#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PADI4	23569	hgsc.bcm.edu	37	1	17668580	17668580	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr1:17668580T>G	ENST00000375448.4	+	7	821	c.795T>G	c.(793-795)atT>atG	p.I265M	AC004824.2_ENST00000602074.1_Intron	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	265					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CGGGGCTCATTACCCTCACCA	0.632																																					p.I265M		Atlas-SNP	.											.	PADI4	70	.	0			c.T795G						.						79.0	76.0	77.0					1																	17668580		2203	4300	6503	SO:0001583	missense	23569	exon7			GCTCATTACCCTC	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.795T>G	chr1.hg19:g.17668580T>G	ENSP00000364597:p.Ile265Met	113.0	0.0		143.0	24.0	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	hg19	CCDS180.1	.	.	.	.	.	.	.	.	.	.	t	13.54	2.268358	0.40095	.	.	ENSG00000159339	ENST00000375448	T	0.23147	1.92	4.63	-3.6	0.04570	Protein-arginine deiminase (PAD), central domain (2);	0.362581	0.29676	N	0.011491	T	0.37489	0.1005	M	0.73598	2.24	0.27846	N	0.940928	D;D	0.53462	0.96;0.96	P;P	0.55455	0.776;0.776	T	0.39461	-0.9613	10	0.72032	D	0.01	-6.0275	11.4194	0.49971	0.0:0.6282:0.0:0.3718	.	265;265	A8K392;Q9UM07	.;PADI4_HUMAN	M	265	ENSP00000364597:I265M	ENSP00000364597:I265M	I	+	3	3	PADI4	17541167	0.000000	0.05858	0.198000	0.23420	0.207000	0.24258	-2.933000	0.00687	-0.657000	0.05373	-0.375000	0.07067	ATT	.	.		0.632	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
LRRC8D	55144	hgsc.bcm.edu	37	1	90400553	90400553	+	Silent	SNP	C	C	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr1:90400553C>A	ENST00000337338.5	+	3	2333	c.1926C>A	c.(1924-1926)ctC>ctA	p.L642L	LRRC8D_ENST00000394593.3_Silent_p.L642L	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	642					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		AGCTGGAACTCCAGAACTGTG	0.403																																					p.L642L		Atlas-SNP	.											.	LRRC8D	78	.	0			c.C1926A						.						67.0	67.0	67.0					1																	90400553		2203	4300	6503	SO:0001819	synonymous_variant	55144	exon3			GGAACTCCAGAAC	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1926C>A	chr1.hg19:g.90400553C>A		106.0	0.0		101.0	5.0	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Silent	SNP	ENST00000337338.5	hg19	CCDS726.1																																																																																			.	.		0.403	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
TDRD5	163589	hgsc.bcm.edu	37	1	179631411	179631411	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr1:179631411T>C	ENST00000367614.1	+	14	2692	c.2333T>C	c.(2332-2334)aTg>aCg	p.M778T	TDRD5_ENST00000444136.1_Missense_Mutation_p.M832T|TDRD5_ENST00000294848.8_Missense_Mutation_p.M778T	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	778					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TGTAAAGAAATGCCACAGAAG	0.473																																					p.M832T		Atlas-SNP	.											.	TDRD5	149	.	0			c.T2495C						.						71.0	67.0	69.0					1																	179631411		2203	4300	6503	SO:0001583	missense	163589	exon15			AAGAAATGCCACA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2333T>C	chr1.hg19:g.179631411T>C	ENSP00000356586:p.Met778Thr	46.0	0.0		75.0	22.0	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	T	0.964	-0.702250	0.03255	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.30448	2.72;2.72;2.93;1.53	5.15	1.3	0.21679	.	1.559390	0.03460	N	0.212089	T	0.24812	0.0602	L	0.40543	1.245	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.15578	-1.0432	10	0.30078	T	0.28	-20.7514	3.9519	0.09372	0.1581:0.1827:0.0:0.6592	.	832;778	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	T	778;778;832;288	ENSP00000356586:M778T;ENSP00000294848:M778T;ENSP00000406052:M832T;ENSP00000410744:M288T	ENSP00000294848:M778T	M	+	2	0	TDRD5	177898034	0.096000	0.21769	0.162000	0.22713	0.781000	0.44180	0.431000	0.21444	0.308000	0.22923	0.528000	0.53228	ATG	.	.		0.473	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TARBP1	6894	hgsc.bcm.edu	37	1	234541734	234541734	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr1:234541734T>C	ENST00000040877.1	-	24	3903	c.3904A>G	c.(3904-3906)Aaa>Gaa	p.K1302E	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1302					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CTTAACACTTTACACACAGTC	0.448																																					p.K1302E		Atlas-SNP	.											.	TARBP1	111	.	0			c.A3904G						.						142.0	129.0	133.0					1																	234541734		2203	4300	6503	SO:0001583	missense	6894	exon24			ACACTTTACACAC		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3904A>G	chr1.hg19:g.234541734T>C	ENSP00000040877:p.Lys1302Glu	210.0	0.0		343.0	158.0	NM_005646	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	hg19	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	T	8.133	0.783430	0.16189	.	.	ENSG00000059588	ENST00000040877	T	0.31510	1.49	4.46	4.46	0.54185	Armadillo-type fold (1);	0.181870	0.46758	D	0.000277	T	0.29817	0.0745	L	0.57536	1.79	0.42529	D	0.993038	B	0.27656	0.184	B	0.22152	0.038	T	0.08330	-1.0727	10	0.30854	T	0.27	-25.421	13.7029	0.62620	0.0:0.0:0.0:1.0	.	1302	Q13395	TARB1_HUMAN	E	1302	ENSP00000040877:K1302E	ENSP00000040877:K1302E	K	-	1	0	TARBP1	232608357	1.000000	0.71417	0.677000	0.29947	0.029000	0.11900	3.619000	0.54196	1.645000	0.50612	0.379000	0.24179	AAA	.	.		0.448	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
FMN2	56776	hgsc.bcm.edu	37	1	240374413	240374413	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr1:240374413T>C	ENST00000319653.9	+	6	4173	c.3943T>C	c.(3943-3945)Tgg>Cgg	p.W1315R		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1315	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.I1457fs(2)|p.W1458fs*5(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTCACTTATTTGGGAAAAAAT	0.323																																					p.W1315R		Atlas-SNP	.											FMN2,extremity,malignant_melanoma,-2,1	FMN2	451	.	3	Complex(2)|Insertion - Frameshift(1)	central_nervous_system(3)	c.T3943C						.						82.0	85.0	84.0					1																	240374413		2203	4300	6503	SO:0001583	missense	56776	exon6			CTTATTTGGGAAA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3943T>C	chr1.hg19:g.240374413T>C	ENSP00000318884:p.Trp1315Arg	37.0	0.0		73.0	37.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	T	14.76	2.632864	0.47049	.	.	ENSG00000155816	ENST00000319653	T	0.44881	0.91	4.49	4.49	0.54785	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.56097	D	0.000028	T	0.68137	0.2968	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75297	-0.3367	10	0.87932	D	0	.	13.8153	0.63287	0.0:0.0:0.0:1.0	.	1315	Q9NZ56	FMN2_HUMAN	R	1315	ENSP00000318884:W1315R	ENSP00000318884:W1315R	W	+	1	0	FMN2	238441036	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.709000	0.84645	1.669000	0.50854	0.533000	0.62120	TGG	.	.		0.323	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
APOB	338	hgsc.bcm.edu	37	2	21227156	21227156	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr2:21227156G>T	ENST00000233242.1	-	28	12199	c.12072C>A	c.(12070-12072)ttC>ttA	p.F4024L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4024					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTGTAGTAGAAGTTCCATT	0.483																																					p.F4024L		Atlas-SNP	.											.	APOB	761	.	0			c.C12072A						.						96.0	94.0	94.0					2																	21227156		2203	4300	6503	SO:0001583	missense	338	exon28			GTAGTAGAAGTTC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12072C>A	chr2.hg19:g.21227156G>T	ENSP00000233242:p.Phe4024Leu	47.0	0.0		57.0	23.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	0.058	-1.230949	0.01518	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.26067	1.76	5.99	0.562	0.17290	.	1.374180	0.04574	N	0.393733	T	0.08935	0.0221	N	0.02315	-0.6	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50171	-0.8859	10	0.02654	T	1	.	6.0254	0.19652	0.1332:0.3837:0.3918:0.0913	.	4024	P04114	APOB_HUMAN	L	4024	ENSP00000233242:F4024L	ENSP00000233242:F4024L	F	-	3	2	APOB	21080661	0.181000	0.23161	0.612000	0.29024	0.205000	0.24178	-0.540000	0.06106	0.411000	0.25702	-0.211000	0.12701	TTC	.	.		0.483	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
UGP2	7360	hgsc.bcm.edu	37	2	64109686	64109686	+	Silent	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr2:64109686T>C	ENST00000337130.5	+	4	818	c.342T>C	c.(340-342)aaT>aaC	p.N114N	UGP2_ENST00000487469.1_3'UTR|UGP2_ENST00000394417.2_Silent_p.N103N|ACA59_ENST00000515966.1_RNA|UGP2_ENST00000445915.2_Silent_p.N123N|UGP2_ENST00000467648.2_Silent_p.N103N	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	114					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						TGAAACTCAATGGTGGTTTGG	0.423																																					p.N114N		Atlas-SNP	.											.	UGP2	38	.	0			c.T342C						.						123.0	129.0	127.0					2																	64109686		2203	4300	6503	SO:0001819	synonymous_variant	7360	exon4			ACTCAATGGTGGT		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.342T>C	chr2.hg19:g.64109686T>C		98.0	0.0		156.0	67.0	NM_006759	Q07131|Q0P6K2|Q86Y81|Q9BU15	Silent	SNP	ENST00000337130.5	hg19	CCDS1875.1																																																																																			.	.		0.423	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	NM_006759	
POLR1B	84172	hgsc.bcm.edu	37	2	113300078	113300078	+	Missense_Mutation	SNP	C	C	A	rs114489202	byFrequency	TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr2:113300078C>A	ENST00000263331.5	+	1	587	c.7C>A	c.(7-9)Cct>Act	p.P3T	POLR1B_ENST00000409894.3_Missense_Mutation_p.P3T|POLR1B_ENST00000537335.1_De_novo_Start_OutOfFrame|POLR1B_ENST00000417433.2_Missense_Mutation_p.P3T|POLR1B_ENST00000541869.1_Missense_Mutation_p.P41T	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	3					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CCACATGGATCCTGGCAGCCG	0.637																																					p.P3T	Ovarian(16;256 576 9537 23969 41147)	Atlas-SNP	.											.	POLR1B	95	.	0			c.C7A						.						40.0	43.0	42.0					2																	113300078		2203	4300	6503	SO:0001583	missense	84172	exon1			ATGGATCCTGGCA	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.7C>A	chr2.hg19:g.113300078C>A	ENSP00000263331:p.Pro3Thr	135.0	0.0		204.0	63.0	NM_019014	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	ENST00000263331.5	hg19	CCDS2097.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036971	0.35893	.	.	ENSG00000125630	ENST00000263331;ENST00000438748;ENST00000430769;ENST00000541869;ENST00000409894;ENST00000417433	T;T;T;T	0.75704	-0.95;-0.96;-0.36;-0.94	5.55	0.504	0.16946	.	0.539199	0.21181	N	0.078811	T	0.43765	0.1262	N	0.08118	0	0.28848	N	0.896231	B;B;B;B	0.18166	0.001;0.026;0.0;0.0	B;B;B;B	0.17979	0.002;0.02;0.001;0.0	T	0.33137	-0.9880	10	0.06494	T	0.89	-4.2535	4.8076	0.13328	0.1175:0.2556:0.4823:0.1447	.	41;3;3;3	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	T	3;3;3;41;3;3	ENSP00000263331:P3T;ENSP00000444136:P41T;ENSP00000387143:P3T;ENSP00000405358:P3T	ENSP00000263331:P3T	P	+	1	0	POLR1B	113016549	0.000000	0.05858	0.265000	0.24526	0.092000	0.18411	-0.756000	0.04777	-0.078000	0.12730	0.655000	0.94253	CCT	.	C|0.987;T|0.013		0.637	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014	
TUBA3E	112714	hgsc.bcm.edu	37	2	130951946	130951946	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr2:130951946G>T	ENST00000312988.7	-	4	569	c.469C>A	c.(469-471)Ctc>Atc	p.L157I		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	157					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					TCCACTGAGAGCCGCTCCATG	0.582																																					p.L157I		Atlas-SNP	.											.	TUBA3E	73	.	0			c.C469A						.						78.0	82.0	81.0					2																	130951946		2202	4299	6501	SO:0001583	missense	112714	exon4			CTGAGAGCCGCTC	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.469C>A	chr2.hg19:g.130951946G>T	ENSP00000318197:p.Leu157Ile	154.0	0.0		262.0	128.0	NM_207312		Missense_Mutation	SNP	ENST00000312988.7	hg19	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	g	11.68	1.710455	0.30322	.	.	ENSG00000152086	ENST00000312988	T	0.74106	-0.81	2.71	2.71	0.32032	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.39274	U	0.001407	T	0.73225	0.3560	L	0.53617	1.68	0.44469	D	0.997407	B	0.09022	0.002	B	0.36464	0.225	T	0.74842	-0.3527	10	0.72032	D	0.01	.	11.1953	0.48709	0.0:0.0:1.0:0.0	.	157	Q6PEY2	TBA3E_HUMAN	I	157	ENSP00000318197:L157I	ENSP00000318197:L157I	L	-	1	0	TUBA3E	130668416	1.000000	0.71417	0.999000	0.59377	0.869000	0.49853	8.207000	0.89746	1.540000	0.49301	0.449000	0.29647	CTC	.	.		0.582	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312	
POTEE	445582	hgsc.bcm.edu	37	2	132021637	132021637	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr2:132021637C>T	ENST00000356920.5	+	15	2703	c.2609C>T	c.(2608-2610)gCc>gTc	p.A870V	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	870	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A870V(1)									GAGGGGAATGCCCTCCCCCAT	0.617																																					p.A870V		Atlas-SNP	.											ENSG00000188219,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.C2609T						.						29.0	30.0	29.0					2																	132021637		2170	4227	6397	SO:0001583	missense	445582	exon15			GGAATGCCCTCCC	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2609C>T	chr2.hg19:g.132021637C>T	ENSP00000439189:p.Ala870Val	121.0	0.0		135.0	45.0	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	hg19	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	16.25	3.070481	0.55539	.	.	ENSG00000188219	ENST00000356920	T	0.06687	3.27	.	.	.	.	.	.	.	.	T	0.15392	0.0371	L	0.48218	1.51	0.80722	D	1	D	0.76494	0.999	D	0.63877	0.919	T	0.03335	-1.1047	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	870	Q6S8J3	POTEE_HUMAN	V	870	ENSP00000439189:A870V	ENSP00000439189:A870V	A	+	2	0	AC131180.1	131738107	1.000000	0.71417	0.113000	0.21522	0.114000	0.19823	5.240000	0.65378	0.119000	0.18210	0.121000	0.15741	GCC	.	.		0.617	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
ATP2B2	491	hgsc.bcm.edu	37	3	10370571	10370571	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr3:10370571G>A	ENST00000352432.4	-	22	3728	c.3659C>T	c.(3658-3660)aCg>aTg	p.T1220M	ATP2B2_ENST00000383800.4_Missense_Mutation_p.T1175M|ATP2B2_ENST00000360273.2_Missense_Mutation_p.T1220M|ATP2B2_ENST00000467702.2_5'UTR|ATP2B2_ENST00000343816.4_Missense_Mutation_p.T1206M|ATP2B2_ENST00000397077.1_Missense_Mutation_p.T1175M|MIR378B_ENST00000578876.1_RNA			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1220					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TGTGTCGGTCGTCAGGTTGAT	0.602																																					p.T1220M	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											ATP2B2_ENST00000360273,NS,carcinoma,0,4	ATP2B2	304	.	0			c.C3659T						.						123.0	106.0	112.0					3																	10370571		2203	4300	6503	SO:0001583	missense	491	exon23			TCGGTCGTCAGGT	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3659C>T	chr3.hg19:g.10370571G>A	ENSP00000324172:p.Thr1220Met	82.0	0.0		115.0	5.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	hg19	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781780	0.70222	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124	D;D;D;D;D;D	0.92299	-3.01;-3.0;-3.0;-3.01;-3.01;-3.0	5.97	5.09	0.68999	.	0.211192	0.48767	D	0.000168	D	0.95201	0.8444	L	0.60455	1.87	0.80722	D	1	D;P;P	0.89917	1.0;0.791;0.871	D;B;B	0.85130	0.997;0.301;0.301	D	0.95603	0.8665	10	0.72032	D	0.01	-21.7517	17.28	0.87126	0.0:0.1255:0.8745:0.0	.	1155;1187;1220	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	M	1220;1175;1175;1220;1206;1155;409;1076	ENSP00000324172:T1220M;ENSP00000373311:T1175M;ENSP00000380267:T1175M;ENSP00000353414:T1220M;ENSP00000344677:T1206M;ENSP00000414854:T1076M	ENSP00000344677:T1206M	T	-	2	0	ATP2B2	10345571	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	7.923000	0.87546	1.518000	0.48934	0.585000	0.79938	ACG	.	.		0.602	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
PLCL2	23228	hgsc.bcm.edu	37	3	17052798	17052798	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr3:17052798A>T	ENST00000418129.2	+	2	2047	c.1582A>T	c.(1582-1584)Agc>Tgc	p.S528C	PLCL2_ENST00000396755.2_Missense_Mutation_p.S528C|PLCL2_ENST00000432376.1_Missense_Mutation_p.S528C	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	654	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						AGTGCTTGCCAGCAAGTACGC	0.408																																					p.S528C		Atlas-SNP	.											.	PLCL2	145	.	0			c.A1582T						.						102.0	106.0	104.0					3																	17052798		2203	4300	6503	SO:0001583	missense	23228	exon2			CTTGCCAGCAAGT	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1582A>T	chr3.hg19:g.17052798A>T	ENSP00000409637:p.Ser528Cys	79.0	0.0		151.0	56.0	NM_015184	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	hg19	CCDS33713.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.597983	0.46318	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	T;T;T	0.68331	-0.32;-0.32;-0.32	5.63	5.63	0.86233	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.221688	0.53938	D	0.000047	T	0.75759	0.3893	.	.	.	0.47094	D	0.999311	D	0.59767	0.986	P	0.61874	0.895	T	0.75499	-0.3296	9	0.38643	T	0.18	.	10.2319	0.43260	0.9263:0.0:0.0737:0.0	.	654	Q9UPR0	PLCL2_HUMAN	C	528;655;528;528	ENSP00000409637:S528C;ENSP00000379979:S528C;ENSP00000412836:S528C	ENSP00000285094:S655C	S	+	1	0	PLCL2	17027802	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.295000	0.72744	2.149000	0.67028	0.528000	0.53228	AGC	.	.		0.408	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	88.0	0.0		143.0	83.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SI	6476	hgsc.bcm.edu	37	3	164755792	164755792	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr3:164755792C>T	ENST00000264382.3	-	21	2384	c.2322G>A	c.(2320-2322)agG>agA	p.R774R		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	774	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCCGTTGTTTCCTCCATGGCC	0.333										HNSCC(35;0.089)																											p.R774R		Atlas-SNP	.											.	SI	500	.	0			c.G2322A						.						125.0	122.0	123.0					3																	164755792		2203	4300	6503	SO:0001819	synonymous_variant	6476	exon21			TTGTTTCCTCCAT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2322G>A	chr3.hg19:g.164755792C>T		45.0	0.0		65.0	29.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	hg19	CCDS3196.1																																																																																			.	.		0.333	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SAMD7	344658	hgsc.bcm.edu	37	3	169639109	169639109	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr3:169639109C>T	ENST00000428432.2	+	4	583	c.194C>T	c.(193-195)tCc>tTc	p.S65F	SAMD7_ENST00000335556.3_Missense_Mutation_p.S65F	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	65										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			AATGTGTTGTCCAGTCGGATC	0.443																																					p.S65F		Atlas-SNP	.											.	SAMD7	69	.	0			c.C194T						.						135.0	114.0	121.0					3																	169639109		2203	4300	6503	SO:0001583	missense	344658	exon4			TGTTGTCCAGTCG	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.194C>T	chr3.hg19:g.169639109C>T	ENSP00000391299:p.Ser65Phe	69.0	0.0		95.0	35.0	NM_182610		Missense_Mutation	SNP	ENST00000428432.2	hg19	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031937	0.54790	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.55588	0.51;0.51	5.52	4.64	0.57946	.	0.258640	0.39544	N	0.001329	T	0.49643	0.1569	L	0.59436	1.845	0.09310	N	0.999999	B	0.20368	0.044	B	0.20384	0.029	T	0.50668	-0.8801	10	0.66056	D	0.02	-3.9081	12.2418	0.54546	0.0:0.9213:0.0:0.0787	.	65	Q7Z3H4	SAMD7_HUMAN	F	65	ENSP00000391299:S65F;ENSP00000334668:S65F	ENSP00000334668:S65F	S	+	2	0	SAMD7	171121803	0.955000	0.32602	0.007000	0.13788	0.010000	0.07245	4.408000	0.59761	1.471000	0.48121	0.655000	0.94253	TCC	.	.		0.443	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610	
FAM157A	728262	hgsc.bcm.edu	37	3	197880164	197880164	+	lincRNA	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr3:197880164G>A	ENST00000437428.2	+	0	44							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcagcaAC	0.527																																					p.Q81Q		Atlas-SNP	.											.	FAM157A	4	.	0			c.G243A						.						3.0	6.0	5.0					3																	197880164		474	1113	1587			728262	exon2			GCAGCAGCAGCAG			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			chr3.hg19:g.197880164G>A		185.0	0.0		254.0	22.0	NM_001145248		Silent	SNP	ENST00000437428.2	hg19																																																																																				.	.		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
MSANTD1	345222	hgsc.bcm.edu	37	4	3255044	3255044	+	Missense_Mutation	SNP	C	C	T	rs541435320		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr4:3255044C>T	ENST00000438480.2	+	2	2178	c.431C>T	c.(430-432)cCg>cTg	p.P144L	MSANTD1_ENST00000510580.1_Missense_Mutation_p.P144L|MSANTD1_ENST00000507492.1_Missense_Mutation_p.P131L	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	144								p.P144Q(2)		endometrium(1)|lung(2)	3						GGCAAACTGCCGGACAGCCAG	0.642													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15148	0.0		0.0	False		,,,				2504	0.0				p.P144L		Atlas-SNP	.											MSANTD1,NS,carcinoma,0,2	MSANTD1	14	.	2	Substitution - Missense(2)	endometrium(2)	c.C431T						.						56.0	68.0	64.0					4																	3255044		2203	4300	6503	SO:0001583	missense	345222	exon2			AACTGCCGGACAG		CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.431C>T	chr4.hg19:g.3255044C>T	ENSP00000411584:p.Pro144Leu	53.0	0.0		74.0	39.0	NM_001042690	C9J6V0	Missense_Mutation	SNP	ENST00000438480.2	hg19	CCDS47003.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.904968	0.52333	.	.	ENSG00000188981	ENST00000507492;ENST00000438480;ENST00000510580	.	.	.	5.52	4.6	0.57074	.	0.312527	0.31747	N	0.007122	T	0.44808	0.1311	L	0.40543	1.245	0.38007	D	0.934424	B;B	0.18166	0.026;0.026	B;B	0.11329	0.006;0.002	T	0.39981	-0.9587	9	0.21540	T	0.41	.	10.2959	0.43625	0.2952:0.7048:0.0:0.0	.	144;144	D6RD98;Q6ZTZ1	.;CD044_HUMAN	L	131;144;144	.	ENSP00000411584:P144L	P	+	2	0	C4orf44	3224842	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.098000	0.50259	2.615000	0.88500	0.591000	0.81541	CCG	.	.		0.642	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982	
ADH4	127	hgsc.bcm.edu	37	4	100060242	100060242	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr4:100060242C>G	ENST00000265512.7	-	4	394	c.320G>C	c.(319-321)aGt>aCt	p.S107T	ADH4_ENST00000505590.1_Missense_Mutation_p.S126T|ADH4_ENST00000504581.1_5'Flank|ADH4_ENST00000423445.1_Missense_Mutation_p.S126T|ADH4_ENST00000508393.1_Missense_Mutation_p.S126T|RP11-696N14.1_ENST00000500358.2_RNA	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	107					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		TGTGAGTGGACTCAGACAAAA	0.358																																					p.S107T		Atlas-SNP	.											.	ADH4	35	.	0			c.G320C						.						94.0	87.0	89.0					4																	100060242		2203	4300	6503	SO:0001583	missense	127	exon4			AGTGGACTCAGAC	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.320G>C	chr4.hg19:g.100060242C>G	ENSP00000265512:p.Ser107Thr	64.0	0.0		146.0	50.0	NM_000670	A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	hg19	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888840	0.33348	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590;ENST00000512499;ENST00000504125	T;T;T;T;T;T	0.04917	3.53;3.53;3.53;3.53;3.53;3.53	4.0	2.26	0.28386	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.128751	0.49305	D	0.000152	T	0.13157	0.0319	M	0.71871	2.18	0.39617	D	0.969975	P;B	0.34522	0.455;0.0	P;B	0.46110	0.504;0.071	T	0.01914	-1.1248	10	0.87932	D	0	-11.6196	7.2803	0.26308	0.0:0.634:0.0:0.366	.	126;107	P08319-2;P08319	.;ADH4_HUMAN	T	126;107;126;126;126;107	ENSP00000424630:S126T;ENSP00000265512:S107T;ENSP00000397939:S126T;ENSP00000425416:S126T;ENSP00000423571:S126T;ENSP00000427525:S107T	ENSP00000265512:S107T	S	-	2	0	ADH4	100279265	0.049000	0.20398	0.949000	0.38748	0.963000	0.63663	-0.140000	0.10342	0.474000	0.27392	0.555000	0.69702	AGT	.	.		0.358	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	
INTS12	57117	hgsc.bcm.edu	37	4	106604433	106604433	+	Silent	SNP	A	A	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr4:106604433A>T	ENST00000451321.2	-	7	1325	c.846T>A	c.(844-846)gtT>gtA	p.V282V	INTS12_ENST00000340139.5_Silent_p.V282V|INTS12_ENST00000394735.1_Silent_p.V282V	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	282	Ser-rich.				snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		CTGACGAGGAAACGCTGGCAC	0.378																																					p.V282V		Atlas-SNP	.											.	INTS12	35	.	0			c.T846A						.						38.0	40.0	40.0					4																	106604433		2202	4298	6500	SO:0001819	synonymous_variant	57117	exon8			CGAGGAAACGCTG		CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.846T>A	chr4.hg19:g.106604433A>T		61.0	0.0		100.0	53.0	NM_020395	B2RC48|Q3B6Z3|Q9HD71	Silent	SNP	ENST00000451321.2	hg19	CCDS3671.1																																																																																			.	.		0.378	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318624.1	NM_020395	
IRX4	50805	hgsc.bcm.edu	37	5	1878323	1878323	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:1878323G>T	ENST00000505790.1	-	6	1776	c.1320C>A	c.(1318-1320)gaC>gaA	p.D440E	IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Missense_Mutation_p.D440E|IRX4_ENST00000513692.1_Missense_Mutation_p.D440E	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	440					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GGAAGACCCCGTCCACCCAGT	0.701																																					p.D440E		Atlas-SNP	.											.	IRX4	45	.	0			c.C1320A						.						9.0	11.0	10.0					5																	1878323		2177	4275	6452	SO:0001583	missense	50805	exon5			GACCCCGTCCACC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.1320C>A	chr5.hg19:g.1878323G>T	ENSP00000423161:p.Asp440Glu	60.0	0.0		83.0	49.0	NM_016358	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	hg19	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	g	15.10	2.733280	0.48939	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692	T;T;T	0.74421	-0.84;-0.84;-0.84	3.42	0.0782	0.14411	.	0.177118	0.47093	D	0.000247	T	0.80363	0.4609	M	0.66939	2.045	0.44871	D	0.99788	D	0.76494	0.999	D	0.79784	0.993	T	0.76534	-0.2924	10	0.62326	D	0.03	-33.678	6.9326	0.24449	0.464:0.0:0.536:0.0	.	440	P78413	IRX4_HUMAN	E	440	ENSP00000231357:D440E;ENSP00000423161:D440E;ENSP00000424235:D440E	ENSP00000231357:D440E	D	-	3	2	IRX4	1931323	0.883000	0.30277	0.997000	0.53966	0.992000	0.81027	-0.078000	0.11375	-0.094000	0.12374	0.552000	0.68991	GAC	.	.		0.701	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
ADCY2	108	hgsc.bcm.edu	37	5	7727323	7727323	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:7727323C>A	ENST00000338316.4	+	14	1909	c.1820C>A	c.(1819-1821)gCc>gAc	p.A607D	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Missense_Mutation_p.A427D	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	607					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GTGACTTGTGCCTGTCTCATA	0.507																																					p.A607D		Atlas-SNP	.											.	ADCY2	337	.	0			c.C1820A						.						226.0	198.0	207.0					5																	7727323		2203	4300	6503	SO:0001583	missense	108	exon14			CTTGTGCCTGTCT	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1820C>A	chr5.hg19:g.7727323C>A	ENSP00000342952:p.Ala607Asp	33.0	0.0		49.0	27.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	hg19	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667702	0.88348	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;D	0.83335	-1.23;-1.71	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.89949	0.6863	M	0.76328	2.33	0.80722	D	1	D;D	0.63046	0.992;0.991	D;D	0.66497	0.944;0.944	D	0.91224	0.5009	10	0.87932	D	0	.	15.3084	0.74011	0.0:1.0:0.0:0.0	.	427;607	B7Z2C1;Q08462	.;ADCY2_HUMAN	D	607;440;427	ENSP00000342952:A607D;ENSP00000444803:A427D	ENSP00000342952:A607D	A	+	2	0	ADCY2	7780323	1.000000	0.71417	0.512000	0.27736	0.905000	0.53344	6.984000	0.76186	2.329000	0.79093	0.650000	0.86243	GCC	.	.		0.507	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
PRDM9	56979	hgsc.bcm.edu	37	5	23527109	23527109	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:23527109T>G	ENST00000296682.3	+	11	2094	c.1912T>G	c.(1912-1914)Tgc>Ggc	p.C638G		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	638					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GCCCTATGTCTGCAGGGAGTG	0.622										HNSCC(3;0.000094)																											p.C638G		Atlas-SNP	.											.	PRDM9	344	.	0			c.T1912G						.						21.0	22.0	22.0					5																	23527109		1390	3096	4486	SO:0001583	missense	56979	exon11			TATGTCTGCAGGG	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1912T>G	chr5.hg19:g.23527109T>G	ENSP00000296682:p.Cys638Gly	221.0	0.0		338.0	95.0	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	hg19	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.676972	0.29783	.	.	ENSG00000164256	ENST00000296682	D	0.85258	-1.96	2.47	2.47	0.30058	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39687	N	0.001284	D	0.94420	0.8205	H	0.98525	4.255	0.49582	D	0.999803	D	0.89917	1.0	D	0.97110	1.0	D	0.93924	0.7208	10	0.87932	D	0	-7.045	8.7536	0.34633	0.0:0.0:0.0:1.0	.	638	Q9NQV7	PRDM9_HUMAN	G	638	ENSP00000296682:C638G	ENSP00000296682:C638G	C	+	1	0	PRDM9	23562866	1.000000	0.71417	0.963000	0.40424	0.026000	0.11368	6.072000	0.71238	1.370000	0.46153	0.454000	0.30748	TGC	.	.		0.622	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
KDM3B	51780	hgsc.bcm.edu	37	5	137762974	137762974	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:137762974G>T	ENST00000314358.5	+	19	4799	c.4599G>T	c.(4597-4599)agG>agT	p.R1533S	KDM3B_ENST00000394866.1_Missense_Mutation_p.R1189S|KDM3B_ENST00000542866.1_Missense_Mutation_p.R565S	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1533	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						ACTTTGTAAGGCCTGATCTGG	0.458																																					p.R1533S		Atlas-SNP	.											.	KDM3B	177	.	0			c.G4599T						.						97.0	94.0	95.0					5																	137762974		2203	4300	6503	SO:0001583	missense	51780	exon19			TGTAAGGCCTGAT	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4599G>T	chr5.hg19:g.137762974G>T	ENSP00000326563:p.Arg1533Ser	56.0	0.0		128.0	88.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	hg19	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627529	0.66901	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	D;D;D	0.84516	-1.86;-1.86;-1.86	5.48	1.66	0.24008	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.055875	0.64402	D	0.000002	D	0.90359	0.6983	M	0.86805	2.84	0.58432	D	0.999993	P;D	0.62365	0.827;0.991	B;D	0.70016	0.429;0.967	D	0.86889	0.2047	10	0.62326	D	0.03	-13.5503	3.9957	0.09558	0.345:0.0:0.3879:0.2671	.	1189;1533	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	S	1533;1323;1189;565	ENSP00000326563:R1533S;ENSP00000378335:R1189S;ENSP00000439462:R565S	ENSP00000326563:R1533S	R	+	3	2	KDM3B	137790873	0.982000	0.34865	0.994000	0.49952	0.968000	0.65278	0.180000	0.16860	0.279000	0.22186	-0.126000	0.14955	AGG	.	.		0.458	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
PCDHGA8	9708	hgsc.bcm.edu	37	5	140773210	140773210	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:140773210T>C	ENST00000398604.2	+	1	830	c.830T>C	c.(829-831)gTg>gCg	p.V277A	PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	277	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGGAAAAGTGGCATACAAA	0.433																																					p.V277A		Atlas-SNP	.											.	PCDHGA8	146	.	0			c.T830C						.						71.0	76.0	74.0					5																	140773210		1849	4096	5945	SO:0001583	missense	9708	exon1			GAAAAGTGGCATA	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.830T>C	chr5.hg19:g.140773210T>C	ENSP00000381605:p.Val277Ala	188.0	0.0		369.0	144.0	NM_014004	A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	hg19	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	18.12	3.553915	0.65425	.	.	ENSG00000253767	ENST00000398604	T	0.52295	0.67	5.41	5.41	0.78517	Cadherin (4);Cadherin-like (1);	0.000000	0.28624	U	0.014683	T	0.79981	0.4540	H	0.98388	4.22	0.35978	D	0.835798	D;D	0.67145	0.996;0.995	D;P	0.65773	0.938;0.897	D	0.90748	0.4655	10	0.87932	D	0	.	15.117	0.72410	0.0:0.0:0.0:1.0	.	277;277	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	A	277	ENSP00000381605:V277A	ENSP00000381605:V277A	V	+	2	0	PCDHGA8	140753394	0.864000	0.29904	0.709000	0.30452	0.707000	0.40811	5.066000	0.64351	2.064000	0.61679	0.533000	0.62120	GTG	.	.		0.433	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
PCDHGA10	56106	hgsc.bcm.edu	37	5	140792981	140792981	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:140792981C>A	ENST00000398610.2	+	1	239	c.239C>A	c.(238-240)tCt>tAt	p.S80Y	PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	80	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCTTTTCTCTCTGAACCCG	0.622																																					p.S80Y		Atlas-SNP	.											.	PCDHGA10	114	.	0			c.C239A						.						61.0	76.0	71.0					5																	140792981		2121	4267	6388	SO:0001583	missense	56106	exon1			TTTTCTCTCTGAA		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.239C>A	chr5.hg19:g.140792981C>A	ENSP00000381611:p.Ser80Tyr	84.0	0.0		242.0	58.0	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	hg19	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	c	15.62	2.887538	0.52014	.	.	ENSG00000253846	ENST00000398610	T	0.29655	1.56	5.89	5.89	0.94794	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.59459	0.2195	M	0.88310	2.945	0.24546	N	0.994044	P;P	0.51791	0.936;0.948	P;P	0.59761	0.771;0.863	T	0.59048	-0.7527	9	0.72032	D	0.01	.	14.6802	0.69012	0.1453:0.8547:0.0:0.0	.	80;80	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	Y	80	ENSP00000381611:S80Y	ENSP00000381611:S80Y	S	+	2	0	PCDHGA10	140773165	0.000000	0.05858	0.977000	0.42913	0.377000	0.30045	0.391000	0.20784	2.788000	0.95919	0.557000	0.71058	TCT	.	.		0.622	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
SH3RF2	153769	hgsc.bcm.edu	37	5	145439465	145439465	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:145439465C>T	ENST00000511217.1	+	8	1644	c.1592C>T	c.(1591-1593)cCc>cTc	p.P531L	SH3RF2_ENST00000511705.1_3'UTR|SH3RF2_ENST00000359120.4_Missense_Mutation_p.P531L			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	531					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGGGATCCCCACTCTCGTG	0.627																																					p.P531L		Atlas-SNP	.											.	SH3RF2	58	.	0			c.C1592T						.						48.0	46.0	47.0					5																	145439465		2203	4300	6503	SO:0001583	missense	153769	exon9			GGATCCCCACTCT	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1592C>T	chr5.hg19:g.145439465C>T	ENSP00000424497:p.Pro531Leu	69.0	0.0		174.0	41.0	NM_152550	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Missense_Mutation	SNP	ENST00000511217.1	hg19	CCDS4280.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750162	0.30955	.	.	ENSG00000156463	ENST00000359120;ENST00000511217	T;T	0.21734	1.99;1.99	4.89	3.09	0.35607	.	0.199556	0.34725	N	0.003725	T	0.34542	0.0901	L	0.54323	1.7	0.22940	N	0.998535	D;B	0.89917	1.0;0.007	D;B	0.87578	0.998;0.006	T	0.05084	-1.0907	10	0.59425	D	0.04	-14.8596	5.2118	0.15320	0.1749:0.6623:0.0:0.1628	.	22;531	Q8TEC5-2;Q8TEC5	.;SH3R2_HUMAN	L	531	ENSP00000352028:P531L;ENSP00000424497:P531L	ENSP00000352028:P531L	P	+	2	0	SH3RF2	145419658	0.292000	0.24362	0.918000	0.36340	0.685000	0.39939	1.139000	0.31504	1.037000	0.40024	0.536000	0.68110	CCC	.	.		0.627	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550	
EBF1	1879	hgsc.bcm.edu	37	5	158139179	158139179	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:158139179G>T	ENST00000313708.6	-	14	1814	c.1532C>A	c.(1531-1533)gCc>gAc	p.A511D	EBF1_ENST00000517373.1_Intron|EBF1_ENST00000380654.4_Missense_Mutation_p.A480D|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	511	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGGGAGTTGGCAGCTGAGCC	0.567			T	HMGA2	lipoma																																p.A511D		Atlas-SNP	.		Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	EBF1	110	.	0			c.C1532A						.						63.0	50.0	54.0					5																	158139179		2203	4300	6503	SO:0001583	missense	1879	exon14			GAGTTGGCAGCTG	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1532C>A	chr5.hg19:g.158139179G>T	ENSP00000322898:p.Ala511Asp	74.0	0.0		209.0	40.0	NM_024007	Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	hg19	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146980	0.57151	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654	T;T	0.52526	0.66;0.66	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.58104	0.2099	M	0.76328	2.33	0.80722	D	1	B;P;P;B	0.38250	0.0;0.624;0.554;0.214	B;B;B;B	0.43478	0.001;0.307;0.421;0.326	T	0.64322	-0.6435	10	0.62326	D	0.03	-7.8475	18.4976	0.90870	0.0:0.0:1.0:0.0	.	511;498;511;480	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	D	511;511;480	ENSP00000322898:A511D;ENSP00000370029:A480D	ENSP00000322898:A511D	A	-	2	0	EBF1	158071757	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.366000	0.59492	2.428000	0.82296	0.650000	0.86243	GCC	.	.		0.567	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
OR10C1	442194	hgsc.bcm.edu	37	6	29408581	29408581	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:29408581C>T	ENST00000444197.2	+	1	1499	c.789C>T	c.(787-789)gcC>gcT	p.A263A	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCCCTAAGGCCAGCTACGATC	0.582																																					p.A263A		Atlas-SNP	.											.	OR10C1	58	.	0			c.C789T						.						236.0	260.0	251.0					6																	29408581		1511	2709	4220	SO:0001819	synonymous_variant	442194	exon1			TAAGGCCAGCTAC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.789C>T	chr6.hg19:g.29408581C>T		39.0	0.0		71.0	28.0	NM_013941	Q5SUN7|Q96R18	Silent	SNP	ENST00000444197.2	hg19	CCDS34364.1																																																																																			.	.		0.582	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
GPSM3	63940	hgsc.bcm.edu	37	6	32160269	32160269	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:32160269C>A	ENST00000375040.3	-	1	414	c.22G>T	c.(22-24)Gaa>Taa	p.E8*	GPSM3_ENST00000375043.3_Nonsense_Mutation_p.E8*|GPSM3_ENST00000487761.1_5'UTR|PBX2_ENST00000375050.4_5'Flank	NM_001276501.1	NP_001263430.1	Q9Y4H4	GPSM3_HUMAN	G-protein signaling modulator 3	8					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cytoplasm (GO:0005737)	GDP-dissociation inhibitor activity (GO:0005092)			large_intestine(1)	1						TCCTCTTCTTCCTGGGGTCTC	0.617																																					p.E8X		Atlas-SNP	.											.	GPSM3	9	.	0			c.G22T						.						35.0	24.0	28.0					6																	32160269		1510	2708	4218	SO:0001587	stop_gained	63940	exon5			CTTCTTCCTGGGG	AF155657	CCDS34419.1	6p21.3	2010-06-24	2010-06-24	2004-02-04	ENSG00000213654	ENSG00000213654			13945	protein-coding gene	gene with protein product	"""activator of G-protein signaling 4"""		"""chromosome 6 open reading frame 9"", ""G-protein signalling modulator 3 (AGS3-like, C. elegans)"""	C6orf9		2259622, 15096500	Standard	NM_022107		Approved	NG1, G18, G18.1a, G18.1b, G18.2, AGS4	uc003oaz.3	Q9Y4H4	OTTHUMG00000031244	ENST00000375040.3:c.22G>T	chr6.hg19:g.32160269C>A	ENSP00000364180:p.Glu8*	48.0	0.0		46.0	23.0	NM_022107	A2BFJ3	Nonsense_Mutation	SNP	ENST00000375040.3	hg19	CCDS34419.1	.	.	.	.	.	.	.	.	.	.	C	38	6.696739	0.97772	.	.	ENSG00000213654	ENST00000375040;ENST00000375043	.	.	.	3.33	2.45	0.29901	.	0.000000	0.53938	U	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-18.7475	6.5847	0.22614	0.0:0.8635:0.0:0.1365	.	.	.	.	X	8	.	ENSP00000364180:E8X	E	-	1	0	GPSM3	32268247	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	0.902000	0.28459	0.748000	0.32831	0.467000	0.42956	GAA	.	.		0.617	GPSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076509.1	NM_022107	
RXRB	6257	hgsc.bcm.edu	37	6	33165574	33165574	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:33165574T>C	ENST00000374680.3	-	4	996	c.785A>G	c.(784-786)tAt>tGt	p.Y262C	RXRB_ENST00000413614.2_Missense_Mutation_p.Y166C|RXRB_ENST00000544186.1_Missense_Mutation_p.Y72C|RXRB_ENST00000374685.4_Missense_Mutation_p.Y262C|RNY4P10_ENST00000365571.1_RNA	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	262					cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	GCACTTCTGATAGCGGCAGTA	0.572																																					p.Y262C		Atlas-SNP	.											.	RXRB	34	.	0			c.A785G						.						69.0	61.0	64.0					6																	33165574		1511	2709	4220	SO:0001583	missense	6257	exon4			TTCTGATAGCGGC	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.785A>G	chr6.hg19:g.33165574T>C	ENSP00000363812:p.Tyr262Cys	37.0	0.0		92.0	31.0	NM_021976	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	hg19	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.459626	0.84317	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186;ENST00000413614	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	4.52	4.52	0.55395	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.98773	0.9587	H	0.95917	3.74	0.58432	D	0.999997	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.998;0.999;0.999;0.999	D	0.99537	1.0962	10	0.87932	D	0	.	12.1371	0.53977	0.0:0.0:0.0:1.0	.	166;262;145;72;262;262;302;262	B7Z3E4;B7Z6J2;B7Z6X3;E9PK95;Q5STQ1;Q5STP9;Q59G65;P28702	.;.;.;.;.;.;.;RXRB_HUMAN	C	262;262;72;166	ENSP00000363817:Y262C;ENSP00000363812:Y262C;ENSP00000439222:Y72C;ENSP00000415561:Y166C	ENSP00000363812:Y262C	Y	-	2	0	RXRB	33273552	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.817000	0.62650	2.028000	0.59812	0.368000	0.22195	TAT	.	.		0.572	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
UNC5CL	222643	hgsc.bcm.edu	37	6	41002766	41002766	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:41002766C>T	ENST00000373164.1	-	1	108	c.48G>A	c.(46-48)ctG>ctA	p.L16L	UNC5CL_ENST00000470102.1_5'Flank|UNC5CL_ENST00000244565.3_Silent_p.L16L			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	16					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGACCCCCACCAGCAGTAGGA	0.602																																					p.L16L		Atlas-SNP	.											.	UNC5CL	52	.	0			c.G48A						.						57.0	52.0	54.0					6																	41002766		2203	4300	6503	SO:0001819	synonymous_variant	222643	exon2			CCCCACCAGCAGT	BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.48G>A	chr6.hg19:g.41002766C>T		37.0	0.0		65.0	21.0	NM_173561	Q5TGU1	Silent	SNP	ENST00000373164.1	hg19	CCDS4847.1																																																																																			.	.		0.602	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561	
PRPH2	5961	hgsc.bcm.edu	37	6	42689887	42689887	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:42689887G>T	ENST00000230381.5	-	1	425	c.186C>A	c.(184-186)aaC>aaA	p.N62K		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	62					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			CTATCAATGAGTTGGGCACAA	0.512																																					p.N62K		Atlas-SNP	.											.	PRPH2	47	.	0			c.C186A						.						128.0	101.0	110.0					6																	42689887		2203	4300	6503	SO:0001583	missense	5961	exon1			CAATGAGTTGGGC		CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.186C>A	chr6.hg19:g.42689887G>T	ENSP00000230381:p.Asn62Lys	75.0	0.0		96.0	47.0	NM_000322	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	hg19	CCDS4871.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631371	0.67015	.	.	ENSG00000112619	ENST00000230381	T	0.79033	-1.23	5.81	1.96	0.26148	.	0.000000	0.85682	D	0.000000	T	0.71091	0.3299	M	0.77820	2.39	0.52501	D	0.999951	P	0.38677	0.642	P	0.48334	0.574	T	0.68588	-0.5369	10	0.30854	T	0.27	.	7.0159	0.24887	0.5358:0.0:0.4642:0.0	.	62	P23942	PRPH2_HUMAN	K	62	ENSP00000230381:N62K	ENSP00000230381:N62K	N	-	3	2	PRPH2	42797865	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.180000	0.50895	0.766000	0.33244	0.655000	0.94253	AAC	.	.		0.512	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322	
FILIP1	27145	hgsc.bcm.edu	37	6	76023019	76023019	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:76023019C>G	ENST00000237172.7	-	5	2859	c.2529G>C	c.(2527-2529)ttG>ttC	p.L843F	FILIP1_ENST00000393004.2_Missense_Mutation_p.L843F|FILIP1_ENST00000370020.1_Missense_Mutation_p.L744F|FILIP1_ENST00000498523.1_5'UTR	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	843										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CGGGTTTCTTCAATCCCACCT	0.453																																					p.L843F		Atlas-SNP	.											.	FILIP1	173	.	0			c.G2529C						.						125.0	138.0	133.0					6																	76023019		2203	4300	6503	SO:0001583	missense	27145	exon5			TTTCTTCAATCCC	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2529G>C	chr6.hg19:g.76023019C>G	ENSP00000237172:p.Leu843Phe	114.0	0.0		137.0	47.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	hg19	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	C	6.050	0.377539	0.11466	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.20200	2.09;2.09;2.09	5.66	4.6	0.57074	.	0.071794	0.56097	D	0.000036	T	0.05731	0.0150	L	0.47716	1.5	0.48571	D	0.999674	P;B;B	0.35050	0.482;0.07;0.044	B;B;B	0.26202	0.066;0.03;0.067	T	0.08432	-1.0722	10	0.09843	T	0.71	-13.0594	7.7235	0.28746	0.1456:0.7108:0.0:0.1437	.	843;843;843	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	F	843;843;744	ENSP00000376728:L843F;ENSP00000237172:L843F;ENSP00000359037:L744F	ENSP00000237172:L843F	L	-	3	2	FILIP1	76079739	1.000000	0.71417	0.820000	0.32676	0.710000	0.40934	0.852000	0.27764	2.678000	0.91216	0.563000	0.77884	TTG	.	.		0.453	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
FBXL4	26235	hgsc.bcm.edu	37	6	99323549	99323549	+	Missense_Mutation	SNP	G	G	A	rs398123061		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:99323549G>A	ENST00000369244.2	-	9	1872	c.1444C>T	c.(1444-1446)Cgg>Tgg	p.R482W	FBXL4_ENST00000229971.1_Missense_Mutation_p.R482W	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	482			R -> W (in MTDPS13). {ECO:0000269|PubMed:23993194}.		ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TCCAGGGTCCGGAGTTTTTTA	0.423																																					p.R482W		Atlas-SNP	.											.	FBXL4	54	.	0			c.C1444T						.						75.0	77.0	76.0					6																	99323549		2202	4300	6502	SO:0001583	missense	26235	exon8			GGGTCCGGAGTTT	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1444C>T	chr6.hg19:g.99323549G>A	ENSP00000358247:p.Arg482Trp	62.0	0.0		92.0	11.0	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	hg19	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002275	0.74932	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.03717	3.83;3.83	6.02	5.13	0.70059	.	0.150727	0.64402	D	0.000009	T	0.12390	0.0301	M	0.84683	2.71	0.58432	D	0.999998	D;D	0.76494	0.999;0.997	D;P	0.63033	0.91;0.723	T	0.01621	-1.1310	10	0.72032	D	0.01	.	16.4802	0.84156	0.0:0.0:0.8678:0.1322	.	482;482	B2R7Q5;Q9UKA2	.;FBXL4_HUMAN	W	482	ENSP00000358247:R482W;ENSP00000229971:R482W	ENSP00000229971:R482W	R	-	1	2	FBXL4	99430270	0.995000	0.38212	0.790000	0.31976	0.998000	0.95712	3.342000	0.52159	1.513000	0.48852	0.591000	0.81541	CGG	.	.		0.423	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
SASH1	23328	hgsc.bcm.edu	37	6	148855918	148855918	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:148855918A>G	ENST00000367467.3	+	16	2451	c.1976A>G	c.(1975-1977)tAt>tGt	p.Y659C		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	659	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TTCAATGGATATGAAGATTTG	0.498																																					p.Y659C		Atlas-SNP	.											.	SASH1	123	.	0			c.A1976G						.						132.0	126.0	128.0					6																	148855918		2203	4300	6503	SO:0001583	missense	23328	exon16			ATGGATATGAAGA	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1976A>G	chr6.hg19:g.148855918A>G	ENSP00000356437:p.Tyr659Cys	60.0	0.0		43.0	36.0	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	hg19	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.394954	0.83011	.	.	ENSG00000111961	ENST00000367467;ENST00000535767;ENST00000537769	D	0.84589	-1.87	5.15	5.15	0.70609	Src homology-3 domain (1);Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.92811	0.7714	M	0.91663	3.23	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94493	0.7703	10	0.87932	D	0	-12.6465	15.0027	0.71486	1.0:0.0:0.0:0.0	.	640;659	Q6P4R9;O94885	.;SASH1_HUMAN	C	659;420;69	ENSP00000356437:Y659C	ENSP00000356437:Y659C	Y	+	2	0	SASH1	148897611	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	7.306000	0.78905	1.953000	0.56701	0.459000	0.35465	TAT	.	.		0.498	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
LATS1	9113	hgsc.bcm.edu	37	6	150001298	150001298	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr6:150001298T>C	ENST00000543571.1	-	5	2853	c.2306A>G	c.(2305-2307)tAt>tGt	p.Y769C	LATS1_ENST00000253339.5_Missense_Mutation_p.Y769C|LATS1_ENST00000542747.1_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GAATGAATAATATAGACGAAC	0.383																																					p.Y769C		Atlas-SNP	.											.	LATS1	241	.	0			c.A2306G						.						123.0	122.0	122.0					6																	150001298		2203	4300	6503	SO:0001583	missense	9113	exon5			GAATAATATAGAC	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2306A>G	chr6.hg19:g.150001298T>C	ENSP00000437550:p.Tyr769Cys	88.0	0.0		82.0	61.0	NM_004690		Missense_Mutation	SNP	ENST00000543571.1	hg19	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	T	19.73	3.882206	0.72294	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.09723	2.95;2.95	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000091	T	0.21186	0.0510	M	0.64404	1.975	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.00662	-1.1621	9	.	.	.	.	15.9043	0.79412	0.0:0.0:0.0:1.0	.	769	O95835	LATS1_HUMAN	C	769	ENSP00000437550:Y769C;ENSP00000253339:Y769C	.	Y	-	2	0	LATS1	150042991	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	7.655000	0.83696	2.203000	0.70933	0.460000	0.39030	TAT	.	.		0.383	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
CREB5	9586	hgsc.bcm.edu	37	7	28843947	28843947	+	Silent	SNP	G	G	T	rs139638068		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr7:28843947G>T	ENST00000357727.2	+	8	1224	c.834G>T	c.(832-834)ccG>ccT	p.P278P	CREB5_ENST00000396299.2_Silent_p.P245P|CREB5_ENST00000396298.2_Silent_p.P139P|CREB5_ENST00000409603.1_Silent_p.P245P|CREB5_ENST00000396300.2_Silent_p.P271P	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	278					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						actcgcacccgcatcagcacc	0.587																																					p.P278P		Atlas-SNP	.											.	CREB5	115	.	0			c.G834T						.						565.0	342.0	417.0					7																	28843947		2203	4300	6503	SO:0001819	synonymous_variant	9586	exon8			GCACCCGCATCAG	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.834G>T	chr7.hg19:g.28843947G>T		77.0	0.0		143.0	59.0	NM_182898	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Silent	SNP	ENST00000357727.2	hg19	CCDS5417.1																																																																																			.	G|1.000;A|0.000		0.587	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904	
CUX1	1523	hgsc.bcm.edu	37	7	101845470	101845470	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr7:101845470A>G	ENST00000292535.7	+	18	2931	c.2893A>G	c.(2893-2895)Atc>Gtc	p.I965V	CUX1_ENST00000550008.2_Missense_Mutation_p.I909V|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.I863V|CUX1_ENST00000360264.3_Missense_Mutation_p.I976V|CUX1_ENST00000549414.2_Missense_Mutation_p.I943V|CUX1_ENST00000556210.1_Missense_Mutation_p.I807V|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	965					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CTGCCAGAGAATCTTCGGGGA	0.567																																					p.I976V		Atlas-SNP	.											.	CUX1	253	.	0			c.A2926G						.						72.0	79.0	76.0					7																	101845470		2203	4300	6503	SO:0001583	missense	1523	exon18			CAGAGAATCTTCG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2893A>G	chr7.hg19:g.101845470A>G	ENSP00000292535:p.Ile965Val	85.0	0.0		97.0	46.0	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.494025	0.64186	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.61859	0.08;0.09;0.07;0.07;0.07;0.08	5.14	5.14	0.70334	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.62307	0.2417	N	0.25825	0.765	0.80722	D	1	P;P	0.45348	0.856;0.826	P;P	0.60949	0.881;0.811	T	0.61836	-0.6981	10	0.37606	T	0.19	-22.5499	14.9669	0.71201	1.0:0.0:0.0:0.0	.	965;976	P39880;P39880-3	CUX1_HUMAN;.	V	976;965;943;909;863;807	ENSP00000353401:I976V;ENSP00000292535:I965V;ENSP00000446630:I943V;ENSP00000447373:I909V;ENSP00000450125:I863V;ENSP00000451558:I807V	ENSP00000292535:I965V	I	+	1	0	CUX1	101632190	1.000000	0.71417	0.987000	0.45799	0.956000	0.61745	7.000000	0.76290	1.953000	0.56701	0.533000	0.62120	ATC	.	.		0.567	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
TTC26	79989	hgsc.bcm.edu	37	7	138849981	138849981	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr7:138849981G>T	ENST00000464848.1	+	9	975		c.e9+1		TTC26_ENST00000495038.1_Splice_Site|TTC26_ENST00000343187.4_Splice_Site|TTC26_ENST00000430935.1_Splice_Site|TTC26_ENST00000478836.2_Splice_Site|TTC26_ENST00000481482.1_Splice_Site			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26						cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						CTTCGTCAAGGTAAGAAAAAT	0.378																																					.		Atlas-SNP	.											.	TTC26	50	.	0			c.895+1G>T						.						106.0	94.0	98.0					7																	138849981		2203	4300	6503	SO:0001630	splice_region_variant	79989	exon9			GTCAAGGTAAGAA	AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.895+1G>T	chr7.hg19:g.138849981G>T		50.0	0.0		95.0	40.0	NM_001144920	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Splice_Site	SNP	ENST00000464848.1	hg19	CCDS5852.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169242	0.78339	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000478836;ENST00000464848;ENST00000343187	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0069	0.86395	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTC26	138500521	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.740000	0.91579	2.384000	0.81235	0.655000	0.94253	.	.	.		0.378	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348919.2	NM_024926	Intron
CLCN1	1180	hgsc.bcm.edu	37	7	143018842	143018842	+	Silent	SNP	T	T	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr7:143018842T>A	ENST00000343257.2	+	5	684	c.597T>A	c.(595-597)cgT>cgA	p.R199R	CLCN1_ENST00000495612.1_3'UTR	NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	199					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CAATACTTCGTGGGGTTGTCC	0.517																																					p.R199R		Atlas-SNP	.											.	CLCN1	141	.	0			c.T597A						.						90.0	77.0	81.0					7																	143018842		2203	4300	6503	SO:0001819	synonymous_variant	1180	exon5			ACTTCGTGGGGTT	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.597T>A	chr7.hg19:g.143018842T>A		82.0	0.0		99.0	10.0	NM_000083	A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	hg19	CCDS5881.1																																																																																			.	.		0.517	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
GIMAP7	168537	hgsc.bcm.edu	37	7	150217878	150217878	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr7:150217878A>G	ENST00000313543.4	+	2	973	c.816A>G	c.(814-816)atA>atG	p.I272M		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	272					GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGAGAAATATATTTAAAGATG	0.249																																					p.I272M		Atlas-SNP	.											.	GIMAP7	47	.	0			c.A816G						.						31.0	34.0	33.0					7																	150217878		2191	4264	6455	SO:0001583	missense	168537	exon2			AAATATATTTAAA	BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.816A>G	chr7.hg19:g.150217878A>G	ENSP00000315474:p.Ile272Met	67.0	0.0		139.0	54.0	NM_153236		Missense_Mutation	SNP	ENST00000313543.4	hg19	CCDS5903.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.262019	0.39995	.	.	ENSG00000179144	ENST00000313543	T	0.05855	3.38	4.94	1.07	0.20283	.	0.514735	0.19268	N	0.118497	T	0.09992	0.0245	M	0.71581	2.175	0.09310	N	1	D	0.56521	0.976	P	0.49853	0.624	T	0.15178	-1.0446	10	0.38643	T	0.18	.	3.2226	0.06721	0.6342:0.0:0.1926:0.1731	.	272	Q8NHV1	GIMA7_HUMAN	M	272	ENSP00000315474:I272M	ENSP00000315474:I272M	I	+	3	3	GIMAP7	149848811	0.002000	0.14202	0.002000	0.10522	0.004000	0.04260	0.676000	0.25247	0.393000	0.25203	0.528000	0.53228	ATA	.	.		0.249	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349277.1	NM_153236	
R3HCC1	203069	hgsc.bcm.edu	37	8	23153535	23153535	+	Silent	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr8:23153535G>A	ENST00000411463.1	+	9	1368	c.1368G>A	c.(1366-1368)cgG>cgA	p.R456R	R3HCC1_ENST00000265806.6_Silent_p.R229R|R3HCC1_ENST00000518454.1_Silent_p.R229R|R3HCC1_ENST00000522012.1_3'UTR			Q9Y3T6	R3HC1_HUMAN	R3H domain and coiled-coil containing 1	456							nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			central_nervous_system(1)|skin(2)	3						TGGCCCGGCGGCTGGTGGCCC	0.637											OREG0018634	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R229R		Atlas-SNP	.											.	R3HCC1	11	.	0			c.G687A						.						12.0	19.0	17.0					8																	23153535		692	1591	2283	SO:0001819	synonymous_variant	203069	exon8			CCGGCGGCTGGTG		CCDS47826.1	8p21.3	2012-05-23		2005-11-20	ENSG00000104679	ENSG00000104679			27329	protein-coding gene	gene with protein product						12477932	Standard	XM_005273427		Approved	DKFZp564N123	uc003xdf.3	Q9Y3T6	OTTHUMG00000163786	ENST00000411463.1:c.1368G>A	chr8.hg19:g.23153535G>A		163.0	0.0	761	113.0	38.0	NM_001136108	B7ZLI1	Silent	SNP	ENST00000411463.1	hg19																																																																																				.	.		0.637	R3HCC1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136108	
JPH1	56704	hgsc.bcm.edu	37	8	75157174	75157174	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr8:75157174T>C	ENST00000342232.4	-	4	1535	c.1495A>G	c.(1495-1497)Agg>Ggg	p.R499G	JPH1_ENST00000518195.1_5'Flank	NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	499					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GCCACACTCCTTTTGTCTTGG	0.562																																					p.R499G		Atlas-SNP	.											.	JPH1	77	.	0			c.A1495G						.						130.0	109.0	116.0					8																	75157174		2203	4300	6503	SO:0001583	missense	56704	exon4			CACTCCTTTTGTC	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.1495A>G	chr8.hg19:g.75157174T>C	ENSP00000344488:p.Arg499Gly	61.0	0.0		136.0	39.0	NM_020647	B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	hg19	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	T	10.59	1.393460	0.25205	.	.	ENSG00000104369	ENST00000342232	T	0.56941	0.43	5.16	-0.266	0.12942	.	0.522889	0.20754	N	0.086299	T	0.32645	0.0836	N	0.14661	0.345	0.18873	N	0.999985	B	0.17667	0.023	B	0.16289	0.015	T	0.13818	-1.0495	10	0.23302	T	0.38	.	14.6527	0.68808	0.0:0.0:0.503:0.497	.	499	Q9HDC5	JPH1_HUMAN	G	499	ENSP00000344488:R499G	ENSP00000344488:R499G	R	-	1	2	JPH1	75319728	1.000000	0.71417	0.565000	0.28409	0.996000	0.88848	1.364000	0.34171	-0.172000	0.10779	0.528000	0.53228	AGG	.	.		0.562	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
DGAT1	8694	hgsc.bcm.edu	37	8	145541100	145541100	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr8:145541100A>C	ENST00000332324.4	-	13	1263	c.990T>G	c.(988-990)aaT>aaG	p.N330K	GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000527438.1_5'Flank	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	330					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			AGATGAGGTGATTGGGGACCT	0.602																																					p.N330K		Atlas-SNP	.											.	DGAT1	26	.	0			c.T990G						.						102.0	116.0	111.0					8																	145541100		2203	4296	6499	SO:0001583	missense	8694	exon13			GAGGTGATTGGGG	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.990T>G	chr8.hg19:g.145541100A>C	ENSP00000332258:p.Asn330Lys	25.0	0.0		63.0	31.0	NM_012079	B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	ENST00000332324.4	hg19	CCDS6420.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.986902	0.53934	.	.	ENSG00000185000	ENST00000332324	T	0.72725	-0.68	5.12	-1.06	0.10002	.	0.094443	0.64402	D	0.000001	D	0.83972	0.5370	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83392	0.0018	10	0.87932	D	0	-15.1327	10.1934	0.43041	0.551:0.0:0.449:0.0	.	330	O75907	DGAT1_HUMAN	K	330	ENSP00000332258:N330K	ENSP00000332258:N330K	N	-	3	2	DGAT1	145511908	0.994000	0.37717	0.993000	0.49108	0.611000	0.37282	0.249000	0.18216	-0.273000	0.09246	-1.070000	0.02257	AAT	.	.		0.602	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	NM_012079	
ZNF462	58499	hgsc.bcm.edu	37	9	109691842	109691842	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr9:109691842C>T	ENST00000277225.5	+	3	5938	c.5649C>T	c.(5647-5649)aaC>aaT	p.N1883N	ZNF462_ENST00000457913.1_Silent_p.N1883N|ZNF462_ENST00000441147.2_Silent_p.N728N			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1883					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TTCTGGGCAACGGCCCCCGCT	0.517																																					p.N1883N		Atlas-SNP	.											.	ZNF462	322	.	0			c.C5649T						.						91.0	77.0	82.0					9																	109691842		2203	4300	6503	SO:0001819	synonymous_variant	58499	exon3			GGGCAACGGCCCC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.5649C>T	chr9.hg19:g.109691842C>T		58.0	0.0		99.0	5.0	NM_021224	Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	hg19	CCDS35096.1																																																																																			.	.		0.517	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
CTNNAL1	8727	hgsc.bcm.edu	37	9	111761413	111761413	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr9:111761413T>C	ENST00000325551.4	-	2	351	c.265A>G	c.(265-267)Ata>Gta	p.I89V	CTNNAL1_ENST00000325580.6_Missense_Mutation_p.I89V|CTNNAL1_ENST00000374593.4_Missense_Mutation_p.I89V|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.I89V	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	89					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		TCATTGGCTATAGCTTCTCCT	0.353																																					p.I89V		Atlas-SNP	.											.	CTNNAL1	51	.	0			c.A265G						.						165.0	163.0	164.0					9																	111761413		2203	4300	6503	SO:0001583	missense	8727	exon2			TGGCTATAGCTTC	AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.265A>G	chr9.hg19:g.111761413T>C	ENSP00000320434:p.Ile89Val	86.0	0.0		165.0	72.0	NM_003798	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	hg19	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601433	0.87055	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580;ENST00000374593	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.69024	0.3065	M	0.86864	2.845	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.993	D;D;D	0.87578	0.987;0.998;0.987	T	0.73525	-0.3955	10	0.54805	T	0.06	-22.9378	14.5927	0.68378	0.0:0.0:0.0:1.0	.	89;89;89	B2RBI4;Q9UBT7-2;Q9UBT7	.;.;CTNL1_HUMAN	V	89	ENSP00000363723:I89V;ENSP00000320434:I89V;ENSP00000323351:I89V;ENSP00000363721:I89V	ENSP00000320434:I89V	I	-	1	0	CTNNAL1	110801234	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.005000	0.88553	2.326000	0.78906	0.533000	0.62120	ATA	.	.		0.353	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
SETX	23064	hgsc.bcm.edu	37	9	135156934	135156934	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr9:135156934G>C	ENST00000224140.5	-	20	6756	c.6574C>G	c.(6574-6576)Ctt>Gtt	p.L2192V	SETX_ENST00000393220.1_Missense_Mutation_p.L2192V|SETX_ENST00000372169.2_Missense_Mutation_p.L2192V	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2192					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AGTGGAGTAAGAGTCTCAATT	0.398																																					p.L2192V		Atlas-SNP	.											.	SETX	234	.	0			c.C6574G						.						114.0	105.0	108.0					9																	135156934		2203	4300	6503	SO:0001583	missense	23064	exon20			GAGTAAGAGTCTC	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6574C>G	chr9.hg19:g.135156934G>C	ENSP00000224140:p.Leu2192Val	110.0	0.0		149.0	58.0	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	hg19	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006883	0.74932	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000002	D	0.95595	0.8568	M	0.81942	2.565	0.49389	D	0.999789	D;D;D	0.76494	0.993;0.996;0.999	D;D;D	0.83275	0.983;0.97;0.996	D	0.95822	0.8850	10	0.87932	D	0	.	18.5257	0.90971	0.0:0.0:1.0:0.0	.	2192;2192;2192	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	V	2192;434;2192;2192	ENSP00000224140:L2192V;ENSP00000409143:L434V;ENSP00000361242:L2192V;ENSP00000376913:L2192V	ENSP00000224140:L2192V	L	-	1	0	SETX	134146755	1.000000	0.71417	0.076000	0.20297	0.929000	0.56500	3.989000	0.56958	2.626000	0.88956	0.650000	0.86243	CTT	.	.		0.398	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
GTF3C4	9329	hgsc.bcm.edu	37	9	135554698	135554698	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr9:135554698G>T	ENST00000372146.4	+	2	2256	c.1692G>T	c.(1690-1692)aaG>aaT	p.K564N		NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	564					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		TGGAAAAAAAGATTGAAAGCA	0.353																																					p.K564N	Pancreas(142;417 1875 11086 31973 47667)	Atlas-SNP	.											.	GTF3C4	53	.	0			c.G1692T						.						89.0	101.0	97.0					9																	135554698		2203	4298	6501	SO:0001583	missense	9329	exon2			AAAAAAGATTGAA	AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.1692G>T	chr9.hg19:g.135554698G>T	ENSP00000361219:p.Lys564Asn	66.0	0.0		107.0	39.0	NM_012204	Q5VZJ7	Missense_Mutation	SNP	ENST00000372146.4	hg19	CCDS6953.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805767	0.50421	.	.	ENSG00000125484	ENST00000372146	T	0.53206	0.63	5.69	4.78	0.61160	.	0.044883	0.85682	D	0.000000	T	0.51126	0.1656	N	0.24115	0.695	0.52501	D	0.999959	D	0.76494	0.999	D	0.64144	0.922	T	0.48969	-0.8987	10	0.44086	T	0.13	-42.4157	13.8581	0.63542	0.0757:0.0:0.9243:0.0	.	564	Q9UKN8	TF3C4_HUMAN	N	564	ENSP00000361219:K564N	ENSP00000361219:K564N	K	+	3	2	GTF3C4	134544519	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.928000	0.63447	2.696000	0.92011	0.655000	0.94253	AAG	.	.		0.353	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1		
ARMC4	55130	hgsc.bcm.edu	37	10	28276331	28276331	+	Silent	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr10:28276331G>T	ENST00000305242.5	-	3	458	c.366C>A	c.(364-366)gcC>gcA	p.A122A	ARMC4_ENST00000239715.3_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	122					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CACATGCTTGGGCTTCCTTCA	0.428																																					p.A122A		Atlas-SNP	.											.	ARMC4	177	.	0			c.C366A						.						85.0	79.0	81.0					10																	28276331		2203	4300	6503	SO:0001819	synonymous_variant	55130	exon3			TGCTTGGGCTTCC	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.366C>A	chr10.hg19:g.28276331G>T		66.0	0.0		96.0	36.0	NM_018076	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	ENST00000305242.5	hg19	CCDS7157.1																																																																																			.	.		0.428	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
ANK3	288	hgsc.bcm.edu	37	10	61831548	61831548	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr10:61831548A>G	ENST00000280772.2	-	37	9282	c.9091T>C	c.(9091-9093)Tat>Cat	p.Y3031H	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3031					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AAACCTACATAACTCTGGTGT	0.413																																					p.Y3031H		Atlas-SNP	.											.	ANK3	703	.	0			c.T9091C						.						73.0	80.0	78.0					10																	61831548		2203	4300	6503	SO:0001583	missense	288	exon37			CTACATAACTCTG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.9091T>C	chr10.hg19:g.61831548A>G	ENSP00000280772:p.Tyr3031His	40.0	0.0		73.0	32.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.608454	0.46527	.	.	ENSG00000151150	ENST00000280772	T	0.63744	-0.06	5.36	5.36	0.76844	.	0.201611	0.24678	N	0.036481	T	0.38026	0.1025	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27806	-1.0063	10	0.15499	T	0.54	.	9.8113	0.40824	0.923:0.0:0.077:0.0	.	3031	Q12955	ANK3_HUMAN	H	3031	ENSP00000280772:Y3031H	ENSP00000280772:Y3031H	Y	-	1	0	ANK3	61501554	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	2.745000	0.47459	2.034000	0.60081	0.379000	0.24179	TAT	.	.		0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
CPEB3	22849	hgsc.bcm.edu	37	10	93999597	93999597	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr10:93999597G>A	ENST00000265997.4	-	2	683	c.511C>T	c.(511-513)Ccc>Tcc	p.P171S	CPEB3_ENST00000412050.4_Missense_Mutation_p.P171S	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	171	Ala-rich.|Pro-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				tgcggcgcgggcgcaggcggc	0.741																																					p.P171S		Atlas-SNP	.											.	CPEB3	43	.	0			c.C511T						.						4.0	6.0	5.0					10																	93999597		1859	3716	5575	SO:0001583	missense	22849	exon2			GCGCGGGCGCAGG	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.511C>T	chr10.hg19:g.93999597G>A	ENSP00000265997:p.Pro171Ser	35.0	0.0		36.0	18.0	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Missense_Mutation	SNP	ENST00000265997.4	hg19	CCDS31246.1	.	.	.	.	.	.	.	.	.	.	G	2.709	-0.269251	0.05716	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.44881	0.91;0.92	0.926	0.926	0.19430	.	0.410133	0.19134	N	0.121880	T	0.28764	0.0713	N	0.08118	0	0.23210	N	0.998117	B;P;P	0.51449	0.002;0.909;0.945	B;P;P	0.56648	0.001;0.641;0.803	T	0.12553	-1.0543	10	0.20046	T	0.44	-6.0617	5.1721	0.15116	0.0:0.0:1.0:0.0	.	171;171;171	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	S	171	ENSP00000398310:P171S;ENSP00000265997:P171S	ENSP00000265997:P171S	P	-	1	0	CPEB3	93989577	0.987000	0.35691	0.984000	0.44739	0.484000	0.33280	-0.229000	0.09098	0.770000	0.33336	0.313000	0.20887	CCC	.	.		0.741	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
DOCK1	1793	hgsc.bcm.edu	37	10	129179616	129179616	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr10:129179616A>G	ENST00000280333.6	+	37	3837	c.3728A>G	c.(3727-3729)cAt>cGt	p.H1243R		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1243	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTGCTTCTCCATGCAAAGCTT	0.368																																					p.H1243R		Atlas-SNP	.											.	DOCK1	188	.	0			c.A3728G						.						149.0	139.0	142.0					10																	129179616		1860	4112	5972	SO:0001583	missense	1793	exon37			TTCTCCATGCAAA	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.3728A>G	chr10.hg19:g.129179616A>G	ENSP00000280333:p.His1243Arg	45.0	0.0		66.0	28.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	hg19		.	.	.	.	.	.	.	.	.	.	A	21.3	4.125409	0.77436	.	.	ENSG00000150760	ENST00000280333	T	0.26223	1.75	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.61388	0.2343	M	0.93763	3.455	0.80722	D	1	D;D;D	0.89917	1.0;0.994;1.0	D;P;D	0.97110	0.992;0.781;1.0	T	0.73212	-0.4054	10	0.87932	D	0	.	14.7436	0.69474	1.0:0.0:0.0:0.0	.	1243;1309;1243	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	R	1243	ENSP00000280333:H1243R	ENSP00000280333:H1243R	H	+	2	0	DOCK1	129069606	1.000000	0.71417	0.986000	0.45419	0.943000	0.58893	8.924000	0.92827	2.072000	0.62099	0.533000	0.62120	CAT	.	.		0.368	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
MUC2	4583	hgsc.bcm.edu	37	11	1084794	1084794	+	Silent	SNP	C	C	T	rs559546110		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:1084794C>T	ENST00000441003.2	+	20	2616	c.2589C>T	c.(2587-2589)taC>taT	p.Y863Y	MUC2_ENST00000359061.5_Silent_p.Y863Y	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	863	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCTCCATTTACGGGAGTGGCC	0.597													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19253	0.0		0.0	False		,,,				2504	0.0				p.Y863Y		Atlas-SNP	.											.	MUC2	614	.	0			c.C2589T						.						68.0	69.0	69.0					11																	1084794		2153	4247	6400	SO:0001819	synonymous_variant	4583	exon20			CATTTACGGGAGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2589C>T	chr11.hg19:g.1084794C>T		61.0	0.0		111.0	47.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.597	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1091476	1091476	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:1091476A>C	ENST00000441003.2	+	29	3912	c.3885A>C	c.(3883-3885)ttA>ttC	p.L1295F	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.L1296F	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1295					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TTGCAGTTTTATCAACAACTC	0.368																																					p.L1295F		Atlas-SNP	.											.	MUC2	614	.	0			c.A3885C						.						69.0	67.0	68.0					11																	1091476		1892	4115	6007	SO:0001583	missense	4583	exon29			AGTTTTATCAACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3885A>C	chr11.hg19:g.1091476A>C	ENSP00000415183:p.Leu1295Phe	185.0	0.0		255.0	15.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	A	0.162	-1.080045	0.01888	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13307	2.64;2.6	2.14	-4.28	0.03732	.	5.854200	0.01814	U	0.033653	T	0.06050	0.0157	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28996	-1.0026	10	0.15952	T	0.53	.	3.8845	0.09093	0.3308:0.2769:0.0:0.3923	.	1295	E7EUV1	.	F	1295;1296	ENSP00000415183:L1295F;ENSP00000351956:L1296F	ENSP00000351956:L1296F	L	+	3	2	MUC2	1081476	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.429000	0.06982	-2.496000	0.00513	-0.712000	0.03635	TTA	.	.		0.368	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR4D10	390197	hgsc.bcm.edu	37	11	59245374	59245374	+	Missense_Mutation	SNP	G	G	A	rs200781301		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:59245374G>A	ENST00000530162.1	+	1	529	c.472G>A	c.(472-474)Gtg>Atg	p.V158M		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V158M(1)|p.V156M(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCACTCCATCGTGCAGATTTC	0.547																																					p.V158M		Atlas-SNP	.											OR4D10_ENST00000530162,colon,carcinoma,0,4	OR4D10	120	.	2	Substitution - Missense(2)	endometrium(2)	c.G472A						.	G	MET/VAL	0,4402		0,0,2201	102.0	103.0	103.0		472	0.7	0.7	11		103	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR4D10	NM_001004705.1	21	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	benign	158/312	59245374	1,12991	2201	4295	6496	SO:0001583	missense	390197	exon1			TCCATCGTGCAGA	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.472G>A	chr11.hg19:g.59245374G>A	ENSP00000436424:p.Val158Met	64.0	0.0		108.0	15.0	NM_001004705	B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	hg19	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	G	10.07	1.249495	0.22880	0.0	1.16E-4	ENSG00000254466	ENST00000530162	T	0.38560	1.13	4.71	0.745	0.18359	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.36635	0.0974	L	0.56124	1.755	0.09310	N	1	B	0.19817	0.039	B	0.27380	0.079	T	0.40590	-0.9555	9	0.72032	D	0.01	.	5.5604	0.17140	0.3238:0.134:0.5422:0.0	.	158	Q8NGI6	OR4DA_HUMAN	M	158	ENSP00000436424:V158M	ENSP00000436424:V158M	V	+	1	0	OR4D10	59001950	0.000000	0.05858	0.704000	0.30370	0.724000	0.41520	-0.097000	0.11042	-0.053000	0.13289	-0.126000	0.14955	GTG	.	.		0.547	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705	
MTA2	9219	hgsc.bcm.edu	37	11	62367685	62367685	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:62367685C>T	ENST00000278823.2	-	3	532	c.143G>A	c.(142-144)cGc>cAc	p.R48H	MTA2_ENST00000527204.1_5'UTR|MTA2_ENST00000524902.1_5'Flank	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	48	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						aatgtccctgcgccggaaaag	0.458																																					p.R48H		Atlas-SNP	.											.	MTA2	54	.	0			c.G143A						.						124.0	124.0	124.0					11																	62367685		2202	4299	6501	SO:0001583	missense	9219	exon3			TCCCTGCGCCGGA	AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.143G>A	chr11.hg19:g.62367685C>T	ENSP00000278823:p.Arg48His	146.0	0.0		176.0	64.0	NM_004739	Q68DB1|Q9UQB5	Missense_Mutation	SNP	ENST00000278823.2	hg19	CCDS8022.1	.	.	.	.	.	.	.	.	.	.	C	32	5.182981	0.94885	.	.	ENSG00000149480	ENST00000278823	T	0.37752	1.18	5.56	5.56	0.83823	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	T	0.64283	0.2584	M	0.84846	2.72	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.69499	-0.5129	10	0.87932	D	0	-0.3396	15.0452	0.71822	0.0:1.0:0.0:0.0	.	48	O94776	MTA2_HUMAN	H	48	ENSP00000278823:R48H	ENSP00000278823:R48H	R	-	2	0	MTA2	62124261	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.628000	0.61282	2.629000	0.89072	0.655000	0.94253	CGC	.	.		0.458	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880095	64880095	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:64880095T>A	ENST00000279263.7	+	2	323	c.161T>A	c.(160-162)cTg>cAg	p.L54Q	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Missense_Mutation_p.L54Q|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	54					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTGCCGGGGCTGGAGGTGCTG	0.756																																					p.L54Q		Atlas-SNP	.											.	TM7SF2	30	.	0			c.T161A						.						2.0	2.0	2.0					11																	64880095		1470	3237	4707	SO:0001583	missense	7108	exon2			CGGGGCTGGAGGT	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.161T>A	chr11.hg19:g.64880095T>A	ENSP00000279263:p.Leu54Gln	71.0	0.0		77.0	24.0	NM_003273	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Missense_Mutation	SNP	ENST00000279263.7	hg19	CCDS41669.1	.	.	.	.	.	.	.	.	.	.	t	12.88	2.071119	0.36566	.	.	ENSG00000149809	ENST00000526809;ENST00000279263;ENST00000524986;ENST00000534371;ENST00000525385;ENST00000345348;ENST00000531321;ENST00000529414;ENST00000530750	D;D;D;D;D;D;D;D;T	0.99167	-4.89;-5.08;-4.39;-5.45;-4.57;-5.26;-5.51;-4.64;-1.45	4.91	-0.0421	0.13865	.	2.067490	0.01756	N	0.030251	D	0.99174	0.9714	M	0.86651	2.83	0.20563	N	0.999885	P;P	0.48764	0.915;0.881	P;P	0.59948	0.739;0.866	D	0.93365	0.6730	10	0.33141	T	0.24	1.5301	8.5502	0.33447	0.0:0.3023:0.0:0.6977	.	54;54	O76062-2;O76062	.;ERG24_HUMAN	Q	54;54;25;54;25;54;25;54;54	ENSP00000432171:L54Q;ENSP00000279263:L54Q;ENSP00000435972:L25Q;ENSP00000432187:L54Q;ENSP00000433325:L25Q;ENSP00000329520:L54Q;ENSP00000431300:L25Q;ENSP00000433275:L54Q;ENSP00000432413:L54Q	ENSP00000279263:L54Q	L	+	2	0	TM7SF2	64636671	0.000000	0.05858	0.001000	0.08648	0.063000	0.16089	-0.512000	0.06313	-0.160000	0.11002	-0.386000	0.06593	CTG	.	.		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
KIAA1377	57562	hgsc.bcm.edu	37	11	101834056	101834056	+	Missense_Mutation	SNP	A	A	G	rs138416296		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:101834056A>G	ENST00000263468.8	+	6	2560	c.2290A>G	c.(2290-2292)Aaa>Gaa	p.K764E	KIAA1377_ENST00000537689.1_Missense_Mutation_p.K565E	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	764										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AGGATCTGCAAAAGTCCAATC	0.363																																					p.K764E		Atlas-SNP	.											.	KIAA1377	111	.	0			c.A2290G						.	A	GLU/LYS	0,4406		0,0,2203	68.0	75.0	73.0		2290	4.4	1.0	11	dbSNP_134	73	1,8597	1.2+/-3.3	0,1,4298	no	missense	KIAA1377	NM_020802.2	56	0,1,6501	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging	764/1118	101834056	1,13003	2203	4299	6502	SO:0001583	missense	57562	exon6			TCTGCAAAAGTCC	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.2290A>G	chr11.hg19:g.101834056A>G	ENSP00000263468:p.Lys764Glu	104.0	0.0		145.0	7.0	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	hg19	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	A	12.43	1.934845	0.34189	0.0	1.16E-4	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.13420	2.59;2.59	5.52	4.39	0.52855	.	0.161033	0.43919	D	0.000506	T	0.25827	0.0629	M	0.64997	1.995	0.28370	N	0.92005	D	0.58620	0.983	P	0.53146	0.719	T	0.07046	-1.0793	10	0.72032	D	0.01	-15.6109	12.8491	0.57848	0.8557:0.1442:0.0:0.0	.	764	Q9P2H0	K1377_HUMAN	E	764;565	ENSP00000263468:K764E;ENSP00000443184:K565E	ENSP00000263468:K764E	K	+	1	0	KIAA1377	101339266	0.070000	0.21116	0.956000	0.39512	0.067000	0.16453	2.100000	0.41777	1.037000	0.40024	0.533000	0.62120	AAA	.	A|1.000;G|0.000		0.363	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
MMP10	4319	hgsc.bcm.edu	37	11	102641594	102641594	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:102641594T>A	ENST00000279441.4	-	10	1397	c.1361A>T	c.(1360-1362)cAg>cTg	p.Q454L		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	454					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	AAACTCAAACTGTGATGATCC	0.378																																					p.Q454L		Atlas-SNP	.											.	MMP10	44	.	0			c.A1361T						.						117.0	101.0	107.0					11																	102641594		2203	4299	6502	SO:0001583	missense	4319	exon10			TCAAACTGTGATG	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.1361A>T	chr11.hg19:g.102641594T>A	ENSP00000279441:p.Gln454Leu	92.0	0.0		115.0	39.0	NM_002425	B2R9X9|Q53HH9	Missense_Mutation	SNP	ENST00000279441.4	hg19	CCDS8321.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.865767	0.51588	.	.	ENSG00000166670	ENST00000279441	T	0.02552	4.25	3.96	3.96	0.45880	Hemopexin/matrixin (2);	0.410152	0.18526	N	0.138631	T	0.15349	0.0370	M	0.82923	2.615	0.49483	D	0.99979	D	0.89917	1.0	D	0.97110	1.0	T	0.01238	-1.1409	10	0.39692	T	0.17	.	13.3079	0.60363	0.0:0.0:0.0:1.0	.	454	P09238	MMP10_HUMAN	L	454	ENSP00000279441:Q454L	ENSP00000279441:Q454L	Q	-	2	0	MMP10	102146804	0.996000	0.38824	0.988000	0.46212	0.476000	0.33039	2.027000	0.41078	1.766000	0.52107	0.533000	0.62120	CAG	.	.		0.378	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1		
MMP10	4319	hgsc.bcm.edu	37	11	102650306	102650306	+	Silent	SNP	T	T	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:102650306T>G	ENST00000279441.4	-	2	312	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	92					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	CGTCAGGAACTCCACACCTGG	0.473																																					p.G92G		Atlas-SNP	.											.	MMP10	44	.	0			c.A276C						.						112.0	90.0	98.0					11																	102650306		2203	4299	6502	SO:0001819	synonymous_variant	4319	exon2			AGGAACTCCACAC	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.276A>C	chr11.hg19:g.102650306T>G		79.0	0.0		135.0	56.0	NM_002425	B2R9X9|Q53HH9	Silent	SNP	ENST00000279441.4	hg19	CCDS8321.1																																																																																			.	.		0.473	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1		
TECTA	7007	hgsc.bcm.edu	37	11	121016728	121016728	+	Silent	SNP	C	C	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr11:121016728C>A	ENST00000392793.1	+	12	4279	c.4008C>A	c.(4006-4008)ggC>ggA	p.G1336G	TECTA_ENST00000264037.2_Silent_p.G1336G|TECTA_ENST00000478058.1_3'UTR			O75443	TECTA_HUMAN	tectorin alpha	1336					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCGATGGGGGCGCGGTGCAGA	0.562																																					p.G1336G		Atlas-SNP	.											.	TECTA	329	.	0			c.C4008A						.						99.0	96.0	97.0					11																	121016728		2203	4299	6502	SO:0001819	synonymous_variant	7007	exon11			TGGGGGCGCGGTG	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4008C>A	chr11.hg19:g.121016728C>A		1014.0	2.0		1428.0	572.0	NM_005422		Silent	SNP	ENST00000392793.1	hg19	CCDS8434.1																																																																																			.	.		0.562	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
TFCP2	7024	hgsc.bcm.edu	37	12	51566149	51566149	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr12:51566149C>T	ENST00000257915.5	-	1	515	c.57G>A	c.(55-57)gtG>gtA	p.V19V	TFCP2_ENST00000549867.1_Silent_p.V19V|TFCP2_ENST00000548115.1_Silent_p.V19V|TFCP2_ENST00000307660.4_Silent_p.V19V	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	19					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						CAAAGTCCTGCACCAACCCGG	0.567																																					p.V19V		Atlas-SNP	.											.	TFCP2	49	.	0			c.G57A						.						125.0	118.0	120.0					12																	51566149		2203	4300	6503	SO:0001819	synonymous_variant	7024	exon1			GTCCTGCACCAAC	U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.57G>A	chr12.hg19:g.51566149C>T		43.0	0.0		74.0	24.0	NM_001173452	A8K5E9|Q12801|Q9UD75|Q9UD77	Silent	SNP	ENST00000257915.5	hg19	CCDS8808.1																																																																																			.	.		0.567	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653	
HOXC4	3221	hgsc.bcm.edu	37	12	54447994	54447994	+	Silent	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr12:54447994G>T	ENST00000430889.2	+	1	334	c.288G>T	c.(286-288)tcG>tcT	p.S96S	HOXC4_ENST00000609810.1_Silent_p.S96S|HOXC4_ENST00000303406.4_Silent_p.S96S	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	96					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						AATCACAGTCGCTCTGCGAGC	0.736																																					p.S96S		Atlas-SNP	.											.	HOXC4	29	.	0			c.G288T						.						14.0	19.0	17.0					12																	54447994		2189	4278	6467	SO:0001819	synonymous_variant	3221	exon3			ACAGTCGCTCTGC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.288G>T	chr12.hg19:g.54447994G>T		62.0	0.0		100.0	49.0	NM_014620		Silent	SNP	ENST00000430889.2	hg19	CCDS8873.1																																																																																			.	.		0.736	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
NR1H4	9971	hgsc.bcm.edu	37	12	100957256	100957256	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr12:100957256G>A	ENST00000551379.1	+	9	1478	c.1450G>A	c.(1450-1452)Gac>Aac	p.D484N	NR1H4_ENST00000549996.1_Missense_Mutation_p.D423N|NR1H4_ENST00000392986.3_Missense_Mutation_p.D474N|NR1H4_ENST00000188403.7_Missense_Mutation_p.D480N|NR1H4_ENST00000548884.1_Missense_Mutation_p.D470N			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	484					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	TGAAATCTGGGACGTGCAGTG	0.438																																					p.D484N		Atlas-SNP	.											.	NR1H4	145	.	0			c.G1450A						.						105.0	103.0	103.0					12																	100957256		2203	4300	6503	SO:0001583	missense	9971	exon9			ATCTGGGACGTGC	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.1450G>A	chr12.hg19:g.100957256G>A	ENSP00000447149:p.Asp484Asn	66.0	0.0		100.0	37.0	NM_001206993	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	ENST00000551379.1	hg19	CCDS55876.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250484	0.59212	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000549996;ENST00000551379;ENST00000188403	D;D;D;D;D	0.96073	-3.9;-3.9;-3.9;-3.9;-3.9	5.59	5.59	0.84812	Nuclear hormone receptor, ligand-binding (2);	0.042114	0.85682	D	0.000000	D	0.97114	0.9057	L	0.55481	1.735	0.80722	D	1	D;B;D;D;P	0.89917	1.0;0.394;1.0;1.0;0.725	D;B;D;D;P	0.87578	0.998;0.311;0.998;0.995;0.721	D	0.96802	0.9590	10	0.51188	T	0.08	.	19.96	0.97242	0.0:0.0:1.0:0.0	.	423;484;480;474;470	F8VYG8;Q96RI1;Q96RI1-4;F1DAL1;B6ZGS9	.;NR1H4_HUMAN;.;.;.	N	470;474;423;484;480	ENSP00000448506:D470N;ENSP00000376712:D474N;ENSP00000448978:D423N;ENSP00000447149:D484N;ENSP00000188403:D480N	ENSP00000188403:D480N	D	+	1	0	NR1H4	99481387	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	9.772000	0.98984	2.793000	0.96121	0.561000	0.74099	GAC	.	.		0.438	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123	
RCBTB2	1102	hgsc.bcm.edu	37	13	49086978	49086978	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr13:49086978T>C	ENST00000344532.3	-	7	826	c.403A>G	c.(403-405)Aca>Gca	p.T135A	RCBTB2_ENST00000481144.1_5'UTR|RCBTB2_ENST00000430805.2_Missense_Mutation_p.T140A|RCBTB2_ENST00000544904.1_Missense_Mutation_p.T111A|RCBTB2_ENST00000544492.1_Intron	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	135					positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TGATTAGTTGTCCCATTGCCC	0.388																																					p.T135A		Atlas-SNP	.											.	RCBTB2	62	.	0			c.A403G						.						132.0	124.0	127.0					13																	49086978		2203	4300	6503	SO:0001583	missense	1102	exon7			TAGTTGTCCCATT	AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.403A>G	chr13.hg19:g.49086978T>C	ENSP00000345144:p.Thr135Ala	65.0	0.0		57.0	33.0	NM_001268	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	hg19	CCDS9411.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255571	0.59321	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544904	D;D;D	0.85629	-2.01;-2.01;-2.01	5.63	4.44	0.53790	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.089095	0.85682	N	0.000000	T	0.79364	0.4433	L	0.50847	1.595	0.52099	D	0.999949	B;B;B;B	0.14012	0.008;0.009;0.001;0.009	B;B;B;B	0.24701	0.015;0.034;0.007;0.055	T	0.71052	-0.4704	10	0.28530	T	0.3	.	6.8414	0.23965	0.1341:0.0711:0.0:0.7948	.	111;140;139;135	B4DPP7;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	A	135;139;140;140;111	ENSP00000345144:T135A;ENSP00000389910:T140A;ENSP00000443904:T111A	ENSP00000345144:T135A	T	-	1	0	RCBTB2	47984979	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.661000	0.61518	1.058000	0.40530	0.477000	0.44152	ACA	.	.		0.388	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268	
MYH6	4624	hgsc.bcm.edu	37	14	23868178	23868178	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr14:23868178C>T	ENST00000356287.3	-	14	1679	c.1650G>A	c.(1648-1650)aaG>aaA	p.K550K	MYH6_ENST00000405093.3_Silent_p.K550K			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	550	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ACAGCTTGGCCTTGAAGGTCA	0.552																																					p.K550K		Atlas-SNP	.											.	MYH6	274	.	0			c.G1650A						.						222.0	161.0	182.0					14																	23868178		2203	4300	6503	SO:0001819	synonymous_variant	4624	exon15			CTTGGCCTTGAAG	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1650G>A	chr14.hg19:g.23868178C>T		78.0	0.0		104.0	52.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	hg19	CCDS9600.1																																																																																			.	.		0.552	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
PCNX	22990	hgsc.bcm.edu	37	14	71575423	71575423	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr14:71575423A>G	ENST00000304743.2	+	34	6850	c.6404A>G	c.(6403-6405)cAt>cGt	p.H2135R	PCNX_ENST00000439984.3_Missense_Mutation_p.H2024R|PCNX_ENST00000556272.1_3'UTR|PCNX_ENST00000238570.5_Missense_Mutation_p.H2063R	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	2135	Ser-rich.					integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGCAGCCGGCATTCATCCCTC	0.567																																					p.H2135R		Atlas-SNP	.											.	PCNX	198	.	0			c.A6404G						.						69.0	65.0	66.0					14																	71575423		2203	4300	6503	SO:0001583	missense	22990	exon34			GCCGGCATTCATC	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.6404A>G	chr14.hg19:g.71575423A>G	ENSP00000304192:p.His2135Arg	78.0	0.0		64.0	49.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	hg19	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.961|4.961	0.178500|0.178500	0.09443|0.09443	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.09163|.	3.42;3.46;3.01|.	5.94|5.94	4.73|4.73	0.59995|0.59995	.|.	0.046608|.	0.85682|.	D|.	0.000000|.	T|T	0.53753|0.53753	0.1816|0.1816	L|L	0.56769|0.56769	1.78|1.78	0.27291|0.27291	N|N	0.957848|0.957848	B;P;P|.	0.40731|.	0.386;0.651;0.728|.	B;B;B|.	0.31946|.	0.124;0.084;0.138|.	T|T	0.48801|0.48801	-0.9003|-0.9003	10|5	0.10111|.	T|.	0.7|.	.|.	12.8894|12.8894	0.58064|0.58064	0.8645:0.1355:0.0:0.0|0.8645:0.1355:0.0:0.0	.|.	2063;2024;2135|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	R|V	2135;2063;2024|1122	ENSP00000304192:H2135R;ENSP00000238570:H2063R;ENSP00000396617:H2024R|.	ENSP00000238570:H2063R|.	H|I	+|+	2|1	0|0	PCNX|PCNX	70645176|70645176	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.135000|0.135000	0.20990|0.20990	6.866000|6.866000	0.75506|0.75506	2.276000|2.276000	0.75962|0.75962	0.455000|0.455000	0.32223|0.32223	CAT|ATT	.	.		0.567	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103570678	103570678	+	Silent	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr14:103570678G>A	ENST00000380069.3	+	4	1312	c.1236G>A	c.(1234-1236)gaG>gaA	p.E412E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	412					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						AGGTCCCCGAGGTGCTGCAGG	0.672																																					p.E412E		Atlas-SNP	.											.	EXOC3L4	35	.	0			c.G1236A						.						11.0	12.0	12.0					14																	103570678		2192	4289	6481	SO:0001819	synonymous_variant	91828	exon4			CCCCGAGGTGCTG	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1236G>A	chr14.hg19:g.103570678G>A		82.0	0.0		58.0	40.0	NM_001077594	Q14CR2	Silent	SNP	ENST00000380069.3	hg19	CCDS32163.1																																																																																			.	.		0.672	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
CKB	1152	hgsc.bcm.edu	37	14	103988750	103988750	+	Silent	SNP	G	G	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr14:103988750G>A	ENST00000348956.2	-	2	438	c.81C>T	c.(79-81)aaC>aaT	p.N27N	RP11-600F24.7_ENST00000568177.1_RNA	NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	27	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	CCATGTGGTTGTTGTGGGCGC	0.687																																					p.N27N	Esophageal Squamous(186;2492 2823 49929 50127)	Atlas-SNP	.											.	CKB	9	.	0			c.C81T						.						66.0	60.0	62.0					14																	103988750		2203	4300	6503	SO:0001819	synonymous_variant	1152	exon2			GTGGTTGTTGTGG		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.81C>T	chr14.hg19:g.103988750G>A		52.0	0.0		39.0	32.0	NM_001823	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	hg19	CCDS9981.1																																																																																			.	.		0.687	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
TGM5	9333	hgsc.bcm.edu	37	15	43527750	43527750	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr15:43527750C>T	ENST00000220420.5	-	10	1638	c.1631G>A	c.(1630-1632)aGt>aAt	p.S544N	TGM5_ENST00000349114.4_Missense_Mutation_p.S462N	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	544					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	AGACTGGGCACTCAGGTTCAC	0.557																																					p.S544N		Atlas-SNP	.											.	TGM5	88	.	0			c.G1631A						.						82.0	61.0	68.0					15																	43527750		2203	4299	6502	SO:0001583	missense	9333	exon10			TGGGCACTCAGGT	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1631G>A	chr15.hg19:g.43527750C>T	ENSP00000220420:p.Ser544Asn	68.0	0.0		96.0	41.0	NM_201631	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	ENST00000220420.5	hg19	CCDS32212.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082888	0.76642	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	T;T	0.70164	-0.46;-0.46	5.05	5.05	0.67936	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.047776	0.85682	D	0.000000	T	0.79076	0.4385	M	0.61703	1.905	0.35154	D	0.77001	B;D	0.89917	0.207;1.0	B;D	0.79784	0.219;0.993	T	0.83095	-0.0131	10	0.44086	T	0.13	-17.4727	15.9436	0.79776	0.0:1.0:0.0:0.0	.	462;544	O43548-2;O43548	.;TGM5_HUMAN	N	544;462;543	ENSP00000220420:S544N;ENSP00000220419:S462N	ENSP00000220420:S544N	S	-	2	0	TGM5	41315042	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.056000	0.30480	2.631000	0.89168	0.655000	0.94253	AGT	.	.		0.557	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	NM_004245	
PYGO1	26108	hgsc.bcm.edu	37	15	55881035	55881035	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr15:55881035A>T	ENST00000302000.6	-	1	110	c.16T>A	c.(16-18)Tct>Act	p.S6T	PYGO1_ENST00000563719.1_5'Flank	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	6					hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GGAGCTGGAGAGTTCTCGGCG	0.582																																					p.S6T		Atlas-SNP	.											.	PYGO1	56	.	0			c.T16A						.						107.0	102.0	104.0					15																	55881035		2193	4292	6485	SO:0001583	missense	26108	exon1			CTGGAGAGTTCTC	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.16T>A	chr15.hg19:g.55881035A>T	ENSP00000302327:p.Ser6Thr	46.0	0.0		54.0	26.0	NM_015617	A7Y2D6	Missense_Mutation	SNP	ENST00000302000.6	hg19	CCDS10155.1	.	.	.	.	.	.	.	.	.	.	a	13.90	2.374917	0.42105	.	.	ENSG00000171016	ENST00000302000	T	0.43688	0.94	1.9	1.9	0.25705	.	0.960325	0.08383	U	0.954185	T	0.21307	0.0513	N	0.08118	0	0.21861	N	0.999504	B	0.18310	0.027	B	0.09377	0.004	T	0.16600	-1.0397	10	0.33141	T	0.24	.	5.8343	0.18599	1.0:0.0:0.0:0.0	.	6	Q9Y3Y4	PYGO1_HUMAN	T	6	ENSP00000302327:S6T	ENSP00000302327:S6T	S	-	1	0	PYGO1	53668327	0.036000	0.19791	0.053000	0.19242	0.406000	0.30931	0.792000	0.26929	1.150000	0.42419	0.241000	0.17934	TCT	.	.		0.582	PYGO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254977.2	NM_015617	
SLX4	84464	hgsc.bcm.edu	37	16	3633142	3633142	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr16:3633142C>T	ENST00000294008.3	-	14	5749	c.5109G>A	c.(5107-5109)gtG>gtA	p.V1703V	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1703	Interaction with PLK1 and TERF2-TERF2IP.|Interaction with SLX1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CAGAGGTGGCCACGGATTCTT	0.597								Direct reversal of damage																													p.V1703V		Atlas-SNP	.											.	SLX4	173	.	0			c.G5109A						.						124.0	114.0	117.0					16																	3633142		2197	4300	6497	SO:0001819	synonymous_variant	84464	exon14			GGTGGCCACGGAT	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.5109G>A	chr16.hg19:g.3633142C>T		75.0	0.0		86.0	30.0	NM_032444	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	hg19	CCDS10506.2																																																																																			.	.		0.597	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
ZFHX3	463	hgsc.bcm.edu	37	16	72821621	72821621	+	Silent	SNP	G	G	A	rs369119448|rs566462936	byFrequency	TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr16:72821621G>A	ENST00000268489.5	-	10	11226	c.10554C>T	c.(10552-10554)ggC>ggT	p.G3518G	RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA|RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Silent_p.G2604G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3518	Poly-Gly.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cgccgccaccgccgccgccgc	0.711													G|||	415	0.0828674	0.0567	0.1801	5008	,	,		5282	0.1766		0.004	False		,,,				2504	0.0337				p.G3518G		Atlas-SNP	.											.	ZFHX3	404	.	0			c.C10554T						.						7.0	11.0	10.0					16																	72821621		1466	3147	4613	SO:0001819	synonymous_variant	463	exon10			GCCACCGCCGCCG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10554C>T	chr16.hg19:g.72821621G>A		2.0	0.0		8.0	4.0	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.		0.711	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
FOXC2	2303	hgsc.bcm.edu	37	16	86602407	86602407	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr16:86602407G>T	ENST00000320354.4	+	1	1551	c.1466G>T	c.(1465-1467)cGc>cTc	p.R489L	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	489					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						CCTCTCTATCGCCACGCAGCC	0.667									Late-onset Hereditary Lymphedema																												p.R489L		Atlas-SNP	.											.	FOXC2	46	.	0			c.G1466T						.						29.0	28.0	28.0					16																	86602407		2089	4144	6233	SO:0001583	missense	2303	exon1	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	TCTATCGCCACGC	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.1466G>T	chr16.hg19:g.86602407G>T	ENSP00000326371:p.Arg489Leu	239.0	0.0		393.0	160.0	NM_005251	C6KMR9|Q14DA6	Missense_Mutation	SNP	ENST00000320354.4	hg19	CCDS10958.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083091	0.55861	.	.	ENSG00000176692	ENST00000320354	D	0.83075	-1.68	4.35	4.35	0.52113	.	3.799080	0.01714	U	0.027918	D	0.89873	0.6841	L	0.39245	1.2	0.58432	D	0.999998	D	0.76494	0.999	D	0.79784	0.993	T	0.77824	-0.2444	10	0.87932	D	0	.	15.5954	0.76574	0.0:0.0:1.0:0.0	.	489	Q99958	FOXC2_HUMAN	L	489	ENSP00000326371:R489L	ENSP00000326371:R489L	R	+	2	0	FOXC2	85159908	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	8.870000	0.92336	2.223000	0.72356	0.462000	0.41574	CGC	.	.		0.667	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	NM_005251	
SLFN11	91607	hgsc.bcm.edu	37	17	33680410	33680410	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr17:33680410C>A	ENST00000394566.1	-	6	2139	c.1867G>T	c.(1867-1869)Gag>Tag	p.E623*	SLFN11_ENST00000308377.4_Nonsense_Mutation_p.E623*	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	623					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.E623K(1)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGTGTGCCTCACAGTGAAAC	0.448																																					p.E623X		Atlas-SNP	.											SLFN11,NS,carcinoma,0,1	SLFN11	112	.	1	Substitution - Missense(1)	lung(1)	c.G1867T						.						50.0	48.0	48.0					17																	33680410		2202	4279	6481	SO:0001587	stop_gained	91607	exon4			GTGCCTCACAGTG	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.1867G>T	chr17.hg19:g.33680410C>A	ENSP00000378067:p.Glu623*	328.0	0.0		598.0	276.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Nonsense_Mutation	SNP	ENST00000394566.1	hg19	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	c	38	6.917570	0.97932	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	.	.	.	3.84	0.484	0.16825	.	0.641420	0.13615	N	0.374871	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	5.8179	0.18506	0.0:0.507:0.3822:0.1108	.	.	.	.	X	623	.	ENSP00000312402:E623X	E	-	1	0	SLFN11	30704523	0.000000	0.05858	0.021000	0.16686	0.540000	0.34992	-2.185000	0.01252	0.039000	0.15632	0.650000	0.86243	GAG	.	.		0.448	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
KRT10	3858	hgsc.bcm.edu	37	17	38975315	38975317	+	Missense_Mutation	TNP	TGG	TGG	GAA			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T|G|G	T|G|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr17:38975315_38975317TGG>GAA	ENST00000269576.5	-	7	1479_1481	c.1470_1472CCA>TTC	c.(1468-1473)ggCCAc>ggTTCc	p.H491S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	491	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 1; AAA60544). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				actgccgccgtggccgccgccgt	0.798																																					p.H491P|p.H491Y|p.G490G		Atlas-SNP	.											.	KRT10	56	.	0			c.A1472C|c.C1471T|c.C1470T						.																																			SO:0001583	missense	3858	exon7			CCGCCGTGGCCGC|CGCCGTGGCCGCC|GCCGTGGCCGCCG	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1470_1472CCA>TTC	chr17.hg19:g.38975315TGG>GAA	ENSP00000269576:p.His491Ser	17.0|16.0|16.0	0.0		85.0|85.0|88.0	18.0|18.0|20.0	NM_000421	Q14664|Q8N175	Missense_Mutation|Missense_Mutation|Silent	SNP	ENST00000269576.5	hg19	CCDS11377.1																																																																																			.	.		0.798	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	14.0	0.0		90.0	19.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
FZD2	2535	hgsc.bcm.edu	37	17	42636226	42636226	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr17:42636226G>T	ENST00000315323.3	+	1	1302	c.1170G>T	c.(1168-1170)atG>atT	p.M390I		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	390					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TCCTGGCCATGGGCCAGATCG	0.667																																					p.M390I		Atlas-SNP	.											.	FZD2	81	.	0			c.G1170T						.						69.0	69.0	69.0					17																	42636226		2203	4299	6502	SO:0001583	missense	2535	exon1			GGCCATGGGCCAG	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1170G>T	chr17.hg19:g.42636226G>T	ENSP00000323901:p.Met390Ile	25.0	0.0		67.0	16.0	NM_001466	Q0VG82	Missense_Mutation	SNP	ENST00000315323.3	hg19	CCDS11484.1	.	.	.	.	.	.	.	.	.	.	g	15.15	2.747560	0.49257	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.81659	-1.52	5.14	5.14	0.70334	GPCR, family 2-like (1);	0.123655	0.64402	D	0.000001	D	0.85860	0.5795	M	0.91717	3.235	0.58432	D	0.999998	B	0.12013	0.005	B	0.21151	0.033	D	0.85132	0.0975	10	0.72032	D	0.01	.	18.213	0.89877	0.0:0.0:1.0:0.0	.	390	Q14332	FZD2_HUMAN	I	466;390	ENSP00000323901:M390I	ENSP00000323901:M390I	M	+	3	0	FZD2	39991752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.733000	0.62036	2.379000	0.81126	0.561000	0.74099	ATG	.	.		0.667	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466	
QRICH2	84074	hgsc.bcm.edu	37	17	74288391	74288392	+	Missense_Mutation	DNP	GC	GC	AT	rs530614567|rs550406051	byFrequency	TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr17:74288391_74288392GC>AT	ENST00000262765.5	-	4	2097_2098	c.1918_1919GC>AT	c.(1918-1920)GCa>ATa	p.A640I		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	640	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						acgctgaactgcaccaggttgc	0.54																																					p.A640V|p.A640T		Atlas-SNP	.											.	QRICH2	143	.	0			c.C1919T|c.G1918A						.																																			SO:0001583	missense	84074	exon4			TGAACTGCACCAG|GAACTGCACCAGG	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1918_1919delinsAT	chr17.hg19:g.74288391_74288392delinsAT	ENSP00000262765:p.Ala640Ile	89.0|87.0	0.0		113.0|115.0	30.0	NM_032134	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	hg19	CCDS32741.1																																																																																			.	.		0.540	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
COLEC12	81035	hgsc.bcm.edu	37	18	347058	347058	+	Silent	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr18:347058G>T	ENST00000400256.3	-	5	771	c.564C>A	c.(562-564)ctC>ctA	p.L188L		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	188					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GATTGCCCTGGAGCACGCTGG	0.463																																					p.L188L		Atlas-SNP	.											COLEC12,right_upper_lobe,carcinoma,0,1	COLEC12	121	.	0			c.C564A						.						155.0	153.0	154.0					18																	347058		2203	4300	6503	SO:0001819	synonymous_variant	81035	exon5			GCCCTGGAGCACG	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.564C>A	chr18.hg19:g.347058G>T		42.0	0.0		57.0	25.0	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	hg19	CCDS32782.1																																																																																			.	.		0.463	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
MAPK4	5596	hgsc.bcm.edu	37	18	48190380	48190380	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr18:48190380G>C	ENST00000400384.2	+	2	1088	c.52G>C	c.(52-54)Ggg>Cgg	p.G18R	MAPK4_ENST00000592595.1_Missense_Mutation_p.G18R|MAPK4_ENST00000540640.1_Intron|MAPK4_ENST00000588540.1_Missense_Mutation_p.G18R	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	18					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		TGACCTCGGTGGGCGCTTTGT	0.597																																					p.G18R		Atlas-SNP	.											.	MAPK4	75	.	0			c.G52C						.						102.0	106.0	105.0					18																	48190380		2058	4201	6259	SO:0001583	missense	5596	exon2			CTCGGTGGGCGCT	X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.52G>C	chr18.hg19:g.48190380G>C	ENSP00000383234:p.Gly18Arg	47.0	0.0		71.0	28.0	NM_002747	A1A4C4|Q0VG04	Missense_Mutation	SNP	ENST00000400384.2	hg19	CCDS42437.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429401	0.43122	.	.	ENSG00000141639	ENST00000400384	T	0.45668	0.89	5.67	2.7	0.31948	Protein kinase-like domain (1);	0.122950	0.37857	N	0.001917	T	0.35451	0.0932	N	0.20445	0.575	0.24868	N	0.992305	P;P	0.37663	0.604;0.604	P;P	0.46543	0.52;0.52	T	0.23940	-1.0174	10	0.26408	T	0.33	-4.9077	13.0808	0.59114	0.0:0.0:0.3809:0.6191	.	18;18	Q0VG04;P31152	.;MK04_HUMAN	R	18	ENSP00000383234:G18R	ENSP00000383234:G18R	G	+	1	0	MAPK4	46444378	0.998000	0.40836	0.040000	0.18447	0.988000	0.76386	3.043000	0.49823	0.719000	0.32188	0.561000	0.74099	GGG	.	.		0.597	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448631.2	NM_002747	
FZR1	51343	hgsc.bcm.edu	37	19	3534791	3534791	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:3534791A>G	ENST00000395095.3	+	13	1449		c.e13-1		FZR1_ENST00000441788.2_Splice_Site|FZR1_ENST00000313639.8_Splice_Site	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)						activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTGTCTGCAGGAGTCTGTG	0.652																																					.		Atlas-SNP	.											.	FZR1	42	.	0			c.1441-2A>G						.						112.0	88.0	96.0					19																	3534791		2203	4300	6503	SO:0001630	splice_region_variant	51343	exon14			GTCTGCAGGAGTC	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1450-1A>G	chr19.hg19:g.3534791A>G		36.0	0.0		30.0	20.0	NM_016263	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Splice_Site	SNP	ENST00000395095.3	hg19	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.644761	0.67358	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.317	0.49399	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FZR1	3485791	1.000000	0.71417	0.997000	0.53966	0.757000	0.42996	8.437000	0.90302	1.753000	0.51906	0.459000	0.35465	.	.	.		0.652	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	Intron
ZNF101	94039	hgsc.bcm.edu	37	19	19790278	19790278	+	Silent	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:19790278A>G	ENST00000592502.1	+	4	590	c.480A>G	c.(478-480)acA>acG	p.T160T	ZNF101_ENST00000444249.2_3'UTR|ZNF101_ENST00000415784.2_Silent_p.T40T			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						CACGGCGCACAGTAACACCAA	0.473																																					p.T160T		Atlas-SNP	.											.	ZNF101	43	.	0			c.A480G						.						96.0	98.0	97.0					19																	19790278		2203	4300	6503	SO:0001819	synonymous_variant	94039	exon4			GCGCACAGTAACA	AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.480A>G	chr19.hg19:g.19790278A>G		76.0	0.0		105.0	49.0	NM_033204	C9JU83|Q0VDG9	Silent	SNP	ENST00000592502.1	hg19	CCDS32971.1																																																																																			.	.		0.473	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
ZNF99	7652	hgsc.bcm.edu	37	19	22941279	22941279	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:22941279C>G	ENST00000596209.1	-	4	1522	c.1432G>C	c.(1432-1434)Gag>Cag	p.E478Q	ZNF99_ENST00000397104.3_Missense_Mutation_p.E387Q	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E387Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAGGGTTTCTCTCCAGTATGA	0.353																																					p.E478Q		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	1	Substitution - Missense(1)	prostate(1)	c.G1432C						.																																			SO:0001583	missense	7652	exon4			GTTTCTCTCCAGT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1432G>C	chr19.hg19:g.22941279C>G	ENSP00000472969:p.Glu478Gln	44.0	0.0		73.0	3.0	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	15.37	2.812264	0.50527	.	.	ENSG00000213973	ENST00000397104	T	0.25912	1.77	1.28	1.28	0.21552	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38188	0.1031	L	0.55834	1.745	0.37534	D	0.918031	D	0.65815	0.995	P	0.61328	0.887	T	0.41980	-0.9478	9	0.72032	D	0.01	.	9.4929	0.38971	0.0:1.0:0.0:0.0	.	387	A8MXY4	ZNF99_HUMAN	Q	387	ENSP00000380293:E387Q	ENSP00000380293:E387Q	E	-	1	0	ZNF99	22733119	0.013000	0.17824	0.386000	0.26170	0.619000	0.37552	0.270000	0.18607	0.675000	0.31264	0.395000	0.25975	GAG	.	.		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
FOSB	2354	hgsc.bcm.edu	37	19	45974560	45974560	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:45974560G>T	ENST00000353609.3	+	3	1147		c.e3+1		FOSB_ENST00000586615.1_Splice_Site|FOSB_ENST00000417353.2_Intron|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000592436.1_Splice_Site|FOSB_ENST00000592811.1_Splice_Site|FOSB_ENST00000590335.1_3'UTR|FOSB_ENST00000585836.1_Intron|FOSB_ENST00000591858.1_Splice_Site|FOSB_ENST00000443841.2_Intron	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B						cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		ACTCCAGGCGGTGAGGACAGG	0.602																																					.		Atlas-SNP	.											.	FOSB	29	.	0			c.555+1G>T						.						30.0	22.0	25.0					19																	45974560		2164	4231	6395	SO:0001630	splice_region_variant	2354	exon3			CAGGCGGTGAGGA		CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.555+1G>T	chr19.hg19:g.45974560G>T		33.0	0.0		70.0	23.0	NM_006732	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Splice_Site	SNP	ENST00000353609.3	hg19	CCDS12664.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420662	0.83559	.	.	ENSG00000125740	ENST00000353609;ENST00000455928	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7514	0.69528	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FOSB	50666400	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.214000	0.95140	2.349000	0.79799	0.561000	0.74099	.	.	.		0.602	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459561.1	NM_006732	Intron
PIH1D1	55011	hgsc.bcm.edu	37	19	49951314	49951314	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:49951314G>C	ENST00000262265.5	-	4	578	c.343C>G	c.(343-345)Cag>Gag	p.Q115E	PIH1D1_ENST00000602226.1_5'Flank|PIH1D1_ENST00000596049.1_Missense_Mutation_p.Q115E	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	115					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		GTACATCCCTGGCCTTCTGCG	0.642																																					p.Q115E		Atlas-SNP	.											.	PIH1D1	23	.	0			c.C343G						.						47.0	41.0	43.0					19																	49951314		2203	4300	6503	SO:0001583	missense	55011	exon4			ATCCCTGGCCTTC	AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.343C>G	chr19.hg19:g.49951314G>C	ENSP00000262265:p.Gln115Glu	73.0	0.0		92.0	31.0	NM_017916	B4DGN7|B4E2X7|Q9BVL0	Missense_Mutation	SNP	ENST00000262265.5	hg19	CCDS12765.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652592	0.47362	.	.	ENSG00000104872	ENST00000262265	T	0.16324	2.35	4.68	3.59	0.41128	.	0.260464	0.38492	N	0.001667	T	0.15609	0.0376	N	0.21282	0.65	0.41384	D	0.987575	P	0.38280	0.625	P	0.46110	0.504	T	0.02345	-1.1173	10	0.52906	T	0.07	-27.8553	9.1202	0.36782	0.0:0.0:0.7657:0.2343	.	115	Q9NWS0	PIHD1_HUMAN	E	115	ENSP00000262265:Q115E	ENSP00000262265:Q115E	Q	-	1	0	PIH1D1	54643126	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.867000	0.39499	2.423000	0.82170	0.655000	0.94253	CAG	.	.		0.642	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916	
ZNF83	55769	hgsc.bcm.edu	37	19	53116865	53116865	+	Missense_Mutation	SNP	T	T	C	rs141749555		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:53116865T>C	ENST00000597597.1	-	2	3206	c.953A>G	c.(952-954)aAa>aGa	p.K318R	ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000541777.2_Missense_Mutation_p.K318R|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000536937.1_Missense_Mutation_p.K318R|ZNF83_ENST00000301096.3_Missense_Mutation_p.K318R|ZNF83_ENST00000544146.1_Missense_Mutation_p.K318R|ZNF83_ENST00000391789.4_Missense_Mutation_p.K290R|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000545872.1_Missense_Mutation_p.K318R			P51522	ZNF83_HUMAN	zinc finger protein 83	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTCATTACATTTGTAAGGTTT	0.413																																					p.K318R		Atlas-SNP	.											.	ZNF83	73	.	0			c.A953G						.						98.0	104.0	102.0					19																	53116865		2203	4300	6503	SO:0001583	missense	55769	exon3			TTACATTTGTAAG	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.953A>G	chr19.hg19:g.53116865T>C	ENSP00000472619:p.Lys318Arg	68.0	0.0		108.0	10.0	NM_018300	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	hg19	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	N	8.722	0.914503	0.17907	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	2.16	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22551	0.0544	N	0.16201	0.385	0.09310	N	1	B;D	0.69078	0.017;0.997	B;D	0.81914	0.01;0.995	T	0.10706	-1.0618	9	0.54805	T	0.06	.	3.4318	0.07432	0.0:0.144:0.2323:0.6237	.	290;318	P51522-2;P51522	.;ZNF83_HUMAN	R	318;318;318;290;318;318;290	ENSP00000445993:K318R;ENSP00000301096:K318R;ENSP00000445470:K318R;ENSP00000440713:K318R;ENSP00000439681:K318R;ENSP00000375666:K290R	ENSP00000301096:K318R	K	-	2	0	ZNF83	57808677	0.000000	0.05858	0.706000	0.30403	0.082000	0.17680	-0.250000	0.08830	0.101000	0.17610	-0.540000	0.04249	AAA	.	.		0.413	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
TPTE	7179	hgsc.bcm.edu	37	21	10906970	10906970	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr21:10906970A>T	ENST00000361285.4	-	24	1920	c.1591T>A	c.(1591-1593)Ttt>Att	p.F531I	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.F493I|TPTE_ENST00000298232.7_Missense_Mutation_p.F513I	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	531	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCCACGGCAAAATCTGATGGA	0.348																																					p.F531I		Atlas-SNP	.											.	TPTE	513	.	0			c.T1591A						.						135.0	121.0	126.0					21																	10906970		2203	4300	6503	SO:0001583	missense	7179	exon24			CGGCAAAATCTGA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1591T>A	chr21.hg19:g.10906970A>T	ENSP00000355208:p.Phe531Ile	154.0	0.0		204.0	12.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	hg19	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	16.06	3.015489	0.54468	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.88664	-2.41;-2.41;-2.41	2.39	2.39	0.29439	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.93726	0.7995	M	0.87180	2.865	0.48632	D	0.99968	D;D;D	0.89917	1.0;1.0;0.967	D;D;D	0.87578	0.998;0.998;0.928	D	0.93203	0.6593	10	0.72032	D	0.01	-27.5535	8.6793	0.34198	1.0:0.0:0.0:0.0	.	493;513;531	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	I	513;531;493	ENSP00000298232:F513I;ENSP00000355208:F531I;ENSP00000344441:F493I	ENSP00000298232:F513I	F	-	1	0	TPTE	9928841	0.998000	0.40836	0.082000	0.20525	0.005000	0.04900	5.171000	0.64996	1.339000	0.45563	0.155000	0.16302	TTT	.	.		0.348	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
PDHA1	5160	hgsc.bcm.edu	37	X	19369497	19369497	+	Silent	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chrX:19369497C>T	ENST00000422285.2	+	4	495	c.390C>T	c.(388-390)tcC>tcT	p.S130S	PDHA1_ENST00000379806.5_Silent_p.S168S|PDHA1_ENST00000379805.3_Silent_p.S130S|PDHA1_ENST00000540249.1_Silent_p.S130S|PDHA1_ENST00000545074.1_Silent_p.S137S			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	130					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					GGGGCCTTTCCGTCCGAGAAA	0.488																																					p.S168S		Atlas-SNP	.											.	PDHA1	85	.	0			c.C504T						.						96.0	92.0	93.0					X																	19369497		2203	4300	6503	SO:0001819	synonymous_variant	5160	exon5			CCTTTCCGTCCGA		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.390C>T	chrX.hg19:g.19369497C>T		174.0	0.0		266.0	88.0	NM_001173454	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Silent	SNP	ENST00000422285.2	hg19	CCDS14192.1																																																																																			.	.		0.488	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1		
FAM47A	158724	hgsc.bcm.edu	37	X	34149803	34149803	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chrX:34149803T>G	ENST00000346193.3	-	1	644	c.593A>C	c.(592-594)cAt>cCt	p.H198P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	198	Pro-rich.									NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TGGGAGGAGATGGGACACCGG	0.607																																					p.H198P		Atlas-SNP	.											.	FAM47A	249	.	0			c.A593C						.						52.0	55.0	54.0					X																	34149803		2200	4296	6496	SO:0001583	missense	158724	exon1			AGGAGATGGGACA	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.593A>C	chrX.hg19:g.34149803T>G	ENSP00000345029:p.His198Pro	42.0	0.0		80.0	4.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	T	7.208	0.594785	0.13875	.	.	ENSG00000185448	ENST00000346193	T	0.13420	2.59	0.603	0.603	0.17541	.	.	.	.	.	T	0.11239	0.0274	L	0.48642	1.525	0.09310	N	1	B	0.17667	0.023	B	0.17722	0.019	T	0.34304	-0.9834	8	0.25106	T	0.35	.	.	.	.	.	198	Q5JRC9	FA47A_HUMAN	P	198	ENSP00000345029:H198P	ENSP00000345029:H198P	H	-	2	0	FAM47A	34059724	0.014000	0.17966	0.045000	0.18777	0.044000	0.14063	-0.226000	0.09139	0.451000	0.26802	0.441000	0.28932	CAT	.	.		0.607	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
TBX22	50945	hgsc.bcm.edu	37	X	79277884	79277884	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chrX:79277884A>G	ENST00000373294.5	+	1	144	c.116A>G	c.(115-117)aAg>aGg	p.K39R	TBX22_ENST00000373291.1_5'Flank|TBX22_ENST00000476373.1_3'UTR|TBX22_ENST00000373296.3_Missense_Mutation_p.K39R|TBX22_ENST00000442340.1_5'UTR	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	39					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CGGGAGAAAAAGGGCGGAGAG	0.607																																					p.K39R		Atlas-SNP	.											.	TBX22	118	.	0			c.A116G						.						59.0	48.0	52.0					X																	79277884		2203	4297	6500	SO:0001583	missense	50945	exon1			AGAAAAAGGGCGG	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.116A>G	chrX.hg19:g.79277884A>G	ENSP00000362390:p.Lys39Arg	71.0	0.0		114.0	5.0	NM_016954	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	hg19	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	A	1.426	-0.571531	0.03882	.	.	ENSG00000122145	ENST00000373296;ENST00000373294	D;D	0.86769	-2.17;-2.17	4.62	1.95	0.26073	.	0.810458	0.11000	N	0.610618	T	0.66479	0.2793	N	0.03608	-0.345	0.09310	N	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.55211	-0.8176	10	0.14656	T	0.56	.	4.4557	0.11642	0.643:0.1764:0.1805:0.0	.	39	Q9Y458	TBX22_HUMAN	R	39	ENSP00000362393:K39R;ENSP00000362390:K39R	ENSP00000362390:K39R	K	+	2	0	TBX22	79164540	0.001000	0.12720	0.017000	0.16124	0.070000	0.16714	1.155000	0.31700	1.512000	0.48834	0.486000	0.48141	AAG	.	.		0.607	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
SMARCA1	6594	hgsc.bcm.edu	37	X	128630827	128630827	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chrX:128630827C>T	ENST00000371122.4	-	12	1655	c.1526G>A	c.(1525-1527)aGc>aAc	p.S509N	SMARCA1_ENST00000371121.3_Missense_Mutation_p.S509N|SMARCA1_ENST00000371123.1_Missense_Mutation_p.S509N	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	509	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						AGTCATCTGGCTGAAAATGAG	0.388																																					p.S509N		Atlas-SNP	.											.	SMARCA1	126	.	0			c.G1526A						.						115.0	105.0	108.0					X																	128630827		2203	4300	6503	SO:0001583	missense	6594	exon12			ATCTGGCTGAAAA	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.1526G>A	chrX.hg19:g.128630827C>T	ENSP00000360163:p.Ser509Asn	118.0	0.0		152.0	118.0	NM_139035	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874123	0.91664	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	5.3	5.3	0.74995	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93792	0.8015	H	0.99764	4.76	0.80722	D	1	D;D;D;D	0.71674	0.998;0.996;0.997;0.996	D;D;D;D	0.69142	0.947;0.917;0.962;0.917	D	0.96997	0.9726	10	0.87932	D	0	-9.5525	18.0774	0.89432	0.0:1.0:0.0:0.0	.	488;509;509;509	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	N	509;509;509;488	ENSP00000360162:S509N;ENSP00000360164:S509N;ENSP00000360163:S509N;ENSP00000404275:S488N	ENSP00000360162:S509N	S	-	2	0	SMARCA1	128458508	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.742000	0.85008	2.205000	0.71048	0.422000	0.28245	AGC	.	.		0.388	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
PRELID1	27166	hgsc.bcm.edu	37	5	176733526	176733534	+	In_Frame_Del	DEL	CAAGGCGGC	CAAGGCGGC	-	rs201616411		TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	CAAGGCGGC	CAAGGCGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:176733526_176733534delCAAGGCGGC	ENST00000303204.4	+	5	827_835	c.615_623delCAAGGCGGC	c.(613-624)agcaaggcggcc>agc	p.KAA206del	MXD3_ENST00000427908.2_3'UTR|PRELID1_ENST00000503216.1_In_Frame_Del_p.KAA195del|RAB24_ENST00000303251.6_5'Flank|RAB24_ENST00000393611.2_5'Flank|RAB24_ENST00000303270.6_5'Flank			Q9Y255	PRLD1_HUMAN	PRELI domain containing 1	206					apoptotic process (GO:0006915)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of cellular respiration (GO:1901857)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of T cell apoptotic process (GO:0070234)|regulation of membrane lipid distribution (GO:0097035)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of T cell differentiation (GO:0045580)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	7	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCTCGCCAGCAAGGCGGCCACCAAGAAG	0.574																																					p.205_208del		Atlas-INDEL	.											.	PRELID1	10	.	0			c.614_622del						.																																			SO:0001651	inframe_deletion	27166	exon5			.	BC013748	CCDS4415.1, CCDS64328.1	5q35.3	2010-01-18			ENSG00000169230	ENSG00000169230			30255	protein-coding gene	gene with protein product	"""protein of relevant evolutionary and lymphoid interest"", ""px19-like protein"""	605733				10784606, 14640972	Standard	NM_013237		Approved	CGI-106, PX19, PRELI	uc003mfx.4	Q9Y255	OTTHUMG00000130847	ENST00000303204.4:c.615_623delCAAGGCGGC	chr5.hg19:g.176733526_176733534delCAAGGCGGC	ENSP00000302114:p.Lys206_Ala208del	85.0	0.0		131.0	21.0	NM_013237	B2R5F7|D6RD25|Q549N2|Q9UI13|Q9UJS9	In_Frame_Del	DEL	ENST00000303204.4	hg19	CCDS4415.1																																																																																			.	.		0.574	PRELID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253414.1	NM_013237	
ZNF112	7771	hgsc.bcm.edu	37	19	44833582	44833582	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:44833582delT	ENST00000337401.4	-	5	834	c.746delA	c.(745-747)gagfs	p.E249fs	ZNF112_ENST00000536500.1_Frame_Shift_Del_p.E266fs|ZNF112_ENST00000354340.4_Frame_Shift_Del_p.E243fs	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TTGAATTGACTCCTGATTAAG	0.413																																					p.E249fs		Atlas-INDEL	.											.	ZFP112	219	.	0			c.747delG						.						128.0	123.0	125.0					19																	44833582		2203	4300	6503	SO:0001589	frameshift_variant	7771	exon5			.	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.746delA	chr19.hg19:g.44833582delT	ENSP00000337081:p.Glu249fs	70.0	0.0		101.0	40.0	NM_001083335	A4FU53|Q9HCA7	Frame_Shift_Del	DEL	ENST00000337401.4	hg19	CCDS54276.1																																																																																			.	.		0.413	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
NFIX	4784	hgsc.bcm.edu	37	19	13192654	13192654	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr19:13192654delC	ENST00000592199.1	+	8	1239	c.1239delC	c.(1237-1239)ggcfs	p.G413fs	NFIX_ENST00000397661.2_Frame_Shift_Del_p.G413fs|NFIX_ENST00000588228.1_Frame_Shift_Del_p.G366fs|NFIX_ENST00000587260.1_Frame_Shift_Del_p.G412fs|NFIX_ENST00000360105.4_Frame_Shift_Del_p.G375fs|NFIX_ENST00000587760.1_Frame_Shift_Del_p.G405fs|NFIX_ENST00000585575.1_Frame_Shift_Del_p.G405fs|NFIX_ENST00000358552.3_Frame_Shift_Del_p.G371fs			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)	413					astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			ATGGCTCGGGCCAGGCCACCG	0.632											OREG0025286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G421fs		Atlas-INDEL	.											.	NFIX	61	.	0			c.1262delG						.						42.0	45.0	44.0					19																	13192654		2010	4158	6168	SO:0001589	frameshift_variant	4784	exon8			.	U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.1239delC	chr19.hg19:g.13192654delC	ENSP00000467512:p.Gly413fs	60.0	0.0	685	58.0	31.0	NM_001271043	B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Frame_Shift_Del	DEL	ENST00000592199.1	hg19																																																																																				.	.		0.632	NFIX-013	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000452763.1	NM_002501	
TCERG1	10915	hgsc.bcm.edu	37	5	145858215	145858215	+	Splice_Site	DEL	A	A	-			TCGA-DD-AAEE-01A-11D-A40R-10	TCGA-DD-AAEE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80030570-7419-492e-92fc-246a27b5b673	bf19b000-ebe1-4b9b-9827-d946d815d0b4	g.chr5:145858215delA	ENST00000296702.5	+	10	1799	c.1761delA	c.(1759-1761)cta>ct	p.L587fs	TCERG1_ENST00000394421.2_Splice_Site_p.L566fs	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	587					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAAGAAACTAAGTAAGTTTT	0.343																																					p.L587fs		Atlas-INDEL	.											.	TCERG1	148	.	0			c.1760delT						.						36.0	38.0	38.0					5																	145858215		2201	4298	6499	SO:0001630	splice_region_variant	10915	exon10			.	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1762+1A>-	chr5.hg19:g.145858215delA		62.0	0.0		176.0	34.0	NM_006706	Q2NKN2|Q59EA1	Frame_Shift_Del	DEL	ENST00000296702.5	hg19	CCDS4282.1																																																																																			.	.		0.343	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	Frame_Shift_Del
