#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLCN6	1185	hgsc.bcm.edu	37	1	11886262	11886262	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:11886262G>T	ENST00000346436.6	+	9	750	c.698G>T	c.(697-699)cGa>cTa	p.R233L	CLCN6_ENST00000376487.3_Missense_Mutation_p.R211L|CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000312413.6_Missense_Mutation_p.R233L|CLCN6_ENST00000376496.3_Missense_Mutation_p.R233L	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	233					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTATTTCCGAAGCGACAGG	0.433																																					p.R233L		Atlas-SNP	.											.	CLCN6	77	.	0			c.G698T						.						132.0	130.0	131.0					1																	11886262		2203	4300	6503	SO:0001583	missense	1185	exon9			ATTTCCGAAGCGA	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.698G>T	chr1.hg19:g.11886262G>T	ENSP00000234488:p.Arg233Leu	74.0	0.0		62.0	8.0	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	hg19	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789898	0.90367	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376487;ENST00000376496;ENST00000376490;ENST00000376491;ENST00000376492	D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24	5.76	4.85	0.62838	Chloride channel, core (2);	0.052716	0.85682	D	0.000000	D	0.96116	0.8734	M	0.84773	2.715	0.80722	D	1	P;D;D;D;D	0.59357	0.947;0.982;0.985;0.985;0.957	P;P;P;P;P	0.58780	0.702;0.683;0.793;0.845;0.803	D	0.96405	0.9300	10	0.72032	D	0.01	-4.9429	14.0578	0.64781	0.0721:0.0:0.9279:0.0	.	211;233;233;233;233	F8W9R3;P51797-3;P51797-4;P51797-2;P51797	.;.;.;.;CLCN6_HUMAN	L	233;233;211;233;233;233;233	ENSP00000308367:R233L;ENSP00000234488:R233L;ENSP00000365670:R211L;ENSP00000365679:R233L	ENSP00000308367:R233L	R	+	2	0	CLCN6	11808849	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.284000	0.95882	1.433000	0.47394	-0.150000	0.13652	CGA	.	.		0.433	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
ARHGAP29	9411	hgsc.bcm.edu	37	1	94655494	94655494	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:94655494T>G	ENST00000260526.6	-	13	1609	c.1427A>C	c.(1426-1428)gAa>gCa	p.E476A	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	476					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		ATCAACTTTTTCTTCTTCAGT	0.353																																					p.E476A		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.A1427C						.						75.0	75.0	75.0					1																	94655494		2203	4300	6503	SO:0001583	missense	9411	exon13			ACTTTTTCTTCTT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1427A>C	chr1.hg19:g.94655494T>G	ENSP00000260526:p.Glu476Ala	65.0	0.0		59.0	5.0	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	hg19	CCDS748.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983358	0.35036	.	.	ENSG00000137962	ENST00000260526	T	0.22945	1.93	6.16	5.04	0.67666	.	0.188580	0.25801	N	0.028213	T	0.09291	0.0229	L	0.43152	1.355	0.80722	D	1	B;B	0.27068	0.167;0.005	B;B	0.24394	0.053;0.011	T	0.07028	-1.0794	10	0.37606	T	0.19	-14.0541	7.4134	0.27029	0.0:0.1286:0.1216:0.7499	.	476;476	F8VWZ8;Q52LW3	.;RHG29_HUMAN	A	476	ENSP00000260526:E476A	ENSP00000260526:E476A	E	-	2	0	ARHGAP29	94428082	.	.	0.994000	0.49952	0.900000	0.52787	.	.	1.139000	0.42245	0.528000	0.53228	GAA	.	.		0.353	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
DENND1B	163486	hgsc.bcm.edu	37	1	197704922	197704922	+	Intron	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:197704922G>A	ENST00000367396.3	-	3	252				DENND1B_ENST00000235453.4_5'UTR|DENND1B_ENST00000400967.2_5'Flank|DENND1B_ENST00000477581.1_5'UTR	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B						positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						AAGCTGGACTGTCCTCTACAG	0.473																																					p.D29D		Atlas-SNP	.											.	DENND1B	108	.	0			c.C87T						.																																			SO:0001627	intron_variant	163486	exon3			TGGACTGTCCTCT	BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.83-20718C>T	chr1.hg19:g.197704922G>A		28.0	0.0		38.0	5.0	NM_001195216	B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Silent	SNP	ENST00000367396.3	hg19	CCDS41452.2																																																																																			.	.		0.473	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086539.1	NM_144977	
NUP133	55746	hgsc.bcm.edu	37	1	229623290	229623290	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:229623290T>C	ENST00000261396.3	-	10	1356	c.1265A>G	c.(1264-1266)gAa>gGa	p.E422G	NUP133_ENST00000537506.1_Missense_Mutation_p.E406G	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	422					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GACAGCACTTTCGTTATACAG	0.388																																					p.E422G		Atlas-SNP	.											.	NUP133	111	.	0			c.A1265G						.						110.0	111.0	111.0					1																	229623290		2203	4300	6503	SO:0001583	missense	55746	exon10			GCACTTTCGTTAT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.1265A>G	chr1.hg19:g.229623290T>C	ENSP00000261396:p.Glu422Gly	52.0	0.0		112.0	6.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	T	19.27	3.795557	0.70452	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.22743	1.94;1.94;1.94	5.07	5.07	0.68467	WD40/YVTN repeat-like-containing domain (1);Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.090399	0.85682	D	0.000000	T	0.32704	0.0838	M	0.63428	1.95	0.58432	D	0.999995	D	0.53312	0.959	P	0.50860	0.652	T	0.04029	-1.0983	10	0.33940	T	0.23	-16.2575	15.1233	0.72463	0.0:0.0:0.0:1.0	.	422	Q8WUM0	NU133_HUMAN	G	422;422;422;406	ENSP00000261396:E422G;ENSP00000355640:E422G;ENSP00000443496:E406G	ENSP00000261396:E422G	E	-	2	0	NUP133	227689913	1.000000	0.71417	0.166000	0.22797	0.484000	0.33280	6.913000	0.75759	2.042000	0.60477	0.477000	0.44152	GAA	.	.		0.388	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
KIF26B	55083	hgsc.bcm.edu	37	1	245772752	245772752	+	Silent	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:245772752G>A	ENST00000407071.2	+	8	2276	c.1836G>A	c.(1834-1836)tcG>tcA	p.S612S	KIF26B_ENST00000366518.4_Silent_p.S231S	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	612	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ACCTGCTGTCGGAGGTGGCCA	0.642																																					p.S612S		Atlas-SNP	.											.	KIF26B	343	.	0			c.G1836A						.						15.0	20.0	19.0					1																	245772752		1976	4135	6111	SO:0001819	synonymous_variant	55083	exon8			GCTGTCGGAGGTG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1836G>A	chr1.hg19:g.245772752G>A		229.0	0.0		314.0	55.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	hg19	CCDS44342.1																																																																																			.	.		0.642	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
OR2T12	127064	hgsc.bcm.edu	37	1	248458151	248458151	+	Missense_Mutation	SNP	C	C	A	rs369908991		TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:248458151C>A	ENST00000317996.1	-	1	729	c.730G>T	c.(730-732)Gct>Tct	p.A244S		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCCACCACAGCCACATGTGAA	0.512													N|||	1	0.000199681	0.0008	0.0	5008	,	,		20472	0.0		0.0	False		,,,				2504	0.0				p.A244S		Atlas-SNP	.											.	OR2T12	113	.	0			c.G730T						.	C	SER/ALA	1,4405	2.1+/-5.4	0,1,2202	78.0	78.0	78.0		730	-1.2	0.2	1		78	0,8594		0,0,4297	no	missense	OR2T12	NM_001004692.1	99	0,1,6499	AA,AC,CC		0.0,0.0227,0.0077	benign	244/321	248458151	1,12999	2203	4297	6500	SO:0001583	missense	127064	exon1			CCACAGCCACATG	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.730G>T	chr1.hg19:g.248458151C>A	ENSP00000324583:p.Ala244Ser	269.0	0.0		449.0	219.0	NM_001004692		Missense_Mutation	SNP	ENST00000317996.1	hg19	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	c	10.45	1.354309	0.24512	2.27E-4	0.0	ENSG00000177201	ENST00000317996	T	0.37915	1.17	1.55	-1.22	0.09494	GPCR, rhodopsin-like superfamily (1);	0.744958	0.10900	N	0.621742	T	0.18215	0.0437	N	0.13198	0.31	0.09310	N	1	B	0.26672	0.156	B	0.29267	0.1	T	0.26052	-1.0114	10	0.51188	T	0.08	.	3.4517	0.07501	0.0:0.3847:0.2115:0.4038	.	244	Q8NG77	O2T12_HUMAN	S	244	ENSP00000324583:A244S	ENSP00000324583:A244S	A	-	1	0	OR2T12	246524774	0.000000	0.05858	0.246000	0.24233	0.701000	0.40568	-1.292000	0.02772	0.645000	0.30675	0.175000	0.17021	GCT	.	.		0.512	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
SH3BP5L	80851	hgsc.bcm.edu	37	1	249106244	249106244	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr1:249106244T>C	ENST00000366472.5	-	7	2266	c.1037A>G	c.(1036-1038)cAg>cGg	p.Q346R	SH3BP5L_ENST00000475978.1_5'UTR|SH3BP5L_ENST00000411742.2_Missense_Mutation_p.Q314R	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	346										endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GTCGCACTTCTGCAGGTCTGA	0.711																																					p.Q346R		Atlas-SNP	.											.	SH3BP5L	47	.	0			c.A1037G						.						19.0	24.0	23.0					1																	249106244		2201	4297	6498	SO:0001583	missense	80851	exon7			CACTTCTGCAGGT	AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.1037A>G	chr1.hg19:g.249106244T>C	ENSP00000355428:p.Gln346Arg	99.0	0.0		140.0	27.0	NM_030645	B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Missense_Mutation	SNP	ENST00000366472.5	hg19	CCDS31126.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.137725	0.37728	.	.	ENSG00000175137	ENST00000366472;ENST00000411742	.	.	.	4.27	4.27	0.50696	.	0.059109	0.64402	D	0.000002	T	0.28499	0.0705	N	0.24115	0.695	0.37437	D	0.91426	P;P;B;P	0.39480	0.675;0.675;0.276;0.675	B;B;B;B	0.28553	0.091;0.066;0.084;0.066	T	0.36456	-0.9747	9	0.46703	T	0.11	-43.7652	11.6585	0.51332	0.0:0.0:0.0:1.0	.	314;239;346;204	B4DQ94;B4DSF1;Q7L8J4;Q96MW4	.;.;3BP5L_HUMAN;.	R	346;314	.	ENSP00000355428:Q346R	Q	-	2	0	SH3BP5L	247072867	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	6.929000	0.75852	1.922000	0.55676	0.260000	0.18958	CAG	.	.		0.711	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097140.1	NM_030645	
ATAD2B	54454	hgsc.bcm.edu	37	2	24033262	24033262	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr2:24033262C>A	ENST00000238789.5	-	18	2721	c.2378G>T	c.(2377-2379)aGa>aTa	p.R793I	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	793						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACAGAGAATCTTTCTAGAGT	0.478																																					p.R793I		Atlas-SNP	.											.	ATAD2B	110	.	0			c.G2378T						.						92.0	95.0	94.0					2																	24033262		1927	4136	6063	SO:0001583	missense	54454	exon18			GAGAATCTTTCTA	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2378G>T	chr2.hg19:g.24033262C>A	ENSP00000238789:p.Arg793Ile	106.0	0.0		119.0	17.0	NM_001242338	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	hg19	CCDS46227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.19|17.19	3.325488|3.325488	0.60743|0.60743	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789	.|D	.|0.95001	.|-3.58	5.51|5.51	2.27|2.27	0.28462|0.28462	.|.	.|1.760050	.|0.03101	.|N	.|0.161139	D|D	0.90703|0.90703	0.7083|0.7083	N|N	0.24115|0.24115	0.695|0.695	0.51767|0.51767	D|D	0.999934|0.999934	.|B;B	.|0.27140	.|0.105;0.169	.|B;B	.|0.32211	.|0.067;0.142	T|T	0.76542|0.76542	-0.2921|-0.2921	5|10	.|0.46703	.|T	.|0.11	.|.	7.1434|7.1434	0.25568|0.25568	0.0:0.2551:0.0:0.7449|0.0:0.2551:0.0:0.7449	.|.	.|793;793	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	Y|I	74|793	.|ENSP00000238789:R793I	.|ENSP00000238789:R793I	D|R	-|-	1|2	0|0	ATAD2B|ATAD2B	23886766|23886766	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.969000|0.969000	0.65631|0.65631	3.501000|3.501000	0.53325|0.53325	0.257000|0.257000	0.21650|0.21650	0.655000|0.655000	0.94253|0.94253	GAT|AGA	.	.		0.478	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
SDPR	8436	hgsc.bcm.edu	37	2	192700699	192700699	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr2:192700699C>T	ENST00000304141.4	-	2	1557	c.1228G>A	c.(1228-1230)Gat>Aat	p.D410N		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			GGGTCCCCATCGGAGCGCTCC	0.637																																					p.D410N		Atlas-SNP	.											.	SDPR	67	.	0			c.G1228A						.						49.0	50.0	50.0					2																	192700699		2203	4300	6503	SO:0001583	missense	8436	exon2			CCCCATCGGAGCG	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1228G>A	chr2.hg19:g.192700699C>T	ENSP00000305675:p.Asp410Asn	21.0	0.0		40.0	20.0	NM_004657		Missense_Mutation	SNP	ENST00000304141.4	hg19	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741892	0.49151	.	.	ENSG00000168497	ENST00000304141	T	0.66815	-0.23	4.79	2.97	0.34412	.	1.359500	0.04585	N	0.395729	T	0.63721	0.2535	L	0.50333	1.59	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.52305	-0.8593	10	0.66056	D	0.02	-0.5275	9.3715	0.38256	0.0:0.8554:0.0:0.1446	.	410	O95810	SDPR_HUMAN	N	410	ENSP00000305675:D410N	ENSP00000305675:D410N	D	-	1	0	SDPR	192408944	0.061000	0.20836	0.000000	0.03702	0.004000	0.04260	1.242000	0.32755	0.626000	0.30322	0.563000	0.77884	GAT	.	.		0.637	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657	
NYAP2	57624	hgsc.bcm.edu	37	2	226447236	226447236	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr2:226447236A>G	ENST00000272907.6	+	4	1516	c.1103A>G	c.(1102-1104)aAc>aGc	p.N368S	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	368	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GTGCTGGAAAACGTGTCTTAC	0.662																																					p.N368S		Atlas-SNP	.											.	.	.	.	0			c.A1103G						.						16.0	20.0	19.0					2																	226447236		1976	4142	6118	SO:0001583	missense	57624	exon4			TGGAAAACGTGTC	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1103A>G	chr2.hg19:g.226447236A>G	ENSP00000272907:p.Asn368Ser	184.0	0.0		269.0	55.0	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	hg19	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918800	0.52546	.	.	ENSG00000144460	ENST00000272907	T	0.47528	0.84	5.16	4.0	0.46444	.	0.048846	0.85682	N	0.000000	T	0.48995	0.1531	M	0.79258	2.445	0.80722	D	1	B	0.15930	0.015	B	0.19148	0.024	T	0.48658	-0.9016	10	0.59425	D	0.04	-37.2006	10.6399	0.45586	0.9248:0.0:0.0752:0.0	.	368	Q9P242	K1486_HUMAN	S	368	ENSP00000272907:N368S	ENSP00000272907:N368S	N	+	2	0	KIAA1486	226155480	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	7.174000	0.77620	0.811000	0.34303	0.528000	0.53228	AAC	.	.		0.662	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	113.0	0.0		118.0	18.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
KLHL18	23276	hgsc.bcm.edu	37	3	47371504	47371504	+	Silent	SNP	G	G	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr3:47371504G>C	ENST00000232766.5	+	4	485	c.465G>C	c.(463-465)ctG>ctC	p.L155L	KLHL18_ENST00000455924.2_Silent_p.L43L	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	155	BACK.									endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GTGCTGTGCTGTACGACGCTG	0.502																																					p.L155L		Atlas-SNP	.											.	KLHL18	46	.	0			c.G465C						.						129.0	123.0	125.0					3																	47371504		2203	4300	6503	SO:0001819	synonymous_variant	23276	exon4			TGTGCTGTACGAC	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.465G>C	chr3.hg19:g.47371504G>C		67.0	0.0		53.0	16.0	NM_025010	A8K612|Q7Z3E8|Q8N125	Silent	SNP	ENST00000232766.5	hg19	CCDS33749.1																																																																																			.	.		0.502	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
PRR23B	389151	hgsc.bcm.edu	37	3	138739004	138739004	+	Missense_Mutation	SNP	C	C	A	rs376706999		TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr3:138739004C>A	ENST00000329447.5	-	1	764	c.500G>T	c.(499-501)cGg>cTg	p.R167L	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	167								p.R167Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGAGTCCATCCGGAGCTCCGG	0.647																																					p.R167L		Atlas-SNP	.											PRR23B,NS,carcinoma,0,1	PRR23B	56	.	1	Substitution - Missense(1)	lung(1)	c.G500T						.						31.0	39.0	36.0					3																	138739004		2201	4299	6500	SO:0001583	missense	389151	exon1			TCCATCCGGAGCT	BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.500G>T	chr3.hg19:g.138739004C>A	ENSP00000328768:p.Arg167Leu	139.0	0.0		138.0	15.0	NM_001013650	B2RNV9	Missense_Mutation	SNP	ENST00000329447.5	hg19	CCDS33868.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364365	0.24684	.	.	ENSG00000184814	ENST00000329447	.	.	.	3.14	0.243	0.15503	.	1.288490	0.05675	N	0.589327	T	0.30541	0.0768	L	0.34521	1.04	0.09310	N	1	B	0.26744	0.158	B	0.23574	0.047	T	0.25398	-1.0133	9	0.40728	T	0.16	.	5.4872	0.16757	0.0:0.6056:0.0:0.3944	.	167	Q6ZRT6	PR23B_HUMAN	L	167	.	ENSP00000328768:R167L	R	-	2	0	PRR23B	140221694	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.107000	0.10873	0.036000	0.15547	0.456000	0.33151	CGG	.	.		0.647	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361501.1	NM_001013650	
TFRC	7037	hgsc.bcm.edu	37	3	195787062	195787062	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr3:195787062T>C	ENST00000360110.4	-	14	1694	c.1525A>G	c.(1525-1527)Aca>Gca	p.T509A	TFRC_ENST00000535031.1_Missense_Mutation_p.T227A|TFRC_ENST00000465288.1_5'UTR|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000392396.3_Missense_Mutation_p.T509A|TFRC_ENST00000420415.1_Missense_Mutation_p.T428A	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	509					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TTTTGCATTGTTTTCTCAATA	0.343			T	BCL6	NHL																																p.T509A		Atlas-SNP	.		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	.	TFRC	54	.	0			c.A1525G						.						139.0	129.0	132.0					3																	195787062		2203	4300	6503	SO:0001583	missense	7037	exon14			GCATTGTTTTCTC	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1525A>G	chr3.hg19:g.195787062T>C	ENSP00000353224:p.Thr509Ala	109.0	0.0		88.0	7.0	NM_001128148	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	ENST00000360110.4	hg19	CCDS3312.1	.	.	.	.	.	.	.	.	.	.	T	9.800	1.180235	0.21787	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	T;T;T;T	0.71103	0.78;0.78;0.78;-0.54	5.44	3.05	0.35203	Peptidase M28 (1);	0.246883	0.47455	D	0.000235	T	0.45895	0.1365	N	0.12569	0.235	0.19575	N	0.999966	B	0.32717	0.381	B	0.32864	0.154	T	0.37103	-0.9720	10	0.07644	T	0.81	0.298	9.1954	0.37224	0.0:0.1462:0.0:0.8538	.	509	P02786	TFR1_HUMAN	A	509;428;509;227	ENSP00000353224:T509A;ENSP00000390133:T428A;ENSP00000376197:T509A;ENSP00000437753:T227A	ENSP00000353224:T509A	T	-	1	0	TFRC	197271459	0.034000	0.19679	0.058000	0.19502	0.685000	0.39939	1.493000	0.35605	0.365000	0.24400	0.533000	0.62120	ACA	.	.		0.343	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1		
POLR2B	5431	hgsc.bcm.edu	37	4	57871518	57871518	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr4:57871518T>C	ENST00000381227.1	+	9	1420	c.1007T>C	c.(1006-1008)aTt>aCt	p.I336T	RNU6-998P_ENST00000515894.1_RNA|POLR2B_ENST00000431623.2_Missense_Mutation_p.I261T|POLR2B_ENST00000441246.2_Missense_Mutation_p.I329T|POLR2B_ENST00000314595.5_Missense_Mutation_p.I336T			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	336					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					GAGAAAAGAATTAAATATGCA	0.368																																					p.I336T		Atlas-SNP	.											.	POLR2B	108	.	0			c.T1007C						.						95.0	97.0	96.0					4																	57871518		2203	4299	6502	SO:0001583	missense	5431	exon8			AAAGAATTAAATA		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1007T>C	chr4.hg19:g.57871518T>C	ENSP00000370625:p.Ile336Thr	300.0	0.0		351.0	27.0	NM_000938	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	hg19	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.406979	0.83230	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.77	5.77	0.91146	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.75961	0.3921	M	0.86805	2.84	0.80722	D	1	P;P	0.39809	0.62;0.689	P;P	0.47705	0.555;0.555	T	0.79027	-0.1971	10	0.54805	T	0.06	.	16.3818	0.83467	0.0:0.0:0.0:1.0	.	261;336	C9J4M6;P30876	.;RPB2_HUMAN	T	336;261;329;336	ENSP00000370625:I336T;ENSP00000391096:I261T;ENSP00000391452:I329T;ENSP00000312735:I336T	ENSP00000312735:I336T	I	+	2	0	POLR2B	57566275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.784000	0.85713	2.330000	0.79161	0.528000	0.53228	ATT	.	.		0.368	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662788	77662788	+	Silent	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr4:77662788G>T	ENST00000296043.6	+	5	4415	c.3462G>T	c.(3460-3462)acG>acT	p.T1154T		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1154					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			GGGAGGCCACGCTCCTGCCGG	0.751																																					p.T1154T		Atlas-SNP	.											.	SHROOM3	134	.	0			c.G3462T						.						3.0	5.0	4.0					4																	77662788		1960	3896	5856	SO:0001819	synonymous_variant	57619	exon5			GGCCACGCTCCTG	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.3462G>T	chr4.hg19:g.77662788G>T		28.0	0.0		35.0	5.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.		0.751	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
IL15	3600	hgsc.bcm.edu	37	4	142653941	142653941	+	Silent	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr4:142653941T>C	ENST00000296545.7	+	8	1273	c.429T>C	c.(427-429)aaT>aaC	p.N143N	IL15_ENST00000514653.1_Silent_p.N116N|IL15_ENST00000394159.1_Silent_p.N116N|IL15_ENST00000529613.1_Silent_p.N143N|IL15_ENST00000477265.1_Silent_p.N116N|IL15_ENST00000320650.4_Silent_p.N143N			P40933	IL15_HUMAN	interleukin 15	143					aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					AGGAAAAAAATATTAAAGAAT	0.269																																					p.N143N	Pancreas(10;184 986 25902)	Atlas-SNP	.											.	IL15	17	.	0			c.T429C						.						79.0	91.0	87.0					4																	142653941		2203	4298	6501	SO:0001819	synonymous_variant	3600	exon8			AAAAAATATTAAA	U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.429T>C	chr4.hg19:g.142653941T>C		258.0	0.0		255.0	32.0	NM_000585	D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Silent	SNP	ENST00000296545.7	hg19	CCDS3755.1																																																																																			.	.		0.269	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257278.2	NM_172175	
GUCY1A3	2982	hgsc.bcm.edu	37	4	156618214	156618214	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr4:156618214T>A	ENST00000296518.7	+	3	404	c.195T>A	c.(193-195)agT>agA	p.S65R	GUCY1A3_ENST00000513574.1_Missense_Mutation_p.S65R|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.S65R|GUCY1A3_ENST00000393832.3_5'UTR|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.S65R|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.S65R|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.S65R|GUCY1A3_ENST00000515602.1_3'UTR			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	65					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GAAAAACCAGTCGGAGCCGAG	0.438																																					p.S65R		Atlas-SNP	.											.	GUCY1A3	133	.	0			c.T195A						.						98.0	101.0	100.0					4																	156618214		2203	4300	6503	SO:0001583	missense	2982	exon3			AACCAGTCGGAGC		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.195T>A	chr4.hg19:g.156618214T>A	ENSP00000296518:p.Ser65Arg	105.0	0.0		112.0	21.0	NM_001130687	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	hg19	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056645	0.55325	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000296518;ENST00000513574	D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.54;-1.68;-1.68;-1.68	5.93	-1.6	0.08426	.	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	M	0.66939	2.045	0.54753	D	0.999986	B;B;B	0.27013	0.166;0.166;0.166	B;B;B	0.19666	0.026;0.026;0.026	T	0.65384	-0.6181	10	0.13853	T	0.58	.	13.5475	0.61713	0.0:0.6929:0.0:0.3071	.	65;65;65	B3KU69;Q02108;D6RDW3	.;GCYA3_HUMAN;.	R	65	ENSP00000424361:S65R;ENSP00000421493:S65R;ENSP00000426968:S65R;ENSP00000412201:S65R;ENSP00000296518:S65R;ENSP00000426040:S65R	ENSP00000296518:S65R	S	+	3	2	GUCY1A3	156837664	0.737000	0.28175	0.988000	0.46212	0.986000	0.74619	-0.010000	0.12743	-0.141000	0.11374	0.482000	0.46254	AGT	.	.		0.438	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
RGMB	285704	hgsc.bcm.edu	37	5	98129071	98129071	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr5:98129071C>A	ENST00000513185.1	+	3	1364	c.928C>A	c.(928-930)Cag>Aag	p.Q310K	RGMB_ENST00000308234.7_Missense_Mutation_p.Q351K			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	310					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		CCAGGACCTGCAGCTGTGCGT	0.632																																					p.Q351K		Atlas-SNP	.											.	RGMB	29	.	0			c.C1051A						.						38.0	39.0	39.0					5																	98129071		2140	4226	6366	SO:0001583	missense	285704	exon5			GACCTGCAGCTGT	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.928C>A	chr5.hg19:g.98129071C>A	ENSP00000423256:p.Gln310Lys	58.0	0.0		55.0	5.0	NM_001012761	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.91	3.913805	0.72983	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.85629	-2.01;-2.01	5.78	5.78	0.91487	Repulsive guidance molecule, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92932	0.7751	M	0.81497	2.545	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.91988	0.5600	10	0.45353	T	0.12	-16.4755	19.9851	0.97342	0.0:1.0:0.0:0.0	.	310	Q6NW40	RGMB_HUMAN	K	351;310	ENSP00000308219:Q351K;ENSP00000423256:Q310K	ENSP00000308219:Q351K	Q	+	1	0	RGMB	98156971	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.929000	0.40114	2.727000	0.93392	0.655000	0.94253	CAG	.	.		0.632	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
PCDHB16	57717	hgsc.bcm.edu	37	5	140563835	140563836	+	Missense_Mutation	DNP	CG	CG	TA	rs370851835|rs535302272	byFrequency	TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr5:140563835_140563836CG>TA	ENST00000361016.2	+	1	2856_2857	c.1701_1702CG>TA	c.(1699-1704)aaCGgc>aaTAgc	p.G568S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	568	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGCAGAACGGCTCCGCGCC	0.713																																					p.N567N|p.G568S		Atlas-SNP	.											PCDHB16,bladder,carcinoma,+2,1|PCDHB16,NS,carcinoma,0,1	PCDHB16	159	.	0			c.C1701T|c.G1702A						.																																			SO:0001583	missense	57717	exon1			GCAGAACGGCTCC|CAGAACGGCTCCG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	Exception_encountered	chr5.hg19:g.140563835_140563836delinsTA	ENSP00000354293:p.Gly568Ser	33.0|32.0	1.0		26.0	3.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent|Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1																																																																																			.	.		0.713	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
SPINK14	408187	hgsc.bcm.edu	37	5	147553855	147553855	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr5:147553855G>T	ENST00000356972.1	+	3	170	c.170G>T	c.(169-171)tGc>tTc	p.C57F	SPINK14_ENST00000562793.1_Intron	NM_001001325.1	NP_001001325.1	Q6IE38	ISK14_HUMAN	serine peptidase inhibitor, Kazal type 14 (putative)	57	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|large_intestine(1)|lung(1)	3						GTCAACCCCTGCCCTGGCTTA	0.413																																					p.C57F		Atlas-SNP	.											.	SPINK14	9	.	0			c.G170T						.						115.0	115.0	115.0					5																	147553855		1501	3128	4629	SO:0001583	missense	408187	exon3			ACCCCTGCCCTGG		CCDS4288.1	5q32	2011-08-31			ENSG00000196800	ENSG00000196800		"""Serine peptidase inhibitors, Kazal type"""	33825	protein-coding gene	gene with protein product							Standard	NM_001001325		Approved	SPINK5L2	uc031sls.1	Q6IE38	OTTHUMG00000129732	ENST00000356972.1:c.170G>T	chr5.hg19:g.147553855G>T	ENSP00000349459:p.Cys57Phe	154.0	0.0		159.0	26.0	NM_001001325		Missense_Mutation	SNP	ENST00000356972.1	hg19	CCDS4288.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793590	0.50102	.	.	ENSG00000196800	ENST00000356972	D	0.98296	-4.85	4.12	4.12	0.48240	Proteinase inhibitor I1, Kazal (3);	0.000000	0.64402	D	0.000015	D	0.98692	0.9561	.	.	.	0.42198	D	0.991754	D	0.89917	1.0	D	0.91635	0.999	D	0.98701	1.0700	9	0.87932	D	0	-16.6243	12.1753	0.54182	0.0:0.0:1.0:0.0	.	57	Q6IE38	ISK14_HUMAN	F	57	ENSP00000349459:C57F	ENSP00000349459:C57F	C	+	2	0	SPINK14	147534048	0.150000	0.22732	0.793000	0.32043	0.788000	0.44548	1.411000	0.34702	2.594000	0.87642	0.655000	0.94253	TGC	.	.		0.413	SPINK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251943.2	NM_001001325	
ZKSCAN3	80317	hgsc.bcm.edu	37	6	28327497	28327497	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr6:28327497C>G	ENST00000377255.3	+	3	431	c.134C>G	c.(133-135)tCc>tGc	p.S45C	ZKSCAN3_ENST00000341464.5_Intron|ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.S45C	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	45					autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						TCTGAGGGCTCCCGCGAGCGC	0.632																																					p.S45C		Atlas-SNP	.											.	ZKSCAN3	50	.	0			c.C134G						.						72.0	81.0	78.0					6																	28327497		2203	4300	6503	SO:0001583	missense	80317	exon2			AGGGCTCCCGCGA	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.134C>G	chr6.hg19:g.28327497C>G	ENSP00000366465:p.Ser45Cys	97.0	0.0		93.0	11.0	NM_024493	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	ENST00000377255.3	hg19	CCDS4650.1	.	.	.	.	.	.	.	.	.	.	.	16.23	3.063438	0.55432	.	.	ENSG00000189298	ENST00000252211;ENST00000454413;ENST00000377255	T;T	0.04654	3.58;3.58	3.83	-2.46	0.06461	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (2);	.	.	.	.	T	0.02688	0.0081	N	0.20845	0.615	0.20703	N	0.999863	D	0.76494	0.999	P	0.62649	0.905	T	0.44452	-0.9327	9	0.32370	T	0.25	.	9.7171	0.40281	0.1535:0.241:0.6054:0.0	.	45	Q9BRR0	ZKSC3_HUMAN	C	45	ENSP00000252211:S45C;ENSP00000366465:S45C	ENSP00000252211:S45C	S	+	2	0	ZKSCAN3	28435476	0.012000	0.17670	0.168000	0.22838	0.436000	0.31835	-0.087000	0.11215	-0.257000	0.09459	0.557000	0.71058	TCC	.	.		0.632	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
CAPN11	11131	hgsc.bcm.edu	37	6	44137079	44137079	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr6:44137079G>T	ENST00000398776.1	+	3	188	c.150G>T	c.(148-150)aaG>aaT	p.K50N	CAPN11_ENST00000542245.1_Missense_Mutation_p.K50N	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	50					proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCAAGGCCAAGGGCGTGGGCC	0.507																																					p.K50N		Atlas-SNP	.											.	CAPN11	66	.	0			c.G150T						.						40.0	42.0	41.0					6																	44137079		1922	4133	6055	SO:0001583	missense	11131	exon3			GGCCAAGGGCGTG	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.150G>T	chr6.hg19:g.44137079G>T	ENSP00000381758:p.Lys50Asn	195.0	0.0		206.0	56.0	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	hg19	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	G	1.764	-0.485979	0.04352	.	.	ENSG00000137225	ENST00000398776;ENST00000542245;ENST00000532171	D;D;T	0.97328	-4.34;-4.34;0.98	4.1	0.0875	0.14451	.	1.652940	0.03073	N	0.157458	D	0.90435	0.7005	L	0.38175	1.15	0.32992	D	0.525041	B	0.18741	0.03	B	0.19946	0.027	T	0.73994	-0.3807	10	0.25106	T	0.35	.	12.7797	0.57471	0.0:0.3365:0.5499:0.1136	.	50	Q9UMQ6	CAN11_HUMAN	N	50;50;80	ENSP00000381758:K50N;ENSP00000441078:K50N;ENSP00000432420:K80N	ENSP00000381758:K50N	K	+	3	2	CAPN11	44245057	0.136000	0.22515	0.143000	0.22291	0.001000	0.01503	0.208000	0.17415	-0.227000	0.09884	-2.547000	0.00178	AAG	.	.		0.507	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
PSPH	5723	hgsc.bcm.edu	37	7	56084931	56084931	+	Silent	SNP	A	A	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr7:56084931A>G	ENST00000395471.3	-	6	1222	c.417T>C	c.(415-417)ttT>ttC	p.F139F	PSPH_ENST00000275605.3_Silent_p.F139F|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	139					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TCTTACCGTTAAAGTAGAATT	0.383																																					p.F139F		Atlas-SNP	.											.	PSPH	23	.	0			c.T417C						.						102.0	81.0	88.0					7																	56084931		2203	4300	6503	SO:0001819	synonymous_variant	5723	exon6			ACCGTTAAAGTAG	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.417T>C	chr7.hg19:g.56084931A>G		212.0	0.0		225.0	54.0	NM_004577	B2RCR5|Q7Z3S5	Silent	SNP	ENST00000395471.3	hg19	CCDS5522.1																																																																																			.	.		0.383	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577	
GNAI1	2770	hgsc.bcm.edu	37	7	79828588	79828588	+	Silent	SNP	C	C	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr7:79828588C>T	ENST00000351004.3	+	4	724	c.351C>T	c.(349-351)ggC>ggT	p.G117G	GNAI1_ENST00000457358.2_Silent_p.G65G	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	117					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						CTGAAGAAGGCTTTATGACTG	0.408																																					p.G117G		Atlas-SNP	.											.	GNAI1	44	.	0			c.C351T						.						115.0	109.0	111.0					7																	79828588		2203	4300	6503	SO:0001819	synonymous_variant	2770	exon4			AGAAGGCTTTATG	AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.351C>T	chr7.hg19:g.79828588C>T		73.0	0.0		104.0	34.0	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Silent	SNP	ENST00000351004.3	hg19	CCDS5595.1																																																																																			.	.		0.408	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
DLX6	1750	hgsc.bcm.edu	37	7	96635385	96635385	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr7:96635385G>A	ENST00000007660.5	+	1	95		c.e1+1		DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6_ENST00000518156.2_Silent_p.Q32Q|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000437541.1_RNA	NM_005222.3	NP_005213.3	P56179	DLX6_HUMAN	distal-less homeobox 6						anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					agcagcagcagcaacagcagc	0.657																																					p.Q32Q		Atlas-SNP	.											DLX6,right_lower_lobe,carcinoma,0,1	DLX6	37	.	0			c.G96A						.						5.0	7.0	6.0					7																	96635385		1971	3959	5930	SO:0001630	splice_region_variant	1750	exon1			GCAGCAGCAACAG		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000007660.5:c.95+1G>A	chr7.hg19:g.96635385G>A		31.0	1.0		41.0	4.0	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Silent	SNP	ENST00000007660.5	hg19																																																																																				.	.		0.657	DLX6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_005222	Intron
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000424859.1_5'UTR|LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000401970.2_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A		Atlas-SNP	.											LHFPL3,NS,carcinoma,0,1	LHFPL3	24	.	1	Substitution - coding silent(1)	kidney(1)	c.C24T						.						11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	chr7.hg19:g.103969251C>T		25.0	0.0		37.0	2.0	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	hg19																																																																																				.	.		0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding		NM_199000	
XPO7	23039	hgsc.bcm.edu	37	8	21846524	21846524	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr8:21846524T>G	ENST00000252512.9	+	16	1898	c.1798T>G	c.(1798-1800)Ttg>Gtg	p.L600V	XPO7_ENST00000434536.1_Missense_Mutation_p.L609V|XPO7_ENST00000433566.4_Missense_Mutation_p.L601V	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	600					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CATCACCAACTTGAAGTACTG	0.438																																					p.L600V		Atlas-SNP	.											.	XPO7	79	.	0			c.T1798G						.						91.0	93.0	92.0					8																	21846524		1881	4122	6003	SO:0001583	missense	23039	exon16			ACCAACTTGAAGT	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1798T>G	chr8.hg19:g.21846524T>G	ENSP00000252512:p.Leu600Val	76.0	0.0		61.0	18.0	NM_015024	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	hg19	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.570976	0.45798	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.42900	0.96;0.96;0.96	5.89	1.36	0.22044	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	M	0.85041	2.73	0.58432	D	0.999998	D;D;D	0.67145	0.996;0.992;0.974	P;P;P	0.62184	0.844;0.899;0.795	T	0.63363	-0.6654	10	0.59425	D	0.04	-9.0294	10.3925	0.44181	0.0:0.6056:0.0:0.3944	.	601;609;600	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	V	609;600;601	ENSP00000404853:L609V;ENSP00000252512:L600V;ENSP00000410249:L601V	ENSP00000252512:L600V	L	+	1	2	XPO7	21902470	0.997000	0.39634	1.000000	0.80357	0.990000	0.78478	0.461000	0.21940	0.242000	0.21303	-0.270000	0.10280	TTG	.	.		0.438	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70585186	70585186	+	Missense_Mutation	SNP	G	G	A	rs369446842		TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr8:70585186G>A	ENST00000260126.4	-	10	3171	c.2465C>T	c.(2464-2466)cCg>cTg	p.P822L	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.P767L|SLCO5A1_ENST00000524945.1_3'UTR	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	822						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P824fs*>26(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GAAGGGCCCCGGGTAGGTCTG	0.587																																					p.P822L		Atlas-SNP	.											.	SLCO5A1	142	.	1	Insertion - Frameshift(1)	lung(1)	c.C2465T						.						57.0	60.0	59.0					8																	70585186		2203	4300	6503	SO:0001583	missense	81796	exon10			GGCCCCGGGTAGG	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2465C>T	chr8.hg19:g.70585186G>A	ENSP00000260126:p.Pro822Leu	63.0	0.0		105.0	10.0	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	hg19	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408609	0.83340	.	.	ENSG00000137571	ENST00000260126;ENST00000530307	T;T	0.54675	0.59;0.56	5.93	5.93	0.95920	.	0.411905	0.24859	N	0.035037	T	0.52322	0.1727	L	0.52573	1.65	0.58432	D	0.999998	B;B	0.17268	0.021;0.021	B;B	0.12156	0.007;0.007	T	0.41627	-0.9498	10	0.44086	T	0.13	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	767;822	E9PKK5;Q9H2Y9	.;SO5A1_HUMAN	L	822;767	ENSP00000260126:P822L;ENSP00000431611:P767L	ENSP00000260126:P822L	P	-	2	0	SLCO5A1	70747740	1.000000	0.71417	0.661000	0.29709	0.962000	0.63368	8.371000	0.90123	2.826000	0.97356	0.655000	0.94253	CCG	.	.		0.587	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
ESRP1	54845	hgsc.bcm.edu	37	8	95686717	95686717	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr8:95686717C>T	ENST00000433389.2	+	12	1824	c.1634C>T	c.(1633-1635)cCg>cTg	p.P545L	ESRP1_ENST00000423620.2_Missense_Mutation_p.P545L|ESRP1_ENST00000358397.5_Missense_Mutation_p.P545L|ESRP1_ENST00000454170.2_Missense_Mutation_p.P545L	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	545					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TTATCCCCACCGCCATGTAAG	0.438																																					p.P545L		Atlas-SNP	.											.	ESRP1	148	.	0			c.C1634T						.						80.0	81.0	81.0					8																	95686717		1912	4139	6051	SO:0001583	missense	54845	exon12			CCCCACCGCCATG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1634C>T	chr8.hg19:g.95686717C>T	ENSP00000405738:p.Pro545Leu	76.0	0.0		109.0	18.0	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	hg19	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405055	0.83230	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000517610	T;T;T;T;T	0.17854	2.54;2.66;2.53;2.72;2.25	5.54	5.54	0.83059	.	0.153256	0.64402	D	0.000014	T	0.43612	0.1255	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.965;0.968;1.0	T	0.13202	-1.0518	10	0.52906	T	0.07	-15.8517	19.8585	0.96775	0.0:1.0:0.0:0.0	.	545;545;545;545;545;545	D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;.;ESRP1_HUMAN	L	545;545;545;545;404	ENSP00000407349:P545L;ENSP00000405738:P545L;ENSP00000351168:P545L;ENSP00000402766:P545L;ENSP00000429125:P404L	ENSP00000351168:P545L	P	+	2	0	ESRP1	95755893	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.760000	0.94817	0.655000	0.94253	CCG	.	.		0.438	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
CYP11B1	1584	hgsc.bcm.edu	37	8	143957167	143957167	+	Missense_Mutation	SNP	T	T	C	rs563321033	byFrequency	TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr8:143957167T>C	ENST00000292427.4	-	6	1114	c.1082A>G	c.(1081-1083)gAg>gGg	p.E361G	CYP11B1_ENST00000517471.1_Missense_Mutation_p.E361G|CYP11B1_ENST00000377675.3_Missense_Mutation_p.E432G	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	361					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CAAGGGCAGCTCGGTGGTTGC	0.687									Familial Hyperaldosteronism type I				.|||	2	0.000399361	0.0	0.0029	5008	,	,		16702	0.0		0.0	False		,,,				2504	0.0				p.E361G		Atlas-SNP	.											.	CYP11B1	128	.	0			c.A1082G						.						69.0	71.0	70.0					8																	143957167		2203	4300	6503	SO:0001583	missense	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GGCAGCTCGGTGG	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1082A>G	chr8.hg19:g.143957167T>C	ENSP00000292427:p.Glu361Gly	138.0	0.0		159.0	7.0	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	hg19	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	6.777	0.512273	0.12944	.	.	ENSG00000160882	ENST00000519285;ENST00000292427;ENST00000517471;ENST00000377675	T;T;T;T	0.76316	-1.01;-0.37;2.65;-0.37	4.42	3.15	0.36227	.	0.447704	0.19021	N	0.124839	T	0.71099	0.3300	L	0.56769	1.78	0.28820	N	0.897732	B;B;B;P;B	0.35050	0.094;0.01;0.022;0.482;0.101	B;B;B;B;B	0.37091	0.085;0.06;0.06;0.208;0.241	T	0.63427	-0.6640	10	0.27785	T	0.31	.	8.2956	0.31984	0.0:0.0:0.3459:0.6541	.	432;361;361;361;77	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	G	16;361;361;432	ENSP00000430144:E16G;ENSP00000292427:E361G;ENSP00000428043:E361G;ENSP00000366903:E432G	ENSP00000292427:E361G	E	-	2	0	CYP11B1	143954169	0.000000	0.05858	0.837000	0.33122	0.272000	0.26649	0.155000	0.16362	1.760000	0.52011	0.454000	0.30748	GAG	.	.		0.687	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
STXBP1	6812	hgsc.bcm.edu	37	9	130423380	130423380	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr9:130423380G>T	ENST00000373299.1	+	6	440		c.e6-1		STXBP1_ENST00000373302.3_Splice_Site	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1						axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						CATACTTGCAGCTTGTCCAGA	0.408																																					.		Atlas-SNP	.											.	STXBP1	99	.	0			c.326-1G>T						.						102.0	92.0	95.0					9																	130423380		2203	4300	6503	SO:0001630	splice_region_variant	6812	exon6			CTTGCAGCTTGTC	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.326-1G>T	chr9.hg19:g.130423380G>T		57.0	0.0		84.0	10.0	NM_001032221	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Splice_Site	SNP	ENST00000373299.1	hg19	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363401	0.82353	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000373299	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5764	0.87950	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STXBP1	129463201	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.529000	0.98049	2.746000	0.94184	0.655000	0.94253	.	.	.		0.408	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	Intron
C1QL3	389941	hgsc.bcm.edu	37	10	16556558	16556558	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr10:16556558G>A	ENST00000298943.3	-	2	1676	c.737C>T	c.(736-738)aCg>aTg	p.T246M		NM_001010908.1	NP_001010908.1	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	246	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				regulation of synapse organization (GO:0050807)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TCCAGAAAACGTGCTGTATTT	0.398																																					p.T246M		Atlas-SNP	.											.	C1QL3	27	.	0			c.C737T						.						144.0	137.0	139.0					10																	16556558		2203	4300	6503	SO:0001583	missense	389941	exon2			GAAAACGTGCTGT		CCDS31156.1	10p13	2012-03-26			ENSG00000165985	ENSG00000165985			19359	protein-coding gene	gene with protein product		615227				21378161	Standard	NM_001010908		Approved	K100, C1ql, C1QTNF13, CTRP13	uc001ioj.1	Q5VWW1	OTTHUMG00000017738	ENST00000298943.3:c.737C>T	chr10.hg19:g.16556558G>A	ENSP00000298943:p.Thr246Met	98.0	0.0		87.0	6.0	NM_001010908	A0PJY4|A0PJY5	Missense_Mutation	SNP	ENST00000298943.3	hg19	CCDS31156.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114609	0.77210	.	.	ENSG00000165985	ENST00000298943;ENST00000448557	T	0.78126	-1.15	5.68	5.68	0.88126	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.89291	0.6673	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89973	0.4095	10	0.87932	D	0	.	19.7873	0.96444	0.0:0.0:1.0:0.0	.	246	Q5VWW1	C1QL3_HUMAN	M	246;223	ENSP00000298943:T246M	ENSP00000298943:T246M	T	-	2	0	C1QL3	16596564	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	9.869000	0.99810	2.673000	0.90976	0.655000	0.94253	ACG	.	.		0.398	C1QL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047003.1	XM_372305	
GDF10	2662	hgsc.bcm.edu	37	10	48438408	48438408	+	Silent	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr10:48438408G>A	ENST00000224605.2	-	1	568	c.303C>T	c.(301-303)agC>agT	p.S101S		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	101					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						TGGCCCTGAAGCTGCGGACCG	0.642																																					p.S101S		Atlas-SNP	.											.	GDF10	79	.	0			c.C303T						.						21.0	16.0	17.0					10																	48438408		2190	4290	6480	SO:0001819	synonymous_variant	2662	exon1			CCTGAAGCTGCGG	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.303C>T	chr10.hg19:g.48438408G>A		56.0	0.0		47.0	10.0	NM_004962	Q5VSQ8|Q9UCX6	Silent	SNP	ENST00000224605.2	hg19	CCDS7220.1																																																																																			.	.		0.642	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962	
CCDC6	8030	hgsc.bcm.edu	37	10	61666139	61666139	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr10:61666139C>A	ENST00000263102.6	-	1	275	c.44G>T	c.(43-45)gGc>gTc	p.G15V		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	15						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GCTGCTGTTGCCCCCCGCCCC	0.776			T	RET	NSCLC																																p.G15V		Atlas-SNP	.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	CCDC6	44	.	0			c.G44T						.						6.0	8.0	8.0					10																	61666139		1702	3561	5263	SO:0001583	missense	8030	exon1			CTGTTGCCCCCCG	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.44G>T	chr10.hg19:g.61666139C>A	ENSP00000263102:p.Gly15Val	25.0	0.0		37.0	17.0	NM_005436	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	hg19	CCDS7257.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576752	0.65878	.	.	ENSG00000108091	ENST00000263102	D	0.85955	-2.05	3.81	3.81	0.43845	.	0.486350	0.22646	N	0.057387	T	0.79656	0.4483	N	0.22421	0.69	0.80722	D	1	P	0.48998	0.918	P	0.48704	0.587	T	0.78732	-0.2089	10	0.38643	T	0.18	-10.9702	11.4095	0.49917	0.0:1.0:0.0:0.0	.	15	Q16204	CCDC6_HUMAN	V	15	ENSP00000263102:G15V	ENSP00000263102:G15V	G	-	2	0	CCDC6	61336145	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.580000	0.53907	2.127000	0.65507	0.563000	0.77884	GGC	.	.		0.776	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
GOLGA7B	401647	hgsc.bcm.edu	37	10	99623838	99623838	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr10:99623838A>T	ENST00000370602.1	+	3	355	c.290A>T	c.(289-291)aAg>aTg	p.K97M		NM_001010917.2	NP_001010917.1	Q2TAP0	GOG7B_HUMAN	golgin A7 family, member B	97						Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|prostate(1)	5						CACTATGAGAAGGTGGCCCCT	0.607																																					p.K97M		Atlas-SNP	.											.	GOLGA7B	11	.	0			c.A290T						.						47.0	48.0	48.0					10																	99623838		2203	4300	6503	SO:0001630	splice_region_variant	401647	exon3			ATGAGAAGGTGGC	BC008047	CCDS31265.1	10q24.2	2011-10-25	2010-02-12	2008-10-03	ENSG00000155265	ENSG00000155265			31668	protein-coding gene	gene with protein product		614189	"""chromosome 10 open reading frame 133"", ""chromosome 10 open reading frame 132"", ""golgi autoantigen, golgin subfamily a, 7B"""	C10orf133, C10orf132			Standard	NM_001010917		Approved	bA459F3.4, bA451M19.3	uc001kos.3	Q2TAP0	OTTHUMG00000018869	ENST00000370602.1:c.291+1A>T	chr10.hg19:g.99623838A>T		77.0	0.0		96.0	26.0	NM_001010917	Q5T4F5	Missense_Mutation	SNP	ENST00000370602.1	hg19	CCDS31265.1	.	.	.	.	.	.	.	.	.	.	A	19.68	3.873689	0.72180	.	.	ENSG00000155265	ENST00000370602	.	.	.	5.17	5.17	0.71159	Golgin subfamily A member 7/ERF4 (1);	0.000000	0.85682	D	0.000000	T	0.79975	0.4539	M	0.86740	2.835	0.80722	D	1	D	0.65815	0.995	D	0.63703	0.917	D	0.83981	0.0332	9	0.87932	D	0	-51.2966	14.1408	0.65318	1.0:0.0:0.0:0.0	.	97	Q2TAP0	GOG7B_HUMAN	M	97	.	ENSP00000359634:K97M	K	+	2	0	GOLGA7B	99613828	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	9.139000	0.94554	2.189000	0.69895	0.459000	0.35465	AAG	.	.		0.607	GOLGA7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049752.1	NM_001010917	Missense_Mutation
COL17A1	1308	hgsc.bcm.edu	37	10	105796292	105796292	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr10:105796292C>A	ENST00000353479.5	-	48	3666	c.3376G>T	c.(3376-3378)Gac>Tac	p.D1126Y	COL17A1_ENST00000369733.3_Missense_Mutation_p.D1081Y	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1126	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TCTGCATAGTCCAAAGACAGG	0.592																																					p.D1126Y		Atlas-SNP	.											.	COL17A1	149	.	0			c.G3376T						.						60.0	55.0	57.0					10																	105796292		2203	4300	6503	SO:0001583	missense	1308	exon48			CATAGTCCAAAGA	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3376G>T	chr10.hg19:g.105796292C>A	ENSP00000340937:p.Asp1126Tyr	67.0	0.0		56.0	14.0	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	hg19	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695403	0.68386	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.92048	-2.96;-2.93	5.75	4.85	0.62838	.	0.000000	0.48767	D	0.000172	D	0.94324	0.8176	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	P	0.60789	0.879	D	0.94521	0.7727	10	0.72032	D	0.01	-23.095	12.8797	0.58010	0.0:0.9254:0.0:0.0746	.	1126	Q9UMD9	COHA1_HUMAN	Y	1126;1081	ENSP00000340937:D1126Y;ENSP00000358748:D1081Y	ENSP00000340937:D1126Y	D	-	1	0	COL17A1	105786282	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.282000	0.43461	1.438000	0.47492	0.549000	0.68633	GAC	.	.		0.592	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
VWA5A	4013	hgsc.bcm.edu	37	11	123989361	123989361	+	Silent	SNP	C	C	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr11:123989361C>T	ENST00000456829.2	+	6	842	c.591C>T	c.(589-591)tcC>tcT	p.S197S	VWA5A_ENST00000361352.5_Silent_p.S197S|VWA5A_ENST00000449321.1_Silent_p.S197S|VWA5A_ENST00000392748.1_Silent_p.S197S|VWA5A_ENST00000392744.4_Silent_p.S213S|VWA5A_ENST00000360334.4_Silent_p.S197S	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	197										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						AGGTCCAATCCAACTGCCCCT	0.493																																					p.S197S		Atlas-SNP	.											.	VWA5A	102	.	0			c.C591T						.						116.0	102.0	107.0					11																	123989361		2201	4299	6500	SO:0001819	synonymous_variant	4013	exon5			CCAATCCAACTGC	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.591C>T	chr11.hg19:g.123989361C>T		77.0	0.0		76.0	25.0	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Silent	SNP	ENST00000456829.2	hg19	CCDS8444.1																																																																																			.	.		0.493	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
KMT2D	8085	hgsc.bcm.edu	37	12	49431178	49431178	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr12:49431178G>A	ENST00000301067.7	-	34	9960	c.9961C>T	c.(9961-9963)Cga>Tga	p.R3321*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3321	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R3051*(1)|p.R3321*(1)									CCTGGCTGTCGGGCACCTGCA	0.622																																					p.R3321X		Atlas-SNP	.											MLL2_ENST00000301067,NS,lymphoid_neoplasm,0,4	MLL2	1173	.	2	Substitution - Nonsense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C9961T						.						18.0	22.0	21.0					12																	49431178		2103	4224	6327	SO:0001587	stop_gained	8085	exon34			GCTGTCGGGCACC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9961C>T	chr12.hg19:g.49431178G>A	ENSP00000301067:p.Arg3321*	113.0	0.0		120.0	25.0	NM_003482	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	50	17.260850	0.99882	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.61	4.71	0.59529	.	0.000000	0.31721	N	0.007180	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.4258	0.61024	0.0:0.0:0.7155:0.2845	.	.	.	.	X	3321	.	ENSP00000301067:R3321X	R	-	1	2	MLL2	47717445	0.998000	0.40836	0.988000	0.46212	0.838000	0.47535	2.968000	0.49224	1.502000	0.48669	0.655000	0.94253	CGA	.	.		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CCDC168	643677	hgsc.bcm.edu	37	13	103385419	103385419	+	Silent	SNP	C	C	T	rs375803026		TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr13:103385419C>T	ENST00000322527.2	-	1	3740	c.3741G>A	c.(3739-3741)gcG>gcA	p.A1247A		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1247																	GGCTGAGGTGCGCTGTTGTTT	0.473																																					p.A5876A		Atlas-SNP	.											.	.	.	.	0			c.G17628A						.	C		0,1384		0,0,692	397.0	298.0	328.0		17628	-1.6	0.0	13		328	1,3181		0,1,1590	no	coding-synonymous	CCDC168	NM_001146197.1		0,1,2282	TT,TC,CC		0.0314,0.0,0.0219		5876/7082	103385419	1,4565	692	1591	2283	SO:0001819	synonymous_variant	643677	exon4			GAGGTGCGCTGTT		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.3741G>A	chr13.hg19:g.103385419C>T		86.0	0.0		67.0	17.0	NM_001146197	Q8N800	Silent	SNP	ENST00000322527.2	hg19																																																																																				.	.		0.473	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
APEX1	328	hgsc.bcm.edu	37	14	20925369	20925369	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr14:20925369T>C	ENST00000216714.3	+	5	927	c.659T>C	c.(658-660)cTt>cCt	p.L220P	APEX1_ENST00000557365.1_3'UTR|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_3'UTR|OSGEP_ENST00000206542.4_5'Flank|APEX1_ENST00000398030.4_Missense_Mutation_p.L220P|APEX1_ENST00000555414.1_Missense_Mutation_p.L220P	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	220					aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	GAAATTGACCTTCGCAACCCC	0.552								Other BER factors																													p.L220P		Atlas-SNP	.											.	APEX1	23	.	0			c.T659C						.						85.0	82.0	83.0					14																	20925369		2203	4300	6503	SO:0001583	missense	328	exon5			TTGACCTTCGCAA	X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.659T>C	chr14.hg19:g.20925369T>C	ENSP00000216714:p.Leu220Pro	110.0	0.0		120.0	31.0	NM_080648	Q969L5|Q99775	Missense_Mutation	SNP	ENST00000216714.3	hg19	CCDS9550.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.36|18.36	3.607500|3.607500	0.66558|0.66558	.|.	.|.	ENSG00000100823|ENSG00000100823	ENST00000438886|ENST00000555414;ENST00000216714;ENST00000553681;ENST00000398030;ENST00000555839	.|T;T;T;T;T	.|0.69175	.|-0.21;-0.21;-0.21;-0.21;-0.38	5.79|5.79	5.79|5.79	0.91817|0.91817	.|Endonuclease/exonuclease/phosphatase (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88945|0.88945	0.6575|0.6575	H|H	0.98507|0.98507	4.25|4.25	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.93021|0.93021	0.6440|0.6440	5|10	.|0.87932	.|D	.|0	.|.	15.118|15.118	0.72419|0.72419	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|220	.|P27695	.|APEX1_HUMAN	L|P	147|220;220;220;220;191	.|ENSP00000451979:L220P;ENSP00000216714:L220P;ENSP00000451327:L220P;ENSP00000381111:L220P;ENSP00000452460:L191P	.|ENSP00000216714:L220P	F|L	+|+	1|2	0|0	APEX1|APEX1	19995209|19995209	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.615000|7.615000	0.83006|0.83006	2.207000|2.207000	0.71202|0.71202	0.533000|0.533000	0.62120|0.62120	TTC|CTT	.	.		0.552	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073641.3	NM_001641	
SERPINA11	256394	hgsc.bcm.edu	37	14	94912770	94912770	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr14:94912770G>A	ENST00000334708.3	-	3	879	c.815C>T	c.(814-816)gCc>gTc	p.A272V	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	272					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		CAGCGCCAAGGCATTTCCTCT	0.552																																					p.A272V		Atlas-SNP	.											.	SERPINA11	53	.	0			c.C815T						.						123.0	111.0	115.0					14																	94912770		2203	4300	6503	SO:0001583	missense	256394	exon3			GCCAAGGCATTTC	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.815C>T	chr14.hg19:g.94912770G>A	ENSP00000335024:p.Ala272Val	97.0	0.0		116.0	25.0	NM_001080451	B2RV07	Missense_Mutation	SNP	ENST00000334708.3	hg19	CCDS32149.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609887	0.46527	.	.	ENSG00000186910	ENST00000334708	D	0.82803	-1.65	5.53	4.45	0.53987	Serpin domain (3);	0.000000	0.64402	D	0.000009	D	0.87168	0.6110	L	0.58510	1.815	0.34251	D	0.678785	P	0.44195	0.828	P	0.58391	0.838	D	0.90081	0.4170	10	0.46703	T	0.11	.	13.0161	0.58757	0.1234:0.0:0.8766:0.0	.	272	Q86U17	SPA11_HUMAN	V	272	ENSP00000335024:A272V	ENSP00000335024:A272V	A	-	2	0	SERPINA11	93982523	1.000000	0.71417	0.166000	0.22797	0.262000	0.26303	3.357000	0.52277	2.591000	0.87537	0.555000	0.69702	GCC	.	.		0.552	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413091.1	NM_001080451	
HERC2	8924	hgsc.bcm.edu	37	15	28412958	28412958	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr15:28412958C>A	ENST00000261609.7	-	68	10537	c.10429G>T	c.(10429-10431)Gac>Tac	p.D3477Y		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTCACTGCGTCCTCAGAGGAA	0.527																																					p.D3477Y		Atlas-SNP	.											.	HERC2	501	.	0			c.G10429T						.						67.0	69.0	68.0					15																	28412958		2203	4300	6503	SO:0001583	missense	8924	exon68			CTGCGTCCTCAGA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10429G>T	chr15.hg19:g.28412958C>A	ENSP00000261609:p.Asp3477Tyr	67.0	0.0		86.0	18.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052115	0.55218	.	.	ENSG00000128731	ENST00000261609	T	0.39406	1.08	5.62	4.7	0.59300	.	0.050966	0.85682	D	0.000000	T	0.46870	0.1415	L	0.57536	1.79	0.80722	D	1	P	0.48503	0.911	P	0.46585	0.521	T	0.51052	-0.8754	10	0.62326	D	0.03	.	14.8081	0.69974	0.0:0.9297:0.0:0.0703	.	3477	O95714	HERC2_HUMAN	Y	3477	ENSP00000261609:D3477Y	ENSP00000261609:D3477Y	D	-	1	0	HERC2	26086553	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	7.788000	0.85771	2.638000	0.89438	0.591000	0.81541	GAC	.	.		0.527	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TUBGCP4	27229	hgsc.bcm.edu	37	15	43668706	43668706	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr15:43668706C>A	ENST00000260383.7	+	3	467	c.213C>A	c.(211-213)caC>caA	p.H71Q	TUBGCP4_ENST00000570081.1_3'UTR|TUBGCP4_ENST00000399460.3_5'Flank|TUBGCP4_ENST00000564079.1_Missense_Mutation_p.H71Q			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	71					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		TTCAGGATCACCATCCATCTC	0.468											OREG0023088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H71Q		Atlas-SNP	.											.	TUBGCP4	48	.	0			c.C213A						.						159.0	149.0	152.0					15																	43668706		1891	4121	6012	SO:0001583	missense	27229	exon3			GGATCACCATCCA	AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.213C>A	chr15.hg19:g.43668706C>A	ENSP00000260383:p.His71Gln	94.0	0.0	918	85.0	23.0	NM_014444	B3KNK6|Q969X3|Q9NVF0	Missense_Mutation	SNP	ENST00000260383.7	hg19		.	.	.	.	.	.	.	.	.	.	C	7.070	0.568059	0.13560	.	.	ENSG00000137822	ENST00000260383	T	0.39787	1.06	5.34	1.36	0.22044	.	0.000000	0.85682	D	0.000000	T	0.23572	0.0570	N	0.19112	0.55	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.06881	-1.0802	10	0.14252	T	0.57	-22.7104	10.6915	0.45872	0.0:0.6524:0.0:0.3476	.	71;71	Q9UGJ1;Q9UGJ1-2	GCP4_HUMAN;.	Q	71	ENSP00000260383:H71Q	ENSP00000260383:H71Q	H	+	3	2	TUBGCP4	41455998	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.197000	0.32211	0.353000	0.24079	-0.136000	0.14681	CAC	.	.		0.468	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000432970.1	NM_014444	
CRAMP1L	57585	hgsc.bcm.edu	37	16	1715078	1715078	+	Silent	SNP	A	A	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr16:1715078A>G	ENST00000397412.3	+	14	2790	c.2691A>G	c.(2689-2691)ccA>ccG	p.P897P	LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000293925.5_Silent_p.P897P|CRAMP1L_ENST00000262317.4_Silent_p.P275P|CRAMP1L_ENST00000436138.3_Silent_p.P894P			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	897						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						TCCCTAGACCATCGGAAAACC	0.478																																					p.P897P		Atlas-SNP	.											.	CRAMP1L	60	.	0			c.A2691G						.						127.0	125.0	126.0					16																	1715078		1989	4163	6152	SO:0001819	synonymous_variant	57585	exon13			TAGACCATCGGAA	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.2691A>G	chr16.hg19:g.1715078A>G		77.0	0.0		72.0	15.0	NM_020825	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Silent	SNP	ENST00000397412.3	hg19	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	A	2.480	-0.319873	0.05386	.	.	ENSG00000007545	ENST00000415022	.	.	.	5.71	-11.4	0.00090	.	.	.	.	.	T	0.32010	0.0815	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41963	-0.9479	4	.	.	.	-33.4245	2.6208	0.04916	0.4934:0.1631:0.0893:0.2542	.	.	.	.	V	55	.	.	I	+	1	0	CRAMP1L	1655079	0.000000	0.05858	0.329000	0.25429	0.183000	0.23260	-2.981000	0.00662	-1.602000	0.01599	-0.621000	0.04028	ATC	.	.		0.478	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
GRB7	2886	hgsc.bcm.edu	37	17	37901708	37901708	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr17:37901708G>A	ENST00000309156.4	+	11	1383	c.1126G>A	c.(1126-1128)Gac>Aac	p.D376N	GRB7_ENST00000394204.1_Missense_Mutation_p.D376N|GRB7_ENST00000394209.2_Missense_Mutation_p.D376N|GRB7_ENST00000445327.2_Missense_Mutation_p.D399N|GRB7_ENST00000394211.3_Missense_Mutation_p.D376N|GRB7_ENST00000309185.3_Missense_Mutation_p.D376N	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	376					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGTGGCCATGGACTTCTCTGG	0.612																																					p.D399N		Atlas-SNP	.											.	GRB7	48	.	0			c.G1195A						.						70.0	66.0	67.0					17																	37901708		2203	4300	6503	SO:0001583	missense	2886	exon11			GCCATGGACTTCT	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.1126G>A	chr17.hg19:g.37901708G>A	ENSP00000310771:p.Asp376Asn	53.0	0.0		47.0	8.0	NM_001242442	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	ENST00000309156.4	hg19	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876208	0.91664	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.69435	-0.4;0.83;0.83;0.83;0.8;-0.4	5.88	5.88	0.94601	BPS (Between PH and SH2) domain (1);	0.000000	0.85682	D	0.000000	D	0.83977	0.5371	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.83253	-0.0052	10	0.45353	T	0.12	-40.6223	19.8311	0.96636	0.0:0.0:1.0:0.0	.	376;376	Q14451-2;Q14451	.;GRB7_HUMAN	N	376;376;376;376;399;376	ENSP00000311752:D376N;ENSP00000310771:D376N;ENSP00000377761:D376N;ENSP00000377759:D376N;ENSP00000403459:D399N;ENSP00000377754:D376N	ENSP00000310771:D376N	D	+	1	0	GRB7	35155234	1.000000	0.71417	1.000000	0.80357	0.378000	0.30076	9.752000	0.98900	2.790000	0.95986	0.591000	0.81541	GAC	.	.		0.612	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310	
TNRC6C	57690	hgsc.bcm.edu	37	17	76075532	76075532	+	Silent	SNP	C	C	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr17:76075532C>T	ENST00000588061.1	+	12	3994	c.3267C>T	c.(3265-3267)acC>acT	p.T1089T	TNRC6C_ENST00000588847.1_Silent_p.T1086T|TNRC6C_ENST00000335749.4_Silent_p.T1086T|TNRC6C_ENST00000301624.4_Silent_p.T1089T|TNRC6C_ENST00000541771.1_Silent_p.T1089T|TNRC6C_ENST00000544502.1_Silent_p.T1086T			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1089					embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AAGCCAGGACCATGCAGCAGC	0.547																																					p.T1089T		Atlas-SNP	.											.	TNRC6C	173	.	0			c.C3267T						.						92.0	104.0	100.0					17																	76075532		2155	4260	6415	SO:0001819	synonymous_variant	57690	exon11			CAGGACCATGCAG	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3267C>T	chr17.hg19:g.76075532C>T		56.0	0.0		57.0	14.0	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	hg19	CCDS45798.1																																																																																			.	.		0.547	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
MYOM1	8736	hgsc.bcm.edu	37	18	3129395	3129395	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr18:3129395T>G	ENST00000356443.4	-	18	2962	c.2629A>C	c.(2629-2631)Agc>Cgc	p.S877R	MYOM1_ENST00000400569.3_Missense_Mutation_p.S877R|MYOM1_ENST00000582016.1_5'UTR|MYOM1_ENST00000261606.7_Intron	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	877					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTAGGTTTGCTGCCAAGCAAA	0.547											OREG0024838	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S877R		Atlas-SNP	.											.	MYOM1	192	.	0			c.A2629C						.						178.0	179.0	178.0					18																	3129395		1935	4138	6073	SO:0001583	missense	8736	exon18			GTTTGCTGCCAAG	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.2629A>C	chr18.hg19:g.3129395T>G	ENSP00000348821:p.Ser877Arg	101.0	0.0	608	126.0	12.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	4.012	-0.000417	0.07819	.	.	ENSG00000101605	ENST00000356443;ENST00000400569	T;T	0.43688	0.94;0.95	5.88	0.54	0.17163	.	0.456915	0.25668	N	0.029086	T	0.19208	0.0461	N	0.14661	0.345	0.24952	N	0.991785	B	0.12630	0.006	B	0.10450	0.005	T	0.18587	-1.0332	10	0.15066	T	0.55	.	5.7522	0.18152	0.0:0.2144:0.2453:0.5403	.	877	P52179	MYOM1_HUMAN	R	877	ENSP00000348821:S877R;ENSP00000383413:S877R	ENSP00000348821:S877R	S	-	1	0	MYOM1	3119395	1.000000	0.71417	0.621000	0.29145	0.040000	0.13550	1.688000	0.37690	0.114000	0.18032	-0.290000	0.09829	AGC	.	.		0.547	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
OSBPL1A	114876	hgsc.bcm.edu	37	18	21743143	21743143	+	Silent	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr18:21743143T>C	ENST00000319481.3	-	28	3059	c.2853A>G	c.(2851-2853)taA>taG	p.*951*	OSBPL1A_ENST00000399443.3_Silent_p.*438*|RP11-799B12.4_ENST00000583267.1_lincRNA|OSBPL1A_ENST00000357041.4_Silent_p.*569*	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	0					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TGTATGCATTTTAATAAATGT	0.348																																					p.X951X		Atlas-SNP	.											.	OSBPL1A	94	.	0			c.A2853G						.						94.0	91.0	92.0					18																	21743143		2203	4300	6503	SO:0001819	synonymous_variant	114876	exon28			TGCATTTTAATAA	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2853A>G	chr18.hg19:g.21743143T>C		82.0	0.0		104.0	14.0	NM_080597	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	hg19	CCDS11884.1																																																																																			.	.		0.348	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
MIDN	90007	hgsc.bcm.edu	37	19	1257098	1257098	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr19:1257098G>A	ENST00000591446.2	+	7	1643	c.1234G>A	c.(1234-1236)Gcg>Acg	p.A412T	MIDN_ENST00000300952.2_Missense_Mutation_p.A412T|CIRBP_ENST00000588030.1_5'Flank			Q504T8	MIDN_HUMAN	midnolin	412						cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGCGGGACGCGCGGGGTCC	0.716																																					p.A412T		Atlas-SNP	.											.	MIDN	34	.	0			c.G1234A						.						14.0	18.0	17.0					19																	1257098		2193	4283	6476	SO:0001583	missense	90007	exon8			CGGGACGCGCGGG	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.1234G>A	chr19.hg19:g.1257098G>A	ENSP00000467679:p.Ala412Thr	71.0	0.0		78.0	17.0	NM_177401	Q96BW8	Missense_Mutation	SNP	ENST00000591446.2	hg19	CCDS32864.1	.	.	.	.	.	.	.	.	.	.	g	14.62	2.588613	0.46110	.	.	ENSG00000167470	ENST00000300952	.	.	.	3.44	3.44	0.39384	.	0.272597	0.31102	U	0.008253	T	0.26846	0.0657	L	0.34521	1.04	0.29005	N	0.887214	D	0.58970	0.984	P	0.44772	0.46	T	0.08006	-1.0743	9	0.25106	T	0.35	-17.2934	9.2415	0.37500	0.0:0.0:0.7835:0.2165	.	412	Q504T8	MIDN_HUMAN	T	412	.	ENSP00000300952:A412T	A	+	1	0	MIDN	1208098	1.000000	0.71417	0.915000	0.36163	0.164000	0.22412	4.907000	0.63300	1.756000	0.51951	0.486000	0.48141	GCG	.	.		0.716	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
PRKCSH	5589	hgsc.bcm.edu	37	19	11558367	11558367	+	Silent	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr19:11558367G>A	ENST00000589838.1	+	10	963	c.963G>A	c.(961-963)gaG>gaA	p.E321E	PRKCSH_ENST00000412601.1_Silent_p.E321E|PRKCSH_ENST00000592741.1_Silent_p.E321E|PRKCSH_ENST00000587327.1_Silent_p.E321E|PRKCSH_ENST00000252455.2_Silent_p.E321E|PRKCSH_ENST00000591462.1_Silent_p.E321E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	321	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaggaagaag	0.632																																					p.E321E		Atlas-SNP	.											.	PRKCSH	55	.	1	Deletion - In frame(1)	central_nervous_system(1)	c.G963A						.						28.0	28.0	28.0					19																	11558367		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAGGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.963G>A	chr19.hg19:g.11558367G>A		64.0	0.0		91.0	4.0	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	hg19	CCDS32911.1																																																																																			.	.		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
CALR	811	hgsc.bcm.edu	37	19	13054677	13054677	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr19:13054677G>T	ENST00000316448.5	+	9	1277	c.1204G>T	c.(1204-1206)Gag>Tag	p.E402*	RAD23A_ENST00000592268.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000541222.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	402	Asp/Glu/Lys-rich.|C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	ggaggacaaggaggaagatga	0.587																																					p.E402X		Atlas-SNP	.											.	CALR	31	.	0			c.G1204T						.						258.0	199.0	219.0					19																	13054677		2203	4299	6502	SO:0001587	stop_gained	811	exon9			GACAAGGAGGAAG	M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1204G>T	chr19.hg19:g.13054677G>T	ENSP00000320866:p.Glu402*	287.0	0.0		372.0	82.0	NM_004343	Q6IAT4|Q9UDG2	Nonsense_Mutation	SNP	ENST00000316448.5	hg19	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165549	0.78339	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	.	.	.	5.4	5.4	0.78164	.	0.351696	0.27591	N	0.018696	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-36.9649	11.4462	0.50125	0.0841:0.0:0.9159:0.0	.	.	.	.	X	402;281	.	ENSP00000320866:E402X	E	+	1	0	CALR	12915677	1.000000	0.71417	0.400000	0.26346	0.301000	0.27625	3.720000	0.54933	2.526000	0.85167	0.555000	0.69702	GAG	.	.		0.587	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
CACNA1A	773	hgsc.bcm.edu	37	19	13616815	13616815	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr19:13616815T>A	ENST00000360228.5	-	1	223	c.224A>T	c.(223-225)aAc>aTc	p.N75I	CACNA1A_ENST00000573710.2_Missense_Mutation_p.N75I	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	75					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGAGACCGGTTAACCGTGAG	0.562																																					p.N75I		Atlas-SNP	.											.	CACNA1A	715	.	0			c.A224T						.						90.0	98.0	96.0					19																	13616815		2085	4212	6297	SO:0001583	missense	773	exon1			GACCGGTTAACCG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.224A>T	chr19.hg19:g.13616815T>A	ENSP00000353362:p.Asn75Ile	1039.0	0.0		1101.0	278.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	hg19	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.871708	0.33069	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.53857	0.6	3.36	3.36	0.38483	.	0.000000	0.64402	U	0.000005	T	0.73705	0.3621	M	0.88241	2.94	0.51767	D	0.999935	D;D	0.71674	0.998;0.99	D;D	0.76071	0.987;0.946	T	0.78432	-0.2206	10	0.87932	D	0	.	10.904	0.47069	0.0:0.0:0.0:1.0	.	75;75	O00555;Q9NS88	CAC1A_HUMAN;.	I	75	ENSP00000353362:N75I	ENSP00000317661:N75I	N	-	2	0	CACNA1A	13477815	1.000000	0.71417	1.000000	0.80357	0.186000	0.23388	7.547000	0.82146	1.414000	0.47017	0.416000	0.27883	AAC	.	.		0.562	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
TM6SF2	53345	hgsc.bcm.edu	37	19	19379472	19379472	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr19:19379472C>A	ENST00000389363.4	-	6	648	c.576G>T	c.(574-576)caG>caT	p.Q192H	TM6SF2_ENST00000586107.1_5'Flank|AC138430.4_ENST00000586064.2_RNA	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	192						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			GCGCCCGGGGCTGGCTGAAGA	0.587																																					p.Q192H		Atlas-SNP	.											.	TM6SF2	39	.	0			c.G576T						.						62.0	65.0	64.0					19																	19379472		1963	4151	6114	SO:0001583	missense	53345	exon6			CCGGGGCTGGCTG	AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.576G>T	chr19.hg19:g.19379472C>A	ENSP00000374014:p.Gln192His	93.0	0.0		118.0	38.0	NM_001001524	Q0IJ64	Missense_Mutation	SNP	ENST00000389363.4	hg19	CCDS42528.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521455	0.44866	.	.	ENSG00000213996	ENST00000389363;ENST00000269990	T	0.29917	1.55	5.01	5.01	0.66863	.	0.312353	0.22424	U	0.060251	T	0.50565	0.1623	M	0.78049	2.395	0.25777	N	0.984778	D	0.61080	0.989	P	0.56916	0.809	T	0.50180	-0.8858	10	0.62326	D	0.03	-11.931	13.8127	0.63273	0.0:1.0:0.0:0.0	.	192	Q9BZW4	TM6S2_HUMAN	H	192	ENSP00000374014:Q192H	ENSP00000269990:Q192H	Q	-	3	2	TM6SF2	19240472	1.000000	0.71417	0.640000	0.29408	0.384000	0.30261	1.625000	0.37029	2.340000	0.79590	0.650000	0.86243	CAG	.	.		0.587	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460122.2	NM_203510	
WDR87	83889	hgsc.bcm.edu	37	19	38383766	38383766	+	Silent	SNP	T	T	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr19:38383766T>C	ENST00000303868.5	-	4	2684	c.2460A>G	c.(2458-2460)caA>caG	p.Q820Q	WDR87_ENST00000447313.2_Silent_p.Q859Q	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	820										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						AAAAGAATTCTTGAGACCTGT	0.473																																					p.Q820Q		Atlas-SNP	.											.	WDR87	191	.	0			c.A2460G						.						96.0	77.0	83.0					19																	38383766		692	1591	2283	SO:0001819	synonymous_variant	83889	exon4			GAATTCTTGAGAC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2460A>G	chr19.hg19:g.38383766T>C		83.0	0.0		75.0	19.0	NM_031951	Q9BWV9	Silent	SNP	ENST00000303868.5	hg19	CCDS46063.1																																																																																			.	.		0.473	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
SLC52A3	113278	hgsc.bcm.edu	37	20	746297	746298	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr20:746297_746298GG>AT	ENST00000217254.7	-	2	362_363	c.121_122CC>AT	c.(121-123)CCc>ATc	p.P41I	SLC52A3_ENST00000381944.3_Missense_Mutation_p.P41I|SLC52A3_ENST00000473664.1_5'UTR	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	41					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										GAGGTAGGAGGGCAGGTACCAG	0.644																																					p.P41L|p.P41T		Atlas-SNP	.											.	.	.	.	0			c.C122T|c.C121A						.																																			SO:0001583	missense	113278	exon2			TAGGAGGGCAGGT|AGGAGGGCAGGTA	AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.121_122delinsAT	chr20.hg19:g.746297_746298delinsAT	ENSP00000217254:p.Pro41Ile	100.0|99.0	0.0		107.0|109.0	32.0	NM_033409	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	ENST00000217254.7	hg19	CCDS13007.1																																																																																			.	.		0.644	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409	
FAM65C	140876	hgsc.bcm.edu	37	20	49247308	49247308	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr20:49247308G>T	ENST00000327979.2	-	2	488	c.77C>A	c.(76-78)gCa>gAa	p.A26E	FAM65C_ENST00000535356.1_Missense_Mutation_p.A30E|FAM65C_ENST00000045083.2_Missense_Mutation_p.A26E			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	26										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCTGAAGCCTGCGAAGGAGGC	0.662																																					p.A26E		Atlas-SNP	.											.	FAM65C	87	.	0			c.C77A						.						29.0	25.0	26.0					20																	49247308		2203	4300	6503	SO:0001583	missense	140876	exon2			AAGCCTGCGAAGG	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.77C>A	chr20.hg19:g.49247308G>T	ENSP00000332663:p.Ala26Glu	142.0	0.0		176.0	52.0	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	hg19	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814019	0.70912	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.20332	2.09;2.09;2.08	4.91	4.91	0.64330	.	0.062145	0.64402	D	0.000005	T	0.46229	0.1382	M	0.77313	2.365	0.43118	D	0.99483	D;D	0.76494	0.999;0.999	D;D	0.69479	0.964;0.964	T	0.50474	-0.8824	10	0.87932	D	0	-11.5365	13.9446	0.64077	0.0:0.0:1.0:0.0	.	30;26	F5H0X2;Q96MK2	.;FA65C_HUMAN	E	26;26;30	ENSP00000332663:A26E;ENSP00000045083:A26E;ENSP00000439802:A30E	ENSP00000045083:A26E	A	-	2	0	FAM65C	48680715	0.996000	0.38824	0.921000	0.36526	0.489000	0.33432	4.426000	0.59882	2.414000	0.81942	0.561000	0.74099	GCA	.	.		0.662	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
RWDD2B	10069	hgsc.bcm.edu	37	21	30380212	30380212	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr21:30380212T>G	ENST00000493196.1	-	4	695	c.595A>C	c.(595-597)Aac>Cac	p.N199H	RWDD2B_ENST00000486719.1_5'UTR	NM_016940.2	NP_058636.1	P57060	RWD2B_HUMAN	RWD domain containing 2B	199										endometrium(1)|kidney(1)|large_intestine(8)|lung(2)	12						TTGCATTTGTTATAGATATGA	0.463																																					p.N199H		Atlas-SNP	.											.	RWDD2B	24	.	0			c.A595C						.						119.0	117.0	118.0					21																	30380212		2203	4300	6503	SO:0001583	missense	10069	exon4			ATTTGTTATAGAT	AF212232	CCDS13582.1	21q22.11	2012-12-07	2007-07-17	2007-07-17	ENSG00000156253	ENSG00000156253			1302	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 6"""	C21orf6		10729227	Standard	NM_016940		Approved	GL011	uc002yms.3	P57060	OTTHUMG00000078805	ENST00000493196.1:c.595A>C	chr21.hg19:g.30380212T>G	ENSP00000418693:p.Asn199His	60.0	0.0		75.0	24.0	NM_016940		Missense_Mutation	SNP	ENST00000493196.1	hg19	CCDS13582.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.523035	0.85600	.	.	ENSG00000156253	ENST00000493196	.	.	.	5.41	5.41	0.78517	Domain of unknown function DUF1115 (1);	0.041393	0.85682	D	0.000000	T	0.79964	0.4537	M	0.84219	2.685	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	D;D	0.69654	0.946;0.965	T	0.82827	-0.0265	9	0.62326	D	0.03	-9.9902	15.612	0.76733	0.0:0.0:0.0:1.0	.	199;199	Q53FD2;P57060	.;RWD2B_HUMAN	H	199	.	ENSP00000418693:N199H	N	-	1	0	RWDD2B	29302083	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.846000	0.86887	2.281000	0.76405	0.533000	0.62120	AAC	.	.		0.463	RWDD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171858.1		
TRAPPC10	7109	hgsc.bcm.edu	37	21	45495012	45495012	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr21:45495012G>T	ENST00000291574.4	+	9	1453	c.1278G>T	c.(1276-1278)ttG>ttT	p.L426F		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	426					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						TGGCAGGTTTGGGAGCTGAGC	0.433																																					p.L426F		Atlas-SNP	.											.	TRAPPC10	109	.	0			c.G1278T						.						98.0	88.0	91.0					21																	45495012		2203	4300	6503	SO:0001583	missense	7109	exon9			AGGTTTGGGAGCT	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1278G>T	chr21.hg19:g.45495012G>T	ENSP00000291574:p.Leu426Phe	63.0	0.0		86.0	4.0	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	hg19	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.576262	0.65878	.	.	ENSG00000160218	ENST00000291574	T	0.47177	0.85	5.21	4.32	0.51571	.	0.000000	0.64402	D	0.000001	T	0.54759	0.1878	L	0.44542	1.39	0.58432	D	0.99999	D	0.76494	0.999	D	0.66716	0.946	T	0.56306	-0.8001	10	0.66056	D	0.02	.	7.2173	0.25967	0.0798:0.0:0.6288:0.2914	.	426	P48553	TPC10_HUMAN	F	426	ENSP00000291574:L426F	ENSP00000291574:L426F	L	+	3	2	TRAPPC10	44319440	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.323000	0.33701	1.297000	0.44761	0.655000	0.94253	TTG	.	.		0.433	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
ZNF280A	129025	hgsc.bcm.edu	37	22	22868555	22868555	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr22:22868555A>G	ENST00000302097.3	-	2	1652	c.1400T>C	c.(1399-1401)aTa>aCa	p.I467T		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TTTGTGCTCTATTTCCTCCTT	0.438																																					p.I467T		Atlas-SNP	.											.	ZNF280A	67	.	0			c.T1400C						.						120.0	114.0	116.0					22																	22868555		2203	4300	6503	SO:0001583	missense	129025	exon2			TGCTCTATTTCCT	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1400T>C	chr22.hg19:g.22868555A>G	ENSP00000302855:p.Ile467Thr	91.0	0.0		100.0	31.0	NM_080740		Missense_Mutation	SNP	ENST00000302097.3	hg19	CCDS13800.1	.	.	.	.	.	.	.	.	.	.	A	1.064	-0.671898	0.03403	.	.	ENSG00000169548	ENST00000302097	T	0.60299	0.2	3.76	-7.04	0.01578	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.30603	0.0770	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24261	-1.0165	9	0.21540	T	0.41	-2.1691	10.0285	0.42085	0.2872:0.0:0.5966:0.1162	.	467	P59817	Z280A_HUMAN	T	467	ENSP00000302855:I467T	ENSP00000302855:I467T	I	-	2	0	ZNF280A	21198555	0.616000	0.27035	0.000000	0.03702	0.105000	0.19272	0.308000	0.19314	-1.943000	0.01039	-0.274000	0.10170	ATA	.	.		0.438	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740	
TLR8	51311	hgsc.bcm.edu	37	X	12939521	12939521	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chrX:12939521G>A	ENST00000218032.6	+	2	2449	c.2362G>A	c.(2362-2364)Gat>Aat	p.D788N	TLR8_ENST00000311912.5_Missense_Mutation_p.D806N	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	788	LRRCT.				cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	AAGATGGATGGATGAACATCT	0.443																																					p.D788N		Atlas-SNP	.											.	TLR8	134	.	0			c.G2362A						.						120.0	101.0	107.0					X																	12939521		2203	4300	6503	SO:0001583	missense	51311	exon2			TGGATGGATGAAC	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.2362G>A	chrX.hg19:g.12939521G>A	ENSP00000218032:p.Asp788Asn	71.0	0.0		71.0	15.0	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	hg19	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	G	6.551	0.469899	0.12461	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.28454	1.61;1.79	5.97	5.1	0.69264	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.41938	D	0.000783	T	0.16685	0.0401	N	0.11284	0.12	0.35845	D	0.826347	D;D	0.59767	0.986;0.986	P;P	0.50490	0.642;0.642	T	0.36915	-0.9728	10	0.07325	T	0.83	.	2.955	0.05874	0.1181:0.1669:0.5375:0.1774	.	788;806	Q9NR97;D1CS70	TLR8_HUMAN;.	N	788;806	ENSP00000218032:D788N;ENSP00000312082:D806N	ENSP00000218032:D788N	D	+	1	0	TLR8	12849442	0.144000	0.22641	0.986000	0.45419	0.904000	0.53231	0.653000	0.24902	1.267000	0.44247	0.600000	0.82982	GAT	.	.		0.443	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24383454	24383454	+	IGR	SNP	G	G	T			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chrX:24383454G>T								AC004552.1 (16431 upstream) : PDK3 (99883 downstream)																							GCGCTGTTCAGATAGTGCAGC	0.562																																					p.Q859H		Atlas-SNP	.											.	.	.	.	0			c.G2577T						.						91.0	79.0	83.0					X																	24383454		1568	3582	5150	SO:0001628	intergenic_variant	100130302	exon1			TGTTCAGATAGTG																													chrX.hg19:g.24383454G>T		74.0	0.0		55.0	19.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.562								
FYB	2533	hgsc.bcm.edu	37	5	39202090	39202091	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr5:39202090_39202091insC	ENST00000351578.6	-	2	1162_1163	c.972_973insG	c.(970-975)gggccafs	p.P325fs	FYB_ENST00000512982.1_Frame_Shift_Ins_p.P325fs|FYB_ENST00000540520.1_Frame_Shift_Ins_p.P335fs|FYB_ENST00000515010.1_Frame_Shift_Ins_p.P325fs|FYB_ENST00000505428.1_Frame_Shift_Ins_p.P325fs	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	325					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.P325A(3)|p.P335A(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TGGCCCCATGGCCCCCCCACTG	0.54																																					p.P335fs		Atlas-INDEL	.											FYB_ENST00000540520,NS,carcinoma,0,12	FYB	354	.	4	Substitution - Missense(4)	kidney(4)	c.1003_1004insG						.																																			SO:0001589	frameshift_variant	2533	exon2			.	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.973dupG	chr5.hg19:g.39202097_39202097dupC	ENSP00000316460:p.Pro325fs	104.0	0.0		108.0	16.0	NM_001243093	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Frame_Shift_Ins	INS	ENST00000351578.6	hg19	CCDS47200.1																																																																																			.	.		0.540	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
KRT2	3849	hgsc.bcm.edu	37	12	53045638	53045639	+	In_Frame_Ins	INS	-	-	AAAGCCGCTGCCGCCTCC			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr12:53045638_53045639insAAAGCCGCTGCCGCCTCC	ENST00000309680.3	-	1	309_310	c.288_289insGGAGGCGGCAGCGGCTTT	c.(286-291)tttgga>tttGGAGGCGGCAGCGGCTTTgga	p.96_97FG>FGGGSGFG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	96	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		ctgccgcctccaaaaccacctc	0.619																																					p.G97delinsGGGSGFG		Atlas-INDEL	.											.	KRT2	94	.	0			c.289_290insGGAGGCGGCAGCGGCTTT						.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.288_289insGGAGGCGGCAGCGGCTTT	chr12.hg19:g.53045638_53045639insAAAGCCGCTGCCGCCTCC	ENSP00000310861:p.Phe96_Gly97insGlyGlyGlySerGlyPhe	132.0	0.0		162.0	59.0	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.		0.619	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
PRKRIR	5612	hgsc.bcm.edu	37	11	76062358	76062362	+	Frame_Shift_Del	DEL	CATGA	CATGA	-			TCGA-DD-AAVQ-01A-11D-A40R-10	TCGA-DD-AAVQ-10A-01D-A40U-10	CATGA	CATGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	909a06f3-3314-45ad-a516-b06af0c953a3	8bb6a3ac-5434-4a1d-952d-273baa389e04	g.chr11:76062358_76062362delCATGA	ENST00000260045.3	-	5	1937_1941	c.1832_1836delTCATG	c.(1831-1836)gtcatgfs	p.VM611fs	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	611					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TGAGTTGTCCCATGACTGAGGGTAC	0.434																																					p.611_613del		Atlas-INDEL	.											.	PRKRIR	65	.	0			c.1833_1837del						.																																			SO:0001589	frameshift_variant	5612	exon5			.	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1832_1836delTCATG	chr11.hg19:g.76062358_76062362delCATGA	ENSP00000260045:p.Val611fs	125.0	0.0		123.0	28.0	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Frame_Shift_Del	DEL	ENST00000260045.3	hg19	CCDS8243.1																																																																																			.	.		0.434	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
