797.1_Missense_Mutation_p.H419R|USP3_ENST00000558218.1_3'UTR	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	463	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		GTGGTGCACCATGGTTCCGGG	0.552																																					p.H463R		Atlas-SNP	.											.	USP3	37	.	0			c.A1388G						.						170.0	165.0	167.0					15																	63881201		2203	4300	6503	SO:0001583	missense	9960	exon14			TGCACCATGGTTC	AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1388A>G	chr15.hg19:g.63881201A>G	ENSP00000369681:p.His463Arg	103.0	0.0		94.0	36.0	NM_006537	B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	hg19	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	A	19.40	3.821312	0.71028	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000538686	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.28	5.28	0.74379	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.34919	0.0914	L	0.61036	1.89	0.58432	D	0.999999	B;B;B;B	0.26708	0.064;0.157;0.157;0.157	B;B;B;B	0.31245	0.056;0.126;0.126;0.126	T	0.10405	-1.0631	10	0.27785	T	0.31	.	15.493	0.75624	1.0:0.0:0.0:0.0	.	419;419;441;463	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	R	419;463;441;214;294	ENSP00000445828:H419R;ENSP00000369681:H463R;ENSP00000268049:H441R;ENSP00000445642:H214R	ENSP00000268049:H441R	H	+	2	0	USP3	61668254	1.000000	0.71417	0.928000	0.36995	0.992000	0.81027	7.469000	0.80959	2.129000	0.65627	0.533000	0.62120	CAT	.	.		0.552	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
SEMA7A	8482	hgsc.bcm.edu	37	15	74703257	74703257	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr15:74703257G>A	ENST00000261918.4	-	14	2257	c.1709C>T	c.(1708-1710)tCc>tTc	p.S570F	SEMA7A_ENST00000542748.1_Missense_Mutation_p.S405F|SEMA7A_ENST00000543145.2_Missense_Mutation_p.S556F	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	570	Ig-like C2-type.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						GGCGTGGCGGGATTCCATGGG	0.617																																					p.S570F		Atlas-SNP	.											.	SEMA7A	58	.	0			c.C1709T						.						100.0	102.0	101.0					15																	74703257		2197	4296	6493	SO:0001583	missense	8482	exon14			TGGCGGGATTCCA	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.1709C>T	chr15.hg19:g.74703257G>A	ENSP00000261918:p.Ser570Phe	59.0	0.0		60.0	27.0	NM_003612	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	ENST00000261918.4	hg19	CCDS10262.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056403	0.76074	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.14516	2.5;2.5;2.5	4.55	4.55	0.56014	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.33789	0.0875	L	0.59436	1.845	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.07290	-1.0780	10	0.72032	D	0.01	-29.3795	15.1021	0.72288	0.0:0.0:1.0:0.0	.	556;570	F5H1S0;O75326	.;SEM7A_HUMAN	F	570;556;405	ENSP00000261918:S570F;ENSP00000438966:S556F;ENSP00000441493:S405F	ENSP00000261918:S570F	S	-	2	0	SEMA7A	72490310	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.133000	0.71682	2.094000	0.63399	0.555000	0.69702	TCC	.	.		0.617	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
VPS33B	26276	hgsc.bcm.edu	37	15	91548981	91548981	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr15:91548981T>C	ENST00000333371.3	-	13	1326	c.973A>G	c.(973-975)Aat>Gat	p.N325D	VPS33B_ENST00000535843.1_Missense_Mutation_p.N234D|VPS33B_ENST00000535906.1_Missense_Mutation_p.N298D	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	325					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					GACACGAAATTCTTCATCTGC	0.567																																					p.N325D		Atlas-SNP	.											.	VPS33B	42	.	0			c.A973G						.						100.0	88.0	92.0					15																	91548981		2198	4298	6496	SO:0001583	missense	26276	exon13			CGAAATTCTTCAT	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.973A>G	chr15.hg19:g.91548981T>C	ENSP00000327650:p.Asn325Asp	69.0	0.0		98.0	37.0	NM_018668	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	ENST00000333371.3	hg19	CCDS10369.1	.	.	.	.	.	.	.	.	.	.	T	2.975	-0.211555	0.06140	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.79454	-1.27;-1.27;-1.27	5.65	3.36	0.38483	.	0.206931	0.48767	N	0.000162	T	0.49745	0.1575	N	0.04018	-0.295	0.36927	D	0.89168	B;B	0.18610	0.023;0.029	B;B	0.18561	0.013;0.022	T	0.48670	-0.9015	10	0.02654	T	1	-15.5283	8.9629	0.35858	0.0:0.2121:0.0:0.7879	.	298;325	F5H008;Q9H267	.;VP33B_HUMAN	D	325;298;234;280	ENSP00000327650:N325D;ENSP00000444053:N298D;ENSP00000446267:N234D	ENSP00000327650:N325D	N	-	1	0	VPS33B	89349985	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	1.109000	0.31135	0.567000	0.29293	-0.256000	0.11100	AAT	.	.		0.567	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668	
NDUFB10	4716	hgsc.bcm.edu	37	16	2011585	2011586	+	Nonsense_Mutation	DNP	TA	TA	AT			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr16:2011585_2011586TA>AT	ENST00000268668.6	+	3	474_475	c.357_358TA>AT	c.(355-360)tgTAtc>tgATtc	p.119_120CI>*F	NDUFB10_ENST00000543683.2_Nonsense_Mutation_p.119_120CI>*F|SNORA10_ENST00000384084.1_RNA|SNORA64_ENST00000384674.1_RNA|NDUFB10_ENST00000569148.1_Nonsense_Mutation_p.108_109CI>*F	NM_004548.2	NP_004539.1	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa	119					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			lung(1)|urinary_tract(1)	2						AGCAGAACTGTATCAAGGAAGT	0.564																																					p.C119X|p.I120F		Atlas-SNP	.											.	NDUFB10	17	.	0			c.T357A|c.A358T						.																																			SO:0001587	stop_gained	4716	exon3			GAACTGTATCAAG|AACTGTATCAAGG	AF044954	CCDS10451.1	16p13.3	2011-07-04	2002-08-29		ENSG00000140990	ENSG00000140990		"""Mitochondrial respiratory chain complex / Complex I"""	7696	protein-coding gene	gene with protein product	"""complex I PDSW subunit"""	603843	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (22kD, PDSW)"""			9763677, 9878551	Standard	NM_004548		Approved	PDSW	uc002cni.2	O96000	OTTHUMG00000128709	Exception_encountered	chr16.hg19:g.2011585_2011586delinsAT	ENSP00000268668:p.C119_I120delins*F	98.0	0.0		101.0	44.0	NM_004548	Q96II6	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000268668.6	hg19	CCDS10451.1																																																																																			.	.		0.564	NDUFB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250614.2	NM_004548	
OTOA	146183	hgsc.bcm.edu	37	16	21698947	21698947	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr16:21698947C>T	ENST00000286149.4	+	7	614	c.613C>T	c.(613-615)Cgc>Tgc	p.R205C	OTOA_ENST00000388956.4_Missense_Mutation_p.R126C|OTOA_ENST00000388958.3_Missense_Mutation_p.R205C			Q7RTW8	OTOAN_HUMAN	otoancorin	205					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)		p.R205G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TCGGGACCTGCGCGAGGATGC	0.542																																					p.R205C		Atlas-SNP	.											OTOA,NS,carcinoma,0,1	OTOA	144	.	1	Substitution - Missense(1)	lung(1)	c.C613T						.						33.0	31.0	32.0					16																	21698947		2199	4300	6499	SO:0001583	missense	146183	exon7			GACCTGCGCGAGG	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.613C>T	chr16.hg19:g.21698947C>T	ENSP00000286149:p.Arg205Cys	78.0	0.0		98.0	39.0	NM_144672	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	hg19		.	.	.	.	.	.	.	.	.	.	C	4.169	0.029956	0.08101	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956	T;T;T	0.13196	2.61;2.61;2.61	4.36	1.24	0.21308	.	0.331976	0.25192	N	0.032444	T	0.09992	0.0245	L	0.40543	1.245	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.23154	-1.0196	10	0.45353	T	0.12	-0.245	6.0997	0.20041	0.0:0.6637:0.1542:0.1821	.	126;205	B3KWU3;E9PF51	.;.	C	205;205;126	ENSP00000373610:R205C;ENSP00000286149:R205C;ENSP00000373608:R126C	ENSP00000286149:R205C	R	+	1	0	OTOA	21606448	0.033000	0.19621	0.033000	0.17914	0.134000	0.20937	0.725000	0.25970	-0.001000	0.14495	-0.262000	0.10625	CGC	.	.		0.542	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1		
IRX3	79191	hgsc.bcm.edu	37	16	54318534	54318534	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr16:54318534G>C	ENST00000329734.3	-	2	1971	c.1259C>G	c.(1258-1260)cCc>cGc	p.P420R		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	420	Pro-rich.				mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GTGCAGGCGGGGGCCGGGCGG	0.781																																					p.P420R	GBM(143;1830 1866 4487 4646 37383)	Atlas-SNP	.											.	IRX3	25	.	0			c.C1259G						.						2.0	2.0	2.0					16																	54318534		898	2112	3010	SO:0001583	missense	79191	exon2			AGGCGGGGGCCGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1259C>G	chr16.hg19:g.54318534G>C	ENSP00000331608:p.Pro420Arg	21.0	0.0		18.0	13.0	NM_024336	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	hg19	CCDS10750.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427863	0.25726	.	.	ENSG00000177508	ENST00000329734	T	0.54071	0.59	4.4	3.45	0.39498	.	0.509375	0.19782	N	0.106198	T	0.43590	0.1254	L	0.36672	1.1	0.24597	N	0.993794	D	0.61080	0.989	P	0.47573	0.55	T	0.20371	-1.0277	10	0.24483	T	0.36	-4.5461	8.096	0.30829	0.1104:0.0:0.8896:0.0	.	420	P78415	IRX3_HUMAN	R	420	ENSP00000331608:P420R	ENSP00000331608:P420R	P	-	2	0	IRX3	52876035	0.180000	0.23148	0.965000	0.40720	0.001000	0.01503	0.461000	0.21940	1.060000	0.40578	-0.136000	0.14681	CCC	.	.		0.781	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
DPEP2	64174	hgsc.bcm.edu	37	16	68023228	68023228	+	Silent	SNP	G	G	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr16:68023228G>T	ENST00000572888.1	-	8	1718	c.1068C>A	c.(1066-1068)ggC>ggA	p.G356G	DPEP2_ENST00000412757.2_Silent_p.G356G|DPEP2_ENST00000393847.1_Silent_p.G356G			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	356					arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		GCACTCACTTGCCGGCCCCAT	0.557																																					p.G356G		Atlas-SNP	.											.	DPEP2	43	.	0			c.C1068A						.						123.0	90.0	101.0					16																	68023228		2198	4300	6498	SO:0001819	synonymous_variant	64174	exon9			TCACTTGCCGGCC	AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.1068C>A	chr16.hg19:g.68023228G>T		62.0	0.0		62.0	31.0	NM_022355	B2RCF8|Q6UX92|Q8TC95	Silent	SNP	ENST00000572888.1	hg19	CCDS10857.1																																																																																			.	.		0.557	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1	NM_022355	
ZNF276	92822	hgsc.bcm.edu	37	16	89799791	89799791	+	Silent	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr16:89799791C>T	ENST00000443381.2	+	7	1348	c.1251C>T	c.(1249-1251)ccC>ccT	p.P417P	ZNF276_ENST00000446326.2_Silent_p.P203P|ZNF276_ENST00000289816.5_Silent_p.P342P|ZNF276_ENST00000568064.1_Silent_p.P325P	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GACCCAAGCCCGGATGGAAGA	0.547																																					p.P417P		Atlas-SNP	.											.	ZNF276	70	.	0			c.C1251T						.						120.0	138.0	132.0					16																	89799791		2198	4300	6498	SO:0001819	synonymous_variant	92822	exon7			CAAGCCCGGATGG	AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.1251C>T	chr16.hg19:g.89799791C>T		142.0	0.0		155.0	71.0	NM_001113525	Q0VGA1|Q2TBE8|Q3B7H7	Silent	SNP	ENST00000443381.2	hg19	CCDS45554.1																																																																																			.	.		0.547	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422517.1	NM_152287	
FAM222B	55731	hgsc.bcm.edu	37	17	27086796	27086796	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr17:27086796T>C	ENST00000341217.5	-	3	396	c.181A>G	c.(181-183)Atc>Gtc	p.I61V	FAM222B_ENST00000577682.1_Intron|FAM222B_ENST00000583522.1_Intron|FAM222B_ENST00000582266.1_Intron|FAM222B_ENST00000452648.3_Missense_Mutation_p.I61V|FAM222B_ENST00000581407.1_Missense_Mutation_p.I61V|FAM222B_ENST00000583953.1_Intron|FAM222B_ENST00000581381.1_Intron|FAM222B_ENST00000582059.1_Intron	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	61																	TTGGGGAAGATTTTTATAGTC	0.522																																					p.I61V		Atlas-SNP	.											.	.	.	.	0			c.A181G						.						65.0	67.0	66.0					17																	27086796		2030	4177	6207	SO:0001583	missense	55731	exon4			GGAAGATTTTTAT	AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.181A>G	chr17.hg19:g.27086796T>C	ENSP00000343115:p.Ile61Val	115.0	0.0		126.0	39.0	NM_018182	Q9H6F3|Q9NVJ4|Q9NXN6	Missense_Mutation	SNP	ENST00000341217.5	hg19	CCDS45637.1	.	.	.	.	.	.	.	.	.	.	T	9.223	1.033768	0.19590	.	.	ENSG00000173065	ENST00000341217;ENST00000452648	T;T	0.53640	0.61;0.61	4.5	3.42	0.39159	.	0.000000	0.85682	D	0.000000	T	0.44603	0.1301	M	0.68317	2.08	0.53005	D	0.999968	B	0.22541	0.071	B	0.20955	0.032	T	0.45264	-0.9273	10	0.87932	D	0	-4.4992	9.2346	0.37459	0.0:0.0863:0.0:0.9137	.	61	Q8WU58	CQ063_HUMAN	V	61	ENSP00000343115:I61V;ENSP00000413645:I61V	ENSP00000343115:I61V	I	-	1	0	C17orf63	24110922	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.469000	0.80959	0.877000	0.35895	0.459000	0.35465	ATC	.	.		0.522	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446703.1	NM_018182	
CLTC	1213	hgsc.bcm.edu	37	17	57743863	57743863	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr17:57743863A>G	ENST00000269122.3	+	12	2079	c.1805A>G	c.(1804-1806)aAt>aGt	p.N602S	CLTC_ENST00000393043.1_Missense_Mutation_p.N602S|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	602	Distal segment.|Heavy chain arm.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATTCTAGGCAATCAGATGTTC	0.393			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.N602S		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.A1805G						.						106.0	103.0	104.0					17																	57743863		2203	4300	6503	SO:0001583	missense	1213	exon12			TAGGCAATCAGAT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1805A>G	chr17.hg19:g.57743863A>G	ENSP00000269122:p.Asn602Ser	110.0	0.0		113.0	44.0	NM_004859	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	hg19	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.904339	0.92035	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.22743	1.94;1.94	5.84	5.84	0.93424	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.50956	0.1646	M	0.82630	2.6	0.80722	D	1	D;B	0.69078	0.997;0.283	D;B	0.80764	0.994;0.349	T	0.55617	-0.8113	10	0.59425	D	0.04	.	16.226	0.82293	1.0:0.0:0.0:0.0	.	602;602	Q00610;Q00610-2	CLH1_HUMAN;.	S	602	ENSP00000269122:N602S;ENSP00000376763:N602S	ENSP00000269122:N602S	N	+	2	0	CLTC	55098645	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.339000	0.96797	2.230000	0.72887	0.528000	0.53228	AAT	.	.		0.393	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
EPG5	57724	hgsc.bcm.edu	37	18	43490657	43490657	+	Missense_Mutation	SNP	T	T	C	rs200456950		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr18:43490657T>C	ENST00000282041.5	-	23	4068	c.4034A>G	c.(4033-4035)cAt>cGt	p.H1345R	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1345					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CAAATTGATATGAGCAGGACT	0.428											OREG0024952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H1345R		Atlas-SNP	.											.	EPG5	199	.	0			c.A4034G						.	T	ARG/HIS	0,3754		0,0,1877	80.0	77.0	78.0		4034	5.2	1.0	18		78	1,8227		0,1,4113	no	missense	EPG5	NM_020964.2	29	0,1,5990	CC,CT,TT		0.0122,0.0,0.0083	benign	1345/2580	43490657	1,11981	1877	4114	5991	SO:0001583	missense	57724	exon23			TTGATATGAGCAG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4034A>G	chr18.hg19:g.43490657T>C	ENSP00000282041:p.His1345Arg	93.0	0.0	916	95.0	34.0	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	hg19	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.986623	0.74589	0.0	1.22E-4	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.09911	2.93	5.22	5.22	0.72569	.	0.092864	0.40908	D	0.001000	T	0.19604	0.0471	L	0.59436	1.845	0.49582	D	0.9998	P;P	0.51933	0.949;0.949	P;P	0.51550	0.673;0.673	T	0.00458	-1.1727	10	0.62326	D	0.03	-16.202	11.4923	0.50387	0.1342:0.0:0.0:0.8658	.	1345;1345	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	R	1345;220	ENSP00000282041:H1345R	ENSP00000282041:H1345R	H	-	2	0	EPG5	41744655	1.000000	0.71417	0.996000	0.52242	0.958000	0.62258	5.907000	0.69908	1.977000	0.57605	0.533000	0.62120	CAT	.	T|0.999;C|0.001		0.428	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
SMIM7	79086	hgsc.bcm.edu	37	19	16764845	16764845	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr19:16764845C>T	ENST00000487416.2	-	4	259		c.e4+1		CTC-429P9.4_ENST00000593962.1_Splice_Site|SMIM7_ENST00000597711.1_Intron|SMIM7_ENST00000358726.6_Splice_Site|CTC-429P9.4_ENST00000600705.1_Intron|SMIM7_ENST00000397349.2_Splice_Site	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7							integral component of membrane (GO:0016021)											GCTGGACTCACACAATCATGC	0.478																																					.		Atlas-SNP	.											.	.	.	.	0			c.212+1G>A						.						91.0	93.0	92.0					19																	16764845		2029	4185	6214	SO:0001630	splice_region_variant	79086	exon5			GACTCACACAATC	AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.212+1G>A	chr19.hg19:g.16764845C>T		57.0	0.0		56.0	22.0	NM_024104	A8MX44	Splice_Site	SNP	ENST00000487416.2	hg19	CCDS12348.2	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878536	0.72294	.	.	ENSG00000214046	ENST00000487416;ENST00000358726	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0574	0.80816	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C19orf42	16625845	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	7.025000	0.76449	2.655000	0.90218	0.650000	0.86243	.	.	.		0.478	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313801.2	NM_024104	Intron
KMT2B	9757	hgsc.bcm.edu	37	19	36216413	36216413	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr19:36216413C>T	ENST00000222270.7	+	12	3676	c.3676C>T	c.(3676-3678)Cac>Tac	p.H1226Y	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.H1226Y	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1226					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGACCCATTCCACCCATTCTG	0.607																																					p.H1226Y		Atlas-SNP	.											.	MLL4	229	.	0			c.C3676T						.						199.0	215.0	210.0					19																	36216413		2097	4225	6322	SO:0001583	missense	8085	exon12			CCATTCCACCCAT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.3676C>T	chr19.hg19:g.36216413C>T	ENSP00000222270:p.His1226Tyr	26.0	0.0		27.0	11.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764356	0.49574	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.99849	-7.15;-7.15	5.54	5.54	0.83059	Zinc finger, PHD-finger (1);Zinc finger, PHD-type (1);	0.000000	0.47455	D	0.000238	D	0.99809	0.9917	M	0.79926	2.475	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	D	0.97234	0.9886	10	0.87932	D	0	.	18.4191	0.90582	0.0:1.0:0.0:0.0	.	1226	Q9UMN6	MLL4_HUMAN	Y	1226	ENSP00000222270:H1226Y;ENSP00000398837:H1226Y	ENSP00000222270:H1226Y	H	+	1	0	AD000671.1	40908253	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.178000	0.77657	2.884000	0.98904	0.655000	0.94253	CAC	.	.		0.607	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
ZFP30	22835	hgsc.bcm.edu	37	19	38126047	38126047	+	Silent	SNP	G	G	A	rs575517303		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr19:38126047G>A	ENST00000351218.2	-	6	1952	c.1395C>T	c.(1393-1395)ccC>ccT	p.P465P	ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000392144.1_Silent_p.P465P|ZFP30_ENST00000514101.2_Silent_p.P465P	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACAGTCATAGGGCTTTTCAC	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		20515	0.0		0.0	False		,,,				2504	0.001				p.P465P		Atlas-SNP	.											.	ZFP30	68	.	0			c.C1395T						.						86.0	81.0	83.0					19																	38126047		2203	4300	6503	SO:0001819	synonymous_variant	22835	exon6			GTCATAGGGCTTT	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1395C>T	chr19.hg19:g.38126047G>A		107.0	0.0		117.0	56.0	NM_014898	Q58EY8	Silent	SNP	ENST00000351218.2	hg19	CCDS33005.1																																																																																			.	.		0.368	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898	
ZNF83	55769	hgsc.bcm.edu	37	19	53116801	53116801	+	Silent	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr19:53116801G>A	ENST00000597597.1	-	2	3270	c.1017C>T	c.(1015-1017)caC>caT	p.H339H	ZNF83_ENST00000541777.2_Silent_p.H339H|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000301096.3_Silent_p.H339H|ZNF83_ENST00000545872.1_Silent_p.H339H|ZNF83_ENST00000391789.4_Silent_p.H311H|ZNF83_ENST00000536937.1_Silent_p.H339H|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000544146.1_Silent_p.H339H			P51522	ZNF83_HUMAN	zinc finger protein 83	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TCTCTCCAGTGTGGATTCTCC	0.418																																					p.H339H		Atlas-SNP	.											ZNF83,NS,carcinoma,0,2	ZNF83	73	.	0			c.C1017T						.						118.0	120.0	120.0					19																	53116801		2203	4300	6503	SO:0001819	synonymous_variant	55769	exon3			TCCAGTGTGGATT	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.1017C>T	chr19.hg19:g.53116801G>A		110.0	2.0		136.0	8.0	NM_018300	A8MT75|Q3ZCX0|Q6PI08	Silent	SNP	ENST00000597597.1	hg19	CCDS12854.1																																																																																			.	.		0.418	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
NLRP12	91662	hgsc.bcm.edu	37	19	54313913	54313913	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr19:54313913G>A	ENST00000324134.6	-	3	1168	c.1000C>T	c.(1000-1002)Cct>Tct	p.P334S	NLRP12_ENST00000391775.3_Missense_Mutation_p.P334S|NLRP12_ENST00000535162.1_Missense_Mutation_p.P334S|NLRP12_ENST00000345770.5_Missense_Mutation_p.P334S|NLRP12_ENST00000391772.1_Missense_Mutation_p.P334S|NLRP12_ENST00000354278.3_Missense_Mutation_p.P334S|NLRP12_ENST00000351894.4_Missense_Mutation_p.P334S|NLRP12_ENST00000391773.1_Missense_Mutation_p.P334S	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	334	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GATAGCTCAGGGAGCAGCTTC	0.582																																					p.S334S		Atlas-SNP	.											.	NLRP12	236	.	0			c.T1000T						.						64.0	68.0	66.0					19																	54313913		2203	4300	6503	SO:0001583	missense	91662	exon3			GCTCAGGGAGCAG	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1000C>T	chr19.hg19:g.54313913G>A	ENSP00000319377:p.Pro334Ser	44.0	0.0		78.0	29.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	hg19	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036571	0.54896	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4	4.64	4.64	0.57946	NACHT nucleoside triphosphatase (1);	0.000000	0.42682	D	0.000662	D	0.89012	0.6594	M	0.79123	2.44	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.998	D;D;D;D	0.71656	0.947;0.947;0.947;0.974	D	0.90599	0.4543	10	0.87932	D	0	.	15.4217	0.75018	0.0:0.0:1.0:0.0	.	334;334;334;334	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	S	334	ENSP00000319377:P334S;ENSP00000438030:P334S;ENSP00000340473:P334S;ENSP00000346231:P334S;ENSP00000375655:P334S;ENSP00000375653:P334S;ENSP00000375652:P334S	ENSP00000319377:P334S	P	-	1	0	NLRP12	59005725	1.000000	0.71417	0.945000	0.38365	0.405000	0.30901	3.118000	0.50414	2.315000	0.78130	0.485000	0.47835	CCT	.	.		0.582	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
SAMHD1	25939	hgsc.bcm.edu	37	20	35563535	35563535	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr20:35563535T>A	ENST00000262878.4	-	4	605	c.406A>T	c.(406-408)Att>Ttt	p.I136F	SAMHD1_ENST00000373694.5_5'UTR	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	136					dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				GGTGTATCAATGATTCGGACG	0.388																																					p.I136F		Atlas-SNP	.											.	SAMHD1	62	.	0			c.A406T						.						139.0	130.0	133.0					20																	35563535		2203	4300	6503	SO:0001583	missense	25939	exon4			TATCAATGATTCG	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.406A>T	chr20.hg19:g.35563535T>A	ENSP00000262878:p.Ile136Phe	147.0	0.0		178.0	77.0	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	hg19	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.039053	0.93630	.	.	ENSG00000101347	ENST00000262878	D	0.97620	-4.46	6.05	6.05	0.98169	HD domain (1);	0.000000	0.85682	D	0.000000	D	0.98689	0.9560	M	0.94021	3.485	0.80722	D	1	P	0.49862	0.929	P	0.59595	0.86	D	0.99402	1.0928	10	0.72032	D	0.01	-22.8833	16.5932	0.84781	0.0:0.0:0.0:1.0	.	136	Q9Y3Z3	SAMH1_HUMAN	F	136	ENSP00000262878:I136F	ENSP00000262878:I136F	I	-	1	0	SAMHD1	34996949	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.991000	0.88244	2.320000	0.78422	0.528000	0.53228	ATT	.	.		0.388	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
TIAM1	7074	hgsc.bcm.edu	37	21	32638770	32638770	+	Silent	SNP	T	T	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr21:32638770T>A	ENST00000286827.3	-	5	990	c.519A>T	c.(517-519)gcA>gcT	p.A173A	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Silent_p.A173A	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	173					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GCCAGATGTCTGCAGATTTGG	0.502																																					p.A173A		Atlas-SNP	.											.	TIAM1	522	.	0			c.A519T						.						101.0	99.0	100.0					21																	32638770		2203	4300	6503	SO:0001819	synonymous_variant	7074	exon5			GATGTCTGCAGAT		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.519A>T	chr21.hg19:g.32638770T>A		64.0	0.0		65.0	26.0	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	hg19	CCDS13609.1																																																																																			.	.		0.502	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
ZMAT5	55954	hgsc.bcm.edu	37	22	30144469	30144469	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr22:30144469T>C	ENST00000344318.3	-	2	181	c.65A>G	c.(64-66)aAg>aGg	p.K22R	ZMAT5_ENST00000397781.3_Missense_Mutation_p.K22R	NM_001003692.1	NP_001003692.1	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin-type 5	22					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)			CAGGTGCTTCTTGCGGTTGTG	0.622																																					p.K22R		Atlas-SNP	.											.	ZMAT5	12	.	0			c.A65G						.						146.0	121.0	129.0					22																	30144469		2203	4300	6503	SO:0001583	missense	55954	exon2			TGCTTCTTGCGGT		CCDS13868.1	22q12.2	2013-09-20	2010-09-15		ENSG00000100319	ENSG00000100319		"""Zinc fingers, matrin-type"""	28046	protein-coding gene	gene with protein product	"""U11/U12 snRNP 20K"""					9847074	Standard	NM_019103		Approved	SNRNP20	uc003agn.3	Q9UDW3	OTTHUMG00000151292	ENST00000344318.3:c.65A>G	chr22.hg19:g.30144469T>C	ENSP00000344241:p.Lys22Arg	85.0	0.0		104.0	41.0	NM_001003692	A8K9F6	Missense_Mutation	SNP	ENST00000344318.3	hg19	CCDS13868.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.645414	0.87859	.	.	ENSG00000100319	ENST00000344318;ENST00000397781	.	.	.	5.36	5.36	0.76844	Zinc finger, U1-C type (1);	0.000000	0.85682	D	0.000000	T	0.70413	0.3221	L	0.53561	1.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70901	-0.4746	9	0.46703	T	0.11	-41.5185	13.0873	0.59149	0.0:0.0:0.0:1.0	.	22	Q9UDW3	ZMAT5_HUMAN	R	22	.	ENSP00000344241:K22R	K	-	2	0	ZMAT5	28474469	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.574000	0.82434	2.036000	0.60181	0.418000	0.28097	AAG	.	.		0.622	ZMAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322114.1	NM_019103	
ARFGAP3	26286	hgsc.bcm.edu	37	22	43227599	43227599	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr22:43227599G>C	ENST00000263245.5	-	6	740	c.521C>G	c.(520-522)tCt>tGt	p.S174C	ARFGAP3_ENST00000437119.2_Missense_Mutation_p.S130C|ARFGAP3_ENST00000429508.2_Missense_Mutation_p.S102C	NM_001142293.1|NM_014570.4	NP_001135765.1|NP_055385.3	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating protein 3	174					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|protein secretion (GO:0009306)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	11						TGATGTTAAAGAAGATGGTTC	0.413																																					p.S174C	GBM(58;544 1030 21460 27159 48838)	Atlas-SNP	.											.	ARFGAP3	48	.	0			c.C521G						.						142.0	129.0	133.0					22																	43227599		2203	4300	6503	SO:0001583	missense	26286	exon6			GTTAAAGAAGATG	AK002083	CCDS14042.1, CCDS46722.1	22q13.2	2009-11-30	2002-08-20	2002-08-23	ENSG00000242247	ENSG00000242247		"""ADP-ribosylation factor GTPase activating proteins"""	661	protein-coding gene	gene with protein product		612439	"""ADP-ribosylation factor GTPase activating protein 1"""	ARFGAP1		10704287, 11172815	Standard	NM_014570		Approved		uc003bdd.2	Q9NP61	OTTHUMG00000150718	ENST00000263245.5:c.521C>G	chr22.hg19:g.43227599G>C	ENSP00000263245:p.Ser174Cys	91.0	0.0		85.0	40.0	NM_014570	E9PB03|Q9BSC6|Q9H9J0|Q9NT10|Q9NUP5|Q9Y4V3|Q9Y4V4	Missense_Mutation	SNP	ENST00000263245.5	hg19	CCDS14042.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.15|19.15	3.770901|3.770901	0.69992|0.69992	.|.	.|.	ENSG00000242247|ENSG00000242247	ENST00000453516|ENST00000263245;ENST00000429508;ENST00000437119;ENST00000454099	.|T;T;T;T	.|0.48201	.|3.4;3.3;3.37;0.82	4.77|4.77	3.75|3.75	0.43078|0.43078	.|.	.|0.944481	.|0.08868	.|N	.|0.881991	T|T	0.62950|0.62950	0.2470|0.2470	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	1|1	.|D;D;D	.|0.76494	.|0.999;0.965;0.996	.|D;P;P	.|0.65987	.|0.94;0.571;0.789	T|T	0.47898|0.47898	-0.9081|-0.9081	5|10	.|0.66056	.|D	.|0.02	0.635|0.635	9.7865|9.7865	0.40679|0.40679	0.0983:0.0:0.9017:0.0|0.0983:0.0:0.9017:0.0	.|.	.|102;130;174	.|C9JZR4;E9PB03;Q9NP61	.|.;.;ARFG3_HUMAN	L|C	20|174;102;130;102	.|ENSP00000263245:S174C;ENSP00000393959:S102C;ENSP00000388791:S130C;ENSP00000403520:S102C	.|ENSP00000263245:S174C	F|S	-|-	3|2	2|0	ARFGAP3|ARFGAP3	41557543|41557543	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.585000|0.585000	0.36419|0.36419	1.236000|1.236000	0.32683|0.32683	1.000000|1.000000	0.39049|0.39049	0.561000|0.561000	0.74099|0.74099	TTC|TCT	.	.		0.413	ARFGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319747.2	NM_014570	
FRMPD4	9758	hgsc.bcm.edu	37	X	12735950	12735950	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chrX:12735950T>C	ENST00000380682.1	+	16	3511	c.3005T>C	c.(3004-3006)aTg>aCg	p.M1002T		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1002					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CCTGAAACTATGGAGACTAAG	0.537																																					p.M1002T		Atlas-SNP	.											.	FRMPD4	214	.	0			c.T3005C						.						88.0	79.0	82.0					X																	12735950		2203	4300	6503	SO:0001583	missense	9758	exon16			AAACTATGGAGAC	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3005T>C	chrX.hg19:g.12735950T>C	ENSP00000370057:p.Met1002Thr	126.0	0.0		155.0	126.0	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	hg19	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.197762	0.38806	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.08102	3.13	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.13372	0.0324	M	0.72118	2.19	0.42803	D	0.993935	P;P	0.44946	0.846;0.846	B;B	0.39339	0.297;0.297	T	0.01706	-1.1291	10	0.72032	D	0.01	-7.6628	14.6319	0.68663	0.0:0.0:0.0:1.0	.	994;1002	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	T	1002;993;991	ENSP00000370057:M1002T	ENSP00000304583:M991T	M	+	2	0	FRMPD4	12645871	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.607000	0.82883	1.835000	0.53391	0.417000	0.27973	ATG	.	.		0.537	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
MT-ND4	4538	hgsc.bcm.edu	37	M	10971	10971	+	Nonstop_Mutation	SNP	G	G	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chrM:10971G>C	ENST00000361381.2	+	1	212	c.212G>C	c.(211-213)tGa>tCa	p.*71S	MT-TK_ENST00000387421.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	71					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ACTAACTACCTGACTCCTACC	0.448																																					p.W71S		Atlas-SNP	.											.	.	.	.	0			c.G212C						.																																			SO:0001578	stop_lost	0	exon1			CTACCTGACTCCT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.212G>C	chrM.hg19:g.10971G>C	Exception_encountered	15.0	0.0		53.0	14.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
AKR7A2	8574	hgsc.bcm.edu	37	1	19630807	19630808	+	Frame_Shift_Ins	INS	-	-	TCCG			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:19630807_19630808insTCCG	ENST00000235835.3	-	7	1012_1013	c.991_992insCGGA	c.(991-993)gagfs	p.-330fs	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)						carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCCTTCCTCTGTTGCTGCC	0.609																																					p.E331fs		Atlas-INDEL	.											.	AKR7A2	19	.	0			c.992_993insCGGA						.																																			SO:0001589	frameshift_variant	8574	exon7			.	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.991_992insCGGA	chr1.hg19:g.19630807_19630808insTCCG	ENSP00000235835:p.Thr330fs	202.0	0.0		203.0	35.0	NM_003689	O75749|Q5TG63	Frame_Shift_Ins	INS	ENST00000235835.3	hg19	CCDS194.1																																																																																			.	.		0.609	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
PAN2	9924	hgsc.bcm.edu	37	12	56713218	56713225	+	Frame_Shift_Del	DEL	GGCATCGA	GGCATCGA	-			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	GGCATCGA	GGCATCGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr12:56713218_56713225delGGCATCGA	ENST00000425394.2	-	23	3525_3532	c.3149_3156delTCGATGCC	c.(3148-3156)ctcgatgccfs	p.LDA1050fs	PAN2_ENST00000257931.5_Frame_Shift_Del_p.LDA1049fs|PAN2_ENST00000440411.3_Frame_Shift_Del_p.LDA1046fs|PAN2_ENST00000549090.1_5'UTR|PAN2_ENST00000548043.1_Frame_Shift_Del_p.LDA1050fs	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	205					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	AGGAAATTTTGGCATCGAGGTCACCAGG	0.447																																					p.1050_1053del		Atlas-INDEL	.											.	PAN2	107	.	0			c.3150_3157del						.																																			SO:0001589	frameshift_variant	9924	exon23			.	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.3149_3156delTCGATGCC	chr12.hg19:g.56713218_56713225delGGCATCGA	ENSP00000401721:p.Leu1050fs	68.0	0.0		75.0	20.0	NM_001127460		Frame_Shift_Del	DEL	ENST00000425394.2	hg19	CCDS44922.1																																																																																			.	.		0.447	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
ITGA9	3680	hgsc.bcm.edu	37	3	37583948	37583948	+	Frame_Shift_Del	DEL	A	A	-	rs146867977		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:37583948delA	ENST00000264741.5	+	15	1817	c.1561delA	c.(1561-1563)aaafs	p.K522fs	ITGA9_ENST00000422441.1_Frame_Shift_Del_p.K522fs	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	522					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TGACGTGGCCAAAAAGGAGAA	0.517																																					p.A520fs		Atlas-INDEL	.											.	ITGA9	98	.	0			c.1560delC						.						143.0	133.0	136.0					3																	37583948		2203	4300	6503	SO:0001589	frameshift_variant	3680	exon15			.	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1561delA	chr3.hg19:g.37583948delA	ENSP00000264741:p.Lys522fs	179.0	0.0		212.0	86.0	NM_002207	Q14638	Frame_Shift_Del	DEL	ENST00000264741.5	hg19	CCDS2669.1																																																																																			.	.		0.517	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
ILKAP	80895	hgsc.bcm.edu	37	2	239092696	239092697	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr2:239092696_239092697insT	ENST00000254654.3	-	7	765_766	c.590_591insA	c.(589-591)catfs	p.H197fs		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	197	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		CTTCATCAGTATGCTTGAAAGT	0.401																																					p.H197fs		Atlas-INDEL	.											.	ILKAP	42	.	0			c.591_592insA						.																																			SO:0001589	frameshift_variant	80895	exon7			.	AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.591dupA	chr2.hg19:g.239092697_239092697dupT	ENSP00000254654:p.His197fs	82.0	0.0		101.0	27.0	NM_030768	B3KM39	Frame_Shift_Ins	INS	ENST00000254654.3	hg19	CCDS2526.1																																																																																			.	.		0.401	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768	
Unknown	0	hgsc.bcm.edu	37	11	89701771	89701771	+	IGR	DEL	T	T	-			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:89701771delT								TRIM49D1 (46836 upstream) : TRIM49C (62502 downstream)																							TGGGCACAGCTTTTGCAGGCC	0.512																																					p.S33fs		Atlas-INDEL	.											.	.	.	.	0			c.99delC						.						2.0	2.0	2.0					11																	89701771		80	406	486	SO:0001628	intergenic_variant	120146	exon1			.																													chr11.hg19:g.89701771delT		168.0	0.0		174.0	29.0	NM_001136486		Frame_Shift_Del	DEL		hg19																																																																																				.	.	0	0.512								
DGKG	1608	hgsc.bcm.edu	37	3	185970881	185970883	+	Splice_Site	DEL	CCT	CCT	-			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:185970881_185970883delCCT	ENST00000265022.3	-	18	2138_2140	c.1599_1601delAGG	c.(1597-1602)ggaggt>ggt	p.533_534GG>G	DGKG_ENST00000544847.1_Splice_Site_p.474_475GG>G|DGKG_ENST00000344484.4_Splice_Site_p.508_509GG>G|DGKG_ENST00000382164.4_Splice_Site_p.494_495GG>G	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	533	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGCAAACTCACCTCCTCCCCAGC	0.502																																					p.534_534del		Atlas-INDEL	.											.	DGKG	98	.	0			c.1600_1600del						.																																			SO:0001630	splice_region_variant	1608	exon18			.	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1600+1AGG>-	chr3.hg19:g.185970884_185970886delCCT		53.0	0.0		48.0	14.0	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Frame_Shift_Del	DEL	ENST00000265022.3	hg19	CCDS3274.1																																																																																			.	.		0.502	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		In_Frame_Del
SMPD1	6609	hgsc.bcm.edu	37	11	6411971	6411972	+	In_Frame_Ins	INS	-	-	GCTGGC	rs281860676		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr11:6411971_6411972insGCTGGC	ENST00000342245.4	+	1	311_312	c.143_144insGCTGGC	c.(142-147)gctctg>gcGCTGGCtctg	p.48_49AL>ALAL	SMPD1_ENST00000527275.1_In_Frame_Ins_p.48_49AL>ALAL|SMPD1_ENST00000356761.2_In_Frame_Ins_p.48_49AL>ALAL|SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000299397.3_In_Frame_Ins_p.48_49AL>ALAL	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	47			D -> V (in NPDB). {ECO:0000269|PubMed:12369017}.		cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggcgctggcTCTGTCTGACT	0.693																																					p.A48delinsALA		Atlas-INDEL	.											SMPD1_ENST00000342245,colon,carcinoma,0,2	SMPD1	108	.	0			c.143_144insGCTGGC						.																																			SO:0001652	inframe_insertion	6609	exon1			.	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.138_143dupGCTGGC	chr11.hg19:g.6411966_6411971dupGCTGGC	ENSP00000340409:p.Leu47_Ala48dup	84.0	0.0		91.0	16.0	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	In_Frame_Ins	INS	ENST00000342245.4	hg19	CCDS44531.1																																																																																			.	GCTGGCGCTGGC|1.000;|0.000		0.693	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
SETBP1	26040	hgsc.bcm.edu	37	18	42643462	42643463	+	In_Frame_Ins	INS	-	-	CCC			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr18:42643462_42643463insCCC	ENST00000282030.5	+	6	4886_4887	c.4590_4591insCCC	c.(4591-4593)ccg>CCCccg	p.1531_1531P>PP		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1531	3 X 8 AA tandem repeats of P-P-L-P-P-P-P- P.					nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		cgccgcccctgccgccaccgcc	0.752									Schinzel-Giedion syndrome																												p.L1530delinsLP		Atlas-INDEL	.											.	SETBP1	577	.	0			c.4590_4591insCCC						.																																			SO:0001652	inframe_insertion	26040	exon6	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	.	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	Exception_encountered	chr18.hg19:g.42643462_42643463insCCC	ENSP00000282030:p.Pro1537dup	116.0	0.0		156.0	11.0	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	In_Frame_Ins	INS	ENST00000282030.5	hg19	CCDS11923.2																																																																																			.	.		0.752	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
MCM9	254394	hgsc.bcm.edu	37	6	119136492	119136493	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:119136492_119136493insA	ENST00000316316.6	-	13	3212_3213	c.2926_2927insT	c.(2926-2928)tctfs	p.S976fs		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	976					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TCCTGGGGTAGATGTTAACTTT	0.505																																					p.S976fs		Atlas-INDEL	.											.	MCM9	73	.	0			c.2927_2928insT						.																																			SO:0001589	frameshift_variant	254394	exon12			.	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.2927dupT	chr6.hg19:g.119136493_119136493dupA	ENSP00000314505:p.Ser976fs	79.0	0.0		102.0	47.0	NM_017696	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Frame_Shift_Ins	INS	ENST00000316316.6	hg19	CCDS56447.1																																																																																			.	.		0.505	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	
CYP2C8	1558	hgsc.bcm.edu	37	10	96798766	96798766	+	Frame_Shift_Del	DEL	G	G	-	rs181052138		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr10:96798766delG	ENST00000371270.3	-	8	1273	c.1179delC	c.(1177-1179)tccfs	p.S393fs	CYP2C8_ENST00000535898.1_Frame_Shift_Del_p.S291fs	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	393				GTTIMALLTS -> SFDNKIMLAA (in Ref. 1; AAA35740). {ECO:0000305}.	arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	CATGTAGCACGGAAGTCAGTA	0.388																																					p.V394fs		Atlas-INDEL	.											.	CYP2C8	73	.	0			c.1180delG						.						128.0	119.0	122.0					10																	96798766		2203	4300	6503	SO:0001589	frameshift_variant	1558	exon8			.	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.1179delC	chr10.hg19:g.96798766delG	ENSP00000360317:p.Ser393fs	102.0	0.0		121.0	36.0	NM_000770	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Frame_Shift_Del	DEL	ENST00000371270.3	hg19	CCDS7438.1																																																																																			.	.		0.388	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
ASTE1	28990	hgsc.bcm.edu	37	3	130743203	130743232	+	In_Frame_Del	DEL	GACATAAGTACCACACTGGAAGAAGTCCTG	GACATAAGTACCACACTGGAAGAAGTCCTG	-	rs149777056		TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	GACATAAGTACCACACTGGAAGAAGTCCTG	GACATAAGTACCACACTGGAAGAAGTCCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr3:130743203_130743232delGACATAAGTACCACACTGGAAGAAGTCCTG	ENST00000264992.3	-	3	1360_1389	c.919_948delCAGGACTTCTTCCAGTGTGGTACTTATGTC	c.(919-948)caggacttcttccagtgtggtacttatgtcdel	p.QDFFQCGTYV307del	NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000511262.1_5'Flank|ASTE1_ENST00000514044.1_In_Frame_Del_p.QDFFQCGTYV307del|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000356918.4_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	307					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.F310fs*25(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						CATCTGGACAGACATAAGTACCACACTGGAAGAAGTCCTGTAGCTTCACC	0.426																																					p.307_317del		Atlas-INDEL	.											.	ASTE1	67	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.920_949del						.																																			SO:0001651	inframe_deletion	28990	exon3			.	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.919_948delCAGGACTTCTTCCAGTGTGGTACTTATGTC	chr3.hg19:g.130743203_130743232delGACATAAGTACCACACTGGAAGAAGTCCTG	ENSP00000264992:p.Gln307_Val316del	130.0	0.0		107.0	29.0	NM_014065	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	In_Frame_Del	DEL	ENST00000264992.3	hg19	CCDS3068.1																																																																																			.	.		0.426	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
SENP6	26054	hgsc.bcm.edu	37	6	76419283	76419283	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr6:76419283delA	ENST00000447266.2	+	20	3235	c.2757delA	c.(2755-2757)tcafs	p.S919fs	SENP6_ENST00000370010.2_Frame_Shift_Del_p.S912fs|SENP6_ENST00000370014.3_Frame_Shift_Del_p.S919fs|SENP6_ENST00000541192.1_3'UTR	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	919	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				GCGATGAATCACCTGAAGCTG	0.343																																					p.S919fs		Atlas-INDEL	.											.	SENP6	189	.	0			c.2756delC						.						103.0	95.0	97.0					6																	76419283		1838	4080	5918	SO:0001589	frameshift_variant	26054	exon20			.		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.2757delA	chr6.hg19:g.76419283delA	ENSP00000402527:p.Ser919fs	114.0	0.0		103.0	41.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Frame_Shift_Del	DEL	ENST00000447266.2	hg19	CCDS47454.1																																																																																			.	.		0.343	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
AKR7A2	8574	hgsc.bcm.edu	37	1	19630804	19630805	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:19630804_19630805insC	ENST00000235835.3	-	7	1015_1016	c.994_995insG	c.(994-996)gaafs	p.E332fs	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	332					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGGGCCCTTCCTCTGTTGCT	0.604																																					p.E332fs		Atlas-INDEL	.											.	AKR7A2	19	.	0			c.995_996insG						.																																			SO:0001589	frameshift_variant	8574	exon7			.	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.995dupG	chr1.hg19:g.19630806_19630806dupC	ENSP00000235835:p.Glu332fs	206.0	0.0		205.0	37.0	NM_003689	O75749|Q5TG63	Frame_Shift_Ins	INS	ENST00000235835.3	hg19	CCDS194.1																																																																																			.	.		0.604	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
IKBKAP	8518	hgsc.bcm.edu	37	9	111653509	111653510	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr9:111653509_111653510insGC	ENST00000374647.5	-	28	3440_3441	c.3133_3134insGC	c.(3133-3135)ctgfs	p.L1045fs	IKBKAP_ENST00000537196.1_Frame_Shift_Ins_p.L696fs|IKBKAP_ENST00000467959.1_5'Flank	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	1045					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GAGGCCCACCAGCTGGTCTTTG	0.441																																					p.L1045fs		Atlas-INDEL	.											.	IKBKAP	122	.	0			c.3134_3135insGC						.																																			SO:0001589	frameshift_variant	8518	exon28			.	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.3132_3133dupGC	chr9.hg19:g.111653510_111653511dupGC	ENSP00000363779:p.Leu1045fs	119.0	0.0		125.0	55.0	NM_003640	Q5JSV2|Q9H327|Q9UG87	Frame_Shift_Ins	INS	ENST00000374647.5	hg19	CCDS6773.1																																																																																			.	.		0.441	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
HSD17B7	51478	hgsc.bcm.edu	37	1	162769552	162769570	+	Frame_Shift_Del	DEL	TCCTCTGTCACAGTGACAA	TCCTCTGTCACAGTGACAA	-	rs528471207	byFrequency	TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	TCCTCTGTCACAGTGACAA	TCCTCTGTCACAGTGACAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:162769552_162769570delTCCTCTGTCACAGTGACAA	ENST00000254521.3	+	5	522_540	c.467_485delTCCTCTGTCACAGTGACAA	c.(466-486)ctcctctgtcacagtgacaatfs	p.LLCHSDN156fs	HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000367917.3_Frame_Shift_Del_p.LLCHSDN156fs	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	156					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					CTGGAGCCTCTCCTCTGTCACAGTGACAATCCATCTCAG	0.42																																					p.156_162del		Atlas-INDEL	.											.	HSD17B7	25	.	0			c.466_484del						.																																			SO:0001589	frameshift_variant	51478	exon5			.	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.467_485delTCCTCTGTCACAGTGACAA	chr1.hg19:g.162769552_162769570delTCCTCTGTCACAGTGACAA	ENSP00000254521:p.Leu156fs	324.0	0.0		492.0	85.0	NM_016371	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Frame_Shift_Del	DEL	ENST00000254521.3	hg19	CCDS1242.1																																																																																			.	.		0.420	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371	
IQCC	55721	hgsc.bcm.edu	37	1	32672166	32672166	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAEB-01A-11D-A40R-10	TCGA-DD-AAEB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ba6d6e9d-643f-400c-b52e-e08fb1d79709	a6b0ad70-8f87-4734-8dc2-6b9203d461d0	g.chr1:32672166delG	ENST00000291358.6	+	3	264	c.243delG	c.(241-243)cagfs	p.Q81fs	DCDC2B_ENST00000409358.1_5'Flank|IQCC_ENST00000537469.1_Frame_Shift_Del_p.Q161fs|RP4-622L5.7_ENST00000373604.4_RNA|RP4-622L5.7_ENST00000421616.1_RNA	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	81										endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ATCCAGAGCAGGGGCTGTGGA	0.532																																					p.Q161fs		Atlas-INDEL	.											.	IQCC	46	.	0			c.482delA						.						97.0	105.0	102.0					1																	32672166		2203	4300	6503	SO:0001589	frameshift_variant	55721	exon3			.	AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.243delG	chr1.hg19:g.32672166delG	ENSP00000291358:p.Gln81fs	253.0	0.0		302.0	131.0	NM_001160042	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Frame_Shift_Del	DEL	ENST00000291358.6	hg19	CCDS355.1																																																																																			.	.		0.532	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134	
