#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
COL16A1	1307	hgsc.bcm.edu	37	1	32131190	32131190	+	Silent	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr1:32131190G>A	ENST00000373672.3	-	55	4002	c.3486C>T	c.(3484-3486)ggC>ggT	p.G1162G	COL16A1_ENST00000271069.6_Silent_p.G1162G	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1162	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCACCGGTGGGCCCGGAAAGC	0.627																																					p.G1162G	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.C3486T						.						79.0	85.0	83.0					1																	32131190		1972	4150	6122	SO:0001819	synonymous_variant	1307	exon55			CGGTGGGCCCGGA	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3486C>T	chr1.hg19:g.32131190G>A		50.0	0.0		52.0	10.0	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	hg19	CCDS41297.1																																																																																			.	.		0.627	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
RBBP4	5928	hgsc.bcm.edu	37	1	33134435	33134435	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr1:33134435C>T	ENST00000373493.5	+	5	739	c.580C>T	c.(580-582)Ctt>Ttt	p.L194F	RBBP4_ENST00000458695.2_Missense_Mutation_p.L159F|RBBP4_ENST00000524393.1_3'UTR|RBBP4_ENST00000373485.1_Missense_Mutation_p.L194F|RBBP4_ENST00000544435.1_5'UTR|RBBP4_ENST00000414241.3_Missense_Mutation_p.L193F	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4	194					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGGGCACTTACTTAGTGCTTC	0.488																																					p.L194F		Atlas-SNP	.											.	RBBP4	38	.	0			c.C580T						.						99.0	88.0	92.0					1																	33134435		2203	4300	6503	SO:0001583	missense	5928	exon5			CACTTACTTAGTG	BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.580C>T	chr1.hg19:g.33134435C>T	ENSP00000362592:p.Leu194Phe	75.0	0.0		78.0	17.0	NM_005610	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Missense_Mutation	SNP	ENST00000373493.5	hg19	CCDS366.1	.	.	.	.	.	.	.	.	.	.	C	33	5.269434	0.95429	.	.	ENSG00000162521	ENST00000414241;ENST00000373493;ENST00000373485;ENST00000458695	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	L	0.38531	1.155	0.80722	D	1	D;D	0.58620	0.983;0.973	P;P	0.62382	0.793;0.901	T	0.68614	-0.5362	10	0.72032	D	0.01	.	19.0691	0.93125	0.0:1.0:0.0:0.0	.	193;194	Q09028-2;Q09028	.;RBBP4_HUMAN	F	193;194;194;159	ENSP00000398242:L193F;ENSP00000362592:L194F;ENSP00000362584:L194F;ENSP00000396057:L159F	ENSP00000362584:L194F	L	+	1	0	RBBP4	32907022	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.761000	0.85260	2.835000	0.97688	0.591000	0.81541	CTT	.	.		0.488	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021957.3	NM_005610	
ASB17	127247	hgsc.bcm.edu	37	1	76397785	76397785	+	Silent	SNP	G	G	A	rs534539433		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr1:76397785G>A	ENST00000284142.6	-	1	331	c.192C>T	c.(190-192)gaC>gaT	p.D64D		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	64					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TGAGTAGTGCGTCAAAACCAT	0.393													G|||	1	0.000199681	0.0	0.0	5008	,	,		18876	0.001		0.0	False		,,,				2504	0.0				p.D64D		Atlas-SNP	.											ASB17,NS,carcinoma,-2,1	ASB17	53	.	0			c.C192T						.						153.0	140.0	144.0					1																	76397785		2203	4300	6503	SO:0001819	synonymous_variant	127247	exon1			TAGTGCGTCAAAA	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.192C>T	chr1.hg19:g.76397785G>A		180.0	0.0		147.0	19.0	NM_080868	B1APB8|Q8N0X5	Silent	SNP	ENST00000284142.6	hg19	CCDS671.1																																																																																			.	.		0.393	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868	
RPL5	6125	hgsc.bcm.edu	37	1	93299205	93299205	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr1:93299205T>A	ENST00000370321.3	+	3	267	c.177T>A	c.(175-177)gaT>gaA	p.D59E		NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5	59					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		CAAACAGAGATATCATTTGTC	0.373																																					p.D59E		Atlas-SNP	.											.,1	RPL5	38	.	0			c.T177A						.						61.0	67.0	65.0					1																	93299205		2203	4300	6503	SO:0001583	missense	6125	exon3			CAGAGATATCATT	U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.177T>A	chr1.hg19:g.93299205T>A	ENSP00000359345:p.Asp59Glu	67.0	0.0		48.0	8.0	NM_000969	Q32LZ3|Q53HH6|Q9H3F4	Missense_Mutation	SNP	ENST00000370321.3	hg19	CCDS741.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186516	0.78789	.	.	ENSG00000122406	ENST00000432788;ENST00000370321;ENST00000315741	T	0.63744	-0.06	4.69	-0.82	0.10826	.	0.000000	0.85682	D	0.000000	T	0.68485	0.3006	H	0.98466	4.24	0.58432	D	0.999999	B	0.31949	0.348	B	0.40256	0.324	T	0.71656	-0.4527	10	0.56958	D	0.05	.	11.3036	0.49320	0.0:0.5127:0.0:0.4873	.	59	P46777	RL5_HUMAN	E	9;59;9	ENSP00000359345:D59E	ENSP00000359338:D9E	D	+	3	2	RPL5	93071793	0.828000	0.29307	0.998000	0.56505	0.917000	0.54804	-0.054000	0.11826	-0.129000	0.11620	-0.366000	0.07423	GAT	.	.		0.373	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030058.2	NM_000969	
BNIPL	149428	hgsc.bcm.edu	37	1	151019153	151019153	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr1:151019153G>C	ENST00000368931.3	+	10	1220	c.1064G>C	c.(1063-1065)gGa>gCa	p.G355A	C1orf56_ENST00000368926.5_5'Flank|BNIPL_ENST00000295294.7_Missense_Mutation_p.G273A	NM_138278.3	NP_612122.2	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein like	355					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|regulation of growth rate (GO:0040009)	cytosol (GO:0005829)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|endometrium(3)|large_intestine(1)|lung(4)|skin(1)	10	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CATGGCTCAGGAGGGACATAG	0.498																																					p.G355A		Atlas-SNP	.											.	BNIPL	45	.	0			c.G1064C						.						120.0	106.0	111.0					1																	151019153		2203	4300	6503	SO:0001583	missense	149428	exon10			GCTCAGGAGGGAC	AF193056	CCDS978.2, CCDS53362.1	1q21.2	2008-02-05			ENSG00000163141	ENSG00000163141			16976	protein-coding gene	gene with protein product		611275				12681488, 11741952	Standard	NM_138278		Approved	BNIPl-1, BNIPL-2, PP753	uc001ewl.2	Q7Z465	OTTHUMG00000035157	ENST00000368931.3:c.1064G>C	chr1.hg19:g.151019153G>C	ENSP00000357927:p.Gly355Ala	101.0	0.0		110.0	29.0	NM_138278	Q6DK43|Q8TCY7|Q8WYG2	Missense_Mutation	SNP	ENST00000368931.3	hg19	CCDS978.2	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004133	0.54254	.	.	ENSG00000163141	ENST00000368931;ENST00000361277;ENST00000295294	T;T;T	0.53640	1.32;1.31;0.61	5.82	3.9	0.45041	.	0.781797	0.11843	N	0.524093	T	0.15132	0.0365	L	0.31664	0.95	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24012	-1.0172	10	0.25751	T	0.34	.	8.7024	0.34334	0.0821:0.1503:0.7676:0.0	.	355	Q7Z465	BNIPL_HUMAN	A	355;353;273	ENSP00000357927:G355A;ENSP00000355333:G353A;ENSP00000295294:G273A	ENSP00000295294:G273A	G	+	2	0	BNIPL	149285777	0.998000	0.40836	0.049000	0.19019	0.685000	0.39939	1.925000	0.40074	0.744000	0.32741	0.655000	0.94253	GGA	.	.		0.498	BNIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085092.1	NM_138279	
PLB1	151056	hgsc.bcm.edu	37	2	28763246	28763246	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:28763246C>T	ENST00000327757.5	+	12	756	c.712C>T	c.(712-714)Ccc>Tcc	p.P238S	PLB1_ENST00000422425.2_Missense_Mutation_p.P249S	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	238	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TGCACCAGAGCCCTGTAATTG	0.592																																					p.P249S		Atlas-SNP	.											.	PLB1	255	.	0			c.C745T						.						56.0	55.0	56.0					2																	28763246		2203	4300	6503	SO:0001583	missense	151056	exon12			CCAGAGCCCTGTA		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.712C>T	chr2.hg19:g.28763246C>T	ENSP00000330442:p.Pro238Ser	45.0	0.0		35.0	10.0	NM_001170585	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	hg19	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	C	1.439	-0.568150	0.03910	.	.	ENSG00000163803	ENST00000327757;ENST00000422425	T;T	0.11169	2.82;2.8	5.03	-10.1	0.00402	.	1.149250	0.06223	N	0.687149	T	0.07143	0.0181	L	0.54323	1.7	0.09310	N	1	B;B	0.25312	0.123;0.002	B;B	0.30572	0.117;0.007	T	0.35525	-0.9785	10	0.09084	T	0.74	-0.1735	2.0119	0.03489	0.3356:0.1103:0.3529:0.2013	.	249;238	Q6P1J6-3;Q6P1J6	.;PLB1_HUMAN	S	238;249	ENSP00000330442:P238S;ENSP00000416440:P249S	ENSP00000330442:P238S	P	+	1	0	PLB1	28616750	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-4.034000	0.00309	-2.450000	0.00543	-1.147000	0.01851	CCC	.	.		0.592	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
FSHR	2492	hgsc.bcm.edu	37	2	49190880	49190880	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:49190880C>A	ENST00000406846.2	-	10	1199	c.1080G>T	c.(1078-1080)atG>atT	p.M360I	FSHR_ENST00000541117.1_Missense_Mutation_p.M96I|FSHR_ENST00000304421.4_Missense_Mutation_p.M334I|FSHR_ENST00000346173.3_Missense_Mutation_p.M298I	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	360					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TGTTGTACCCCATGATATCTT	0.448									Gonadal Dysgenesis, 46 XX																												p.M360I		Atlas-SNP	.											.	FSHR	164	.	0			c.G1080T						.						236.0	201.0	213.0					2																	49190880		2203	4300	6503	SO:0001583	missense	2492	exon10	Familial Cancer Database		GTACCCCATGATA		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1080G>T	chr2.hg19:g.49190880C>A	ENSP00000384708:p.Met360Ile	147.0	0.0		134.0	12.0	NM_000145	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	hg19	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026316	0.75390	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.91219	0.7233	M	0.66439	2.03	0.80722	D	1	D;D;D	0.56287	0.958;0.975;0.958	D;D;D	0.71656	0.943;0.974;0.943	D	0.90361	0.4373	9	.	.	.	.	17.7465	0.88422	0.0:1.0:0.0:0.0	.	334;298;360	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	I	360;298;334;96	ENSP00000384708:M360I;ENSP00000333908:M298I;ENSP00000306780:M334I;ENSP00000444172:M96I	.	M	-	3	0	FSHR	49044384	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.651000	0.83577	2.673000	0.90976	0.561000	0.74099	ATG	.	.		0.448	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
FBLN7	129804	hgsc.bcm.edu	37	2	112922614	112922614	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:112922614G>A	ENST00000331203.2	+	3	543	c.272G>A	c.(271-273)aGa>aAa	p.R91K	FBLN7_ENST00000472377.1_3'UTR|FBLN7_ENST00000409667.3_Missense_Mutation_p.R91K|FBLN7_ENST00000409903.1_Missense_Mutation_p.R91K|FBLN7_ENST00000409450.3_Missense_Mutation_p.R91K	NM_001128165.1|NM_153214.2	NP_001121637.1|NP_694946.2	Q53RD9	FBLN7_HUMAN	fibulin 7	91	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCAGACGGCAGAAAGTTTGGA	0.547																																					p.R91K		Atlas-SNP	.											.	FBLN7	49	.	0			c.G272A						.						70.0	68.0	69.0					2																	112922614		2203	4300	6503	SO:0001583	missense	129804	exon3			ACGGCAGAAAGTT		CCDS2095.1, CCDS46391.1	2q13	2010-06-15			ENSG00000144152	ENSG00000144152		"""Fibulins"""	26740	protein-coding gene	gene with protein product		611551				17699513	Standard	NM_153214		Approved	FLJ37440, TM14	uc002tho.1	Q53RD9	OTTHUMG00000153267	ENST00000331203.2:c.272G>A	chr2.hg19:g.112922614G>A	ENSP00000331411:p.Arg91Lys	103.0	0.0		85.0	25.0	NM_153214	A0JNV1|A0JNV2|Q5H9P5|Q8N9G0	Missense_Mutation	SNP	ENST00000331203.2	hg19	CCDS2095.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.486995	0.44249	.	.	ENSG00000144152	ENST00000331203;ENST00000409903;ENST00000409667;ENST00000409450	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.6	3.7	0.42460	Complement control module (2);Sushi/SCR/CCP (3);	0.288868	0.38111	N	0.001818	T	0.42653	0.1212	L	0.31207	0.915	0.23820	N	0.996753	B;B;B;B	0.17465	0.0;0.003;0.022;0.015	B;B;B;B	0.24974	0.001;0.012;0.032;0.057	T	0.31420	-0.9944	10	0.05959	T	0.93	-16.4405	6.959	0.24587	0.3788:0.0:0.6212:0.0	.	91;91;91;91	Q53RD9-4;Q53RD9-2;Q53RD9;B8ZZC1	.;.;FBLN7_HUMAN;.	K	91	ENSP00000331411:R91K;ENSP00000386295:R91K;ENSP00000386822:R91K;ENSP00000387000:R91K	ENSP00000331411:R91K	R	+	2	0	FBLN7	112639085	0.054000	0.20591	0.868000	0.34077	0.958000	0.62258	0.254000	0.18314	0.641000	0.30601	-0.345000	0.07892	AGA	.	.		0.547	FBLN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330505.1	NM_153214	
BAZ2B	29994	hgsc.bcm.edu	37	2	160269055	160269055	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:160269055C>A	ENST00000392783.2	-	14	2963	c.2468G>T	c.(2467-2469)gGa>gTa	p.G823V	BAZ2B_ENST00000355831.2_Splice_Site_p.G789V|BAZ2B_ENST00000343439.5_Splice_Site_p.G723V|BAZ2B_ENST00000392782.1_Splice_Site_p.G787V	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	823				G -> E (in Ref. 1; BAA89212). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CCACTGCATTCCCTTTTAATT	0.333																																					p.G823V		Atlas-SNP	.											.	BAZ2B	196	.	0			c.G2468T						.						92.0	74.0	79.0					2																	160269055		1817	4071	5888	SO:0001630	splice_region_variant	29994	exon14			TGCATTCCCTTTT	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2467-1G>T	chr2.hg19:g.160269055C>A		76.0	0.0		77.0	15.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452484	0.63290	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.61274	0.16;0.19;0.16;0.12	5.49	5.49	0.81192	Methyl-CpG DNA binding (1);DNA-binding, integrase-type (1);	0.000000	0.36374	U	0.002640	T	0.69975	0.3171	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;1.0;1.0	T	0.72513	-0.4270	10	0.87932	D	0	-8.5924	19.3616	0.94442	0.0:1.0:0.0:0.0	.	627;723;787;823	Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;BAZ2B_HUMAN	V	787;823;789;723	ENSP00000376533:G787V;ENSP00000376534:G823V;ENSP00000348087:G789V;ENSP00000339670:G723V	ENSP00000339670:G723V	G	-	2	0	BAZ2B	159977301	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.362000	0.79507	2.568000	0.86640	0.650000	0.86243	GGA	.	.		0.333	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		Missense_Mutation
XIRP2	129446	hgsc.bcm.edu	37	2	168103526	168103526	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:168103526T>C	ENST00000409195.1	+	9	5713	c.5624T>C	c.(5623-5625)cTt>cCt	p.L1875P	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.L1653P|XIRP2_ENST00000295237.9_Missense_Mutation_p.L1875P|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1700					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTCAAGTCACTTAAAGAATCA	0.383																																					p.L1875P		Atlas-SNP	.											.	XIRP2	914	.	0			c.T5624C						.						80.0	72.0	75.0					2																	168103526		1884	4120	6004	SO:0001583	missense	129446	exon9			AGTCACTTAAAGA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5624T>C	chr2.hg19:g.168103526T>C	ENSP00000386840:p.Leu1875Pro	181.0	0.0		189.0	52.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.298886	0.60195	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.07021	3.24;3.24;3.23	5.46	5.46	0.80206	.	0.131337	0.52532	D	0.000075	T	0.27594	0.0678	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.71870	0.936;0.971;0.975	T	0.00763	-1.1576	10	0.59425	D	0.04	-9.6873	14.8073	0.69968	0.0:0.0:0.0:1.0	.	1700;1700;1653	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	P	1875;1875;1653	ENSP00000386840:L1875P;ENSP00000295237:L1875P;ENSP00000387255:L1653P	ENSP00000295237:L1875P	L	+	2	0	XIRP2	167811772	1.000000	0.71417	0.972000	0.41901	0.946000	0.59487	7.331000	0.79192	2.199000	0.70637	0.528000	0.53228	CTT	.	.		0.383	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
USP40	55230	hgsc.bcm.edu	37	2	234402122	234402122	+	Missense_Mutation	SNP	T	T	C	rs368100283		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:234402122T>C	ENST00000427112.2	-	24	2898	c.2863A>G	c.(2863-2865)Acc>Gcc	p.T955A	USP40_ENST00000450966.1_Missense_Mutation_p.T967A|USP40_ENST00000251722.6_Missense_Mutation_p.T955A|USP40_ENST00000409945.1_Missense_Mutation_p.T131A			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	955					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GTACAGTTGGTCTGGTCCTGA	0.512																																					p.T967A		Atlas-SNP	.											.	USP40	174	.	0			c.A2899G						.	T	ALA/THR	0,3948		0,0,1974	66.0	68.0	67.0		2899	-10.8	0.0	2		67	1,8307		0,1,4153	no	missense	USP40	NM_018218.2	58	0,1,6127	CC,CT,TT		0.012,0.0,0.0082	benign	967/1248	234402122	1,12255	1974	4154	6128	SO:0001583	missense	55230	exon24			AGTTGGTCTGGTC	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2863A>G	chr2.hg19:g.234402122T>C	ENSP00000387898:p.Thr955Ala	183.0	0.0		157.0	35.0	NM_018218	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	hg19	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	T	9.535	1.111763	0.20714	0.0	1.2E-4	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000409945	T;T;T	0.04502	3.61;3.61;3.61	5.77	-10.8	0.00216	.	7739.210000	0.00166	N	0.000000	T	0.02727	0.0082	N	0.22421	0.69	0.09310	N	1	B;B;B	0.19817	0.004;0.001;0.039	B;B;B	0.16289	0.012;0.001;0.015	T	0.34453	-0.9828	10	0.08381	T	0.77	.	8.5971	0.33723	0.1825:0.601:0.103:0.1136	.	967;131;615	Q9NVE5-3;Q9NVE5-2;B4DN96	.;.;.	A	967;955;955;131	ENSP00000415434:T967A;ENSP00000251722:T955A;ENSP00000387898:T955A	ENSP00000251722:T955A	T	-	1	0	USP40	234066861	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-1.169000	0.03120	-2.118000	0.00828	0.459000	0.35465	ACC	.	.		0.512	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
BAP1	8314	hgsc.bcm.edu	37	3	52436363	52436363	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr3:52436363T>A	ENST00000460680.1	-	17	2602	c.2131A>T	c.(2131-2133)Aag>Tag	p.K711*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.K693*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TTCCGCTGCTTGTGGAGCCGG	0.652			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.K711X	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.A2131T						.						20.0	23.0	22.0					3																	52436363		2200	4296	6496	SO:0001587	stop_gained	8314	exon17			GCTGCTTGTGGAG	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.2131A>T	chr3.hg19:g.52436363T>A	ENSP00000417132:p.Lys711*	52.0	0.0		60.0	15.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.012645	0.75161	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000478368	.	.	.	5.52	5.52	0.82312	.	0.045134	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6244	0.76840	0.0:0.0:0.0:1.0	.	.	.	.	X	711;693;235	.	ENSP00000296288:K693X	K	-	1	0	BAP1	52411403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.985000	0.88162	2.093000	0.63338	0.459000	0.35465	AAG	.	.		0.652	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
PHF7	51533	hgsc.bcm.edu	37	3	52442612	52442612	+	5'Flank	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr3:52442612C>T	ENST00000327906.3	+	0	0				BAP1_ENST00000296288.5_Missense_Mutation_p.G45R|BAP1_ENST00000460680.1_Missense_Mutation_p.G45R|PHF7_ENST00000347025.2_5'Flank	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.G45*(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		AAGATAAATCCATATACAGGG	0.493																																					p.G45R		Atlas-SNP	.											BAP1,upper_arm,benign_melanocytic_nevus,0,1	BAP1	371	.	1	Substitution - Nonsense(1)	skin(1)	c.G133A						.						31.0	31.0	31.0					3																	52442612		2203	4299	6502	SO:0001631	upstream_gene_variant	8314	exon4			TAAATCCATATAC	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		chr3.hg19:g.52442612C>T	Exception_encountered	132.0	0.0		111.0	30.0	NM_004656	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	hg19	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	C	35	5.432866	0.96150	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.61510	0.1;0.1	5.43	5.43	0.79202	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.099859	0.64402	D	0.000002	D	0.84999	0.5597	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90012	0.4122	10	0.87932	D	0	-3.095	19.2289	0.93829	0.0:1.0:0.0:0.0	.	45	Q92560	BAP1_HUMAN	R	45	ENSP00000417132:G45R;ENSP00000296288:G45R	ENSP00000296288:G45R	G	-	1	0	BAP1	52417652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.550000	0.86006	0.655000	0.94253	GGA	.	.		0.493	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
CCDC54	84692	hgsc.bcm.edu	37	3	107096716	107096716	+	Silent	SNP	C	C	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr3:107096716C>A	ENST00000261058.1	+	1	529	c.282C>A	c.(280-282)gtC>gtA	p.V94V		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	94										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						TACCAAAAGTCCAGGAAAAGA	0.378																																					p.V94V		Atlas-SNP	.											.	CCDC54	56	.	0			c.C282A						.						72.0	70.0	71.0					3																	107096716		2203	4300	6503	SO:0001819	synonymous_variant	84692	exon1			AAAAGTCCAGGAA	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.282C>A	chr3.hg19:g.107096716C>A		108.0	0.0		118.0	24.0	NM_032600	Q96A43	Silent	SNP	ENST00000261058.1	hg19	CCDS2949.1																																																																																			.	.		0.378	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600	
NDUFB4	4710	hgsc.bcm.edu	37	3	120320137	120320137	+	Intron	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr3:120320137G>A	ENST00000184266.2	+	2	378				NDUFB4_ENST00000492739.1_Intron|NDUFB4_ENST00000485064.1_Silent_p.E120E	NM_004547.5	NP_004538.2	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|large_intestine(1)|lung(3)	5				GBM - Glioblastoma multiforme(114;0.14)		TAGTATTTGAGTGATAGGTTC	0.483																																					p.E120E		Atlas-SNP	.											.	NDUFB4	21	.	0			c.G360A						.						101.0	117.0	112.0					3																	120320137		2203	4296	6499	SO:0001627	intron_variant	4710	exon2			ATTTGAGTGATAG	AF044957	CCDS2999.1, CCDS54630.1	3q13.33	2011-07-04	2002-08-29		ENSG00000065518	ENSG00000065518		"""Mitochondrial respiratory chain complex / Complex I"""	7699	protein-coding gene	gene with protein product	"""complex I B15 subunit"""	603840	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4 (15kD, B15)"""			9878551	Standard	NM_004547		Approved	B15	uc003edu.3	O95168	OTTHUMG00000159442	ENST00000184266.2:c.327+33G>A	chr3.hg19:g.120320137G>A		39.0	0.0		33.0	9.0	NM_001168331	B2RUY3|B9EJC7	Silent	SNP	ENST00000184266.2	hg19	CCDS2999.1																																																																																			.	.		0.483	NDUFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355420.1	NM_004547	
ALG1L	200810	hgsc.bcm.edu	37	3	125648374	125648374	+	Missense_Mutation	SNP	G	G	C	rs200222793		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr3:125648374G>C	ENST00000340333.3	-	6	548	c.385C>G	c.(385-387)Cta>Gta	p.L129V	FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	129							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						AACTGGTTTAGCTTGCCTGCA	0.512																																					p.L149V		Atlas-SNP	.											.	ALG1L	12	.	0			c.C445G						.						42.0	53.0	49.0					3																	125648374		1369	2314	3683	SO:0001583	missense	200810	exon7			GGTTTAGCTTGCC	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.385C>G	chr3.hg19:g.125648374G>C	ENSP00000340009:p.Leu129Val	143.0	0.0		129.0	31.0	NM_001195223	D3DNA5	Missense_Mutation	SNP	ENST00000340333.3	hg19	CCDS33840.1	.	.	.	.	.	.	.	.	.	.	.	13.73	2.323743	0.41096	.	.	ENSG00000189366	ENST00000340333	T	0.73047	-0.71	2.3	2.3	0.28687	.	0.000000	0.64402	D	0.000001	T	0.70544	0.3236	L	0.41236	1.265	0.80722	D	1	D	0.71674	0.998	P	0.62740	0.906	T	0.70382	-0.4887	10	0.72032	D	0.01	-10.2455	5.0245	0.14378	0.1808:0.0:0.8192:0.0	.	129	Q6GMV1	ALG1L_HUMAN	V	129	ENSP00000340009:L129V	ENSP00000340009:L129V	L	-	1	2	ALG1L	127131064	1.000000	0.71417	0.350000	0.25708	0.050000	0.14768	2.710000	0.47169	1.285000	0.44548	0.184000	0.17185	CTA	.	G|0.999;T|0.001		0.512	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356347.1	NM_001015050	
HTT	3064	hgsc.bcm.edu	37	4	3230458	3230458	+	Silent	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr4:3230458T>C	ENST00000355072.5	+	58	8110	c.7965T>C	c.(7963-7965)tcT>tcC	p.S2655S	HTT_ENST00000513806.1_3'UTR	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2655					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CACCCACGTCTCCAGTCAACT	0.493																																					p.S2655S		Atlas-SNP	.											.	HTT	221	.	0			c.T7965C						.						84.0	88.0	87.0					4																	3230458		1992	4173	6165	SO:0001819	synonymous_variant	3064	exon58			CACGTCTCCAGTC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7965T>C	chr4.hg19:g.3230458T>C		102.0	0.0		94.0	15.0	NM_002111	Q9UQB7	Silent	SNP	ENST00000355072.5	hg19	CCDS43206.1																																																																																			.	.		0.493	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
EVC	2121	hgsc.bcm.edu	37	4	5747031	5747031	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr4:5747031A>G	ENST00000264956.6	+	7	1086	c.902A>G	c.(901-903)aAg>aGg	p.K301R	EVC_ENST00000509451.1_Missense_Mutation_p.K301R|EVC_ENST00000382674.2_Missense_Mutation_p.K301R	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	301					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GATGTGGAAAAGAAGGAGAGA	0.433																																					p.K301R		Atlas-SNP	.											.	EVC	90	.	0			c.A902G						.						131.0	128.0	129.0					4																	5747031		2203	4300	6503	SO:0001583	missense	2121	exon7			TGGAAAAGAAGGA	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.902A>G	chr4.hg19:g.5747031A>G	ENSP00000264956:p.Lys301Arg	110.0	0.0		110.0	19.0	NM_153717		Missense_Mutation	SNP	ENST00000264956.6	hg19	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.690075	0.00738	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.41758	0.99;0.99;1.09	5.4	-0.135	0.13477	.	0.225320	0.44902	N	0.000415	T	0.19927	0.0479	N	0.11789	0.175	0.24232	N	0.995391	B	0.06786	0.001	B	0.09377	0.004	T	0.29761	-1.0001	10	0.02654	T	1	.	14.2527	0.66031	0.1562:0.0:0.8438:0.0	.	301	P57679	EVC_HUMAN	R	301	ENSP00000264956:K301R;ENSP00000372120:K301R;ENSP00000426774:K301R	ENSP00000264956:K301R	K	+	2	0	EVC	5797932	1.000000	0.71417	0.600000	0.28864	0.004000	0.04260	0.900000	0.28431	-0.391000	0.07763	-0.385000	0.06624	AAG	.	.		0.433	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
NFXL1	152518	hgsc.bcm.edu	37	4	47850263	47850263	+	Nonsense_Mutation	SNP	G	G	A	rs565045894		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr4:47850263G>A	ENST00000507489.1	-	23	2829	c.2653C>T	c.(2653-2655)Caa>Taa	p.Q885*	NFXL1_ENST00000381538.3_Nonsense_Mutation_p.Q885*	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	885						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TTATGTTTTTGCCATAGTGAT	0.368																																					p.Q885X		Atlas-SNP	.											.	NFXL1	79	.	0			c.C2653T						.						164.0	153.0	157.0					4																	47850263		2203	4300	6503	SO:0001587	stop_gained	152518	exon23			GTTTTTGCCATAG	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2653C>T	chr4.hg19:g.47850263G>A	ENSP00000422037:p.Gln885*	71.0	0.0		71.0	11.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Nonsense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977014	0.74360	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	.	.	.	5.79	4.92	0.64577	.	0.087565	0.48767	D	0.000174	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-17.6633	15.9323	0.79672	0.0:0.0:0.8644:0.1356	.	.	.	.	X	885	.	ENSP00000370949:Q885X	Q	-	1	0	NFXL1	47545020	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	4.502000	0.60400	2.727000	0.93392	0.650000	0.86243	CAA	.	.		0.368	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
GPRIN3	285513	hgsc.bcm.edu	37	4	90170448	90170448	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr4:90170448T>C	ENST00000609438.1	-	2	1332	c.814A>G	c.(814-816)Agc>Ggc	p.S272G	GPRIN3_ENST00000333209.4_Missense_Mutation_p.S272G	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	272										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GAAGGTTCGCTAGTGAGGGGG	0.562																																					p.S272G		Atlas-SNP	.											.	GPRIN3	90	.	0			c.A814G						.						72.0	76.0	75.0					4																	90170448		2203	4300	6503	SO:0001583	missense	285513	exon2			GTTCGCTAGTGAG	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.814A>G	chr4.hg19:g.90170448T>C	ENSP00000476603:p.Ser272Gly	65.0	0.0		52.0	12.0	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	hg19	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	T	7.866	0.727104	0.15439	.	.	ENSG00000185477	ENST00000333209	T	0.11930	2.73	5.64	3.17	0.36434	.	0.000000	0.40385	N	0.001108	T	0.06872	0.0175	N	0.19112	0.55	0.09310	N	1	B	0.32653	0.379	B	0.27170	0.077	T	0.33548	-0.9864	10	0.26408	T	0.33	-5.0071	5.9496	0.19237	0.0:0.1447:0.1396:0.7158	.	272	Q6ZVF9	GRIN3_HUMAN	G	272	ENSP00000328672:S272G	ENSP00000328672:S272G	S	-	1	0	GPRIN3	90389471	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	-0.230000	0.09083	0.535000	0.28714	0.528000	0.53228	AGC	.	.		0.562	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
GATB	5188	hgsc.bcm.edu	37	4	152637251	152637251	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr4:152637251C>T	ENST00000263985.6	-	5	713	c.673G>A	c.(673-675)Gac>Aac	p.D225N	PET112_ENST00000512306.1_Missense_Mutation_p.D225N|PET112_ENST00000515812.1_Intron	NM_004564.2	NP_004555.1												p.D225N(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						CAGGACATGTCGGGCTCCAGG	0.577																																					p.D225N		Atlas-SNP	.											PET112,NS,carcinoma,0,1	PET112	43	.	1	Substitution - Missense(1)	endometrium(1)	c.G673A						.						53.0	49.0	50.0					4																	152637251		2203	4300	6503	SO:0001583	missense	5188	exon5			ACATGTCGGGCTC																												ENST00000263985.6:c.673G>A	chr4.hg19:g.152637251C>T	ENSP00000263985:p.Asp225Asn	138.0	0.0		125.0	22.0	NM_004564		Missense_Mutation	SNP	ENST00000263985.6	hg19	CCDS3776.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828700	0.90955	.	.	ENSG00000059691	ENST00000263985;ENST00000512306	T;T	0.53857	0.6;0.65	5.22	5.22	0.72569	Aspartyl/Glutamyl-tRNA(Gln) amidotransferase, subunit B/E, catalytic (1);	0.100907	0.64402	D	0.000003	T	0.78317	0.4264	H	0.94264	3.515	0.80722	D	1	D;D	0.67145	0.994;0.996	P;P	0.58780	0.671;0.845	D	0.85507	0.1195	10	0.87932	D	0	-23.6428	18.7623	0.91856	0.0:1.0:0.0:0.0	.	225;225	D6RDU9;O75879	.;GATB_HUMAN	N	225	ENSP00000263985:D225N;ENSP00000420831:D225N	ENSP00000263985:D225N	D	-	1	0	PET112	152856701	1.000000	0.71417	0.776000	0.31678	0.889000	0.51656	5.989000	0.70587	2.422000	0.82143	0.655000	0.94253	GAC	.	.		0.577	PET112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365671.1		
GFM2	84340	hgsc.bcm.edu	37	5	74018369	74018369	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr5:74018369A>C	ENST00000296805.3	-	20	2503	c.2046T>G	c.(2044-2046)gaT>gaG	p.D682E	RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000515125.1_5'UTR|GFM2_ENST00000509430.1_Missense_Mutation_p.D682E|GFM2_ENST00000345239.2_Missense_Mutation_p.D635E	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		AAACTTGCTTATCAGCTTTCT	0.358																																					p.D682E		Atlas-SNP	.											.	GFM2	38	.	0			c.T2046G						.						80.0	81.0	81.0					5																	74018369		2203	4300	6503	SO:0001583	missense	84340	exon20			TTGCTTATCAGCT	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.2046T>G	chr5.hg19:g.74018369A>C	ENSP00000296805:p.Asp682Glu	105.0	0.0		109.0	18.0	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	hg19	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	A	10.32	1.317325	0.23908	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000509430	T;T;T	0.41758	0.99;0.99;0.99	5.96	-4.28	0.03732	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Translation elongation factor EFG/EF2, C-terminal (1);	0.198488	0.56097	N	0.000039	T	0.20659	0.0497	N	0.17082	0.46	0.80722	D	1	B;B;B	0.21071	0.003;0.051;0.003	B;B;B	0.18871	0.006;0.023;0.01	T	0.01182	-1.1426	10	0.51188	T	0.08	-11.5008	8.4158	0.32670	0.2843:0.294:0.4217:0.0	.	680;635;682	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	E	682;635;682	ENSP00000296805:D682E;ENSP00000296804:D635E;ENSP00000427004:D682E	ENSP00000296805:D682E	D	-	3	2	GFM2	74054125	0.275000	0.24201	0.905000	0.35620	0.854000	0.48673	-0.305000	0.08188	-0.627000	0.05589	-0.297000	0.09499	GAT	.	.		0.358	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
SH3PXD2B	285590	hgsc.bcm.edu	37	5	171766054	171766054	+	Silent	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr5:171766054G>A	ENST00000311601.5	-	13	2225	c.2055C>T	c.(2053-2055)ggC>ggT	p.G685G	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	685					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTGCCTGGGGGCCCTCCCCAT	0.642																																					p.G685G		Atlas-SNP	.											.	SH3PXD2B	91	.	0			c.C2055T						.						60.0	58.0	58.0					5																	171766054		2203	4300	6503	SO:0001819	synonymous_variant	285590	exon13			CTGGGGGCCCTCC	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2055C>T	chr5.hg19:g.171766054G>A		71.0	0.0		96.0	16.0	NM_001017995	B6F0V2|Q9P2Q1	Silent	SNP	ENST00000311601.5	hg19	CCDS34291.1																																																																																			.	.		0.642	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
HIST1H4C	8364	hgsc.bcm.edu	37	6	26104199	26104199	+	Silent	SNP	A	A	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr6:26104199A>T	ENST00000377803.2	+	1	96	c.24A>T	c.(22-24)ggA>ggT	p.G8G		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	8					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GCAAAGGCGGAAAAGGCTTGG	0.517																																					p.G8G		Atlas-SNP	.											.	HIST1H4C	14	.	0			c.A24T						.						56.0	57.0	56.0					6																	26104199		2203	4300	6503	SO:0001819	synonymous_variant	8364	exon1			AGGCGGAAAAGGC	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.24A>T	chr6.hg19:g.26104199A>T		77.0	0.0		93.0	11.0	NM_003542	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000377803.2	hg19	CCDS4583.1																																																																																			.	.		0.517	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542	
DPCR1	135656	hgsc.bcm.edu	37	6	30920202	30920202	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr6:30920202C>T	ENST00000462446.1	+	2	3989	c.3961C>T	c.(3961-3963)Cct>Tct	p.P1321S	DPCR1_ENST00000304311.2_Missense_Mutation_p.P163S|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	445						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						TGATTCATTCCCTGCATGGGC	0.502																																					p.P1321S		Atlas-SNP	.											.	DPCR1	99	.	0			c.C3961T						.						100.0	76.0	84.0					6																	30920202		2203	4300	6503	SO:0001583	missense	135656	exon2			TCATTCCCTGCAT	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3961C>T	chr6.hg19:g.30920202C>T	ENSP00000417182:p.Pro1321Ser	91.0	0.0		107.0	15.0	NM_080870	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	hg19	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141384	0.57044	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.70516	-0.21;-0.49	3.78	3.78	0.43462	.	.	.	.	.	T	0.72676	0.3490	L	0.52573	1.65	0.33012	D	0.527678	D	0.89917	1.0	D	0.91635	0.999	T	0.73531	-0.3953	9	0.87932	D	0	-13.4067	11.2912	0.49252	0.0:1.0:0.0:0.0	.	1321	E9PEI6	.	S	1321;445;163	ENSP00000417182:P1321S;ENSP00000305948:P163S	ENSP00000305948:P163S	P	+	1	0	DPCR1	31028181	0.419000	0.25449	0.994000	0.49952	0.922000	0.55478	1.884000	0.39668	2.075000	0.62263	0.551000	0.68910	CCT	.	.		0.502	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
UBR2	23304	hgsc.bcm.edu	37	6	42637952	42637952	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr6:42637952G>A	ENST00000372899.1	+	35	4262	c.4004G>A	c.(4003-4005)aGc>aAc	p.S1335N	UBR2_ENST00000372883.3_3'UTR|UBR2_ENST00000372901.1_Missense_Mutation_p.S1335N	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1335					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGTTGGGGTAGCTGCGCGTAC	0.408																																					p.S1335N		Atlas-SNP	.											.	UBR2	134	.	0			c.G4004A						.						141.0	120.0	127.0					6																	42637952		2203	4300	6503	SO:0001583	missense	23304	exon35			GGGGTAGCTGCGC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.4004G>A	chr6.hg19:g.42637952G>A	ENSP00000361990:p.Ser1335Asn	152.0	0.0		201.0	27.0	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	hg19	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.503097	0.64298	.	.	ENSG00000024048	ENST00000372899;ENST00000372901	T;T	0.58797	0.31;0.31	5.36	4.47	0.54385	.	0.134335	0.64402	D	0.000002	T	0.46737	0.1408	M	0.65498	2.005	0.80722	D	1	P;P	0.40660	0.694;0.726	B;B	0.40864	0.281;0.342	T	0.52335	-0.8589	10	0.45353	T	0.12	-28.1992	15.6784	0.77349	0.0:0.1422:0.8578:0.0	.	1335;1335	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	N	1335	ENSP00000361990:S1335N;ENSP00000361992:S1335N	ENSP00000361990:S1335N	S	+	2	0	UBR2	42745930	1.000000	0.71417	0.959000	0.39883	0.934000	0.57294	6.026000	0.70873	1.215000	0.43411	0.655000	0.94253	AGC	.	.		0.408	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
KLHL32	114792	hgsc.bcm.edu	37	6	97561870	97561870	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr6:97561870G>T	ENST00000369261.4	+	7	1202	c.839G>T	c.(838-840)cGc>cTc	p.R280L	KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.R211L|KLHL32_ENST00000536676.1_Missense_Mutation_p.R244L	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	280										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TGGCAGACTCGCAGGACCAAA	0.527																																					p.R280L		Atlas-SNP	.											.	KLHL32	85	.	0			c.G839T						.						94.0	80.0	85.0					6																	97561870		2203	4300	6503	SO:0001583	missense	114792	exon7			AGACTCGCAGGAC	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.839G>T	chr6.hg19:g.97561870G>T	ENSP00000358265:p.Arg280Leu	152.0	0.0		130.0	23.0	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	hg19	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753878	0.31046	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.73258	-0.69;-0.71;-0.73	5.5	5.5	0.81552	.	0.560131	0.20386	N	0.093355	T	0.45617	0.1351	L	0.46157	1.445	0.36971	D	0.893828	B;B;B;B	0.06786	0.0;0.001;0.0;0.001	B;B;B;B	0.09377	0.001;0.001;0.0;0.004	T	0.27839	-1.0062	10	0.13853	T	0.58	.	11.5958	0.50972	0.0:0.1331:0.7291:0.1379	.	211;244;280;280	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	L	280;244;211	ENSP00000358265:R280L;ENSP00000440382:R244L;ENSP00000441527:R211L	ENSP00000358265:R280L	R	+	2	0	KLHL32	97668591	0.149000	0.22717	0.962000	0.40283	0.945000	0.59286	2.087000	0.41653	2.854000	0.98071	0.655000	0.94253	CGC	.	.		0.527	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
SCIN	85477	hgsc.bcm.edu	37	7	12610443	12610443	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr7:12610443G>T	ENST00000297029.5	+	1	132	c.31G>T	c.(31-33)Gcc>Tcc	p.A11S	AC005281.2_ENST00000433040.1_RNA	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	11	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CGAAGAGTTCGCCCGGGCGGG	0.652																																					p.A11S		Atlas-SNP	.											.	SCIN	105	.	0			c.G31T						.						16.0	25.0	22.0					7																	12610443		692	1590	2282	SO:0001583	missense	85477	exon1			GAGTTCGCCCGGG	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.31G>T	chr7.hg19:g.12610443G>T	ENSP00000297029:p.Ala11Ser	77.0	0.0		84.0	12.0	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	hg19	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	6.796	0.515941	0.12944	.	.	ENSG00000006747	ENST00000297029;ENST00000417018	T;T	0.17213	2.29;2.29	4.89	3.04	0.35103	.	0.309943	0.28130	N	0.016482	T	0.09468	0.0233	N	0.16790	0.44	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.14783	-1.0460	10	0.10111	T	0.7	-6.9749	11.3956	0.49841	0.0:0.1476:0.7154:0.137	.	11	Q9Y6U3	ADSV_HUMAN	S	11	ENSP00000297029:A11S;ENSP00000404380:A11S	ENSP00000297029:A11S	A	+	1	0	SCIN	12576968	0.818000	0.29161	0.264000	0.24511	0.007000	0.05969	2.267000	0.43329	0.619000	0.30197	-0.321000	0.08615	GCC	.	.		0.652	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
SP8	221833	hgsc.bcm.edu	37	7	20825271	20825271	+	Silent	SNP	C	C	A	rs145875827		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr7:20825271C>A	ENST00000361443.4	-	3	348	c.111G>T	c.(109-111)tcG>tcT	p.S37S	SP8_ENST00000418710.2_Silent_p.S55S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	37	Ser-rich.				dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						AAGAAGAGGACGAGGAGCGTT	0.632																																					p.S55S		Atlas-SNP	.											.	SP8	43	.	0			c.G165T						.						46.0	47.0	47.0					7																	20825271		2203	4300	6503	SO:0001819	synonymous_variant	221833	exon2			AGAGGACGAGGAG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.111G>T	chr7.hg19:g.20825271C>A		88.0	0.0		77.0	14.0	NM_182700	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	hg19	CCDS5372.1																																																																																			.	C|1.000;T|0.000		0.632	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
ELN	2006	hgsc.bcm.edu	37	7	73452038	73452038	+	Splice_Site	SNP	G	G	A	rs376512299		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr7:73452038G>A	ENST00000252034.7	+	4	564	c.165G>A	c.(163-165)gcG>gcA	p.A55A	ELN_ENST00000358929.4_Splice_Site_p.A55A|ELN_ENST00000380575.4_Splice_Site_p.A45A|ELN_ENST00000445912.1_Splice_Site_p.A55A|ELN_ENST00000380562.4_Splice_Site_p.A55A|ELN_ENST00000380576.5_Splice_Site_p.A55A|ELN_ENST00000320399.6_Splice_Site_p.A55A|ELN_ENST00000357036.5_Splice_Site_p.A55A|ELN_ENST00000458204.1_Splice_Site_p.A45A|ELN_ENST00000320492.7_Splice_Site_p.A55A|ELN_ENST00000414324.1_Splice_Site_p.A45A|ELN_ENST00000380553.4_Splice_Site_p.A55A|ELN_ENST00000380584.4_Splice_Site_p.A55A|ELN_ENST00000429192.1_Splice_Site_p.A55A	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	55					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)	p.A55A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CCTCTGCAGCGCTGGGGCCTG	0.587			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.A55A		Atlas-SNP	.		Dom	yes		7	7q11.23	2006	elastin	yes	L	ELN,NS,haematopoietic_neoplasm,0,1	ELN	81	.	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.G165A						.	A	,,,,	3,4403	6.2+/-15.9	0,3,2200	86.0	63.0	71.0		165,135,165,165,165	-10.3	0.0	7		71	0,8600		0,0,4300	no	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	ELN	NM_000501.2,NM_001081752.1,NM_001081753.1,NM_001081754.1,NM_001081755.1	,,,,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,,,,	55/725,45/678,55/693,55/712,55/706	73452038	3,13003	2203	4300	6503	SO:0001630	splice_region_variant	2006	exon4			TGCAGCGCTGGGG		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.164-1G>A	chr7.hg19:g.73452038G>A		80.0	0.0		100.0	24.0	NM_001081753	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	hg19	CCDS5562.2																																																																																			.	.		0.587	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	Silent
ZNF804B	219578	hgsc.bcm.edu	37	7	88963559	88963559	+	Silent	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr7:88963559C>T	ENST00000333190.4	+	4	1872	c.1263C>T	c.(1261-1263)agC>agT	p.S421S		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	421							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAAGAGTTAGCAAAAATGTTC	0.388										HNSCC(36;0.09)																											p.S421S		Atlas-SNP	.											.	ZNF804B	322	.	0			c.C1263T						.						52.0	55.0	54.0					7																	88963559		2203	4300	6503	SO:0001819	synonymous_variant	219578	exon4			AGTTAGCAAAAAT	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1263C>T	chr7.hg19:g.88963559C>T		86.0	0.0		85.0	17.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	hg19	CCDS5613.1																																																																																			.	.		0.388	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
TRPS1	7227	hgsc.bcm.edu	37	8	116426762	116426762	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr8:116426762C>T	ENST00000220888.5	-	6	3494	c.3335G>A	c.(3334-3336)cGg>cAg	p.R1112Q	TRPS1_ENST00000520276.1_Missense_Mutation_p.R1116Q|TRPS1_ENST00000519076.1_Missense_Mutation_p.R866Q|TRPS1_ENST00000395715.3_Missense_Mutation_p.R1125Q			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1112	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ACTCCAGAACCGCAGCCAATC	0.468									Langer-Giedion syndrome																												p.R1125Q		Atlas-SNP	.											TRPS1_ENST00000395715,caecum,carcinoma,0,4	TRPS1	516	.	0			c.G3374A						.						94.0	92.0	93.0					8																	116426762		1911	4131	6042	SO:0001583	missense	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	CAGAACCGCAGCC	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3335G>A	chr8.hg19:g.116426762C>T	ENSP00000220888:p.Arg1112Gln	163.0	0.0		214.0	35.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	C	23.7	4.445419	0.84101	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D;D;D;D	0.99311	-5.73;-5.71;-5.59;-5.71	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.98817	0.9601	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.992;0.996	D	0.99945	1.1458	10	0.87932	D	0	.	19.865	0.96801	0.0:1.0:0.0:0.0	.	1116;1112;1125	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	Q	1125;1112;866;1116	ENSP00000379065:R1125Q;ENSP00000220888:R1112Q;ENSP00000428910:R866Q;ENSP00000428680:R1116Q	ENSP00000220888:R1112Q	R	-	2	0	TRPS1	116495938	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.622000	0.83099	2.685000	0.91497	0.655000	0.94253	CGG	.	.		0.468	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
TMEM245	23731	hgsc.bcm.edu	37	9	111882014	111882014	+	Silent	SNP	C	C	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr9:111882014C>A	ENST00000374586.3	-	1	211	c.180G>T	c.(178-180)gtG>gtT	p.V60V		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	60						integral component of membrane (GO:0016021)											ACACGAACAGCACGGCCCCGG	0.692																																					p.V60V		Atlas-SNP	.											.	.	.	.	0			c.G180T						.						10.0	17.0	15.0					9																	111882014		1987	4143	6130	SO:0001819	synonymous_variant	23731	exon1			GAACAGCACGGCC	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.180G>T	chr9.hg19:g.111882014C>A		49.0	0.0		45.0	16.0	NM_032012	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Silent	SNP	ENST00000374586.3	hg19	CCDS43858.1																																																																																			.	.		0.692	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
SETX	23064	hgsc.bcm.edu	37	9	135205038	135205038	+	Silent	SNP	T	T	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr9:135205038T>G	ENST00000224140.5	-	10	2129	c.1947A>C	c.(1945-1947)ccA>ccC	p.P649P	SETX_ENST00000393220.1_Silent_p.P649P|SETX_ENST00000372169.2_Silent_p.P649P	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	649					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GCACTTTCATTGGTTCTTTAG	0.353																																					p.P649P		Atlas-SNP	.											.	SETX	234	.	0			c.A1947C						.						99.0	95.0	96.0					9																	135205038		2203	4300	6503	SO:0001819	synonymous_variant	23064	exon10			TTTCATTGGTTCT	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1947A>C	chr9.hg19:g.135205038T>G		62.0	0.0		68.0	12.0	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	ENST00000224140.5	hg19	CCDS6947.1																																																																																			.	.		0.353	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
CFAP46	54777	hgsc.bcm.edu	37	10	134713078	134713078	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr10:134713078A>T	ENST00000368586.5	-	23	3117	c.3017T>A	c.(3016-3018)cTg>cAg	p.L1006Q	TTC40_ENST00000368582.2_Missense_Mutation_p.L1006Q	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CACCAGTCGCAGCTGCTTCCG	0.672																																					p.L1006Q		Atlas-SNP	.											.	TTC40	100	.	0			c.T3017A						.																																			SO:0001583	missense	54777	exon23			AGTCGCAGCTGCT																												ENST00000368586.5:c.3017T>A	chr10.hg19:g.134713078A>T	ENSP00000357575:p.Leu1006Gln	76.0	0.0		98.0	27.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.944398	0.53079	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.77877	-1.13;-1.13	3.58	3.58	0.41010	.	.	.	.	.	D	0.83298	0.5224	.	.	.	0.22787	N	0.998738	D	0.61080	0.989	P	0.61003	0.882	T	0.72411	-0.4302	8	0.72032	D	0.01	.	8.7662	0.34704	1.0:0.0:0.0:0.0	.	1006	Q5SR76	CJ093_HUMAN	Q	1006	ENSP00000357575:L1006Q;ENSP00000357571:L1006Q	ENSP00000357571:L1006Q	L	-	2	0	C10orf93	134563068	0.975000	0.34042	0.972000	0.41901	0.673000	0.39480	0.796000	0.26986	1.648000	0.50643	0.379000	0.24179	CTG	.	.		0.672	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
MUC2	4583	hgsc.bcm.edu	37	11	1093075	1093075	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr11:1093075A>G	ENST00000441003.2	+	30	4921	c.4894A>G	c.(4894-4896)Atc>Gtc	p.I1632V	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.I1599V	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cccaacagccatcaccaccac	0.632																																					p.I1632V		Atlas-SNP	.											.	MUC2	614	.	0			c.A4894G						.						100.0	149.0	132.0					11																	1093075		1865	3567	5432	SO:0001583	missense	4583	exon30			ACAGCCATCACCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4894A>G	chr11.hg19:g.1093075A>G	ENSP00000415183:p.Ile1632Val	28.0	0.0		21.0	4.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	A	0.873	-0.731385	0.03135	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.12255	2.7;3.0	0.703	0.703	0.18116	.	.	.	.	.	T	0.04137	0.0115	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.01281	0.0	T	0.43766	-0.9371	8	0.02654	T	1	.	3.7866	0.08703	1.0:0.0:0.0:0.0	.	1632	E7EUV1	.	V	1632;1599	ENSP00000415183:I1632V;ENSP00000351956:I1599V	ENSP00000351956:I1599V	I	+	1	0	MUC2	1083075	0.000000	0.05858	0.003000	0.11579	0.018000	0.09664	0.316000	0.19469	0.571000	0.29365	0.102000	0.15555	ATC	.	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR4A47	403253	hgsc.bcm.edu	37	11	48510973	48510973	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr11:48510973T>A	ENST00000446524.1	+	1	705	c.629T>A	c.(628-630)cTg>cAg	p.L210Q		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						ATTGTGTTTCTGCTCTTACTC	0.463																																					p.L210Q		Atlas-SNP	.											.	OR4A47	72	.	0			c.T629A						.						105.0	101.0	103.0					11																	48510973		2201	4298	6499	SO:0001583	missense	403253	exon1			TGTTTCTGCTCTT	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.629T>A	chr11.hg19:g.48510973T>A	ENSP00000412752:p.Leu210Gln	84.0	0.0		85.0	20.0	NM_001005512		Missense_Mutation	SNP	ENST00000446524.1	hg19	CCDS31490.1	.	.	.	.	.	.	.	.	.	.	N	12.73	2.024773	0.35701	.	.	ENSG00000237388	ENST00000446524	T	0.44881	0.91	4.59	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.792028	0.10645	N	0.650501	T	0.69984	0.3172	H	0.96633	3.855	0.09310	N	1	D	0.53745	0.962	P	0.61003	0.882	T	0.58967	-0.7542	10	0.72032	D	0.01	.	4.9005	0.13771	0.0:0.1002:0.1868:0.7129	.	210	Q6IF82	O4A47_HUMAN	Q	210	ENSP00000412752:L210Q	ENSP00000412752:L210Q	L	+	2	0	OR4A47	48467549	0.000000	0.05858	0.155000	0.22561	0.765000	0.43378	0.331000	0.19733	0.599000	0.29845	0.172000	0.16884	CTG	.	.		0.463	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512	
OR4D6	219983	hgsc.bcm.edu	37	11	59224678	59224678	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr11:59224678T>A	ENST00000300127.2	+	1	268	c.245T>A	c.(244-246)cTg>cAg	p.L82Q		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						CCCAAGTTCCTGGTGGATCTT	0.453																																					p.L82Q		Atlas-SNP	.											.	OR4D6	65	.	0			c.T245A						.						137.0	126.0	130.0					11																	59224678		2201	4295	6496	SO:0001583	missense	219983	exon1			AGTTCCTGGTGGA	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.245T>A	chr11.hg19:g.59224678T>A	ENSP00000300127:p.Leu82Gln	143.0	0.0		125.0	34.0	NM_001004708	B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	hg19	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.380000	0.82682	.	.	ENSG00000166884	ENST00000300127	T	0.00433	7.43	6.01	6.01	0.97437	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41938	D	0.000782	T	0.02342	0.0072	H	0.97186	3.955	0.38690	D	0.952741	D	0.89917	1.0	D	0.85130	0.997	T	0.06625	-1.0816	10	0.87932	D	0	-8.9509	15.3555	0.74423	0.0:0.0:0.0:1.0	.	82	Q8NGJ1	OR4D6_HUMAN	Q	82	ENSP00000300127:L82Q	ENSP00000300127:L82Q	L	+	2	0	OR4D6	58981254	0.947000	0.32204	1.000000	0.80357	0.968000	0.65278	6.293000	0.72731	2.299000	0.77371	0.533000	0.62120	CTG	.	.		0.453	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708	
MAP4K2	5871	hgsc.bcm.edu	37	11	64568236	64568236	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr11:64568236C>A	ENST00000294066.2	-	10	816	c.725G>T	c.(724-726)tGg>tTg	p.W242L	MAP4K2_ENST00000377350.3_Splice_Site_p.W242L|MAP4K2_ENST00000468062.1_5'UTR	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						TGGCCCTTACCAGCGAGTCTT	0.637																																					p.W242L		Atlas-SNP	.											.	MAP4K2	83	.	0			c.G725T						.						26.0	22.0	23.0					11																	64568236		2198	4295	6493	SO:0001630	splice_region_variant	5871	exon10			CCTTACCAGCGAG	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.725+1G>T	chr11.hg19:g.64568236C>A		35.0	0.0		37.0	13.0	NM_004579	Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	hg19	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721659	0.68959	.	.	ENSG00000168067	ENST00000294066;ENST00000377350;ENST00000439069	T;T;T	0.20332	2.08;2.08;2.08	4.66	4.66	0.58398	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.29684	0.0741	N	0.17838	0.53	0.80722	D	1	P;D	0.64830	0.931;0.994	P;D	0.71870	0.782;0.975	T	0.04373	-1.0956	9	.	.	.	.	15.4664	0.75403	0.0:1.0:0.0:0.0	.	242;242	Q86VU3;Q12851	.;M4K2_HUMAN	L	242;242;198	ENSP00000294066:W242L;ENSP00000366567:W242L;ENSP00000403563:W198L	.	W	-	2	0	MAP4K2	64324812	1.000000	0.71417	0.997000	0.53966	0.259000	0.26198	7.331000	0.79192	2.332000	0.79248	0.456000	0.33151	TGG	.	.		0.637	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	Missense_Mutation
OVOL1	5017	hgsc.bcm.edu	37	11	65562094	65562094	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr11:65562094G>A	ENST00000335987.3	+	3	756	c.404G>A	c.(403-405)cGc>cAc	p.R135H	RP11-770G2.5_ENST00000531155.1_RNA|OVOL1_ENST00000532448.1_Missense_Mutation_p.R73H	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1	135					cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		ATGCTGAACCGCCACATGAAG	0.587																																					p.R135H		Atlas-SNP	.											.	OVOL1	15	.	0			c.G404A						.						127.0	94.0	105.0					11																	65562094		2201	4297	6498	SO:0001583	missense	5017	exon3			TGAACCGCCACAT	BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.404G>A	chr11.hg19:g.65562094G>A	ENSP00000337862:p.Arg135His	79.0	0.0		85.0	22.0	NM_004561	Q6PCB1	Missense_Mutation	SNP	ENST00000335987.3	hg19	CCDS8112.1	.	.	.	.	.	.	.	.	.	.	G	36	5.639352	0.96693	.	.	ENSG00000172818	ENST00000335987;ENST00000532448	T;T	0.26810	1.71;1.71	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.081121	0.52532	D	0.000075	T	0.44582	0.1300	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.27773	-1.0064	10	0.48119	T	0.1	-37.3183	15.7757	0.78214	0.0:0.0:1.0:0.0	.	135	O14753	OVOL1_HUMAN	H	135;73	ENSP00000337862:R135H;ENSP00000434220:R73H	ENSP00000337862:R135H	R	+	2	0	OVOL1	65318670	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	9.780000	0.99024	2.313000	0.78055	0.561000	0.74099	CGC	.	.		0.587	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390690.1	NM_004561	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103026161	103026161	+	Silent	SNP	A	A	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr11:103026161A>G	ENST00000375735.2	+	25	3819	c.3675A>G	c.(3673-3675)ctA>ctG	p.L1225L	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Silent_p.L1225L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1225	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGACTAGTCTAGAGAAACTAC	0.413																																					p.L1225L		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.A3675G						.						83.0	82.0	82.0					11																	103026161		1831	4083	5914	SO:0001819	synonymous_variant	79659	exon25			TAGTCTAGAGAAA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3675A>G	chr11.hg19:g.103026161A>G		119.0	0.0		134.0	28.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	hg19	CCDS53701.1																																																																																			.	.		0.413	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ARID2	196528	hgsc.bcm.edu	37	12	46231303	46231303	+	Silent	SNP	T	T	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr12:46231303T>G	ENST00000334344.6	+	10	1315	c.1143T>G	c.(1141-1143)ctT>ctG	p.L381L	ARID2_ENST00000444670.1_Silent_p.L10L|ARID2_ENST00000422737.1_Silent_p.L232L|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	381					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TGGGAAATCTTTGCAAAGCAG	0.323			"""N, S, F"""		hepatocellular carcinoma																																p.L381L		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.T1143G						.						100.0	98.0	99.0					12																	46231303		2203	4300	6503	SO:0001819	synonymous_variant	196528	exon10			AAATCTTTGCAAA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1143T>G	chr12.hg19:g.46231303T>G		105.0	0.0		112.0	26.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.		0.323	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
COL2A1	1280	hgsc.bcm.edu	37	12	48376330	48376330	+	Silent	SNP	A	A	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr12:48376330A>C	ENST00000380518.3	-	34	2420	c.2256T>G	c.(2254-2256)ccT>ccG	p.P752P	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Silent_p.P683P	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	752	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCCTCTCGCCAGGCATTCCCT	0.627																																					p.P752P		Atlas-SNP	.											.	COL2A1	368	.	0			c.T2256G						.						36.0	37.0	37.0					12																	48376330		2203	4300	6503	SO:0001819	synonymous_variant	1280	exon34			CTCGCCAGGCATT	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.2256T>G	chr12.hg19:g.48376330A>C		94.0	0.0		66.0	18.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Silent	SNP	ENST00000380518.3	hg19	CCDS41778.1																																																																																			.	.		0.627	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
CS	1431	hgsc.bcm.edu	37	12	56669864	56669864	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr12:56669864T>C	ENST00000351328.3	-	7	894	c.704A>G	c.(703-705)gAc>gGc	p.D235G	CS_ENST00000548567.1_Missense_Mutation_p.D169G|CS_ENST00000542324.2_Missense_Mutation_p.D222G	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	235					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		GTGAGACCAGTCCAGGTTAGA	0.483																																					p.D235G		Atlas-SNP	.											.	CS	44	.	0			c.A704G						.						157.0	129.0	139.0					12																	56669864		2203	4300	6503	SO:0001583	missense	1431	exon7			GACCAGTCCAGGT		CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.704A>G	chr12.hg19:g.56669864T>C	ENSP00000342056:p.Asp235Gly	122.0	0.0		102.0	25.0	NM_004077	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Missense_Mutation	SNP	ENST00000351328.3	hg19	CCDS8913.1	.	.	.	.	.	.	.	.	.	.	T	29.6	5.022699	0.93462	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000542324	.	.	.	5.41	5.41	0.78517	Citrate synthase-like, large alpha subdomain (1);Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	D	0.83649	0.5300	M	0.88842	2.985	0.80722	D	1	D;D;D;D	0.65815	0.98;0.995;0.995;0.995	P;D;D;D	0.68943	0.897;0.961;0.93;0.961	D	0.87020	0.2128	9	0.87932	D	0	-23.7983	14.7325	0.69393	0.0:0.0:0.0:1.0	.	169;222;190;235	B7Z1E1;B4DJV2;B3KTN4;O75390	.;.;.;CISY_HUMAN	G	169;235;222	.	ENSP00000342056:D235G	D	-	2	0	CS	54956131	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.725000	0.84808	2.184000	0.69523	0.454000	0.30748	GAC	.	.		0.483	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
METAP2	10988	hgsc.bcm.edu	37	12	95867960	95867960	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr12:95867960C>T	ENST00000323666.5	+	1	234	c.5C>T	c.(4-6)gCg>gTg	p.A2V	METAP2_ENST00000551840.1_Missense_Mutation_p.A2V|METAP2_ENST00000550777.1_Missense_Mutation_p.A2V|METAP2_ENST00000261220.9_Missense_Mutation_p.A2V|METAP2_ENST00000546753.1_Missense_Mutation_p.A2V	NM_006838.3	NP_006829.1			methionyl aminopeptidase 2											endometrium(3)|large_intestine(2)|lung(7)|prostate(1)	13						GGCAACATGGCGGGTGTGGAG	0.657																																					p.A2V		Atlas-SNP	.											.	METAP2	28	.	0			c.C5T						.						33.0	41.0	38.0					12																	95867960		2201	4297	6498	SO:0001583	missense	10988	exon1			ACATGGCGGGTGT	U13261	CCDS9052.1	12q22	2014-09-04			ENSG00000111142		3.4.11.18		16672	protein-coding gene	gene with protein product	"""Peptidase M"""	601870				7644482, 8858118	Standard	NM_006838		Approved	MNPEP, p67, MAP2	uc001tec.3	P50579	OTTHUMG00000170280	ENST00000323666.5:c.5C>T	chr12.hg19:g.95867960C>T	ENSP00000325312:p.Ala2Val	147.0	0.0		163.0	32.0	NM_006838		Missense_Mutation	SNP	ENST00000323666.5	hg19	CCDS9052.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764262	0.89932	.	.	ENSG00000111142	ENST00000323666;ENST00000546753;ENST00000261220;ENST00000549502;ENST00000553151;ENST00000550777;ENST00000551840	.	.	.	5.19	4.28	0.50868	.	0.116232	0.56097	D	0.000022	T	0.50411	0.1614	N	0.08118	0	0.37963	D	0.93302	B;D;D;D;D	0.76494	0.064;0.976;0.999;0.999;0.999	B;D;D;D;D	0.71184	0.02;0.921;0.972;0.972;0.939	T	0.62358	-0.6871	9	0.87932	D	0	-2.6333	11.198	0.48724	0.1837:0.8163:0.0:0.0	.	2;2;2;2;2	B4DUX5;F8VRR3;G3XA91;F8VQZ7;P50579	.;.;.;.;AMPM2_HUMAN	V	2	.	ENSP00000261220:A2V	A	+	2	0	METAP2	94392091	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.704000	0.54815	1.279000	0.44446	0.561000	0.74099	GCG	.	.		0.657	METAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408296.1	NM_006838	
ZC3H13	23091	hgsc.bcm.edu	37	13	46563046	46563046	+	Silent	SNP	A	A	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr13:46563046A>G	ENST00000242848.4	-	9	1479	c.1131T>C	c.(1129-1131)caT>caC	p.H377H	ZC3H13_ENST00000282007.3_Silent_p.H377H			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	377	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ACGACAAAGAATGTGAAGGAT	0.483																																					p.H377H	Esophageal Squamous(187;747 2077 11056 31291 44172)	Atlas-SNP	.											.	ZC3H13	197	.	0			c.T1131C						.						151.0	133.0	139.0					13																	46563046		2203	4300	6503	SO:0001819	synonymous_variant	23091	exon9			CAAAGAATGTGAA	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1131T>C	chr13.hg19:g.46563046A>G		126.0	0.0		98.0	28.0	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Silent	SNP	ENST00000242848.4	hg19																																																																																				.	.		0.483	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
BCL11B	64919	hgsc.bcm.edu	37	14	99640931	99640931	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr14:99640931C>T	ENST00000357195.3	-	4	2251	c.2242G>A	c.(2242-2244)Ggc>Agc	p.G748S	BCL11B_ENST00000443726.2_Missense_Mutation_p.G554S|BCL11B_ENST00000345514.2_Missense_Mutation_p.G677S	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	748					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CGCAGGCTGCCGTTCTCGGAC	0.731			T	TLX3	T-ALL																																p.G748S		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	108	.	0			c.G2242A						.						10.0	10.0	10.0					14																	99640931		2119	4166	6285	SO:0001583	missense	64919	exon4			GGCTGCCGTTCTC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2242G>A	chr14.hg19:g.99640931C>T	ENSP00000349723:p.Gly748Ser	26.0	0.0		29.0	10.0	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	hg19	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063502	0.76187	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.12984	2.65;2.67;2.63	4.25	4.25	0.50352	.	0.000000	0.64402	D	0.000019	T	0.36358	0.0964	M	0.68952	2.095	0.58432	D	0.999999	D;P	0.89917	1.0;0.705	D;B	0.97110	1.0;0.016	T	0.17198	-1.0377	10	0.51188	T	0.08	-17.2728	17.0216	0.86435	0.0:1.0:0.0:0.0	.	677;748	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	S	748;677;554	ENSP00000349723:G748S;ENSP00000280435:G677S;ENSP00000387419:G554S	ENSP00000280435:G677S	G	-	1	0	BCL11B	98710684	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.069000	0.76755	2.080000	0.62538	0.561000	0.74099	GGC	.	.		0.731	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
FURIN	5045	hgsc.bcm.edu	37	15	91423406	91423406	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr15:91423406G>A	ENST00000268171.3	+	13	1738	c.1459G>A	c.(1459-1461)Gct>Act	p.A487T		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	487					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCTGGAGCACGCTCAGGCGCG	0.672																																					p.A487T		Atlas-SNP	.											.	FURIN	85	.	0			c.G1459A						.						43.0	43.0	43.0					15																	91423406		2197	4297	6494	SO:0001583	missense	5045	exon13			GAGCACGCTCAGG	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1459G>A	chr15.hg19:g.91423406G>A	ENSP00000268171:p.Ala487Thr	105.0	0.0		82.0	19.0	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Missense_Mutation	SNP	ENST00000268171.3	hg19	CCDS10364.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048084	0.75846	.	.	ENSG00000140564	ENST00000268171	T	0.63913	-0.07	4.65	3.73	0.42828	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.122566	0.56097	D	0.000023	T	0.48295	0.1492	N	0.19112	0.55	0.35797	D	0.822878	P	0.41748	0.761	B	0.40199	0.322	T	0.63528	-0.6617	10	0.87932	D	0	-3.5694	13.1447	0.59454	0.0779:0.0:0.9221:0.0	.	487	P09958	FURIN_HUMAN	T	487	ENSP00000268171:A487T	ENSP00000268171:A487T	A	+	1	0	FURIN	89224410	0.998000	0.40836	0.531000	0.27976	0.778000	0.44026	7.682000	0.84083	1.180000	0.42898	0.485000	0.47835	GCT	.	.		0.672	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
GLIS2	84662	hgsc.bcm.edu	37	16	4386759	4386759	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr16:4386759G>A	ENST00000262366.3	+	8	1630	c.809G>A	c.(808-810)tGc>tAc	p.C270Y	GLIS2_ENST00000433375.1_Missense_Mutation_p.C270Y|RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	270					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						TACGAGGGCTGCAACAAGCGC	0.612																																					p.C270Y		Atlas-SNP	.											.	GLIS2	29	.	0			c.G809A						.						28.0	26.0	27.0					16																	4386759		2195	4293	6488	SO:0001583	missense	84662	exon6			AGGGCTGCAACAA	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.809G>A	chr16.hg19:g.4386759G>A	ENSP00000262366:p.Cys270Tyr	116.0	0.0		93.0	6.0	NM_032575	B3KX84	Missense_Mutation	SNP	ENST00000262366.3	hg19	CCDS10511.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799917	0.90538	.	.	ENSG00000126603	ENST00000262366;ENST00000433375	D;D	0.85861	-2.04;-2.04	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.050475	0.85682	D	0.000000	D	0.94748	0.8305	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95307	0.8408	10	0.87932	D	0	.	19.1994	0.93704	0.0:0.0:1.0:0.0	.	270	Q9BZE0	GLIS2_HUMAN	Y	270	ENSP00000262366:C270Y;ENSP00000395547:C270Y	ENSP00000262366:C270Y	C	+	2	0	GLIS2	4326760	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.784000	0.99039	2.837000	0.97791	0.655000	0.94253	TGC	.	.		0.612	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251630.1	NM_032575	
KIAA0556	23247	hgsc.bcm.edu	37	16	27709794	27709794	+	Silent	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr16:27709794G>A	ENST00000261588.4	+	9	1105	c.1086G>A	c.(1084-1086)aaG>aaA	p.K362K	CTD-2049O4.1_ENST00000564893.1_RNA|KIAA0556_ENST00000567894.1_3'UTR	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	362						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						TCAGCAGAAAGGCCGAGCAGC	0.642																																					p.K362K		Atlas-SNP	.											.	KIAA0556	348	.	0			c.G1086A						.						26.0	27.0	27.0					16																	27709794		2197	4300	6497	SO:0001819	synonymous_variant	23247	exon9			CAGAAAGGCCGAG	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1086G>A	chr16.hg19:g.27709794G>A		72.0	0.0		60.0	17.0	NM_015202	A7E2C2	Silent	SNP	ENST00000261588.4	hg19	CCDS32415.1																																																																																			.	.		0.642	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
SF3B3	23450	hgsc.bcm.edu	37	16	70605100	70605100	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr16:70605100A>T	ENST00000302516.5	+	25	3722	c.3511A>T	c.(3511-3513)Aag>Tag	p.K1171*		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	1171					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CTTCCCTGTGAAGGTAGGTTG	0.552																																					p.K1171X		Atlas-SNP	.											.	SF3B3	99	.	0			c.A3511T						.						87.0	75.0	79.0					16																	70605100		2198	4300	6498	SO:0001587	stop_gained	23450	exon25			CCTGTGAAGGTAG	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.3511A>T	chr16.hg19:g.70605100A>T	ENSP00000305790:p.Lys1171*	68.0	0.0		66.0	34.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Nonsense_Mutation	SNP	ENST00000302516.5	hg19	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	A	43	10.271615	0.99372	.	.	ENSG00000189091	ENST00000302516	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1146	0.81295	1.0:0.0:0.0:0.0	.	.	.	.	X	1171	.	ENSP00000305790:K1171X	K	+	1	0	SF3B3	69162601	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	9.245000	0.95431	2.200000	0.70718	0.460000	0.39030	AAG	.	.		0.552	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
KIF1C	10749	hgsc.bcm.edu	37	17	4927022	4927022	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr17:4927022G>A	ENST00000320785.5	+	23	3245	c.2888G>A	c.(2887-2889)cGc>cAc	p.R963H		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	963					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GGGGGGCTGCGCAGGCCCCCA	0.697																																					p.R963H	Melanoma(96;1023 1447 10250 19259 33730)	Atlas-SNP	.											.	KIF1C	70	.	0			c.G2888A						.						11.0	14.0	13.0					17																	4927022		2113	4145	6258	SO:0001583	missense	10749	exon23			GGCTGCGCAGGCC	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2888G>A	chr17.hg19:g.4927022G>A	ENSP00000320821:p.Arg963His	104.0	0.0		82.0	4.0	NM_006612	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	hg19	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318031	0.60524	.	.	ENSG00000129250	ENST00000320785	T	0.73575	-0.76	4.93	4.93	0.64822	.	.	.	.	.	T	0.69513	0.3119	L	0.29908	0.895	0.35110	D	0.766065	D	0.65815	0.995	P	0.50082	0.63	T	0.77148	-0.2694	9	0.54805	T	0.06	.	11.3585	0.49630	0.0:0.1832:0.8168:0.0	.	963	O43896	KIF1C_HUMAN	H	963	ENSP00000320821:R963H	ENSP00000320821:R963H	R	+	2	0	KIF1C	4867746	0.995000	0.38212	1.000000	0.80357	0.964000	0.63967	1.903000	0.39858	2.558000	0.86282	0.655000	0.94253	CGC	.	.		0.697	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1		
ERBB2	2064	hgsc.bcm.edu	37	17	37876052	37876052	+	Silent	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr17:37876052G>A	ENST00000269571.5	+	16	2070	c.1911G>A	c.(1909-1911)ctG>ctA	p.L637L	ERBB2_ENST00000541774.1_Silent_p.L622L|ERBB2_ENST00000445658.2_Silent_p.L361L|ERBB2_ENST00000584601.1_Silent_p.L607L|ERBB2_ENST00000406381.2_Silent_p.L607L|ERBB2_ENST00000540147.1_Silent_p.L607L|ERBB2_ENST00000584450.1_Silent_p.L637L			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	637					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GTGTGGACCTGGATGACAAGG	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L637L		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429	.	0			c.G1911A						.						174.0	142.0	153.0					17																	37876052		2203	4300	6503	SO:0001819	synonymous_variant	2064	exon16			GGACCTGGATGAC	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1911G>A	chr17.hg19:g.37876052G>A		97.0	0.0		180.0	43.0	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	hg19	CCDS32642.1																																																																																			.	.		0.597	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	34.0	0.0		96.0	18.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
RAB5C	5878	hgsc.bcm.edu	37	17	40277843	40277843	+	Silent	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr17:40277843C>T	ENST00000346213.4	-	6	821	c.609G>A	c.(607-609)caG>caA	p.Q203Q	CTD-2132N18.3_ENST00000592574.1_Intron|RAB5C_ENST00000393860.3_Silent_p.Q203Q|RAB5C_ENST00000547517.1_Silent_p.Q236Q	NM_004583.3	NP_004574.2	P51148	RAB5C_HUMAN	RAB5C, member RAS oncogene family	203					endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)|skin(1)	7		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GGTTGTTCTCCTGGAGGTCCA	0.617																																					p.Q236Q		Atlas-SNP	.											.	RAB5C	20	.	0			c.G708A						.						40.0	37.0	38.0					17																	40277843		2203	4300	6503	SO:0001819	synonymous_variant	5878	exon7			GTTCTCCTGGAGG	U18420	CCDS11419.1, CCDS58551.1	17q21.2	2013-02-15			ENSG00000108774	ENSG00000108774		"""RAB, member RAS oncogene"""	9785	protein-coding gene	gene with protein product	"""RAB, member of RAS oncogene family-like"", ""RAB5C, member of RAS oncogene family"""	604037		RABL		8646882	Standard	NM_004583		Approved	RAB5CL	uc010cxx.3	P51148	OTTHUMG00000169703	ENST00000346213.4:c.609G>A	chr17.hg19:g.40277843C>T		48.0	0.0		48.0	5.0	NM_001252039	F8W1H5|Q6FH55|Q9P0Y5	Silent	SNP	ENST00000346213.4	hg19	CCDS11419.1																																																																																			.	.		0.617	RAB5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405509.1	NM_004583	
NGFR	4804	hgsc.bcm.edu	37	17	47590143	47590143	+	Silent	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr17:47590143C>T	ENST00000172229.3	+	6	1181	c.1056C>T	c.(1054-1056)aaC>aaT	p.N352N	NGFR_ENST00000504201.1_Silent_p.N258N|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	352	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					AGCTTCTCAACGGCTCTGCGG	0.667																																					p.N352N		Atlas-SNP	.											.	NGFR	46	.	0			c.C1056T						.						56.0	62.0	60.0					17																	47590143		2202	4298	6500	SO:0001819	synonymous_variant	4804	exon6			TCTCAACGGCTCT	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1056C>T	chr17.hg19:g.47590143C>T		173.0	0.0		172.0	7.0	NM_002507	B2R961|B4E096	Silent	SNP	ENST00000172229.3	hg19	CCDS11549.1																																																																																			.	.		0.667	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
KLC3	147700	hgsc.bcm.edu	37	19	45848977	45848977	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr19:45848977G>A	ENST00000391946.2	+	2	280	c.178G>A	c.(178-180)Ggc>Agc	p.G60S	KLC3_ENST00000585434.1_Missense_Mutation_p.G60S|KLC3_ENST00000470402.1_Missense_Mutation_p.G74S	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	60					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCCGGCAGCCGGCTTGGAGAT	0.721																																					p.G60S		Atlas-SNP	.											.	KLC3	37	.	0			c.G178A						.						5.0	8.0	7.0					19																	45848977		1841	3919	5760	SO:0001583	missense	147700	exon2			GCAGCCGGCTTGG	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.178G>A	chr19.hg19:g.45848977G>A	ENSP00000375810:p.Gly60Ser	122.0	0.0		141.0	6.0	NM_177417	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	ENST00000391946.2	hg19	CCDS12660.2	.	.	.	.	.	.	.	.	.	.	G	1.204	-0.631672	0.03584	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	D;D	0.82433	-1.6;-1.61	3.4	1.22	0.21188	.	0.651119	0.13625	N	0.374157	T	0.66577	0.2803	N	0.14661	0.345	0.09310	N	1	B;B;B	0.18013	0.01;0.025;0.014	B;B;B	0.12837	0.008;0.008;0.004	T	0.54159	-0.8335	10	0.38643	T	0.18	-23.0123	7.3856	0.26880	0.2277:0.0:0.7723:0.0	.	60;74;60	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	S	60;74	ENSP00000375810:G60S;ENSP00000436019:G74S	ENSP00000375810:G60S	G	+	1	0	KLC3	50540817	0.950000	0.32346	0.006000	0.13384	0.098000	0.18820	2.903000	0.48711	0.280000	0.22209	-0.643000	0.03959	GGC	.	.		0.721	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	NM_145275	
RIN2	54453	hgsc.bcm.edu	37	20	19955803	19955803	+	Silent	SNP	C	C	T	rs370646119		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr20:19955803C>T	ENST00000255006.6	+	8	1430	c.1281C>T	c.(1279-1281)agC>agT	p.S427S	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	378					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AGACCTTGAGCGGCGGCCGGC	0.692																																					p.S427S		Atlas-SNP	.											.	RIN2	126	.	0			c.C1281T						.	C	,	2,3680		0,2,1839	29.0	31.0	30.0		1281,1134	0.1	0.1	20		30	0,8156		0,0,4078	no	coding-synonymous,coding-synonymous	RIN2	NM_001242581.1,NM_018993.3	,	0,2,5917	TT,TC,CC		0.0,0.0543,0.0169	,	427/945,378/896	19955803	2,11836	1841	4078	5919	SO:0001819	synonymous_variant	54453	exon8			CTTGAGCGGCGGC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1281C>T	chr20.hg19:g.19955803C>T		728.0	0.0		675.0	47.0	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000255006.6	hg19	CCDS56182.1																																																																																			.	.		0.692	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
PCIF1	63935	hgsc.bcm.edu	37	20	44571777	44571777	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr20:44571777G>T	ENST00000372409.3	+	8	1079	c.715G>T	c.(715-717)Gag>Tag	p.E239*		NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	239					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						CTGGATGCTGGAGCGCAAGGT	0.537																																					p.E239X		Atlas-SNP	.											.	PCIF1	51	.	0			c.G715T						.						77.0	60.0	66.0					20																	44571777		2203	4300	6503	SO:0001587	stop_gained	63935	exon8			ATGCTGGAGCGCA	AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.715G>T	chr20.hg19:g.44571777G>T	ENSP00000361486:p.Glu239*	63.0	0.0		51.0	16.0	NM_022104	E1P5P1|Q54AB9|Q9NT85	Nonsense_Mutation	SNP	ENST00000372409.3	hg19	CCDS13388.1	.	.	.	.	.	.	.	.	.	.	G	40	7.972069	0.98588	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-21.579	17.4916	0.87705	0.0:0.0:1.0:0.0	.	.	.	.	X	239	.	ENSP00000361486:E239X	E	+	1	0	PCIF1	44005184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.519000	0.98025	2.606000	0.88127	0.655000	0.94253	GAG	.	.		0.537	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1	NM_022104	
ZBTB46	140685	hgsc.bcm.edu	37	20	62421975	62421975	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr20:62421975T>C	ENST00000245663.4	-	2	286	c.136A>G	c.(136-138)Aag>Gag	p.K46E	ZBTB46_ENST00000480766.1_5'Flank|ZBTB46_ENST00000302995.2_Missense_Mutation_p.K46E|ZBTB46_ENST00000395104.1_Missense_Mutation_p.K46E	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	46	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					AGGACGTTCTTGTGCGCCTTG	0.642																																					p.K46E		Atlas-SNP	.											.	ZBTB46	72	.	0			c.A136G						.						70.0	57.0	62.0					20																	62421975		2203	4300	6503	SO:0001583	missense	140685	exon2			CGTTCTTGTGCGC	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.136A>G	chr20.hg19:g.62421975T>C	ENSP00000245663:p.Lys46Glu	33.0	0.0		41.0	8.0	NM_025224	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	hg19	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.066925	0.76301	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.78924	-1.22;-1.22;-1.22	5.77	5.77	0.91146	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.052838	0.64402	D	0.000001	D	0.90672	0.7074	M	0.92738	3.34	0.44843	D	0.997857	D	0.89917	1.0	D	0.91635	0.999	D	0.92793	0.6250	10	0.87932	D	0	.	15.2702	0.73696	0.0:0.0:0.0:1.0	.	46	Q86UZ6	ZBT46_HUMAN	E	46	ENSP00000245663:K46E;ENSP00000303102:K46E;ENSP00000378536:K46E	ENSP00000245663:K46E	K	-	1	0	ZBTB46	61892419	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	4.944000	0.63561	2.205000	0.71048	0.533000	0.62120	AAG	.	.		0.642	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
RWDD2B	10069	hgsc.bcm.edu	37	21	30380106	30380106	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr21:30380106C>G	ENST00000493196.1	-	4	801	c.701G>C	c.(700-702)aGt>aCt	p.S234T	RWDD2B_ENST00000486719.1_5'UTR	NM_016940.2	NP_058636.1	P57060	RWD2B_HUMAN	RWD domain containing 2B	234										endometrium(1)|kidney(1)|large_intestine(8)|lung(2)	12						TTCACAGGCACTTTGTGGGCC	0.408																																					p.S234T		Atlas-SNP	.											.	RWDD2B	24	.	0			c.G701C						.						75.0	77.0	76.0					21																	30380106		2203	4300	6503	SO:0001583	missense	10069	exon4			CAGGCACTTTGTG	AF212232	CCDS13582.1	21q22.11	2012-12-07	2007-07-17	2007-07-17	ENSG00000156253	ENSG00000156253			1302	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 6"""	C21orf6		10729227	Standard	NM_016940		Approved	GL011	uc002yms.3	P57060	OTTHUMG00000078805	ENST00000493196.1:c.701G>C	chr21.hg19:g.30380106C>G	ENSP00000418693:p.Ser234Thr	52.0	0.0		54.0	14.0	NM_016940		Missense_Mutation	SNP	ENST00000493196.1	hg19	CCDS13582.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650602	0.67472	.	.	ENSG00000156253	ENST00000493196	.	.	.	5.65	4.77	0.60923	Domain of unknown function DUF1115 (1);	0.232469	0.52532	D	0.000066	T	0.52661	0.1748	L	0.39326	1.205	0.37913	D	0.931429	B;P	0.47484	0.098;0.896	B;P	0.53224	0.076;0.721	T	0.52808	-0.8526	9	0.22109	T	0.4	-8.6106	10.9956	0.47573	0.0:0.8588:0.0:0.1412	.	234;234	Q53FD2;P57060	.;RWD2B_HUMAN	T	234	.	ENSP00000418693:S234T	S	-	2	0	RWDD2B	29301977	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.022000	0.41030	1.626000	0.50381	0.655000	0.94253	AGT	.	.		0.408	RWDD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171858.1		
TEX33	339669	hgsc.bcm.edu	37	22	37395926	37395926	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr22:37395926C>T	ENST00000405091.2	-	5	840	c.589G>A	c.(589-591)Gac>Aac	p.D197N	TEX33_ENST00000381821.1_Missense_Mutation_p.D197N|TEX33_ENST00000402860.3_Missense_Mutation_p.D112N			O43247	TEX33_HUMAN	testis expressed 33	197																	TCATAGTAGTCTGAGAAGACG	0.537																																					p.D197N		Atlas-SNP	.											.	TEX33	25	.	0			c.G589A						.						131.0	122.0	125.0					22																	37395926		2203	4300	6503	SO:0001583	missense	339669	exon4			AGTAGTCTGAGAA	BC042635	CCDS13937.1, CCDS54524.1	22q12.3	2013-10-11	2012-02-16	2012-02-16	ENSG00000185264	ENSG00000185264			28568	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 33"""	C22orf33		22332119	Standard	NM_178552		Approved	MGC35206, EAN57	uc003aqf.3	O43247	OTTHUMG00000150531	ENST00000405091.2:c.589G>A	chr22.hg19:g.37395926C>T	ENSP00000386118:p.Asp197Asn	53.0	0.0		43.0	7.0	NM_001163857	B1AH46|Q6ICF2|Q8IVQ2|Q9Y4V8	Missense_Mutation	SNP	ENST00000405091.2	hg19	CCDS54524.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.93|11.93	1.786867|1.786867	0.31593|0.31593	.|.	.|.	ENSG00000185264|ENSG00000185264	ENST00000402860;ENST00000405091;ENST00000381821|ENST00000442538	.|.	.|.	.|.	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	0.329651|.	0.25458|.	N|.	0.030540|.	T|T	0.63745|0.63745	0.2537|0.2537	M|M	0.69823|0.69823	2.125|2.125	0.32343|0.32343	N|N	0.559505|0.559505	D|.	0.57257|.	0.979|.	P|.	0.56563|.	0.801|.	T|T	0.71397|0.71397	-0.4605|-0.4605	9|5	0.37606|.	T|.	0.19|.	-13.7082|-13.7082	13.5338|13.5338	0.61638|0.61638	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	197|.	O43247|.	EAN57_HUMAN|.	N|K	112;197;197|55	.|.	ENSP00000371243:D197N|.	D|R	-|-	1|2	0|0	C22orf33|C22orf33	35725872|35725872	0.992000|0.992000	0.36948|0.36948	0.991000|0.991000	0.47740|0.47740	0.144000|0.144000	0.21451|0.21451	3.828000|3.828000	0.55753|0.55753	2.261000|2.261000	0.74972|0.74972	0.558000|0.558000	0.71614|0.71614	GAC|AGA	.	.		0.537	TEX33-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318778.2	NM_178552	
SBF1	6305	hgsc.bcm.edu	37	22	50893272	50893272	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr22:50893272T>A	ENST00000390679.3	-	34	4889	c.4705A>T	c.(4705-4707)Aat>Tat	p.N1569Y	SBF1_ENST00000348911.6_Missense_Mutation_p.N1570Y|SBF1_ENST00000380817.3_Missense_Mutation_p.N1595Y|SBF1_ENST00000476293.1_5'Flank			O95248	MTMR5_HUMAN	SET binding factor 1	1569	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TACATGTAATTGTGGAACACA	0.642																																					p.N1595Y		Atlas-SNP	.											.	SBF1	211	.	0			c.A4783T						.						44.0	50.0	48.0					22																	50893272		2072	4195	6267	SO:0001583	missense	6305	exon35			TGTAATTGTGGAA	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.4705A>T	chr22.hg19:g.50893272T>A	ENSP00000375097:p.Asn1569Tyr	64.0	0.0		44.0	17.0	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.47|17.47	3.398530|3.398530	0.62177|0.62177	.|.	.|.	ENSG00000100241|ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679|ENST00000418590	D;D;D|.	0.94537|.	-3.45;-3.45;-3.45|.	3.74|3.74	3.74|3.74	0.42951|0.42951	Myotubularin phosphatase domain (1);|.	0.054068|.	0.64402|.	D|.	0.000001|.	D|D	0.86239|0.86239	0.5885|0.5885	H|H	0.96518|0.96518	3.835|3.835	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.998;0.998;0.999|.	D|D	0.90033|0.90033	0.4136|0.4136	10|5	0.87932|.	D|.	0|.	.|.	12.5669|12.5669	0.56314|0.56314	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1569;1595;128|.	O95248;O95248-4;A6PVG7|.	MTMR5_HUMAN;.;.|.	Y|L	1595;1570;1605;1569|128	ENSP00000370196:N1595Y;ENSP00000252027:N1570Y;ENSP00000375097:N1569Y|.	ENSP00000336522:N1605Y|.	N|Q	-|-	1|2	0|0	SBF1|SBF1	49240138|49240138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.481000|0.481000	0.33189|0.33189	7.466000|7.466000	0.80914|0.80914	1.701000|1.701000	0.51217|0.51217	0.379000|0.379000	0.24179|0.24179	AAT|CAA	.	.		0.642	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
FRMPD4	9758	hgsc.bcm.edu	37	X	12701706	12701706	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chrX:12701706G>A	ENST00000380682.1	+	6	1079	c.573G>A	c.(571-573)tcG>tcA	p.S191S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	191					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.S191S(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GCCAAGTGTCGGTGAGTTTAC	0.448																																					p.S191S		Atlas-SNP	.											.	FRMPD4	214	.	1	Substitution - coding silent(1)	central_nervous_system(1)	c.G573A						.						96.0	73.0	81.0					X																	12701706		2203	4300	6503	SO:0001630	splice_region_variant	9758	exon6			AGTGTCGGTGAGT	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.573+1G>A	chrX.hg19:g.12701706G>A		116.0	0.0		101.0	49.0	NM_014728	A8K0X9|O15032	Silent	SNP	ENST00000380682.1	hg19	CCDS35201.1																																																																																			.	.		0.448	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	Silent
MED14	9282	hgsc.bcm.edu	37	X	40526016	40526016	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chrX:40526016T>C	ENST00000324817.1	-	24	3339	c.3221A>G	c.(3220-3222)cAt>cGt	p.H1074R		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1074	Pro-rich.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGAGATTCCATGCGAGGATGG	0.473																																					p.H1074R		Atlas-SNP	.											.	MED14	108	.	0			c.A3221G						.						46.0	39.0	41.0					X																	40526016		2203	4300	6503	SO:0001583	missense	9282	exon24			ATTCCATGCGAGG	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.3221A>G	chrX.hg19:g.40526016T>C	ENSP00000323720:p.His1074Arg	183.0	0.0		161.0	72.0	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	hg19	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.895970	0.33442	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.75	5.75	0.90469	.	0.056936	0.64402	D	0.000001	T	0.33760	0.0874	N	0.14661	0.345	0.37914	D	0.931453	B	0.22604	0.072	B	0.25884	0.064	T	0.31530	-0.9940	9	0.25106	T	0.35	.	8.8488	0.35188	0.3082:0.0:0.0:0.6918	.	1074	O60244	MED14_HUMAN	R	1074	.	ENSP00000323720:H1074R	H	-	2	0	MED14	40410960	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.288000	0.72679	1.931000	0.55961	0.402000	0.26972	CAT	.	.		0.473	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	
FGF16	8823	hgsc.bcm.edu	37	X	76711987	76711987	+	Silent	SNP	T	T	C			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chrX:76711987T>C	ENST00000439435.1	+	2	324	c.324T>C	c.(322-324)tgT>tgC	p.C108C				O43320	FGF16_HUMAN	fibroblast growth factor 16	0					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of brown fat cell proliferation (GO:0070349)|response to temperature stimulus (GO:0009266)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(1)|lung(2)	4						GCCCTCCATGTCCAGAGACCT	0.502																																					p.S109P		Atlas-SNP	.											.	FGF16	16	.	0			c.T325C						.						111.0	106.0	107.0					X																	76711987		1900	4107	6007	SO:0001819	synonymous_variant	8823	exon2			TCCATGTCCAGAG	AB009391	CCDS75996.1	Xq21.1	2014-01-31			ENSG00000196468	ENSG00000196468			3672	protein-coding gene	gene with protein product		300827	"""metacarpal 4-5 fusion"""	MF4		9473496, 11474196, 23709756	Standard	NM_003868		Approved		uc011mqp.2	O43320	OTTHUMG00000013133	ENST00000439435.1:c.324T>C	chrX.hg19:g.76711987T>C		114.0	0.0		100.0	41.0	NM_003868		Missense_Mutation	SNP	ENST00000439435.1	hg19																																																																																				.	.		0.502	FGF16-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036814.1	NM_003868	
CYLC1	1538	hgsc.bcm.edu	37	X	83126541	83126541	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chrX:83126541A>T	ENST00000329312.4	+	3	177	c.140A>T	c.(139-141)gAt>gTt	p.D47V		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	47					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GGTACAAATGATAAATCAAGA	0.294																																					p.D47V		Atlas-SNP	.											.	CYLC1	272	.	0			c.A140T						.						66.0	60.0	62.0					X																	83126541		2203	4296	6499	SO:0001583	missense	1538	exon3			CAAATGATAAATC	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.140A>T	chrX.hg19:g.83126541A>T	ENSP00000331556:p.Asp47Val	372.0	1.0		388.0	190.0	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	hg19	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	a	2.791	-0.251370	0.05867	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.42900	0.96	4.59	2.2	0.27929	.	.	.	.	.	T	0.25494	0.0620	N	0.22421	0.69	0.09310	N	1	B;B	0.25169	0.119;0.119	B;B	0.21917	0.037;0.037	T	0.21759	-1.0236	9	0.62326	D	0.03	0.4273	3.5805	0.07950	0.652:0.229:0.119:0.0	.	47;47	P35663;F5H4V5	CYLC1_HUMAN;.	V	47	ENSP00000331556:D47V	ENSP00000331556:D47V	D	+	2	0	CYLC1	83013197	0.010000	0.17322	0.057000	0.19452	0.001000	0.01503	0.175000	0.16762	0.683000	0.31428	0.486000	0.48141	GAT	.	.		0.294	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
RAB39B	116442	hgsc.bcm.edu	37	X	154493379	154493379	+	Silent	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chrX:154493379G>A	ENST00000369454.3	-	1	495	c.195C>T	c.(193-195)acC>acT	p.T65T		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	65					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTGACCCGCGGTATCCCAGA	0.617																																					p.T65T		Atlas-SNP	.											.	RAB39B	37	.	0			c.C195T						.						74.0	60.0	65.0					X																	154493379		2203	4300	6503	SO:0001819	synonymous_variant	116442	exon1			ACCCGCGGTATCC	AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.195C>T	chrX.hg19:g.154493379G>A		61.0	0.0		64.0	30.0	NM_171998	Q5JT79|Q8NEX3	Silent	SNP	ENST00000369454.3	hg19	CCDS14766.1																																																																																			.	.		0.617	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058792.1	NM_171998	
MT-CYB	4519	hgsc.bcm.edu	37	M	15699	15699	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chrM:15699G>A	ENST00000361789.2	+	1	953	c.953G>A	c.(952-954)cGc>cAc	p.R318H	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-ND6_ENST00000361681.2_5'Flank			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	318					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CATAATATTTCGCCCACTAAG	0.448											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.R318H		Atlas-SNP	.											.	.	.	.	0			c.G953A						.																																			SO:0001583	missense	0	exon1			TATTTCGCCCACT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.953G>A	chrM.hg19:g.15699G>A	ENSP00000354554:p.Arg318His	17.0	0.0	585	24.0	11.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.448	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19427544	19427545	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr12:19427544_19427545insA	ENST00000299275.6	+	10	928_929	c.922_923insA	c.(922-924)caafs	p.Q308fs	PLEKHA5_ENST00000538714.1_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000359180.3_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000543806.1_Frame_Shift_Ins_p.Q200fs|PLEKHA5_ENST00000429027.2_Frame_Shift_Ins_p.Q314fs|PLEKHA5_ENST00000424268.1_Frame_Shift_Ins_p.Q200fs|PLEKHA5_ENST00000355397.3_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000539256.1_Frame_Shift_Ins_p.Q66fs|PLEKHA5_ENST00000309364.4_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000317589.4_Frame_Shift_Ins_p.Q308fs	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	308					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CCAAAACAATCAAAAAAACAAG	0.327																																					p.Q314fs	Pancreas(196;329 2193 11246 14234 19524)	Atlas-INDEL	.											.,2	PLEKHA5	198	.	0			c.940_941insA						.																																			SO:0001589	frameshift_variant	54477	exon11			.	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.929dupA	chr12.hg19:g.19427551_19427551dupA	ENSP00000299275:p.Gln308fs	140.0	0.0		166.0	33.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Frame_Shift_Ins	INS	ENST00000299275.6	hg19	CCDS8682.1																																																																																			.	.		0.327	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156767	26156769	+	In_Frame_Del	DEL	CCT	CCT	-	rs377472965		TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr6:26156767_26156769delCCT	ENST00000304218.3	+	1	209_211	c.149_151delCCT	c.(148-153)gcctcc>gcc	p.S51del	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	51	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCTGTTGCCGCCTCCAAGGAGCG	0.606																																					p.50_50del		Atlas-INDEL	.											.	HIST1H1E	69	.	0			c.148_150del						.																																			SO:0001651	inframe_deletion	3008	exon1			.	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.149_151delCCT	chr6.hg19:g.26156767_26156769delCCT	ENSP00000307705:p.Ser51del	68.0	0.0		85.0	25.0	NM_005321	Q4VB25	In_Frame_Del	DEL	ENST00000304218.3	hg19	CCDS4586.1																																																																																			.	.		0.606	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
NEB	4703	hgsc.bcm.edu	37	2	152426620	152426620	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAVR-01A-11D-A40R-10	TCGA-DD-AAVR-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de2cbef6-7b85-4ffc-b131-32615e787573	c5cdd91e-522e-444f-9a7e-81c5d13d1a33	g.chr2:152426620delT	ENST00000172853.10	-	81	12449	c.12302delA	c.(12301-12303)aagfs	p.K4102fs	NEB_ENST00000427231.2_Frame_Shift_Del_p.K5803fs|NEB_ENST00000409198.1_Frame_Shift_Del_p.K4102fs|NEB_ENST00000604864.1_Frame_Shift_Del_p.K5803fs|NEB_ENST00000397345.3_Frame_Shift_Del_p.K5803fs|NEB_ENST00000603639.1_Frame_Shift_Del_p.K5803fs			P20929	NEBU_HUMAN	nebulin	4102					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTAGGCCTTCTTGGCCTGAAT	0.502																																					p.K5802fs		Atlas-INDEL	.											.	NEB	1697	.	0			c.17406delG						.						42.0	41.0	41.0					2																	152426620		2053	4190	6243	SO:0001589	frameshift_variant	4703	exon109			.	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.12302delA	chr2.hg19:g.152426620delT	ENSP00000172853:p.Lys4102fs	57.0	0.0		57.0	13.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Frame_Shift_Del	DEL	ENST00000172853.10	hg19																																																																																				.	.		0.502	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
