#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HEYL	26508	hgsc.bcm.edu	37	1	40092821	40092821	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr1:40092821G>T	ENST00000372852.3	-	5	664	c.345C>A	c.(343-345)gaC>gaA	p.D115E	HEYL_ENST00000535435.1_Missense_Mutation_p.D87E	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	115					atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGCTCCGGAAGTCAACTGCCA	0.607																																					p.D115E		Atlas-SNP	.											.	HEYL	27	.	0			c.C345A						.						27.0	29.0	29.0					1																	40092821		2201	4299	6500	SO:0001583	missense	26508	exon5			CCGGAAGTCAACT	BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.345C>A	chr1.hg19:g.40092821G>T	ENSP00000361943:p.Asp115Glu	161.0	0.0		85.0	53.0	NM_014571	Q5TG99	Missense_Mutation	SNP	ENST00000372852.3	hg19	CCDS439.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981283	0.74474	.	.	ENSG00000163909	ENST00000372852;ENST00000535435	T;T	0.43688	0.94;0.94	5.19	3.31	0.37934	Orange subgroup (1);	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.82517	2.595	0.54753	D	0.999985	D	0.89917	1.0	D	0.97110	1.0	T	0.67364	-0.5689	10	0.87932	D	0	-1.0564	9.7227	0.40313	0.229:0.0:0.771:0.0	.	115	Q9NQ87	HEYL_HUMAN	E	115;87	ENSP00000361943:D115E;ENSP00000439071:D87E	ENSP00000361943:D115E	D	-	3	2	HEYL	39865408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.445000	0.35079	1.192000	0.43071	0.462000	0.41574	GAC	.	.		0.607	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001179.2	NM_014571	
SV2A	9900	hgsc.bcm.edu	37	1	149885087	149885087	+	Silent	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr1:149885087G>A	ENST00000369146.3	-	2	796	c.306C>T	c.(304-306)ccC>ccT	p.P102P	SV2A_ENST00000369145.1_Silent_p.P102P	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	102					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	ACTCTGCCCGGGGAATGCCCT	0.627																																					p.P102P		Atlas-SNP	.											.	SV2A	123	.	0			c.C306T						.						108.0	107.0	107.0					1																	149885087		2203	4300	6503	SO:0001819	synonymous_variant	9900	exon2			TGCCCGGGGAATG	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.306C>T	chr1.hg19:g.149885087G>A		98.0	0.0		131.0	75.0	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	hg19	CCDS940.1																																																																																			.	.		0.627	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
SNX27	81609	hgsc.bcm.edu	37	1	151665429	151665429	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr1:151665429G>A	ENST00000458013.2	+	10	1552	c.1432G>A	c.(1432-1434)Gac>Aac	p.D478N	SNX27_ENST00000368838.1_Missense_Mutation_p.D385N|SNX27_ENST00000368843.3_Missense_Mutation_p.D478N			Q96L92	SNX27_HUMAN	sorting nexin family member 27	478	FERM-like region F3.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCAGCGATGGGACACAGATGA	0.473																																					p.D478N	Colon(46;291 966 40145 41237 41888)	Atlas-SNP	.											.	SNX27	44	.	0			c.G1432A						.						140.0	139.0	139.0					1																	151665429		2203	4300	6503	SO:0001583	missense	81609	exon10			CGATGGGACACAG	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1432G>A	chr1.hg19:g.151665429G>A	ENSP00000400333:p.Asp478Asn	173.0	0.0		236.0	63.0	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	hg19		.	.	.	.	.	.	.	.	.	.	G	28.0	4.882795	0.91740	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	D;D;D	0.92699	-3.09;-3.09;-3.09	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.87653	0.6231	L	0.51422	1.61	0.80722	D	1	P;P	0.49862	0.757;0.929	B;B	0.42827	0.225;0.399	D	0.87512	0.2440	10	0.39692	T	0.17	.	16.7243	0.85417	0.0:0.0:1.0:0.0	.	478;478	Q96L92;Q96L92-3	SNX27_HUMAN;.	N	478;478;385	ENSP00000400333:D478N;ENSP00000357836:D478N;ENSP00000357831:D385N	ENSP00000357831:D385N	D	+	1	0	SNX27	149932053	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.970000	0.93415	2.726000	0.93360	0.563000	0.77884	GAC	.	.		0.473	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
GREB1	9687	hgsc.bcm.edu	37	2	11775439	11775439	+	Missense_Mutation	SNP	G	G	T	rs200590869		TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:11775439G>T	ENST00000381486.2	+	30	5554	c.5254G>T	c.(5254-5256)Gcc>Tcc	p.A1752S	GREB1_ENST00000396123.1_Missense_Mutation_p.A750S|GREB1_ENST00000234142.5_Missense_Mutation_p.A1752S	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1752						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGTGCACAGCGCCGGCCTCCT	0.612																																					p.A1752S	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.G5254T						.						63.0	70.0	68.0					2																	11775439		2050	4191	6241	SO:0001583	missense	9687	exon30			CACAGCGCCGGCC		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5254G>T	chr2.hg19:g.11775439G>T	ENSP00000370896:p.Ala1752Ser	67.0	0.0		62.0	28.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698882	0.30142	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.42900	0.96;0.96;0.96	4.61	4.61	0.57282	.	0.054859	0.64402	D	0.000001	T	0.23451	0.0567	N	0.11724	0.165	0.46678	D	0.99915	B	0.32071	0.355	B	0.35550	0.205	T	0.07195	-1.0785	10	0.05959	T	0.93	-27.4037	12.5377	0.56150	0.0:0.0:0.8334:0.1666	.	1752	Q4ZG55	GREB1_HUMAN	S	1752;1752;750	ENSP00000370896:A1752S;ENSP00000234142:A1752S;ENSP00000379429:A750S	ENSP00000234142:A1752S	A	+	1	0	GREB1	11692890	0.960000	0.32886	1.000000	0.80357	0.991000	0.79684	2.920000	0.48844	2.124000	0.65301	0.563000	0.77884	GCC	.	.		0.612	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
ATAD2B	54454	hgsc.bcm.edu	37	2	24021162	24021162	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:24021162C>T	ENST00000238789.5	-	19	2829	c.2486G>A	c.(2485-2487)aGt>aAt	p.S829N	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	829						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTAAACAATACTAGGTACTGT	0.363																																					p.S829N		Atlas-SNP	.											.	ATAD2B	110	.	0			c.G2486A						.						60.0	56.0	57.0					2																	24021162		1841	4099	5940	SO:0001583	missense	54454	exon19			ACAATACTAGGTA	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2486G>A	chr2.hg19:g.24021162C>T	ENSP00000238789:p.Ser829Asn	362.0	1.0		322.0	114.0	NM_001242338	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	hg19	CCDS46227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.582972|5.582972	0.96578|0.96578	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000238789|ENST00000381024	D|.	0.95342|.	-3.68|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.775342|.	0.12289|.	N|.	0.482158|.	D|D	0.84999|0.84999	0.5597|0.5597	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.83275|.	0.99;0.996|.	D|D	0.86144|0.86144	0.1583|0.1583	10|5	0.87932|.	D|.	0|.	.|.	20.0916|20.0916	0.97822|0.97822	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	829;829|.	Q9ULI0;Q9ULI0-2|.	ATD2B_HUMAN;.|.	N|I	829|110	ENSP00000238789:S829N|.	ENSP00000238789:S829N|.	S|V	-|-	2|1	0|0	ATAD2B|ATAD2B	23874666|23874666	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.651000|7.651000	0.83577|0.83577	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	AGT|GTA	.	.		0.363	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
CFC1	55997	hgsc.bcm.edu	37	2	131356332	131356332	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:131356332G>C	ENST00000259216.4	-	3	392	c.130C>G	c.(130-132)Cag>Gag	p.Q44E		NM_032545.3	NP_115934.1	P0CG37	CFC1_HUMAN	cripto, FRL-1, cryptic family 1	44					determination of left/right symmetry (GO:0007368)|gastrulation (GO:0007369)|nodal signaling pathway (GO:0038092)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nodal binding (GO:0038100)			endometrium(1)|lung(4)	5	Colorectal(110;0.1)					CGGTGCTTCTGAGTGGCAACC	0.517																																					p.Q44E		Atlas-SNP	.											.	.	.	.	0			c.C130G						.						16.0	25.0	22.0					2																	131356332		2172	4252	6424	SO:0001583	missense	653275	exon3			GCTTCTGAGTGGC	AF312769	CCDS2162.1, CCDS74573.1, CCDS74574.1	2q21.2	2014-02-04			ENSG00000136698	ENSG00000136698			18292	protein-coding gene	gene with protein product		605194	"""heterotaxy 2 (autosomal dominant)"""	HTX2		11062482, 10858660	Standard	NM_032545		Approved	CRYPTIC, HTX2	uc002tro.2	P0CG37	OTTHUMG00000131628	ENST00000259216.4:c.130C>G	chr2.hg19:g.131356332G>C	ENSP00000259216:p.Gln44Glu	945.0	0.0		1179.0	177.0	NM_001079530	B2RCY0|B9EJD3|Q53T05|Q9GZR3	Missense_Mutation	SNP	ENST00000259216.4	hg19	CCDS2162.1	.	.	.	.	.	.	.	.	.	.	.	4.579	0.107512	0.08780	.	.	ENSG00000136698	ENST00000259216	D	0.89343	-2.5	1.91	1.91	0.25777	.	1.275020	0.05417	N	0.543449	D	0.84238	0.5428	M	0.61703	1.905	0.09310	N	1	B	0.28470	0.213	B	0.26202	0.067	T	0.68146	-0.5486	10	0.02654	T	1	-5.6354	7.2964	0.26395	0.0:0.0:1.0:0.0	.	44	P0CG37	CFC1_HUMAN	E	44	ENSP00000259216:Q44E	ENSP00000259216:Q44E	Q	-	1	0	CFC1	131072802	0.011000	0.17503	0.063000	0.19743	0.117000	0.20001	2.818000	0.48041	1.379000	0.46325	0.436000	0.28706	CAG	.	.		0.517	CFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333367.1	NM_032545	
LRP1B	53353	hgsc.bcm.edu	37	2	141294168	141294168	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:141294168C>T	ENST00000389484.3	-	46	8595	c.7624G>A	c.(7624-7626)Gaa>Aaa	p.E2542K		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2542	LDL-receptor class A 11. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGCAGTTTTTCATCTGATTTA	0.418										TSP Lung(27;0.18)																											p.E2542K	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.G7624A						.						150.0	150.0	150.0					2																	141294168		2203	4300	6503	SO:0001583	missense	53353	exon46			GTTTTTCATCTGA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7624G>A	chr2.hg19:g.141294168C>T	ENSP00000374135:p.Glu2542Lys	130.0	0.0		200.0	42.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	34	5.382062	0.95967	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99105	-5.43	5.19	5.19	0.71726	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99635	0.9866	H	0.98426	4.23	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.97468	1.0039	10	0.72032	D	0.01	.	18.7053	0.91635	0.0:1.0:0.0:0.0	.	2542	Q9NZR2	LRP1B_HUMAN	K	2542;2480	ENSP00000374135:E2542K	ENSP00000374135:E2542K	E	-	1	0	LRP1B	141010638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.726000	0.84824	2.430000	0.82344	0.650000	0.86243	GAA	.	.		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SLC25A12	8604	hgsc.bcm.edu	37	2	172641967	172641967	+	Silent	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:172641967T>C	ENST00000422440.2	-	18	1891	c.1854A>G	c.(1852-1854)gaA>gaG	p.E618E	SLC25A12_ENST00000392592.4_Silent_p.E511E	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	618					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TAGGTGTTGGTTCTGAACCAG	0.517																																					p.E618E		Atlas-SNP	.											.	SLC25A12	59	.	0			c.A1854G						.						176.0	157.0	163.0					2																	172641967		2203	4300	6503	SO:0001819	synonymous_variant	8604	exon18			TGTTGGTTCTGAA	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1854A>G	chr2.hg19:g.172641967T>C		137.0	0.0		217.0	49.0	NM_003705	B3KR64|Q96AM8	Silent	SNP	ENST00000422440.2	hg19	CCDS33327.1																																																																																			.	.		0.517	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098961	178098961	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:178098961T>C	ENST00000397062.3	-	2	638	c.84A>G	c.(82-84)atA>atG	p.I28M	NFE2L2_ENST00000446151.2_Missense_Mutation_p.I12M|NFE2L2_ENST00000464747.1_Missense_Mutation_p.I12M|NFE2L2_ENST00000397063.4_Missense_Mutation_p.I12M|NFE2L2_ENST00000423513.1_Missense_Mutation_p.I12M	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	28					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CTCCAAGATCTATATCTTGCC	0.363			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.I28M		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	225	.	0			c.A84G						.						65.0	58.0	60.0					2																	178098961		1844	4099	5943	SO:0001583	missense	4780	exon2			AAGATCTATATCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.84A>G	chr2.hg19:g.178098961T>C	ENSP00000380252:p.Ile28Met	57.0	0.0		54.0	11.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.395205	0.42512	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.78	0.292	0.15737	.	0.042355	0.85682	D	0.000000	T	0.52901	0.1763	M	0.86740	2.835	0.46927	D	0.999257	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.80764	0.972;0.994;0.988;0.972	T	0.52646	-0.8548	10	0.87932	D	0	.	7.0251	0.24936	0.4323:0.0:0.2239:0.3438	.	12;12;12;28	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	M	12;28;12;12;12;12;12	ENSP00000380253:I12M;ENSP00000380252:I28M;ENSP00000411575:I12M;ENSP00000391590:I12M;ENSP00000400073:I12M;ENSP00000412191:I12M;ENSP00000410015:I12M	ENSP00000380252:I28M	I	-	3	3	NFE2L2	177807207	0.997000	0.39634	1.000000	0.80357	0.965000	0.64279	0.326000	0.19646	0.103000	0.17682	-2.000000	0.00444	ATA	.	.		0.363	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098968	178098968	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:178098968T>C	ENST00000397062.3	-	2	631	c.77A>G	c.(76-78)cAa>cGa	p.Q26R	NFE2L2_ENST00000446151.2_Missense_Mutation_p.Q10R|NFE2L2_ENST00000464747.1_Missense_Mutation_p.Q10R|NFE2L2_ENST00000397063.4_Missense_Mutation_p.Q10R|NFE2L2_ENST00000423513.1_Missense_Mutation_p.Q10R	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	26					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q26P(1)|p.Q26L(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ATCTATATCTTGCCTCCAAAG	0.348			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.Q26R		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,-1,2	NFE2L2	225	.	2	Substitution - Missense(2)	lung(2)	c.A77G						.						59.0	53.0	55.0					2																	178098968		1842	4098	5940	SO:0001583	missense	4780	exon2			ATATCTTGCCTCC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.77A>G	chr2.hg19:g.178098968T>C	ENSP00000380252:p.Gln26Arg	52.0	0.0		50.0	9.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.075082	0.76415	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35;1.35	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66025	0.2748	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.76494	0.999;0.993;0.998;0.999	D;D;D;D	0.80764	0.994;0.968;0.994;0.994	T	0.72782	-0.4189	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	10;10;10;26	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	R	10;26;10;10;10;10;10	ENSP00000380253:Q10R;ENSP00000380252:Q26R;ENSP00000411575:Q10R;ENSP00000391590:Q10R;ENSP00000400073:Q10R;ENSP00000412191:Q10R;ENSP00000410015:Q10R	ENSP00000380252:Q26R	Q	-	2	0	NFE2L2	177807214	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.698000	0.84413	2.210000	0.71456	0.460000	0.39030	CAA	.	.		0.348	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098972	178098972	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:178098972T>A	ENST00000397062.3	-	2	627	c.73A>T	c.(73-75)Agg>Tgg	p.R25W	NFE2L2_ENST00000446151.2_Missense_Mutation_p.R9W|NFE2L2_ENST00000464747.1_Missense_Mutation_p.R9W|NFE2L2_ENST00000397063.4_Missense_Mutation_p.R9W|NFE2L2_ENST00000423513.1_Missense_Mutation_p.R9W	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	25					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ATATCTTGCCTCCAAAGTATG	0.348			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.R25W		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	225	.	0			c.A73T						.						57.0	51.0	53.0					2																	178098972		1838	4097	5935	SO:0001583	missense	4780	exon2			CTTGCCTCCAAAG		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.73A>T	chr2.hg19:g.178098972T>A	ENSP00000380252:p.Arg25Trp	48.0	0.0		47.0	8.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852272	0.71719	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3;1.3	5.78	5.78	0.91487	.	0.081400	0.85682	D	0.000000	T	0.65428	0.2690	M	0.85542	2.76	0.54753	D	0.999985	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.87578	0.992;0.998;0.975;0.992	T	0.71570	-0.4553	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	9;9;9;25	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	W	9;25;9;9;9;9;9	ENSP00000380253:R9W;ENSP00000380252:R25W;ENSP00000411575:R9W;ENSP00000391590:R9W;ENSP00000400073:R9W;ENSP00000412191:R9W;ENSP00000410015:R9W	ENSP00000380252:R25W	R	-	1	2	NFE2L2	177807218	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.881000	0.69706	2.210000	0.71456	0.460000	0.39030	AGG	.	.		0.348	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
PLEKHA3	65977	hgsc.bcm.edu	37	2	179365879	179365879	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:179365879G>A	ENST00000234453.5	+	7	1153	c.751G>A	c.(751-753)Gat>Aat	p.D251N		NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3	251						Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TTCTTGTAGTGATATTCCTCT	0.413																																					p.D251N		Atlas-SNP	.											.	PLEKHA3	25	.	0			c.G751A						.						88.0	92.0	90.0					2																	179365879		2203	4300	6503	SO:0001583	missense	65977	exon7			TGTAGTGATATTC	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.751G>A	chr2.hg19:g.179365879G>A	ENSP00000234453:p.Asp251Asn	249.0	0.0		333.0	87.0	NM_019091	Q4ZG69|Q86TQ1|Q9NXT3	Missense_Mutation	SNP	ENST00000234453.5	hg19	CCDS33336.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002626	0.93227	.	.	ENSG00000116095	ENST00000234453;ENST00000421187	T	0.20738	2.05	5.77	5.77	0.91146	.	0.051963	0.64402	D	0.000001	T	0.34774	0.0909	L	0.27053	0.805	0.53688	D	0.999978	D	0.63880	0.993	D	0.74674	0.984	T	0.02307	-1.1179	10	0.23891	T	0.37	-3.391	19.9795	0.97321	0.0:0.0:1.0:0.0	.	251	Q9HB20	PKHA3_HUMAN	N	251;60	ENSP00000234453:D251N	ENSP00000234453:D251N	D	+	1	0	PLEKHA3	179074125	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	7.539000	0.82063	2.720000	0.93068	0.650000	0.86243	GAT	.	.		0.413	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
CTLA4	1493	hgsc.bcm.edu	37	2	204736111	204736111	+	Silent	SNP	G	G	A	rs200657280		TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr2:204736111G>A	ENST00000302823.3	+	3	625	c.468G>A	c.(466-468)ccG>ccA	p.P156P	CTLA4_ENST00000427473.2_Intron|CTLA4_ENST00000472206.1_Intron|CTLA4_ENST00000487393.1_Intron|CTLA4_ENST00000295854.6_Intron	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	156					B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	ATCCAGAACCGTGCCCAGATT	0.453																																					p.P156P		Atlas-SNP	.											.	CTLA4	24	.	0			c.G468A						.	G	,	1,4405	2.1+/-5.4	0,1,2202	172.0	162.0	165.0		,468	-9.4	1.0	2		165	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous	CTLA4	NM_001037631.2,NM_005214.4	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	,156/224	204736111	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1493	exon3			AGAACCGTGCCCA		CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.468G>A	chr2.hg19:g.204736111G>A		79.0	0.0		54.0	13.0	NM_005214	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Silent	SNP	ENST00000302823.3	hg19	CCDS2362.1																																																																																			.	G|0.999;A|0.001		0.453	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
IFT57	55081	hgsc.bcm.edu	37	3	107886700	107886700	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr3:107886700G>C	ENST00000264538.3	-	7	1036	c.789C>G	c.(787-789)atC>atG	p.I263M	IFT57_ENST00000468021.1_5'Flank	NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	263					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			GGTCAACATGGATTCTCCAAT	0.353																																					p.I263M		Atlas-SNP	.											.	IFT57	44	.	0			c.C789G						.						198.0	188.0	191.0					3																	107886700		2203	4300	6503	SO:0001583	missense	55081	exon7			AACATGGATTCTC	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.789C>G	chr3.hg19:g.107886700G>C	ENSP00000264538:p.Ile263Met	71.0	0.0		98.0	30.0	NM_018010	Q96DA9	Missense_Mutation	SNP	ENST00000264538.3	hg19	CCDS2951.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615305	0.46631	.	.	ENSG00000114446	ENST00000264538	.	.	.	5.93	4.14	0.48551	.	0.196743	0.52532	D	0.000066	T	0.56514	0.1990	L	0.37897	1.145	0.45554	D	0.998509	P	0.39480	0.675	P	0.48704	0.587	T	0.54589	-0.8271	9	0.45353	T	0.12	.	11.3385	0.49518	0.2007:0.0:0.7993:0.0	.	263	Q9NWB7	IFT57_HUMAN	M	263	.	ENSP00000264538:I263M	I	-	3	3	IFT57	109369390	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.473000	0.35387	0.831000	0.34780	0.655000	0.94253	ATC	.	.		0.353	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
LPHN3	23284	hgsc.bcm.edu	37	4	62598783	62598783	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr4:62598783A>T	ENST00000514591.1	+	7	1035	c.706A>T	c.(706-708)Agg>Tgg	p.R236W	LPHN3_ENST00000514996.1_Missense_Mutation_p.R236W|LPHN3_ENST00000545650.1_Missense_Mutation_p.R236W|LPHN3_ENST00000509896.1_Missense_Mutation_p.R304W|LPHN3_ENST00000514157.1_Missense_Mutation_p.R236W|LPHN3_ENST00000506720.1_Missense_Mutation_p.R304W|LPHN3_ENST00000508946.1_Missense_Mutation_p.R236W|LPHN3_ENST00000504896.1_Missense_Mutation_p.R236W|LPHN3_ENST00000507625.1_Missense_Mutation_p.R304W|LPHN3_ENST00000506746.1_Missense_Mutation_p.R304W|LPHN3_ENST00000512091.2_Missense_Mutation_p.R236W|LPHN3_ENST00000507164.1_Missense_Mutation_p.R304W|LPHN3_ENST00000511324.1_Missense_Mutation_p.R304W|LPHN3_ENST00000508693.1_Missense_Mutation_p.R304W|LPHN3_ENST00000506700.1_Missense_Mutation_p.R236W			Q9HAR2	LPHN3_HUMAN	latrophilin 3	236	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TTTGCGGACTAGGATAAAGAG	0.463																																					p.R236W		Atlas-SNP	.											.	LPHN3	800	.	0			c.A706T						.						79.0	73.0	75.0					4																	62598783		1903	4119	6022	SO:0001583	missense	23284	exon5			CGGACTAGGATAA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.706A>T	chr4.hg19:g.62598783A>T	ENSP00000422533:p.Arg236Trp	84.0	0.0		79.0	5.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.108454	0.56291	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.26	4.05	0.47172	.	0.000000	0.85682	D	0.000000	D	0.94837	0.8332	M	0.90198	3.095	0.53005	D	0.999968	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.992	D	0.94708	0.7889	10	0.87932	D	0	.	11.5444	0.50685	0.8498:0.1502:0.0:0.0	.	236;304;236	E9PE04;E7EN28;Q9HAR2-2	.;.;.	W	236;236;304;304;236;236;236;236;236;304;304;304;236;236;236;304;304;236	ENSP00000423388:R236W;ENSP00000422533:R236W;ENSP00000423787:R304W;ENSP00000425033:R304W;ENSP00000424120:R236W;ENSP00000439831:R236W;ENSP00000421476:R304W;ENSP00000424030:R304W;ENSP00000421372:R304W;ENSP00000425201:R236W;ENSP00000423434:R236W;ENSP00000421627:R236W;ENSP00000420931:R304W;ENSP00000425884:R304W;ENSP00000424258:R236W	ENSP00000280009:R236W	R	+	1	2	LPHN3	62281378	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.504000	0.60414	0.822000	0.34565	-0.472000	0.04984	AGG	.	.		0.463	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
IRF2	3660	hgsc.bcm.edu	37	4	185309971	185309971	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr4:185309971G>A	ENST00000393593.3	-	9	1198	c.991C>T	c.(991-993)Cgg>Tgg	p.R331W		NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	331					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		ACGCTGGCCCGGGTCTCCCGG	0.597																																					p.R331W		Atlas-SNP	.											IRF2,colon,carcinoma,0,1	IRF2	53	.	0			c.C991T						.						62.0	72.0	68.0					4																	185309971		2203	4300	6503	SO:0001583	missense	3660	exon9			TGGCCCGGGTCTC		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.991C>T	chr4.hg19:g.185309971G>A	ENSP00000377218:p.Arg331Trp	101.0	0.0		61.0	37.0	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	hg19	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611787	0.66558	.	.	ENSG00000168310	ENST00000393593	D	0.99113	-5.44	5.08	3.25	0.37280	.	0.385573	0.22328	N	0.061515	D	0.98927	0.9636	L	0.61218	1.895	0.53688	D	0.999976	D	0.89917	1.0	D	0.91635	0.999	D	0.99107	1.0845	10	0.87932	D	0	-2.7438	12.7538	0.57323	0.0:0.0:0.5362:0.4638	.	331	P14316	IRF2_HUMAN	W	331	ENSP00000377218:R331W	ENSP00000377218:R331W	R	-	1	2	IRF2	185546965	0.992000	0.36948	0.920000	0.36463	0.992000	0.81027	2.124000	0.42006	0.641000	0.30601	0.561000	0.74099	CGG	.	.		0.597	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
IRX1	79192	hgsc.bcm.edu	37	5	3600742	3600742	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr5:3600742G>T	ENST00000302006.3	+	3	1384	c.1332G>T	c.(1330-1332)agG>agT	p.R444S	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	444					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TCGTCCCCAGGCCAGATTCGC	0.617																																					p.R444S		Atlas-SNP	.											.	IRX1	106	.	0			c.G1332T						.						55.0	59.0	58.0					5																	3600742		2203	4300	6503	SO:0001583	missense	79192	exon3			CCCCAGGCCAGAT	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1332G>T	chr5.hg19:g.3600742G>T	ENSP00000305244:p.Arg444Ser	92.0	0.0		88.0	28.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	hg19	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.656142	0.29425	.	.	ENSG00000170549	ENST00000302006	T	0.60920	0.15	4.17	2.33	0.28932	.	0.420300	0.24449	N	0.038438	T	0.68026	0.2956	M	0.62723	1.935	0.44123	D	0.996901	D	0.71674	0.998	D	0.76071	0.987	T	0.64249	-0.6452	10	0.52906	T	0.07	.	7.6322	0.28247	0.3832:0.0:0.6168:0.0	.	444	P78414	IRX1_HUMAN	S	444	ENSP00000305244:R444S	ENSP00000305244:R444S	R	+	3	2	IRX1	3653742	1.000000	0.71417	0.250000	0.24296	0.162000	0.22319	1.322000	0.33689	0.211000	0.20683	0.467000	0.42956	AGG	.	.		0.617	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
EGFLAM	133584	hgsc.bcm.edu	37	5	38427168	38427168	+	Missense_Mutation	SNP	C	C	G	rs370628892		TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr5:38427168C>G	ENST00000354891.3	+	14	2214	c.1868C>G	c.(1867-1869)cCc>cGc	p.P623R	EGFLAM_ENST00000336740.6_Missense_Mutation_p.P389R|EGFLAM_ENST00000322350.5_Missense_Mutation_p.P623R|EGFLAM-AS1_ENST00000508986.1_RNA|EGFLAM_ENST00000397202.2_5'UTR	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	623	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GCTGCAACTCCCTGGCCACTG	0.483																																					p.P623R	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.C1868G						.						166.0	163.0	164.0					5																	38427168		2203	4300	6503	SO:0001583	missense	133584	exon14			CAACTCCCTGGCC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1868C>G	chr5.hg19:g.38427168C>G	ENSP00000346964:p.Pro623Arg	43.0	0.0		66.0	24.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	hg19	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.428998	0.25726	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.70282	-0.47;-0.47;-0.47	5.76	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.056805	0.64402	D	0.000001	T	0.64249	0.2581	L	0.50993	1.605	0.80722	D	1	B;B;B	0.31893	0.122;0.345;0.009	B;B;B	0.32211	0.117;0.142;0.009	T	0.59804	-0.7385	10	0.16896	T	0.51	-11.7169	15.058	0.71930	0.0:0.731:0.269:0.0	.	389;623;623	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	R	623;623;389;389	ENSP00000346964:P623R;ENSP00000313084:P623R;ENSP00000337607:P389R	ENSP00000313084:P623R	P	+	2	0	EGFLAM	38462925	0.976000	0.34144	0.957000	0.39632	0.202000	0.24057	2.957000	0.49137	1.394000	0.46624	0.655000	0.94253	CCC	.	.		0.483	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
FNIP1	96459	hgsc.bcm.edu	37	5	131013525	131013525	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr5:131013525G>A	ENST00000510461.1	-	13	1485	c.1390C>T	c.(1390-1392)Ctt>Ttt	p.L464F	FNIP1_ENST00000307968.7_Missense_Mutation_p.L436F|FNIP1_ENST00000511848.1_Missense_Mutation_p.L464F|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307954.8_Missense_Mutation_p.L419F	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	464					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		ACCCAGGCAAGATGATTGGTC	0.388																																					p.L464F		Atlas-SNP	.											.	FNIP1	104	.	0			c.C1390T						.						90.0	87.0	88.0					5																	131013525		2203	4300	6503	SO:0001583	missense	96459	exon13			AGGCAAGATGATT	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1390C>T	chr5.hg19:g.131013525G>A	ENSP00000421985:p.Leu464Phe	91.0	0.0		69.0	18.0	NM_133372	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	hg19	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972914	0.92919	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.45	5.45	0.79879	.	.	.	.	.	T	0.73961	0.3654	M	0.84846	2.72	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.997;0.999;1.0	T	0.77474	-0.2574	9	0.72032	D	0.01	-7.3683	19.6467	0.95778	0.0:0.0:1.0:0.0	.	464;464;436;464	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	F	436;419;224;464;464	ENSP00000309266:L436F;ENSP00000310453:L419F;ENSP00000421985:L464F;ENSP00000425619:L464F	ENSP00000310453:L419F	L	-	1	0	FNIP1	131041424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.346000	0.72999	2.716000	0.92895	0.655000	0.94253	CTT	.	.		0.388	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
TNIP1	10318	hgsc.bcm.edu	37	5	150415262	150415262	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr5:150415262T>C	ENST00000389378.2	-	14	1990	c.1402A>G	c.(1402-1404)Atc>Gtc	p.I468V	TNIP1_ENST00000521591.1_Missense_Mutation_p.I468V|TNIP1_ENST00000524280.1_Missense_Mutation_p.I468V|TNIP1_ENST00000523200.1_Missense_Mutation_p.I468V|TNIP1_ENST00000518977.1_Missense_Mutation_p.I468V|TNIP1_ENST00000521423.1_Intron|TNIP1_ENST00000520931.1_Missense_Mutation_p.I415V|TNIP1_ENST00000315050.7_Missense_Mutation_p.I468V|TNIP1_ENST00000522226.1_Missense_Mutation_p.I468V|TNIP1_ENST00000523338.1_Missense_Mutation_p.I468V	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	468	Required for inhibitory activity of TNF- induced NF-kappa-B activation. {ECO:0000250}.|Ubiquitin-binding domain (UBD).				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCTCGAAGATCTTCACCTGG	0.592																																					p.I468V		Atlas-SNP	.											.	TNIP1	51	.	0			c.A1402G						.						82.0	70.0	74.0					5																	150415262		2203	4300	6503	SO:0001583	missense	10318	exon14			CGAAGATCTTCAC	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1402A>G	chr5.hg19:g.150415262T>C	ENSP00000374029:p.Ile468Val	41.0	0.0		36.0	11.0	NM_001252385	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	hg19	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.270156	0.80469	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000517504;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840	D;D;D;D;D;D;D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96;-3.96;-3.96;-3.96;-3.96;-3.96;-3.96	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.97598	0.9213	M	0.74881	2.28	0.51233	D	0.999911	D;D;D;D;D;D;D	0.89917	0.993;0.997;0.991;0.997;0.997;0.999;1.0	D;D;D;D;D;D;D	0.85130	0.984;0.993;0.978;0.993;0.993;0.997;0.997	D	0.97035	0.9753	10	0.23302	T	0.38	-19.6252	14.8334	0.70164	0.0:0.0:0.0:1.0	.	468;422;422;468;468;468;468	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	V	415;468;81;468;468;425;425;430;468;468;468;468;468;425	ENSP00000429891:I415V;ENSP00000374029:I468V;ENSP00000430739:I81V;ENSP00000317891:I468V;ENSP00000428243:I468V;ENSP00000428187:I468V;ENSP00000430760:I468V;ENSP00000430971:I468V;ENSP00000429912:I468V;ENSP00000431105:I468V	ENSP00000317891:I468V	I	-	1	0	TNIP1	150395455	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.613000	0.67688	2.086000	0.62901	0.459000	0.35465	ATC	.	.		0.592	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058	
DSP	1832	hgsc.bcm.edu	37	6	7580097	7580097	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr6:7580097C>G	ENST00000379802.3	+	23	4015	c.3674C>G	c.(3673-3675)tCc>tGc	p.S1225C	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1225	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAGGAGATATCCATGCAAAAA	0.373																																					p.S1225C		Atlas-SNP	.											.	DSP	306	.	0			c.C3674G						.						75.0	72.0	73.0					6																	7580097		2203	4300	6503	SO:0001583	missense	1832	exon23			AGATATCCATGCA	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3674C>G	chr6.hg19:g.7580097C>G	ENSP00000369129:p.Ser1225Cys	183.0	0.0		300.0	193.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	hg19	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265944	0.59540	.	.	ENSG00000096696	ENST00000379802	D	0.92699	-3.09	5.37	5.37	0.77165	.	0.117336	0.38778	N	0.001579	D	0.87341	0.6153	L	0.34521	1.04	0.80722	D	1	P	0.44578	0.838	B	0.43916	0.436	D	0.89031	0.3442	10	0.56958	D	0.05	.	18.7003	0.91618	0.0:1.0:0.0:0.0	.	1225	P15924	DESP_HUMAN	C	1225	ENSP00000369129:S1225C	ENSP00000369129:S1225C	S	+	2	0	DSP	7525096	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.917000	0.63369	2.518000	0.84900	0.557000	0.71058	TCC	.	.		0.373	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
SLC17A4	10050	hgsc.bcm.edu	37	6	25776923	25776923	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr6:25776923T>A	ENST00000377905.4	+	9	1207	c.1088T>A	c.(1087-1089)cTc>cAc	p.L363H	SLC17A4_ENST00000439485.2_Missense_Mutation_p.L133H|SLC17A4_ENST00000397076.2_Missense_Mutation_p.L133H	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	363					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ATCCTCAGACTCATCACCATC	0.488																																					p.L363H		Atlas-SNP	.											.	SLC17A4	79	.	0			c.T1088A						.						172.0	159.0	164.0					6																	25776923		2203	4300	6503	SO:0001583	missense	10050	exon9			TCAGACTCATCAC	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1088T>A	chr6.hg19:g.25776923T>A	ENSP00000367137:p.Leu363His	115.0	0.0		173.0	30.0	NM_005495	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	hg19	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.700694	0.68501	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.61859	0.11;0.14;0.07	5.63	5.63	0.86233	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.45867	D	0.000332	T	0.64951	0.2645	M	0.64676	1.99	0.35717	D	0.816877	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.993;0.984	T	0.69359	-0.5166	10	0.48119	T	0.1	.	12.535	0.56137	0.0:0.0:0.0:1.0	.	133;133;363	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	H	363;133;133	ENSP00000367137:L363H;ENSP00000391345:L133H;ENSP00000380266:L133H	ENSP00000367137:L363H	L	+	2	0	SLC17A4	25884902	0.519000	0.26242	0.515000	0.27774	0.996000	0.88848	2.608000	0.46308	2.279000	0.76181	0.533000	0.62120	CTC	.	.		0.488	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		
RUNX2	860	hgsc.bcm.edu	37	6	45390466	45390466	+	Silent	SNP	A	A	G	rs575896136	byFrequency	TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr6:45390466A>G	ENST00000371438.1	+	2	553	c.195A>G	c.(193-195)caA>caG	p.Q65Q	RUNX2_ENST00000541979.1_Silent_p.Q133Q|RUNX2_ENST00000359524.5_Silent_p.Q51Q|RUNX2_ENST00000371436.6_Silent_p.Q65Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371432.3_Silent_p.Q51Q|RUNX2_ENST00000352853.5_Silent_p.Q133Q|RUNX2_ENST00000465038.2_Silent_p.Q65Q|RUNX2_ENST00000576263.1_Silent_p.Q65Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	65	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	8	0.00159744	0.0023	0.0	5008	,	,		7675	0.002		0.0	False		,,,				2504	0.0031				p.Q65Q		Atlas-SNP	.											.	RUNX2	128	.	0			c.A195G						.						10.0	15.0	14.0					6																	45390466		1452	3071	4523	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.195A>G	chr6.hg19:g.45390466A>G		48.0	0.0		103.0	5.0	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
RP9	6100	hgsc.bcm.edu	37	7	33136968	33136968	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr7:33136968C>T	ENST00000297157.3	-	4	337	c.320G>A	c.(319-321)cGt>cAt	p.R107H		NM_203288.1	NP_976033.1	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9 (autosomal dominant)	107	PIM1-binding. {ECO:0000250}.				cognition (GO:0050890)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|signal recognition particle receptor complex (GO:0005785)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|urinary_tract(1)	7			GBM - Glioblastoma multiforme(11;0.0403)			GCGTTTGCAACGCCAACCTAA	0.363																																					p.R107H		Atlas-SNP	.											.	RP9	19	.	0			c.G320A						.						79.0	75.0	76.0					7																	33136968		2203	4300	6503	SO:0001583	missense	6100	exon4			TTGCAACGCCAAC	AX016710	CCDS5440.1	7p14.3	2014-01-28			ENSG00000164610	ENSG00000164610			10288	protein-coding gene	gene with protein product	"""Pim-1 kinase associated protein"""	607331				8513323	Standard	NM_203288		Approved	PAP-1	uc003tdm.3	Q8TA86	OTTHUMG00000152988	ENST00000297157.3:c.320G>A	chr7.hg19:g.33136968C>T	ENSP00000297157:p.Arg107His	54.0	0.0		59.0	19.0	NM_203288		Missense_Mutation	SNP	ENST00000297157.3	hg19	CCDS5440.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654263	0.67472	.	.	ENSG00000164610	ENST00000297157;ENST00000448915	D;D	0.83163	-1.69;-1.69	3.77	3.77	0.43336	Zinc finger, CCHC-type (1);	0.000000	0.85682	D	0.000000	T	0.81024	0.4737	M	0.76727	2.345	0.53688	D	0.999979	P	0.40050	0.7	B	0.32583	0.148	D	0.85052	0.0929	10	0.56958	D	0.05	-43.348	16.449	0.83973	0.0:1.0:0.0:0.0	.	107	Q8TA86	RP9_HUMAN	H	107;73	ENSP00000297157:R107H;ENSP00000411577:R73H	ENSP00000297157:R107H	R	-	2	0	RP9	33103493	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.032000	0.76498	2.028000	0.59812	0.400000	0.26472	CGT	.	.		0.363	RP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328914.1	NM_203288	
MELK	9833	hgsc.bcm.edu	37	9	36589546	36589546	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr9:36589546G>T	ENST00000298048.2	+	4	342	c.158G>T	c.(157-159)cGg>cTg	p.R53L	MELK_ENST00000536329.1_Intron|MELK_ENST00000543751.1_Missense_Mutation_p.R21L|MELK_ENST00000541717.1_Missense_Mutation_p.R53L|MELK_ENST00000538311.1_5'UTR|MELK_ENST00000487398.1_3'UTR|MELK_ENST00000536987.1_5'UTR|MELK_ENST00000536860.1_Missense_Mutation_p.R53L|MELK_ENST00000545008.1_Missense_Mutation_p.R53L	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	53	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GATTTGCCCCGGATCAAAACG	0.398																																					p.R53L	Ovarian(82;980 1317 7225 14391 18624)	Atlas-SNP	.											.	MELK	74	.	0			c.G158T						.						167.0	152.0	158.0					9																	36589546		2203	4300	6503	SO:0001583	missense	9833	exon4			TGCCCCGGATCAA	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.158G>T	chr9.hg19:g.36589546G>T	ENSP00000298048:p.Arg53Leu	81.0	0.0		63.0	25.0	NM_001256688	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	hg19	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	G	30	5.053502	0.93793	.	.	ENSG00000165304	ENST00000298048;ENST00000545008;ENST00000536860;ENST00000541717;ENST00000543751	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;1.81	5.21	5.21	0.72293	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72326	0.3446	L	0.33668	1.02	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.998;0.999;0.999;1.0;0.999	T	0.75703	-0.3225	10	0.87932	D	0	-9.8066	18.7878	0.91961	0.0:0.0:1.0:0.0	.	21;53;53;53;21;53	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A7;Q14680	.;.;.;.;.;MELK_HUMAN	L	53;53;53;53;21	ENSP00000298048:R53L;ENSP00000445452:R53L;ENSP00000439792:R53L;ENSP00000437804:R53L;ENSP00000441596:R21L	ENSP00000298048:R53L	R	+	2	0	MELK	36579546	1.000000	0.71417	0.522000	0.27862	0.948000	0.59901	9.142000	0.94618	2.446000	0.82766	0.655000	0.94253	CGG	.	.		0.398	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
NRP1	8829	hgsc.bcm.edu	37	10	33510747	33510747	+	Silent	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr10:33510747T>C	ENST00000265371.4	-	9	1707	c.1182A>G	c.(1180-1182)gtA>gtG	p.V394V	NRP1_ENST00000374867.2_Silent_p.V394V|NRP1_ENST00000374816.3_Silent_p.V394V|NRP1_ENST00000374821.5_Silent_p.V394V|NRP1_ENST00000374823.5_Silent_p.V394V|NRP1_ENST00000432372.2_Silent_p.V394V|NRP1_ENST00000395995.1_Silent_p.V394V|NRP1_ENST00000374875.1_Silent_p.V213V|NRP1_ENST00000374822.4_Silent_p.V394V			O14786	NRP1_HUMAN	neuropilin 1	394	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GTTTGGGGAATACTGCAACCA	0.418																																					p.V394V	Melanoma(104;886 1489 44640 45944 51153)	Atlas-SNP	.											.	NRP1	126	.	0			c.A1182G						.						161.0	153.0	156.0					10																	33510747		2203	4300	6503	SO:0001819	synonymous_variant	8829	exon8			GGGGAATACTGCA	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1182A>G	chr10.hg19:g.33510747T>C		129.0	0.0		116.0	45.0	NM_001244973	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Silent	SNP	ENST00000265371.4	hg19	CCDS7177.1																																																																																			.	.		0.418	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2		
VSTM4	196740	hgsc.bcm.edu	37	10	50255074	50255074	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr10:50255074G>T	ENST00000332853.4	-	7	814	c.791C>A	c.(790-792)aCg>aAg	p.T264K		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T264R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						TTTATGGAACGTGGGGGCTAT	0.473																																					p.T264K		Atlas-SNP	.											VSTM4,NS,carcinoma,0,1	VSTM4	83	.	1	Substitution - Missense(1)	lung(1)	c.C791A						.						324.0	295.0	305.0					10																	50255074		2203	4300	6503	SO:0001583	missense	196740	exon7			TGGAACGTGGGGG	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.791C>A	chr10.hg19:g.50255074G>T	ENSP00000331062:p.Thr264Lys	128.0	0.0		125.0	38.0	NM_001031746	B4DNI6|Q96MX7	Missense_Mutation	SNP	ENST00000332853.4	hg19	CCDS31198.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839349	0.32513	.	.	ENSG00000165633	ENST00000332853	T	0.05855	3.38	5.92	5.92	0.95590	.	0.514470	0.21973	N	0.066437	T	0.02649	0.0080	N	0.01352	-0.895	0.80722	D	1	B	0.24768	0.111	B	0.20577	0.03	T	0.56183	-0.8021	10	0.12430	T	0.62	-3.0249	15.8243	0.78686	0.0:0.0:1.0:0.0	.	264	Q8IW00	VSTM4_HUMAN	K	264	ENSP00000331062:T264K	ENSP00000331062:T264K	T	-	2	0	VSTM4	49925080	0.177000	0.23109	0.036000	0.18154	0.071000	0.16799	3.182000	0.50910	2.811000	0.96726	0.555000	0.69702	ACG	.	.		0.473	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984	
BTAF1	9044	hgsc.bcm.edu	37	10	93744021	93744021	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr10:93744021T>C	ENST00000265990.6	+	19	2595	c.2287T>C	c.(2287-2289)Tat>Cat	p.Y763H	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	763					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				AGAACATTTATATTATGACGA	0.353																																					p.Y763H		Atlas-SNP	.											.	BTAF1	148	.	0			c.T2287C						.						103.0	94.0	97.0					10																	93744021		2202	4300	6502	SO:0001583	missense	9044	exon19			CATTTATATTATG	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.2287T>C	chr10.hg19:g.93744021T>C	ENSP00000265990:p.Tyr763His	105.0	0.0		76.0	24.0	NM_003972	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	hg19	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.977054	0.74360	.	.	ENSG00000095564	ENST00000265990	T	0.64803	-0.12	5.67	5.67	0.87782	Domain of unknown function DUF3535 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79118	0.4392	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.77731	-0.2478	10	0.27082	T	0.32	-4.614	15.9104	0.79470	0.0:0.0:0.0:1.0	.	763;763	Q2M1V9;O14981	.;BTAF1_HUMAN	H	763	ENSP00000265990:Y763H	ENSP00000265990:Y763H	Y	+	1	0	BTAF1	93734001	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.040000	0.89188	2.155000	0.67459	0.528000	0.53228	TAT	.	.		0.353	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
TSSC4	10078	hgsc.bcm.edu	37	11	2424065	2424065	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr11:2424065C>T	ENST00000333256.6	+	3	645	c.202C>T	c.(202-204)Ccc>Tcc	p.P68S	TSSC4_ENST00000380992.1_Intron|AC124057.5_ENST00000433035.1_RNA|TSSC4_ENST00000380996.5_Intron|TSSC4_ENST00000451491.2_Missense_Mutation_p.P68S			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	68										endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCGCCCTCACCCCCGTCAGG	0.637																																					p.P68S		Atlas-SNP	.											.	TSSC4	19	.	0			c.C202T						.						37.0	30.0	32.0					11																	2424065		2192	4296	6488	SO:0001583	missense	10078	exon2			CCCTCACCCCCGT	AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.202C>T	chr11.hg19:g.2424065C>T	ENSP00000331087:p.Pro68Ser	80.0	0.0		81.0	33.0	NM_005706	C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	ENST00000333256.6	hg19	CCDS7735.1	.	.	.	.	.	.	.	.	.	.	C	3.429	-0.116589	0.06838	.	.	ENSG00000184281	ENST00000333256;ENST00000437110;ENST00000435795;ENST00000485682;ENST00000496468;ENST00000451491	T;T;T;T;T;T	0.45276	2.54;1.56;0.9;0.91;1.56;2.54	3.07	0.937	0.19494	.	0.515929	0.16858	U	0.196644	T	0.33030	0.0849	M	0.62723	1.935	0.09310	N	1	B	0.29432	0.244	B	0.27076	0.076	T	0.15867	-1.0422	9	.	.	.	-2.7914	4.7102	0.12868	0.0:0.5819:0.184:0.2342	.	68	Q9Y5U2	TSSC4_HUMAN	S	68	ENSP00000331087:P68S;ENSP00000396925:P68S;ENSP00000403475:P68S;ENSP00000431430:P68S;ENSP00000435013:P68S;ENSP00000411224:P68S	.	P	+	1	0	TSSC4	2380641	0.000000	0.05858	0.001000	0.08648	0.103000	0.19146	-0.004000	0.12878	0.653000	0.30826	0.462000	0.41574	CCC	.	.		0.637	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027369.3	NM_005706	
OR52B4	143496	hgsc.bcm.edu	37	11	4389234	4389234	+	Missense_Mutation	SNP	G	G	A	rs267602877		TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr11:4389234G>A	ENST00000408920.2	-	1	382	c.292C>T	c.(292-294)Cgt>Tgt	p.R98C		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	98					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGATGCAACGATCCAGGGAG	0.527																																					p.R98C		Atlas-SNP	.											.	OR52B4	56	.	0			c.C292T						.						101.0	104.0	103.0					11																	4389234		2145	4245	6390	SO:0001583	missense	143496	exon1			TGCAACGATCCAG	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.292C>T	chr11.hg19:g.4389234G>A	ENSP00000386160:p.Arg98Cys	137.0	0.0		128.0	49.0	NM_001005161	A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	hg19	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	G	2.127	-0.400048	0.04865	.	.	ENSG00000221996	ENST00000408920	T	0.03035	4.07	5.28	-10.6	0.00265	GPCR, rhodopsin-like superfamily (1);	1.091190	0.06975	N	0.818824	T	0.01800	0.0057	N	0.11892	0.195	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.48031	-0.9070	10	0.62326	D	0.03	.	5.3366	0.15961	0.5348:0.2427:0.088:0.1345	.	98	Q8NGK2	O52B4_HUMAN	C	98	ENSP00000386160:R98C	ENSP00000386160:R98C	R	-	1	0	OR52B4	4345810	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-3.536000	0.00438	-2.787000	0.00358	-2.226000	0.00293	CGT	.	.		0.527	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
AHNAK	79026	hgsc.bcm.edu	37	11	62295933	62295933	+	Missense_Mutation	SNP	T	T	C	rs543137707		TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr11:62295933T>C	ENST00000378024.4	-	5	6230	c.5956A>G	c.(5956-5958)Acc>Gcc	p.T1986A	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1986					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATCTTGGGGGTCTTGAAGTGC	0.507													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22609	0.0		0.0	False		,,,				2504	0.0				p.T1986A		Atlas-SNP	.											.	AHNAK	532	.	0			c.A5956G						.						269.0	276.0	273.0					11																	62295933		2202	4299	6501	SO:0001583	missense	79026	exon5			TGGGGGTCTTGAA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5956A>G	chr11.hg19:g.62295933T>C	ENSP00000367263:p.Thr1986Ala	102.0	0.0		109.0	8.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	t	0.001	-3.251305	0.00022	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.00856	5.61	3.78	-1.22	0.09494	.	.	.	.	.	T	0.00300	0.0009	N	0.00459	-1.475	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.42344	-0.9457	9	0.02654	T	1	.	5.0121	0.14317	0.0:0.5779:0.149:0.273	.	1986	Q09666	AHNK_HUMAN	A	75;1986	ENSP00000367263:T1986A	ENSP00000244934:T75A	T	-	1	0	AHNAK	62052509	0.873000	0.30073	0.009000	0.14445	0.052000	0.14988	0.460000	0.21924	-0.580000	0.05944	-0.802000	0.03209	ACC	.	.		0.507	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
CCDC84	338657	hgsc.bcm.edu	37	11	118886070	118886070	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr11:118886070G>C	ENST00000334418.1	+	10	915	c.859G>C	c.(859-861)Gat>Cat	p.D287H	RPS25_ENST00000528547.1_5'Flank	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	287										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		GGCCAACTTTGATCACAGCTC	0.488																																					p.D287H		Atlas-SNP	.											.	CCDC84	21	.	0			c.G859C						.						39.0	42.0	41.0					11																	118886070		2200	4295	6495	SO:0001583	missense	338657	exon10			AACTTTGATCACA	AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.859G>C	chr11.hg19:g.118886070G>C	ENSP00000334767:p.Asp287His	128.0	0.0		118.0	42.0	NM_198489		Missense_Mutation	SNP	ENST00000334418.1	hg19	CCDS8405.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059383	0.93846	.	.	ENSG00000186166	ENST00000334418	T	0.47528	0.84	5.76	5.76	0.90799	.	0.091955	0.64402	D	0.000001	T	0.69655	0.3135	M	0.65498	2.005	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.70817	-0.4769	10	0.87932	D	0	-23.307	19.9738	0.97296	0.0:0.0:1.0:0.0	.	287	Q86UT8	CCD84_HUMAN	H	287	ENSP00000334767:D287H	ENSP00000334767:D287H	D	+	1	0	CCDC84	118391280	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.275000	0.95738	2.732000	0.93576	0.655000	0.94253	GAT	.	.		0.488	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389315.1	NM_198489	
TAS2R50	259296	hgsc.bcm.edu	37	12	11138987	11138987	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr12:11138987T>C	ENST00000506868.1	-	1	524	c.473A>G	c.(472-474)tAt>tGt	p.Y158C	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	158					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						GTTTCCTTCATATTCTTCTGC	0.398																																					p.Y158C		Atlas-SNP	.											.	TAS2R50	37	.	0			c.A473G						.						171.0	164.0	166.0					12																	11138987		2203	4300	6503	SO:0001583	missense	259296	exon1			CCTTCATATTCTT	AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.473A>G	chr12.hg19:g.11138987T>C	ENSP00000424040:p.Tyr158Cys	120.0	0.0		123.0	41.0	NM_176890	P59545|Q2M255|Q645Y0	Missense_Mutation	SNP	ENST00000506868.1	hg19	CCDS8638.1	.	.	.	.	.	.	.	.	.	.	T	4.909	0.168934	0.09339	.	.	ENSG00000212126	ENST00000506868	T	0.37752	1.18	2.08	-0.897	0.10553	.	1.002760	0.08044	U	0.995590	T	0.31009	0.0783	L	0.58810	1.83	0.09310	N	1	B	0.18013	0.025	B	0.23852	0.049	T	0.36986	-0.9725	10	0.44086	T	0.13	.	3.3518	0.07155	0.0:0.1551:0.2363:0.6086	.	158	P59544	T2R50_HUMAN	C	158	ENSP00000424040:Y158C	ENSP00000424040:Y158C	Y	-	2	0	TAS2R50	11030254	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-0.410000	0.07151	-0.360000	0.08138	0.260000	0.18958	TAT	.	.		0.398	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370192.2	NM_176890	
PHLDA1	22822	hgsc.bcm.edu	37	12	76424919	76424919	+	Silent	SNP	C	C	T	rs527917078|rs371223910	byFrequency	TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr12:76424919C>T	ENST00000266671.5	-	1	2793	c.603G>A	c.(601-603)caG>caA	p.Q201Q	RP11-290L1.3_ENST00000552367.1_RNA|PHLDA1_ENST00000602540.1_Silent_p.Q60Q|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	201	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Q201Q(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gctgttgttgctgctgctgct	0.642																																					p.Q201Q		Atlas-SNP	.											PHLDA1,caecum,carcinoma,0,2	PHLDA1	39	.	1	Substitution - coding silent(1)	endometrium(1)	c.G603A						.						14.0	16.0	16.0					12																	76424919		2187	4264	6451	SO:0001819	synonymous_variant	22822	exon1			TTGTTGCTGCTGC	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.603G>A	chr12.hg19:g.76424919C>T		28.0	0.0		23.0	2.0	NM_007350	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Silent	SNP	ENST00000266671.5	hg19	CCDS31861.1																																																																																			.	.		0.642	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
SH2B3	10019	hgsc.bcm.edu	37	12	111885580	111885580	+	Missense_Mutation	SNP	G	G	T	rs74163667		TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr12:111885580G>T	ENST00000341259.2	+	7	1714	c.1357G>T	c.(1357-1359)Gcc>Tcc	p.A453S	SH2B3_ENST00000538307.1_Missense_Mutation_p.A251S	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	453	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	GTGCGGCGCCGCCTGTGATGT	0.642																																					p.A453S		Atlas-SNP	.											.	SH2B3	62	.	0			c.G1357T						.						64.0	56.0	59.0					12																	111885580		2203	4300	6503	SO:0001583	missense	10019	exon7			GGCGCCGCCTGTG	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1357G>T	chr12.hg19:g.111885580G>T	ENSP00000345492:p.Ala453Ser	57.0	0.0		64.0	4.0	NM_005475	B9EGG5|O95184	Missense_Mutation	SNP	ENST00000341259.2	hg19	CCDS9153.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476594	0.44044	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.43294	0.95;0.95	4.96	4.96	0.65561	SH2 motif (1);	0.096959	0.64402	N	0.000001	T	0.22126	0.0533	N	0.08118	0	0.80722	D	1	B;B;P	0.38535	0.386;0.289;0.635	B;B;B	0.41764	0.366;0.201;0.347	T	0.12400	-1.0549	10	0.06236	T	0.91	-2.7783	9.9527	0.41649	0.1278:0.0:0.8722:0.0	.	251;317;453	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	S	453;263;251	ENSP00000345492:A453S;ENSP00000440597:A251S	ENSP00000345492:A453S	A	+	1	0	SH2B3	110369963	1.000000	0.71417	0.946000	0.38457	0.705000	0.40729	6.249000	0.72427	2.474000	0.83562	0.462000	0.41574	GCC	.	.		0.642	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
NPAS3	64067	hgsc.bcm.edu	37	14	34269937	34269937	+	Silent	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr14:34269937G>A	ENST00000356141.4	+	12	2424	c.2424G>A	c.(2422-2424)agG>agA	p.R808R	NPAS3_ENST00000346562.2_Silent_p.R776R|NPAS3_ENST00000551492.1_Silent_p.R813R|NPAS3_ENST00000548645.1_Silent_p.R778R|NPAS3_ENST00000357798.5_Silent_p.R795R			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	808					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TGGTGCACAGGGTGACCGGGA	0.716																																					p.R808R		Atlas-SNP	.											.	NPAS3	266	.	0			c.G2424A						.						9.0	9.0	9.0					14																	34269937		2159	4216	6375	SO:0001819	synonymous_variant	64067	exon12			GCACAGGGTGACC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2424G>A	chr14.hg19:g.34269937G>A		41.0	0.0		39.0	9.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	hg19	CCDS53891.1																																																																																			.	.		0.716	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
RFX7	64864	hgsc.bcm.edu	37	15	56388062	56388062	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr15:56388062T>C	ENST00000559447.2	-	9	1844	c.1573A>G	c.(1573-1575)Atc>Gtc	p.I525V	RFX7_ENST00000423270.1_Missense_Mutation_p.I622V|RFX7_ENST00000422057.1_Missense_Mutation_p.I525V|RFX7_ENST00000317318.6_Missense_Mutation_p.I622V			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	525					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GATAGAGTGATAGTGCTTTGA	0.408																																					p.I622V		Atlas-SNP	.											.	RFX7	170	.	0			c.A1864G						.						91.0	87.0	88.0					15																	56388062		1995	4169	6164	SO:0001583	missense	64864	exon9			GAGTGATAGTGCT			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1573A>G	chr15.hg19:g.56388062T>C	ENSP00000453281:p.Ile525Val	21.0	0.0		23.0	9.0	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	hg19		.	.	.	.	.	.	.	.	.	.	T	0.153	-1.089567	0.01873	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.49432	0.78;0.78;0.78	5.5	-9.57	0.00562	.	1.024190	0.07800	N	0.956385	T	0.15782	0.0380	N	0.03608	-0.345	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42085	-0.9472	10	0.02654	T	1	1.1266	10.5474	0.45068	0.0:0.2693:0.153:0.5777	.	525;525	Q2KHR2;C9JU50	RFX7_HUMAN;.	V	525;622;622	ENSP00000387504:I525V;ENSP00000313299:I622V;ENSP00000397644:I622V	ENSP00000313299:I622V	I	-	1	0	RFX7	54175354	0.524000	0.26282	0.161000	0.22692	0.928000	0.56348	-0.234000	0.09028	-1.265000	0.02449	-1.151000	0.01829	ATC	.	.		0.408	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
HERC1	8925	hgsc.bcm.edu	37	15	63916053	63916053	+	Silent	SNP	C	C	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr15:63916053C>T	ENST00000443617.2	-	73	13569	c.13482G>A	c.(13480-13482)gcG>gcA	p.A4494A		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4494					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CTACTTGTCTCGCTATTTGGA	0.453																																					p.A4494A		Atlas-SNP	.											.	HERC1	624	.	0			c.G13482A						.						81.0	80.0	80.0					15																	63916053		1943	4142	6085	SO:0001819	synonymous_variant	8925	exon73			TTGTCTCGCTATT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.13482G>A	chr15.hg19:g.63916053C>T		61.0	0.0		72.0	24.0	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	hg19	CCDS45277.1																																																																																			.	.		0.453	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
AXIN1	8312	hgsc.bcm.edu	37	16	354369	354369	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr16:354369C>A	ENST00000262320.3	-	5	1560	c.1189G>T	c.(1189-1191)Gag>Tag	p.E397*	AXIN1_ENST00000354866.3_Nonsense_Mutation_p.E397*|AXIN1_ENST00000481769.1_5'UTR	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	397	Interaction with GSK3B. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.?(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TGCACAGCCTCCAGGCGGTGG	0.706																																					p.E397X		Atlas-SNP	.											.	AXIN1	290	.	1	Unknown(1)	liver(1)	c.G1189T						.						29.0	29.0	29.0					16																	354369		2202	4293	6495	SO:0001587	stop_gained	8312	exon5			CAGCCTCCAGGCG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1189G>T	chr16.hg19:g.354369C>A	ENSP00000262320:p.Glu397*	105.0	0.0		71.0	44.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	41	9.002289	0.99033	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.2156	18.617	0.91306	0.0:1.0:0.0:0.0	.	.	.	.	X	397	.	ENSP00000262320:E397X	E	-	1	0	AXIN1	294370	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.625000	0.83145	2.418000	0.82041	0.563000	0.77884	GAG	.	.		0.706	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
RNF167	26001	hgsc.bcm.edu	37	17	4848077	4848077	+	Silent	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr17:4848077G>A	ENST00000262482.6	+	10	1475	c.819G>A	c.(817-819)caG>caA	p.Q273Q	RNF167_ENST00000571816.1_Silent_p.Q273Q|RNF167_ENST00000575111.1_Silent_p.Q273Q|RNF167_ENST00000572430.1_Silent_p.Q273Q|RNF167_ENST00000576229.1_Silent_p.Q238Q	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167	273					negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						TTTGCAAGCAGCCTGTTCATC	0.602																																					p.Q273Q		Atlas-SNP	.											.	RNF167	14	.	0			c.G819A						.						112.0	111.0	112.0					17																	4848077		2203	4300	6503	SO:0001819	synonymous_variant	26001	exon10			CAAGCAGCCTGTT	AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.819G>A	chr17.hg19:g.4848077G>A		119.0	0.0		114.0	38.0	NM_015528	D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	Silent	SNP	ENST00000262482.6	hg19	CCDS11060.1																																																																																			.	.		0.602	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216854.3	NM_015528	
ALOX15B	247	hgsc.bcm.edu	37	17	7951790	7951790	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr17:7951790G>C	ENST00000380183.4	+	14	2077	c.1938G>C	c.(1936-1938)caG>caC	p.Q646H	ALOX15B_ENST00000380173.2_Missense_Mutation_p.Q617H|ALOX15B_ENST00000573359.1_Missense_Mutation_p.Q572H|ALOX15B_ENST00000572022.1_Missense_Mutation_p.Q634H	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	646	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						GCCTGGCCCAGATCTCGAGGG	0.637																																					p.Q646H		Atlas-SNP	.											.	ALOX15B	66	.	0			c.G1938C						.						68.0	73.0	71.0					17																	7951790		2203	4300	6503	SO:0001583	missense	247	exon14			GGCCCAGATCTCG	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1938G>C	chr17.hg19:g.7951790G>C	ENSP00000369530:p.Gln646His	55.0	0.0		47.0	19.0	NM_001141	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	hg19	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.596515	0.28445	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.90004	-2.6;-2.6	3.74	2.77	0.32553	Lipoxygenase, C-terminal (3);	0.710389	0.13984	N	0.349250	D	0.92277	0.7550	M	0.72353	2.195	0.29685	N	0.841373	P;P;P;D	0.53619	0.916;0.898;0.898;0.961	P;P;P;P	0.62014	0.852;0.769;0.769;0.897	D	0.86855	0.2026	10	0.62326	D	0.03	-23.1093	10.0815	0.42393	0.1028:0.0:0.8972:0.0	.	634;572;617;646	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	H	617;572;646	ENSP00000369520:Q617H;ENSP00000369530:Q646H	ENSP00000344337:Q572H	Q	+	3	2	ALOX15B	7892515	0.970000	0.33590	1.000000	0.80357	0.147000	0.21601	0.603000	0.24149	0.899000	0.36444	0.561000	0.74099	CAG	.	.		0.637	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
ZNF830	91603	hgsc.bcm.edu	37	17	33288644	33288644	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr17:33288644A>G	ENST00000361952.3	+	1	96	c.59A>G	c.(58-60)gAa>gGa	p.E20G	CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000421975.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	20					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				AATCAGGAAGAATTGCGGCGG	0.567																																					p.E20G		Atlas-SNP	.											.	ZNF830	26	.	0			c.A59G						.						87.0	93.0	91.0					17																	33288644		2203	4300	6503	SO:0001583	missense	91603	exon1			AGGAAGAATTGCG	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.59A>G	chr17.hg19:g.33288644A>G	ENSP00000354518:p.Glu20Gly	159.0	0.0		144.0	49.0	NM_052857	Q96F60|Q96GZ5|Q9BU38	Missense_Mutation	SNP	ENST00000361952.3	hg19	CCDS32618.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.552719	0.86127	.	.	ENSG00000198783	ENST00000361952	T	0.18016	2.24	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.37865	0.1019	L	0.61218	1.895	0.54753	D	0.999986	D	0.89917	1.0	D	0.85130	0.997	T	0.11817	-1.0572	10	0.72032	D	0.01	-2.7862	11.7947	0.52093	1.0:0.0:0.0:0.0	.	20	Q96NB3	ZN830_HUMAN	G	20	ENSP00000354518:E20G	ENSP00000354518:E20G	E	+	2	0	ZNF830	30312757	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.311000	0.78958	2.279000	0.76181	0.533000	0.62120	GAA	.	.		0.567	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
WNK4	65266	hgsc.bcm.edu	37	17	40947049	40947049	+	Silent	SNP	C	C	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr17:40947049C>A	ENST00000246914.5	+	14	2631	c.2610C>A	c.(2608-2610)ccC>ccA	p.P870P		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	870					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCAGCACACCCGAGTTTCCGG	0.572																																					p.P870P	Esophageal Squamous(6;201 374 4964 23855 42828)	Atlas-SNP	.											.	WNK4	182	.	0			c.C2610A						.						186.0	168.0	174.0					17																	40947049		2203	4300	6503	SO:0001819	synonymous_variant	65266	exon14			CACACCCGAGTTT	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.2610C>A	chr17.hg19:g.40947049C>A		121.0	0.0		122.0	44.0	NM_032387	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Silent	SNP	ENST00000246914.5	hg19	CCDS11439.1																																																																																			.	.		0.572	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1		
TMEM241	85019	hgsc.bcm.edu	37	18	21001406	21001406	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr18:21001406C>T	ENST00000383233.3	-	3	174	c.122G>A	c.(121-123)tGg>tAg	p.W41*	TMEM241_ENST00000542162.1_Nonsense_Mutation_p.W41*|TMEM241_ENST00000399707.1_Intron|TMEM241_ENST00000450466.2_5'UTR	NM_032933.4	NP_116322.3	Q24JQ0	TM241_HUMAN	transmembrane protein 241	41						integral component of membrane (GO:0016021)											GAGCGTCTGCCACCTGGAAAG	0.493																																					p.W41X		Atlas-SNP	.											.	.	.	.	0			c.G122A						.						99.0	75.0	83.0					18																	21001406		2203	4300	6503	SO:0001587	stop_gained	85019	exon3			GTCTGCCACCTGG	BC082984	CCDS11876.2	18q11.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134490	ENSG00000134490			31723	protein-coding gene	gene with protein product		615430	"""chromosome 18 open reading frame 45"""	C18orf45		12477932	Standard	NM_032933		Approved	MGC11386, FLJ44259	uc002kuf.3	Q24JQ0	OTTHUMG00000131771	ENST00000383233.3:c.122G>A	chr18.hg19:g.21001406C>T	ENSP00000372720:p.Trp41*	61.0	0.0		80.0	33.0	NM_032933	I0J130|Q6ZTS7|Q6ZW41	Nonsense_Mutation	SNP	ENST00000383233.3	hg19	CCDS11876.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.690917|5.690917	0.96793|0.96793	.|.	.|.	ENSG00000134490|ENSG00000134490	ENST00000497608|ENST00000383233;ENST00000542162	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.089767	.|0.50627	.|D	.|0.000106	T|.	0.73133|.	0.3548|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.68973|.	-0.5268|.	4|.	.|0.33141	.|T	.|0.24	-35.7723|-35.7723	18.5659|18.5659	0.91116|0.91116	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	S|X	68|41	.|.	.|ENSP00000372720:W41X	G|W	-|-	1|2	0|0	C18orf45|C18orf45	19255404|19255404	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.877000|0.877000	0.50540|0.50540	5.500000|5.500000	0.66943|0.66943	2.678000|2.678000	0.91216|0.91216	0.643000|0.643000	0.83706|0.83706	GGC|TGG	.	.		0.493	TMEM241-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254702.3	NM_032933	
CDH19	28513	hgsc.bcm.edu	37	18	64212133	64212133	+	Silent	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr18:64212133G>A	ENST00000540086.1	-	6	1029	c.783C>T	c.(781-783)taC>taT	p.Y261Y	CDH19_ENST00000262150.2_Silent_p.Y261Y	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	371	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CAGTCAAGCGGTATAAACCTT	0.328																																					p.Y261Y		Atlas-SNP	.											.	CDH19	141	.	0			c.C783T						.						73.0	66.0	69.0					18																	64212133		2203	4300	6503	SO:0001819	synonymous_variant	28513	exon6			CAAGCGGTATAAA	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.783C>T	chr18.hg19:g.64212133G>A		53.0	0.0		54.0	21.0	NM_021153	O15098	Silent	SNP	ENST00000540086.1	hg19	CCDS59325.1																																																																																			.	.		0.328	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	
TMPRSS9	360200	hgsc.bcm.edu	37	19	2413945	2413945	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr19:2413945G>A	ENST00000332578.3	+	9	1400	c.1400G>A	c.(1399-1401)aGc>aAc	p.S467N		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	467					plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGTGGTCAGCACCCCCACC	0.622																																					p.S467N		Atlas-SNP	.											.	TMPRSS9	79	.	0			c.G1400A						.						28.0	30.0	29.0					19																	2413945		2203	4300	6503	SO:0001583	missense	360200	exon9			TGGTCAGCACCCC	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.1400G>A	chr19.hg19:g.2413945G>A	ENSP00000330264:p.Ser467Asn	65.0	0.0		63.0	24.0	NM_182973	Q6ZND6|Q7Z411	Missense_Mutation	SNP	ENST00000332578.3	hg19	CCDS12088.1	.	.	.	.	.	.	.	.	.	.	G	0.234	-1.018527	0.02078	.	.	ENSG00000178297	ENST00000395264;ENST00000332578	D	0.87887	-2.31	3.81	-7.3	0.01446	.	0.666044	0.12640	N	0.451440	T	0.61974	0.2390	N	0.01874	-0.695	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.57171	-0.7857	10	0.13108	T	0.6	.	12.5008	0.55953	0.1482:0.1298:0.722:0.0	.	467;501	Q7Z410;E7EMP4	TMPS9_HUMAN;.	N	501;467	ENSP00000330264:S467N	ENSP00000330264:S467N	S	+	2	0	TMPRSS9	2364945	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.888000	0.01616	-1.172000	0.02762	-0.518000	0.04402	AGC	.	.		0.622	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
LGI4	163175	hgsc.bcm.edu	37	19	35617194	35617194	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr19:35617194G>A	ENST00000310123.3	-	8	1798	c.1279C>T	c.(1279-1281)Cgc>Tgc	p.R427C	LGI4_ENST00000392225.3_Silent_p.H452H|LGI4_ENST00000493050.1_5'UTR	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	427					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCAATGTAGCGTGTGAGGCAC	0.617																																					p.R427C		Atlas-SNP	.											.	LGI4	32	.	0			c.C1279T						.						33.0	29.0	30.0					19																	35617194		2203	4300	6503	SO:0001583	missense	163175	exon8			TGTAGCGTGTGAG	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.1279C>T	chr19.hg19:g.35617194G>A	ENSP00000312273:p.Arg427Cys	129.0	0.0		146.0	60.0	NM_139284	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	hg19	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140520	0.77775	.	.	ENSG00000153902	ENST00000310123;ENST00000437421	T	0.81163	-1.46	4.66	4.66	0.58398	.	0.000000	0.56097	D	0.000025	D	0.86112	0.5855	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86324	0.1694	10	0.56958	D	0.05	.	10.3441	0.43895	0.0:0.0:0.8037:0.1963	.	338;427	Q658V8;Q8N135	.;LGI4_HUMAN	C	427	ENSP00000312273:R427C	ENSP00000312273:R427C	R	-	1	0	LGI4	40309034	1.000000	0.71417	0.969000	0.41365	0.991000	0.79684	7.729000	0.84864	2.147000	0.66899	0.585000	0.79938	CGC	.	.		0.617	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
CYP2A7	1549	hgsc.bcm.edu	37	19	41383137	41383137	+	Missense_Mutation	SNP	C	C	A	rs148915421	byFrequency	TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr19:41383137C>A	ENST00000301146.4	-	7	1660	c.1119G>T	c.(1117-1119)agG>agT	p.R373S	CYP2A7_ENST00000291764.3_Missense_Mutation_p.R322S|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	373						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCTTTTTAACCCTGCGGGCCA	0.542																																					p.R373S		Atlas-SNP	.											.	CYP2A7	71	.	0			c.G1119T						.						103.0	91.0	95.0					19																	41383137		2203	4299	6502	SO:0001583	missense	1549	exon7			TTTAACCCTGCGG	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.1119G>T	chr19.hg19:g.41383137C>A	ENSP00000301146:p.Arg373Ser	204.0	0.0		207.0	69.0	NM_000764	Q13121	Missense_Mutation	SNP	ENST00000301146.4	hg19	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	C	2.036	-0.421147	0.04734	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.68331	-0.32;-0.32	2.29	-1.27	0.09347	.	0.317790	0.30565	U	0.009351	T	0.40247	0.1109	N	0.13168	0.305	0.09310	N	1	B;B;B	0.22541	0.06;0.03;0.071	B;B;B	0.28638	0.062;0.03;0.092	T	0.15321	-1.0441	10	0.23891	T	0.37	.	3.6874	0.08334	0.0:0.3939:0.2017:0.4044	.	373;322;373	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	S	373;322	ENSP00000301146:R373S;ENSP00000291764:R322S	ENSP00000291764:R322S	R	-	3	2	CYP2A7	46074977	0.000000	0.05858	0.000000	0.03702	0.184000	0.23303	-2.901000	0.00704	-0.226000	0.09899	0.184000	0.17185	AGG	.	C|0.978;T|0.022		0.542	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
PAK7	57144	hgsc.bcm.edu	37	20	9561354	9561354	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr20:9561354G>T	ENST00000378429.3	-	5	974	c.428C>A	c.(427-429)aCc>aAc	p.T143N	PAK7_ENST00000378423.1_Missense_Mutation_p.T143N|PAK7_ENST00000353224.5_Missense_Mutation_p.T143N	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	143	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GTACTTTTCGGTCGTGTAGTC	0.512																																					p.T143N		Atlas-SNP	.											.	PAK7	194	.	0			c.C428A						.						195.0	191.0	192.0					20																	9561354		2203	4300	6503	SO:0001583	missense	57144	exon4			TTTTCGGTCGTGT	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.428C>A	chr20.hg19:g.9561354G>T	ENSP00000367686:p.Thr143Asn	136.0	0.0		144.0	58.0	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	hg19	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.304932	0.01353	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.43688	0.94;0.94;0.94	5.31	5.31	0.75309	.	0.658377	0.15738	N	0.247078	T	0.32224	0.0822	L	0.29908	0.895	0.09310	N	1	B;B	0.12013	0.005;0.002	B;B	0.19391	0.025;0.002	T	0.11665	-1.0578	9	.	.	.	.	12.7852	0.57500	0.0853:0.0:0.9147:0.0	.	143;143	B0AZM9;Q9P286	.;PAK7_HUMAN	N	143;143;143;91	ENSP00000367686:T143N;ENSP00000322957:T143N;ENSP00000367679:T143N	.	T	-	2	0	PAK7	9509354	0.133000	0.22466	0.014000	0.15608	0.035000	0.12851	3.119000	0.50422	2.503000	0.84419	0.544000	0.68410	ACC	.	.		0.512	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
OGFR	11054	hgsc.bcm.edu	37	20	61436212	61436212	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr20:61436212A>G	ENST00000290291.6	+	1	26	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	OGFR-AS1_ENST00000431361.1_RNA|OGFR_ENST00000370461.1_5'Flank	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	1					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					gccgccGAGCATGGACGACCC	0.761																																					p.M1V		Atlas-SNP	.											.	OGFR	63	.	0			c.A1G						.						13.0	12.0	13.0					20																	61436212		1713	3213	4926	SO:0001582	initiator_codon_variant	11054	exon1			CCGAGCATGGACG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1A>G	chr20.hg19:g.61436212A>G	ENSP00000290291:p.Met1Val	94.0	0.0		100.0	6.0	NM_007346	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	hg19	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863634	0.71949	.	.	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163	T;T	0.46819	1.71;0.86	2.64	2.64	0.31445	.	0.226759	0.36101	N	0.002789	T	0.37019	0.0988	.	.	.	0.80722	D	1	P	0.42409	0.779	B	0.37833	0.259	T	0.37957	-0.9683	9	0.87932	D	0	.	8.7102	0.34378	1.0:0.0:0.0:0.0	.	1	Q9NZT2	OGFR_HUMAN	V	1	ENSP00000290291:M1V;ENSP00000359499:M1V	ENSP00000290291:M1V	M	+	1	0	OGFR	60906657	0.847000	0.29606	0.942000	0.38095	0.849000	0.48306	1.722000	0.38042	1.456000	0.47831	0.448000	0.29417	ATG	.	.		0.761	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		Missense_Mutation
TAF9B	51616	hgsc.bcm.edu	37	X	77393271	77393271	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chrX:77393271T>C	ENST00000341864.5	-	4	474	c.380A>G	c.(379-381)tAt>tGt	p.Y127C		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	127					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						CTTCAGCCTATAGTTTGGAGC	0.373																																					p.Y127C		Atlas-SNP	.											.	TAF9B	30	.	0			c.A380G						.						79.0	71.0	74.0					X																	77393271		2203	4296	6499	SO:0001583	missense	51616	exon4			AGCCTATAGTTTG	AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.380A>G	chrX.hg19:g.77393271T>C	ENSP00000339917:p.Tyr127Cys	233.0	1.0		223.0	170.0	NM_015975	B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	ENST00000341864.5	hg19	CCDS35340.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427319	0.62733	.	.	ENSG00000187325	ENST00000341864	T	0.55234	0.53	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.73442	0.3587	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77678	-0.2498	10	0.87932	D	0	-6.0938	10.4058	0.44256	0.0:0.0:0.0:1.0	.	127	Q9HBM6	TAF9B_HUMAN	C	127	ENSP00000339917:Y127C	ENSP00000339917:Y127C	Y	-	2	0	TAF9B	77279927	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.249000	0.78278	1.575000	0.49775	0.486000	0.48141	TAT	.	.		0.373	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975	
PCDHA1	56147	hgsc.bcm.edu	37	5	140166927	140166927	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr5:140166927delC	ENST00000504120.2	+	1	1052	c.1052delC	c.(1051-1053)gcgfs	p.A351fs	PCDHA1_ENST00000394633.3_Frame_Shift_Del_p.A351fs|PCDHA1_ENST00000378133.3_Frame_Shift_Del_p.A351fs	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	351	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGAACTGGCGGTCACTTCA	0.488																																					p.A351fs		Atlas-INDEL	.											.	PCDHA1	387	.	0			c.1051delG						.						97.0	96.0	97.0					5																	140166927		2203	4300	6503	SO:0001589	frameshift_variant	56147	exon1			.	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1052delC	chr5.hg19:g.140166927delC	ENSP00000420840:p.Ala351fs	126.0	0.0		150.0	50.0	NM_031411	O75288|Q9NRT7	Frame_Shift_Del	DEL	ENST00000504120.2	hg19	CCDS54913.1																																																																																			.	.		0.488	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
HSD11B1	3290	hgsc.bcm.edu	37	1	209879256	209879256	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr1:209879256delG	ENST00000367028.2	+	3	358	c.189delG	c.(187-189)gtgfs	p.V63fs	RP1-28O10.1_ENST00000441672.1_RNA|HSD11B1_ENST00000261465.1_Frame_Shift_Del_p.V63fs|HSD11B1_ENST00000367027.3_Frame_Shift_Del_p.V63fs	NM_001206741.1	NP_001193670.1	P28845	DHI1_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1	63					glucocorticoid biosynthetic process (GO:0006704)|lung development (GO:0030324)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	11-beta-hydroxysteroid dehydrogenase (NADP+) activity (GO:0070524)|11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	16				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Prednisone(DB00635)	ATGTGGTGGTGACAGCGAGGT	0.478																																					p.V63fs		Atlas-INDEL	.											.	HSD11B1	35	.	0			c.188delT						.						159.0	148.0	152.0					1																	209879256		2203	4300	6503	SO:0001589	frameshift_variant	3290	exon3			.	BC012593	CCDS1489.1	1q32-q41	2011-09-20			ENSG00000117594	ENSG00000117594	1.1.1.146	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5208	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 26C, member 1"""	600713		HSD11B, HSD11		1885595, 19027726	Standard	NM_005525		Approved	SDR26C1	uc001hhk.3	P28845	OTTHUMG00000036481	ENST00000367028.2:c.189delG	chr1.hg19:g.209879256delG	ENSP00000355995:p.Val63fs	95.0	0.0		124.0	21.0	NM_001206741	B2R9Z1|D3DT89	Frame_Shift_Del	DEL	ENST00000367028.2	hg19	CCDS1489.1																																																																																			.	.		0.478	HSD11B1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088743.2	NM_005525	
KRT2	3849	hgsc.bcm.edu	37	12	53045636	53045637	+	In_Frame_Ins	INS	-	-	CCAAAGCCGCTGCCGCCT			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr12:53045636_53045637insCCAAAGCCGCTGCCGCCT	ENST00000309680.3	-	1	311_312	c.290_291insAGGCGGCAGCGGCTTTGG	c.(289-291)gga>ggAGGCGGCAGCGGCTTTGGa	p.97_97G>GGGSGFG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	97	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		tgctgccgcctccaaaaccacc	0.624																																					p.G97delinsGGGSGFG		Atlas-INDEL	.											.,1	KRT2	94	.	0			c.291_292insAGGCGGCAGCGGCTTTGG						.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.290_291insAGGCGGCAGCGGCTTTGG	chr12.hg19:g.53045636_53045637insCCAAAGCCGCTGCCGCCT	Exception_encountered	155.0	0.0		175.0	65.0	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.		0.624	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
MYOM1	8736	hgsc.bcm.edu	37	18	3187611	3187612	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr18:3187611_3187612insA	ENST00000356443.4	-	5	1128_1129	c.795_796insT	c.(793-798)catgccfs	p.A266fs	MYOM1_ENST00000261606.7_Frame_Shift_Ins_p.A266fs|RP13-270P17.2_ENST00000580139.1_RNA|MYOM1_ENST00000400569.3_Frame_Shift_Ins_p.A266fs	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	266					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTCAGCTTGGCATGATATGTCT	0.361																																					p.A266fs		Atlas-INDEL	.											.	MYOM1	192	.	0			c.796_797insT						.																																			SO:0001589	frameshift_variant	8736	exon5			.	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.796dupT	chr18.hg19:g.3187612_3187612dupA	ENSP00000348821:p.Ala266fs	103.0	0.0		91.0	29.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Frame_Shift_Ins	INS	ENST00000356443.4	hg19	CCDS45824.1																																																																																			.	.		0.361	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
EP400	57634	hgsc.bcm.edu	37	12	132512745	132512746	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-DD-AAVS-01A-11D-A40R-10	TCGA-DD-AAVS-10A-01D-A40U-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eb1a12bf-565b-47ad-b538-1b8bdcfb6f98	05aee9b3-772a-4c49-ac5b-c9d25f14da7e	g.chr12:132512745_132512746delCA	ENST00000333577.4	+	28	5510_5511	c.5401_5402delCA	c.(5401-5403)cacfs	p.H1801fs	EP400_ENST00000332482.4_Frame_Shift_Del_p.H1728fs|EP400_ENST00000389562.2_Frame_Shift_Del_p.H1764fs|EP400_ENST00000389561.2_Frame_Shift_Del_p.H1765fs|EP400_ENST00000330386.6_Frame_Shift_Del_p.H1684fs			Q96L91	EP400_HUMAN	E1A binding protein p400	1801					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CGGGCCAGCGCACAGTTACACT	0.559																																					p.1764_1765del		Atlas-INDEL	.											.	EP400	370	.	0			c.5292_5293del						.																																			SO:0001589	frameshift_variant	57634	exon27			.	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.5401_5402delCA	chr12.hg19:g.132512747_132512748delCA	ENSP00000333602:p.His1801fs	114.0	0.0		85.0	35.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Frame_Shift_Del	DEL	ENST00000333577.4	hg19																																																																																				.	.		0.559	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
