#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DNAJC16	23341	hgsc.bcm.edu	37	1	15888720	15888720	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:15888720C>G	ENST00000375847.3	+	9	1402	c.1238C>G	c.(1237-1239)aCt>aGt	p.T413S	DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375849.1_Missense_Mutation_p.T413S|DNAJC16_ENST00000375838.1_Missense_Mutation_p.T413S	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	413					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTGGCAAACACTCAAGACACA	0.483																																					p.T413S		Atlas-SNP	.											.	DNAJC16	59	.	0			c.C1238G						.						185.0	164.0	171.0					1																	15888720		2203	4300	6503	SO:0001583	missense	23341	exon9			CAAACACTCAAGA	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.1238C>G	chr1.hg19:g.15888720C>G	ENSP00000365007:p.Thr413Ser	135.0	0.0		127.0	46.0	NM_015291	Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	hg19	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615570	0.28801	.	.	ENSG00000116138	ENST00000375847;ENST00000375838;ENST00000375849;ENST00000546230	T;T;T	0.15718	2.4;2.4;2.4	5.96	5.0	0.66597	.	0.206151	0.50627	N	0.000101	T	0.11965	0.0291	N	0.21097	0.63	0.21967	N	0.999444	B;B	0.11235	0.001;0.004	B;B	0.12156	0.002;0.007	T	0.20605	-1.0270	10	0.07030	T	0.85	-11.3812	17.6403	0.88133	0.0:0.8666:0.1334:0.0	.	413;413	Q9Y2G8;Q5TDG9	DJC16_HUMAN;.	S	413	ENSP00000365007:T413S;ENSP00000364998:T413S;ENSP00000365009:T413S	ENSP00000364998:T413S	T	+	2	0	DNAJC16	15761307	0.995000	0.38212	0.963000	0.40424	0.965000	0.64279	3.336000	0.52113	2.833000	0.97629	0.650000	0.86243	ACT	.	.		0.483	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
SPEN	23013	hgsc.bcm.edu	37	1	16199516	16199516	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:16199516A>G	ENST00000375759.3	+	2	493	c.289A>G	c.(289-291)Ata>Gta	p.I97V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	97					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TACAGTTTCCATAGCATCTCG	0.522																																					p.I97V		Atlas-SNP	.											.	SPEN	374	.	0			c.A289G						.						124.0	113.0	117.0					1																	16199516		2203	4300	6503	SO:0001583	missense	23013	exon2			GTTTCCATAGCAT		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.289A>G	chr1.hg19:g.16199516A>G	ENSP00000364912:p.Ile97Val	149.0	0.0		155.0	72.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	10.84	1.462943	0.26248	.	.	ENSG00000065526	ENST00000375759	T	0.08282	3.11	5.7	5.7	0.88788	.	.	.	.	.	T	0.06188	0.0160	N	0.19112	0.55	0.46701	D	0.999165	P	0.35844	0.524	B	0.31946	0.138	T	0.42531	-0.9446	9	0.44086	T	0.13	-2.5073	12.2073	0.54358	0.8578:0.1422:0.0:0.0	.	97	Q96T58	MINT_HUMAN	V	97	ENSP00000364912:I97V	ENSP00000364912:I97V	I	+	1	0	SPEN	16072103	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.778000	0.55371	2.184000	0.69523	0.528000	0.53228	ATA	.	.		0.522	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
PADI1	29943	hgsc.bcm.edu	37	1	17559395	17559395	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:17559395A>T	ENST00000375471.4	+	11	1335	c.1243A>T	c.(1243-1245)Agc>Tgc	p.S415C	PADI1_ENST00000536552.1_5'Flank|PADI1_ENST00000537499.1_5'Flank|PADI1_ENST00000413717.2_5'Flank	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	415					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	CCTGGACGTCAGCCCGCCCGT	0.662																																					p.S415C	Esophageal Squamous(80;414 1257 4580 27746 50832)	Atlas-SNP	.											.	PADI1	77	.	0			c.A1243T						.						30.0	29.0	29.0					1																	17559395		2203	4300	6503	SO:0001583	missense	29943	exon11			GACGTCAGCCCGC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1243A>T	chr1.hg19:g.17559395A>T	ENSP00000364620:p.Ser415Cys	76.0	0.0		54.0	21.0	NM_013358	A1L4K6|Q70SX6	Missense_Mutation	SNP	ENST00000375471.4	hg19	CCDS178.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081213	0.55753	.	.	ENSG00000142623	ENST00000375471	T	0.32988	1.43	4.86	4.86	0.63082	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61899	0.2384	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70579	-0.4833	10	0.72032	D	0.01	-35.5692	13.4182	0.60980	1.0:0.0:0.0:0.0	.	415	Q9ULC6	PADI1_HUMAN	C	415	ENSP00000364620:S415C	ENSP00000364620:S415C	S	+	1	0	PADI1	17431982	1.000000	0.71417	1.000000	0.80357	0.171000	0.22731	6.501000	0.73691	2.040000	0.60383	0.379000	0.24179	AGC	.	.		0.662	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
LRRC8C	84230	hgsc.bcm.edu	37	1	90178412	90178412	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:90178412G>A	ENST00000370454.4	+	3	538	c.283G>A	c.(283-285)Gaa>Aaa	p.E95K	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	95					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CATCACTGTGGAAATGAAAGG	0.483																																					p.E95K		Atlas-SNP	.											.	LRRC8C	73	.	0			c.G283A						.						113.0	105.0	108.0					1																	90178412		2203	4300	6503	SO:0001583	missense	84230	exon3			ACTGTGGAAATGA		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.283G>A	chr1.hg19:g.90178412G>A	ENSP00000359483:p.Glu95Lys	216.0	0.0		244.0	15.0	NM_032270	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	hg19	CCDS725.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762732	0.89932	.	.	ENSG00000171488	ENST00000370454	T	0.24908	1.83	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.11537	0.0281	N	0.08118	0	0.58432	D	0.999997	B	0.31968	0.349	B	0.39379	0.298	T	0.24368	-1.0162	10	0.30078	T	0.28	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	95	Q8TDW0	LRC8C_HUMAN	K	95	ENSP00000359483:E95K	ENSP00000359483:E95K	E	+	1	0	LRRC8C	89951000	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.635000	0.98437	2.826000	0.97356	0.655000	0.94253	GAA	.	.		0.483	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
COL11A1	1301	hgsc.bcm.edu	37	1	103348775	103348775	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:103348775G>A	ENST00000370096.3	-	64	5263	c.4951C>T	c.(4951-4953)Cca>Tca	p.P1651S	COL11A1_ENST00000358392.2_Missense_Mutation_p.P1663S|COL11A1_ENST00000512756.1_Missense_Mutation_p.P1535S|COL11A1_ENST00000353414.4_Missense_Mutation_p.P1612S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1651	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTTGTCTGGATAAATGCAA	0.378																																					p.P1663S		Atlas-SNP	.											.	COL11A1	972	.	0			c.C4987T						.						140.0	136.0	137.0					1																	103348775		2203	4300	6503	SO:0001583	missense	1301	exon64			TGTCTGGATAAAT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4951C>T	chr1.hg19:g.103348775G>A	ENSP00000359114:p.Pro1651Ser	87.0	0.0		89.0	46.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001419	0.74818	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.52	5.52	0.82312	Fibrillar collagen, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.89770	0.6811	M	0.89715	3.055	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.999;0.998	D	0.91278	0.5049	10	0.87932	D	0	.	19.4353	0.94792	0.0:0.0:1.0:0.0	.	1535;1612;1663;1651;871	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1651;1663;1612;871;1535	ENSP00000359114:P1651S;ENSP00000351163:P1663S;ENSP00000302551:P1612S;ENSP00000426533:P1535S	ENSP00000302551:P1612S	P	-	1	0	COL11A1	103121363	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.603000	0.88011	0.591000	0.81541	CCA	.	.		0.378	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
TCHH	7062	hgsc.bcm.edu	37	1	152084174	152084174	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:152084174G>C	ENST00000368804.1	-	2	1518	c.1519C>G	c.(1519-1521)Cta>Gta	p.L507V		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	507	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCGCCTTAGTTGCTGCTCG	0.652																																					p.L507V		Atlas-SNP	.											.	TCHH	275	.	0			c.C1519G						.						63.0	70.0	67.0					1																	152084174		2062	4193	6255	SO:0001583	missense	7062	exon3			GCCTTAGTTGCTG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1519C>G	chr1.hg19:g.152084174G>C	ENSP00000357794:p.Leu507Val	33.0	0.0		37.0	8.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	g	7.583	0.669162	0.14776	.	.	ENSG00000159450	ENST00000368804	T	0.06528	3.29	1.93	0.956	0.19608	.	.	.	.	.	T	0.01061	0.0035	N	0.08118	0	0.09310	N	1	B	0.25904	0.137	B	0.29440	0.102	T	0.48305	-0.9047	9	0.29301	T	0.29	.	7.6375	0.28274	0.0:0.0:0.7453:0.2547	.	507	Q07283	TRHY_HUMAN	V	507	ENSP00000357794:L507V	ENSP00000357794:L507V	L	-	1	2	TCHH	150350798	0.000000	0.05858	0.002000	0.10522	0.099000	0.18886	0.376000	0.20535	0.398000	0.25338	0.109000	0.15622	CTA	.	.		0.652	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TCHH	7062	hgsc.bcm.edu	37	1	152084221	152084221	+	Missense_Mutation	SNP	A	A	C	rs202112040		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:152084221A>C	ENST00000368804.1	-	2	1471	c.1472T>G	c.(1471-1473)cTc>cGc	p.L491R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	491	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCCTCGAGCTTCAGCCA	0.672																																					p.L491R		Atlas-SNP	.											.	TCHH	275	.	0			c.T1472G						.						63.0	70.0	68.0					1																	152084221		2106	4220	6326	SO:0001583	missense	7062	exon3			TCCTCGAGCTTCA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1472T>G	chr1.hg19:g.152084221A>C	ENSP00000357794:p.Leu491Arg	23.0	0.0		40.0	13.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	a	0.064	-1.216147	0.01542	.	.	ENSG00000159450	ENST00000368804	T	0.04603	3.59	2.11	-4.23	0.03789	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43491	-0.9388	9	0.12430	T	0.62	.	7.0185	0.24900	0.2982:0.5613:0.0:0.1406	.	491	Q07283	TRHY_HUMAN	R	491	ENSP00000357794:L491R	ENSP00000357794:L491R	L	-	2	0	TCHH	150350845	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-1.154000	0.03166	-2.764000	0.00368	-1.533000	0.00918	CTC	.	.		0.672	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TCHH	7062	hgsc.bcm.edu	37	1	152084224	152084224	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:152084224T>C	ENST00000368804.1	-	2	1468	c.1469A>G	c.(1468-1470)aAg>aGg	p.K490R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	490	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCGAGCTTCAGCCAACG	0.672																																					p.K490R		Atlas-SNP	.											.	TCHH	275	.	0			c.A1469G						.						65.0	71.0	69.0					1																	152084224		2109	4224	6333	SO:0001583	missense	7062	exon3			TCGAGCTTCAGCC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1469A>G	chr1.hg19:g.152084224T>C	ENSP00000357794:p.Lys490Arg	25.0	0.0		40.0	12.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	t	8.419	0.845945	0.16963	.	.	ENSG00000159450	ENST00000368804	T	0.04654	3.58	2.98	-5.97	0.02227	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48547	-0.9026	9	0.09590	T	0.72	.	5.0277	0.14393	0.1398:0.4054:0.0:0.4548	.	490	Q07283	TRHY_HUMAN	R	490	ENSP00000357794:K490R	ENSP00000357794:K490R	K	-	2	0	TCHH	150350848	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.247000	0.00266	-1.053000	0.03218	-1.396000	0.01147	AAG	.	.		0.672	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
IVL	3713	hgsc.bcm.edu	37	1	152883756	152883756	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:152883756C>T	ENST00000368764.3	+	2	1547	c.1483C>T	c.(1483-1485)Cag>Tag	p.Q495*	IVL_ENST00000392667.2_Nonsense_Mutation_p.Q349*			P07476	INVO_HUMAN	involucrin	495	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTCCCAGagcagcaggtagg	0.592																																					p.Q495X		Atlas-SNP	.											.	IVL	100	.	0			c.C1483T						.						69.0	67.0	68.0					1																	152883756		2173	4267	6440	SO:0001587	stop_gained	3713	exon2			CCAGAGCAGCAGG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1483C>T	chr1.hg19:g.152883756C>T	ENSP00000357753:p.Gln495*	138.0	0.0		125.0	45.0	NM_005547	Q5T7P4	Nonsense_Mutation	SNP	ENST00000368764.3	hg19	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255751	0.59321	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	.	.	.	3.33	-0.241	0.13043	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	7.7917	0.29125	0.1659:0.5314:0.3027:0.0	.	.	.	.	X	495;349	.	ENSP00000357753:Q495X	Q	+	1	0	IVL	151150380	0.000000	0.05858	0.002000	0.10522	0.023000	0.10783	-3.342000	0.00505	-0.138000	0.11434	0.514000	0.50259	CAG	.	.		0.592	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
ATP8B2	57198	hgsc.bcm.edu	37	1	154306627	154306627	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:154306627A>C	ENST00000368489.3	+	10	733	c.733A>C	c.(733-735)Agc>Cgc	p.S245R	ATP8B2_ENST00000368487.3_Missense_Mutation_p.S212R|ATP8B2_ENST00000341822.2_Missense_Mutation_p.S231R|ATP8B2_ENST00000426445.1_3'UTR	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	231					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGACAAATTCAGCGGAACCCT	0.507																																					p.S245R		Atlas-SNP	.											.	ATP8B2	158	.	0			c.A733C						.						232.0	244.0	240.0					1																	154306627		2203	4300	6503	SO:0001583	missense	57198	exon10			AAATTCAGCGGAA	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.733A>C	chr1.hg19:g.154306627A>C	ENSP00000357475:p.Ser245Arg	129.0	0.0		124.0	43.0	NM_020452	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	hg19	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	A	12.87	2.068093	0.36470	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	T;T;T	0.74737	-0.87;-0.87;-0.87	5.3	5.3	0.74995	ATPase, P-type, ATPase-associated domain (1);	0.168925	0.52532	D	0.000065	T	0.56187	0.1968	L	0.37850	1.14	0.33332	D	0.568758	P;B;B	0.45428	0.858;0.001;0.0	P;B;B	0.49387	0.609;0.005;0.008	T	0.55976	-0.8055	10	0.17832	T	0.49	.	9.3671	0.38230	0.9169:0.0:0.0831:0.0	.	231;245;212	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	R	212;245;231	ENSP00000357472:S212R;ENSP00000357475:S245R;ENSP00000340448:S231R	ENSP00000340448:S231R	S	+	1	0	ATP8B2	152573251	0.999000	0.42202	0.998000	0.56505	0.976000	0.68499	2.515000	0.45512	2.228000	0.72767	0.482000	0.46254	AGC	.	.		0.507	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
OBSCN	84033	hgsc.bcm.edu	37	1	228475833	228475833	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:228475833T>C	ENST00000422127.1	+	37	9927	c.9883T>C	c.(9883-9885)Tgt>Cgt	p.C3295R	OBSCN_ENST00000366707.4_Missense_Mutation_p.C414R|OBSCN_ENST00000570156.2_Missense_Mutation_p.C3724R|OBSCN_ENST00000284548.11_Missense_Mutation_p.C3295R|OBSCN_ENST00000366709.4_Missense_Mutation_p.C414R|OBSCN_ENST00000359599.6_Missense_Mutation_p.C2142R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3295	Ig-like 33.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CACGCTGCGGTGTGAGCTGAG	0.607																																					p.C3724R		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T11170C						.						85.0	90.0	88.0					1																	228475833		2050	4187	6237	SO:0001583	missense	84033	exon42			CTGCGGTGTGAGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9883T>C	chr1.hg19:g.228475833T>C	ENSP00000409493:p.Cys3295Arg	136.0	0.0		132.0	70.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420768	0.83559	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	4.99	4.99	0.66335	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93893	0.8046	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96230	0.9167	10	0.87932	D	0	.	14.8356	0.70180	0.0:0.0:0.0:1.0	.	3295;3295	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	R	3295;3295;414;414;2142	ENSP00000284548:C3295R;ENSP00000409493:C3295R;ENSP00000355668:C414R;ENSP00000355670:C414R;ENSP00000352613:C2142R	ENSP00000284548:C3295R	C	+	1	0	OBSCN	226542456	1.000000	0.71417	0.993000	0.49108	0.951000	0.60555	6.031000	0.70911	2.105000	0.64084	0.459000	0.35465	TGT	.	.		0.607	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PCNXL2	80003	hgsc.bcm.edu	37	1	233270849	233270849	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr1:233270849G>T	ENST00000258229.9	-	21	3981	c.3747C>A	c.(3745-3747)agC>agA	p.S1249R	PCNXL2_ENST00000520463.1_5'UTR|PCNXL2_ENST00000488780.2_Missense_Mutation_p.S382R	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1249						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGACAGTGAAGCTCAAGTTAA	0.393																																					p.S1249R		Atlas-SNP	.											.	PCNXL2	204	.	0			c.C3747A						.						79.0	79.0	79.0					1																	233270849		1865	4110	5975	SO:0001583	missense	80003	exon21			AGTGAAGCTCAAG	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.3747C>A	chr1.hg19:g.233270849G>T	ENSP00000258229:p.Ser1249Arg	265.0	1.0		225.0	97.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192282	0.38707	.	.	ENSG00000135749	ENST00000258229;ENST00000484347;ENST00000488780	T	0.08807	3.05	5.63	0.491	0.16867	.	0.500314	0.24912	N	0.034605	T	0.06005	0.0156	N	0.22421	0.69	0.80722	D	1	B	0.31009	0.303	B	0.35859	0.212	T	0.40156	-0.9578	10	0.51188	T	0.08	.	6.534	0.22341	0.463:0.0:0.4221:0.1148	.	1249	A6NKB5	PCX2_HUMAN	R	1249;85;382	ENSP00000258229:S1249R	ENSP00000258229:S1249R	S	-	3	2	PCNXL2	231337472	1.000000	0.71417	0.711000	0.30485	0.746000	0.42486	1.715000	0.37971	-0.077000	0.12752	-0.156000	0.13503	AGC	.	.		0.393	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
RPS7	6201	hgsc.bcm.edu	37	2	3624107	3624107	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr2:3624107A>G	ENST00000304921.5	+	4	342	c.178A>G	c.(178-180)Atc>Gtc	p.I60V	RPS7_ENST00000407445.3_Missense_Mutation_p.I60V|RPS7_ENST00000406376.1_Missense_Mutation_p.I60V|RPS7_ENST00000403564.1_Missense_Mutation_p.I60V	NM_001011.3	NP_001002.1	P62081	RS7_HUMAN	ribosomal protein S7	60					cellular protein metabolic process (GO:0044267)|cytoplasmic translation (GO:0002181)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(2)|urinary_tract(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0963)|Epithelial(75;0.208)		TCGGAAAGCTATCATAATCTT	0.398																																					p.I60V		Atlas-SNP	.											.	RPS7	13	.	0			c.A178G						.						96.0	104.0	101.0					2																	3624107		2203	4300	6503	SO:0001583	missense	6201	exon4			AAAGCTATCATAA		CCDS1648.1	2p25	2011-04-05			ENSG00000171863	ENSG00000171863		"""S ribosomal proteins"""	10440	protein-coding gene	gene with protein product		603658				8522193, 10625621	Standard	NM_001011		Approved	S7	uc002qxw.3	P62081	OTTHUMG00000090305	ENST00000304921.5:c.178A>G	chr2.hg19:g.3624107A>G	ENSP00000339095:p.Ile60Val	393.0	0.0		385.0	199.0	NM_001011	P23821|P24818|Q57Z92|Q6IPH1	Missense_Mutation	SNP	ENST00000304921.5	hg19	CCDS1648.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.162232	0.38217	.	.	ENSG00000171863	ENST00000304921;ENST00000407445;ENST00000403564;ENST00000406376	.	.	.	4.2	4.2	0.49525	.	0.055074	0.64402	U	0.000001	T	0.49795	0.1578	L	0.35414	1.06	0.58432	D	0.999995	B;B	0.12013	0.005;0.001	B;B	0.24269	0.052;0.015	T	0.41520	-0.9504	9	0.18710	T	0.47	.	12.7429	0.57264	1.0:0.0:0.0:0.0	.	60;60	B5MCP9;P62081	.;RS7_HUMAN	V	60	.	ENSP00000339095:I60V	I	+	1	0	RPS7	3601982	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	9.061000	0.93913	1.651000	0.50673	0.460000	0.39030	ATC	.	.		0.398	RPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206667.1	NM_001011	
TRABD2A	129293	hgsc.bcm.edu	37	2	85049140	85049140	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr2:85049140G>C	ENST00000409520.2	-	7	1461	c.1419C>G	c.(1417-1419)caC>caG	p.H473Q	TRABD2A_ENST00000479944.1_5'UTR|TRABD2A_ENST00000335459.5_Missense_Mutation_p.H424Q	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	473					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										TCTGGCTGTGGTGGGAATGCC	0.597																																					p.G424G		Atlas-SNP	.											.	.	.	.	0			c.C1272G						.						34.0	39.0	37.0					2																	85049140		2063	4230	6293	SO:0001583	missense	129293	exon6			GCTGTGGTGGGAA	BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.1419C>G	chr2.hg19:g.85049140G>C	ENSP00000387075:p.His473Gln	132.0	0.0		108.0	47.0	NM_001080824	B4DKK8|I6UMB9	Silent	SNP	ENST00000409520.2	hg19		.	.	.	.	.	.	.	.	.	.	G	6.837	0.523603	0.13066	.	.	ENSG00000186854	ENST00000335459;ENST00000409520	T;T	0.20598	2.06;2.06	4.44	0.28	0.15682	.	1.078140	0.07285	N	0.871403	T	0.12987	0.0315	.	.	.	0.09310	N	1	B;B	0.15141	0.004;0.012	B;B	0.14023	0.003;0.01	T	0.34850	-0.9812	9	0.33141	T	0.24	.	5.0552	0.14529	0.1953:0.3267:0.478:0.0	.	473;424	Q86V40;Q86V40-2	CB089_HUMAN;.	Q	424;473	ENSP00000335004:H424Q;ENSP00000387075:H473Q	ENSP00000335004:H424Q	H	-	3	2	C2orf89	84902651	0.047000	0.20315	0.211000	0.23655	0.552000	0.35366	0.408000	0.21065	0.110000	0.17919	-0.302000	0.09304	CAC	.	.		0.597	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001080824	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098862	178098862	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr2:178098862T>G	ENST00000397062.3	-	2	737	c.183A>C	c.(181-183)caA>caC	p.Q61H	NFE2L2_ENST00000423513.1_Missense_Mutation_p.Q45H|NFE2L2_ENST00000446151.2_Missense_Mutation_p.Q45H|NFE2L2_ENST00000464747.1_Missense_Mutation_p.Q45H|NFE2L2_ENST00000397063.4_Missense_Mutation_p.Q45H	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	61					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CCTTTTGGAGTTGTTCTTGTC	0.423			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.Q61H		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	225	.	0			c.A183C						.						154.0	148.0	150.0					2																	178098862		1879	4103	5982	SO:0001583	missense	4780	exon2			TTGGAGTTGTTCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.183A>C	chr2.hg19:g.178098862T>G	ENSP00000380252:p.Gln61His	94.0	0.0		61.0	14.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425750	0.62733	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.78	4.63	0.57726	.	0.118071	0.64402	D	0.000015	T	0.46328	0.1387	M	0.65975	2.015	0.45183	D	0.998196	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	D;D;D;D	0.79784	0.921;0.993;0.951;0.921	T	0.45745	-0.9240	10	0.42905	T	0.14	.	4.7051	0.12846	0.0:0.2637:0.0:0.7363	.	45;45;45;61	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	H	45;61;45;45;45;45;45	ENSP00000380253:Q45H;ENSP00000380252:Q61H;ENSP00000411575:Q45H;ENSP00000391590:Q45H;ENSP00000400073:Q45H;ENSP00000412191:Q45H;ENSP00000410015:Q45H	ENSP00000380252:Q61H	Q	-	3	2	NFE2L2	177807108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.575000	0.53870	2.210000	0.71456	0.460000	0.39030	CAA	.	.		0.423	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
TTN	7273	hgsc.bcm.edu	37	2	179435762	179435762	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr2:179435762C>G	ENST00000591111.1	-	276	70398	c.70174G>C	c.(70174-70176)Gac>Cac	p.D23392H	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D16093H|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D16160H|TTN_ENST00000589042.1_Missense_Mutation_p.D25033H|TTN_ENST00000342992.6_Missense_Mutation_p.D22465H|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.D15968H|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23392	Fibronectin type-III 70. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCCACCGTCATAGGTGGGT	0.438																																					p.D25033H		Atlas-SNP	.											.	TTN	18412	.	0			c.G75097C						.						152.0	155.0	154.0					2																	179435762		1907	4116	6023	SO:0001583	missense	7273	exon326			CACCGTCATAGGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70174G>C	chr2.hg19:g.179435762C>G	ENSP00000465570:p.Asp23392His	76.0	0.0		71.0	33.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.74	2.327894	0.41197	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.28	5.28	0.74379	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82545	0.5060	M	0.92555	3.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86678	0.1915	9	0.87932	D	0	.	19.2734	0.94019	0.0:1.0:0.0:0.0	.	15968;16093;16160;23392	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	22465;15968;16160;16093;15966	ENSP00000343764:D22465H;ENSP00000434586:D15968H;ENSP00000340554:D16160H;ENSP00000352154:D16093H	ENSP00000340554:D16160H	D	-	1	0	TTN	179144008	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.630000	0.89119	0.650000	0.86243	GAC	.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GULP1	51454	hgsc.bcm.edu	37	2	189449050	189449050	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr2:189449050C>T	ENST00000409580.1	+	11	1382	c.668C>T	c.(667-669)tCt>tTt	p.S223F	GULP1_ENST00000409609.1_Missense_Mutation_p.S223F|GULP1_ENST00000409805.1_Missense_Mutation_p.S120F|GULP1_ENST00000409843.1_Missense_Mutation_p.S223F|GULP1_ENST00000359135.3_Missense_Mutation_p.S223F|GULP1_ENST00000409830.1_Missense_Mutation_p.S223F			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	223					apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			ATTCCATTTTCTCCAATATCA	0.408																																					p.S223F	Pancreas(178;563 2065 20199 42378 52815)	Atlas-SNP	.											.	GULP1	35	.	0			c.C668T						.						231.0	197.0	209.0					2																	189449050		2203	4300	6503	SO:0001583	missense	51454	exon10			CATTTTCTCCAAT	AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.668C>T	chr2.hg19:g.189449050C>T	ENSP00000386289:p.Ser223Phe	243.0	0.0		267.0	114.0	NM_016315	B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Missense_Mutation	SNP	ENST00000409580.1	hg19	CCDS2295.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.7|29.7	5.031842|5.031842	0.93575|0.93575	.|.	.|.	ENSG00000144366|ENSG00000144366	ENST00000451191;ENST00000433052|ENST00000409843;ENST00000409830;ENST00000409805;ENST00000359135;ENST00000409580;ENST00000409609	.|T;T;T;T;T	.|0.49139	.|0.81;0.79;0.79;0.79;0.79	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67961|0.67961	0.2949|0.2949	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.89917	.|0.999;1.0;0.966;0.93	.|D;D;P;P	.|0.91635	.|0.974;0.999;0.691;0.459	T|T	0.68603|0.68603	-0.5365|-0.5365	5|10	.|0.62326	.|D	.|0.03	-8.8574|-8.8574	18.6501|18.6501	0.91428|0.91428	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|120;47;223;223	.|E9PB86;Q59EC1;Q9UBP9;B8ZZ72	.|.;.;GULP1_HUMAN;.	F|F	48;108|223;223;120;223;223;223	.|ENSP00000387144:S223F;ENSP00000386732:S223F;ENSP00000352047:S223F;ENSP00000386289:S223F;ENSP00000386867:S223F	.|ENSP00000352047:S223F	L|S	+|+	1|2	0|0	GULP1|GULP1	189157295|189157295	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	6.770000|6.770000	0.74990|0.74990	2.659000|2.659000	0.90383|0.90383	0.650000|0.650000	0.86243|0.86243	CTC|TCT	.	.		0.408	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335722.1	NM_016315	
SUMF1	285362	hgsc.bcm.edu	37	3	4508802	4508802	+	Missense_Mutation	SNP	G	G	T	rs200789939	byFrequency	TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr3:4508802G>T	ENST00000272902.5	-	1	163	c.128C>A	c.(127-129)gCg>gAg	p.A43E	SUMF1_ENST00000458465.2_Missense_Mutation_p.A43E|SUMF1_ENST00000534863.1_Missense_Mutation_p.A43E|SUMF1_ENST00000383843.5_Missense_Mutation_p.A43E|SUMF1_ENST00000405420.2_Missense_Mutation_p.A43E	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	43					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		AAGGGACCCCGCGCCCGCACC	0.711																																					p.A43E		Atlas-SNP	.											.	SUMF1	23	.	0			c.C128A						.						5.0	7.0	6.0					3																	4508802		2089	4113	6202	SO:0001583	missense	285362	exon1			GACCCCGCGCCCG	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.128C>A	chr3.hg19:g.4508802G>T	ENSP00000272902:p.Ala43Glu	129.0	0.0		95.0	37.0	NM_001164675	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Missense_Mutation	SNP	ENST00000272902.5	hg19	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454038	0.43634	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000458465;ENST00000405420	D;D;D;D;D	0.92699	-2.66;-3.08;-3.04;-2.26;-3.09	4.54	2.71	0.32032	.	0.485588	0.20903	N	0.083614	D	0.86251	0.5888	L	0.59436	1.845	0.09310	N	1	B;B;B;B	0.20368	0.044;0.011;0.006;0.006	B;B;B;B	0.17722	0.016;0.019;0.009;0.009	T	0.67917	-0.5546	10	0.09590	T	0.72	-14.8698	5.3757	0.16164	0.1034:0.0:0.6962:0.2003	.	43;43;43;43	E9PF05;G5E9B0;E9PGL0;Q8NBK3	.;.;.;SUMF1_HUMAN	E	43	ENSP00000440421:A43E;ENSP00000272902:A43E;ENSP00000373355:A43E;ENSP00000410060:A43E;ENSP00000384977:A43E	ENSP00000272902:A43E	A	-	2	0	SUMF1	4483802	0.027000	0.19231	0.013000	0.15412	0.135000	0.20990	1.099000	0.31013	0.615000	0.30124	0.591000	0.81541	GCG	.	G|0.999;A|0.001		0.711	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760	
CELSR3	1951	hgsc.bcm.edu	37	3	48678931	48678931	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr3:48678931A>G	ENST00000164024.4	-	33	9131	c.8851T>C	c.(8851-8853)Tac>Cac	p.Y2951H	MIR4793_ENST00000577502.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.Y2956H	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2951					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCTGGCCAGTAGGACAGGAGG	0.607																																					p.Y2951H		Atlas-SNP	.											.	CELSR3	237	.	0			c.T8851C						.						42.0	47.0	46.0					3																	48678931		2203	4296	6499	SO:0001583	missense	1951	exon33			GCCAGTAGGACAG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.8851T>C	chr3.hg19:g.48678931A>G	ENSP00000164024:p.Tyr2951His	122.0	0.0		104.0	36.0	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	hg19	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.287284	0.59867	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.71698	-0.59;-0.58	5.22	5.22	0.72569	.	.	.	.	.	T	0.79782	0.4505	M	0.72894	2.215	0.53688	D	0.999975	B;B;D	0.71674	0.001;0.001;0.998	B;B;P	0.61477	0.004;0.002;0.889	T	0.77021	-0.2742	9	0.17832	T	0.49	.	15.1004	0.72269	1.0:0.0:0.0:0.0	.	2956;2951;3049	Q9NYQ7-2;Q9NYQ7;Q5Y190	.;CELR3_HUMAN;.	H	2951;2956	ENSP00000164024:Y2951H;ENSP00000445694:Y2956H	ENSP00000164024:Y2951H	Y	-	1	0	CELSR3	48653935	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.591000	0.90824	1.972000	0.57404	0.421000	0.28195	TAC	.	.		0.607	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
FGFBP1	9982	hgsc.bcm.edu	37	4	15937929	15937929	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr4:15937929C>A	ENST00000382333.1	-	3	621	c.327G>T	c.(325-327)gaG>gaT	p.E109D	FGFBP1_ENST00000259988.2_Missense_Mutation_p.E109D	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	109					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						AATAGACTCTCTCATCCTTGA	0.458																																					p.E109D		Atlas-SNP	.											.	FGFBP1	26	.	0			c.G327T						.						107.0	103.0	105.0					4																	15937929		2203	4300	6503	SO:0001583	missense	9982	exon3			GACTCTCTCATCC	M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.327G>T	chr4.hg19:g.15937929C>A	ENSP00000371770:p.Glu109Asp	95.0	0.0		39.0	18.0	NM_005130	A8K5J2	Missense_Mutation	SNP	ENST00000382333.1	hg19	CCDS3418.1	.	.	.	.	.	.	.	.	.	.	C	8.954	0.968816	0.18659	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.14640	2.49;2.49	5.42	-6.62	0.01813	.	1.100300	0.06732	N	0.776804	T	0.04318	0.0119	N	0.04018	-0.295	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.41197	-0.9522	10	0.17369	T	0.5	-0.1104	3.9323	0.09292	0.0866:0.2675:0.3858:0.26	.	109	Q14512	FGFP1_HUMAN	D	109	ENSP00000371770:E109D;ENSP00000259988:E109D	ENSP00000259988:E109D	E	-	3	2	FGFBP1	15547027	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.907000	0.04067	-1.247000	0.02507	-0.512000	0.04463	GAG	.	.		0.458	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1	NM_005130	
FRAS1	80144	hgsc.bcm.edu	37	4	79340185	79340185	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr4:79340185A>T	ENST00000325942.6	+	33	4948	c.4508A>T	c.(4507-4509)tAc>tTc	p.Y1503F	FRAS1_ENST00000264895.6_Missense_Mutation_p.Y1503F	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1503					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AAGATTGTCTACAACATCACT	0.363																																					p.Y1503F		Atlas-SNP	.											.	FRAS1	779	.	0			c.A4508T						.						180.0	173.0	175.0					4																	79340185		1881	4114	5995	SO:0001583	missense	80144	exon33			TTGTCTACAACAT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4508A>T	chr4.hg19:g.79340185A>T	ENSP00000326330:p.Tyr1503Phe	73.0	0.0		44.0	18.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	A	10.18	1.278996	0.23307	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.40225	1.04;1.04	5.22	5.22	0.72569	.	0.069181	0.64402	D	0.000012	T	0.39572	0.1083	M	0.64260	1.97	0.80722	D	1	P;B	0.35982	0.531;0.341	B;B	0.34452	0.183;0.137	T	0.33548	-0.9864	10	0.42905	T	0.14	.	11.1482	0.48442	0.8621:0.0:0.0:0.1379	.	1503;1503	E9PHH6;A2RRR8	.;.	F	1503	ENSP00000326330:Y1503F;ENSP00000264895:Y1503F	ENSP00000264895:Y1503F	Y	+	2	0	FRAS1	79559209	0.998000	0.40836	0.720000	0.30636	0.017000	0.09413	2.789000	0.47813	2.099000	0.63709	0.533000	0.62120	TAC	.	.		0.363	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
CDH9	1007	hgsc.bcm.edu	37	5	26885790	26885790	+	Silent	SNP	C	C	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr5:26885790C>A	ENST00000231021.4	-	11	1987	c.1815G>T	c.(1813-1815)ctG>ctT	p.L605L		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	605	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CTGAAAGGATCAGGGCTTCTG	0.498																																					p.L605L	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.G1815T						.						84.0	69.0	74.0					5																	26885790		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon11			AAGGATCAGGGCT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1815G>T	chr5.hg19:g.26885790C>A		188.0	0.0		206.0	98.0	NM_016279	Q3B7I5	Silent	SNP	ENST00000231021.4	hg19	CCDS3893.1																																																																																			.	.		0.498	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
SNX18	112574	hgsc.bcm.edu	37	5	53839038	53839038	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr5:53839038C>T	ENST00000381410.4	+	2	1841	c.1651C>T	c.(1651-1653)Cga>Tga	p.R551*	SNX18_ENST00000343017.6_3'UTR	NM_001102575.1	NP_001096045.1	Q96RF0	SNX18_HUMAN	sorting nexin 18	0	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				GGAGAGTAGGCGACACGTGGA	0.398																																					p.R551X		Atlas-SNP	.											.	SNX18	102	.	0			c.C1651T						.						92.0	90.0	90.0					5																	53839038		1904	4113	6017	SO:0001587	stop_gained	112574	exon2			AGTAGGCGACACG	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000381410.4:c.1651C>T	chr5.hg19:g.53839038C>T	ENSP00000370817:p.Arg551*	265.0	0.0		275.0	117.0	NM_001102575	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Nonsense_Mutation	SNP	ENST00000381410.4	hg19	CCDS43317.1	.	.	.	.	.	.	.	.	.	.	C	39	7.430029	0.98279	.	.	ENSG00000178996	ENST00000381410	.	.	.	5.72	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7453	0.62872	0.2803:0.7197:0.0:0.0	.	.	.	.	X	551	.	ENSP00000370817:R551X	R	+	1	2	SNX18	53874795	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.969000	0.40510	1.379000	0.46325	0.655000	0.94253	CGA	.	.		0.398	SNX18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214073.2		
ZNF608	57507	hgsc.bcm.edu	37	5	124080294	124080294	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr5:124080294A>T	ENST00000306315.5	-	1	824	c.389T>A	c.(388-390)aTc>aAc	p.I130N	ZNF608_ENST00000504926.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	130							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		AGTGCTGCTGATCTCGGGAAT	0.522																																					p.I130N		Atlas-SNP	.											.	ZNF608	117	.	0			c.T389A						.						75.0	74.0	74.0					5																	124080294		2203	4300	6503	SO:0001583	missense	57507	exon1			CTGCTGATCTCGG	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.389T>A	chr5.hg19:g.124080294A>T	ENSP00000307746:p.Ile130Asn	84.0	0.0		74.0	45.0	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	hg19	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.316022	0.40996	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.42900	0.96	5.07	3.89	0.44902	.	0.000000	0.64402	D	0.000014	T	0.44767	0.1309	L	0.51422	1.61	0.39589	D	0.96955	D	0.56968	0.978	P	0.50049	0.629	T	0.38156	-0.9674	10	0.36615	T	0.2	-6.4651	12.049	0.53495	0.8556:0.1444:0.0:0.0	.	130	Q9ULD9	ZN608_HUMAN	N	130	ENSP00000307746:I130N	ENSP00000307746:I130N	I	-	2	0	ZNF608	124108193	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.809000	0.47971	0.859000	0.35456	0.533000	0.62120	ATC	.	.		0.522	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
PCDHB7	56129	hgsc.bcm.edu	37	5	140554567	140554567	+	Silent	SNP	G	G	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr5:140554567G>C	ENST00000231137.3	+	1	2325	c.2151G>C	c.(2149-2151)gcG>gcC	p.A717A	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	717					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCAGGGCGGCCCCGGTGG	0.662																																					p.A717A		Atlas-SNP	.											.	PCDHB7	231	.	0			c.G2151C						.						72.0	122.0	105.0					5																	140554567		2203	4298	6501	SO:0001819	synonymous_variant	56129	exon1			CAGGGCGGCCCCG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2151G>C	chr5.hg19:g.140554567G>C		139.0	0.0		142.0	62.0	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	hg19	CCDS4249.1																																																																																			.	.		0.662	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
MRS2	57380	hgsc.bcm.edu	37	6	24412501	24412501	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr6:24412501A>G	ENST00000378386.3	+	5	559	c.466A>G	c.(466-468)Aat>Gat	p.N156D	MRS2_ENST00000378353.1_Missense_Mutation_p.N156D|MRS2_ENST00000543597.1_5'UTR|MRS2_ENST00000274747.7_Silent_p.*118*|MRS2_ENST00000443868.2_Intron|MRS2_ENST00000483634.1_3'UTR|MRS2_ENST00000535061.1_Missense_Mutation_p.N106D	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	156						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						AGATTATCGTAATTTAAACTT	0.348																																					p.N156D		Atlas-SNP	.											.	MRS2	31	.	0			c.A466G						.						92.0	89.0	90.0					6																	24412501		2203	4300	6503	SO:0001583	missense	57380	exon5			TATCGTAATTTAA	AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.466A>G	chr6.hg19:g.24412501A>G	ENSP00000367637:p.Asn156Asp	223.0	0.0		205.0	98.0	NM_020662	A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Missense_Mutation	SNP	ENST00000378386.3	hg19	CCDS4552.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.317485	0.40996	.	.	ENSG00000124532	ENST00000535061;ENST00000378386;ENST00000378353	T;T;T	0.43294	1.47;1.54;0.95	5.46	2.88	0.33553	.	0.165679	0.53938	D	0.000046	T	0.09555	0.0235	N	0.12887	0.27	0.80722	D	1	B;B;B	0.18166	0.005;0.026;0.005	B;B;B	0.22152	0.005;0.038;0.009	T	0.10894	-1.0610	10	0.10111	T	0.7	.	11.9533	0.52966	0.7253:0.2746:0.0:0.0	.	106;156;156	F5GWH3;Q9HD23;Q9HD23-2	.;MRS2_HUMAN;.	D	106;156;156	ENSP00000441839:N106D;ENSP00000367637:N156D;ENSP00000367604:N156D	ENSP00000367604:N156D	N	+	1	0	MRS2	24520480	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	1.492000	0.35594	0.881000	0.35993	0.379000	0.24179	AAT	.	.		0.348	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040002.1		
HIST1H2AE	3012	hgsc.bcm.edu	37	6	26217258	26217258	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr6:26217258C>T	ENST00000303910.2	+	1	94	c.56C>T	c.(55-57)tCt>tTt	p.S19F	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	19						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				AAAACGCGTTCTTCCAGGGCC	0.557																																					p.S19F		Atlas-SNP	.											.	HIST1H2AE	25	.	0			c.C56T						.						67.0	57.0	60.0					6																	26217258		2203	4299	6502	SO:0001583	missense	3012	exon1			CGCGTTCTTCCAG	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.56C>T	chr6.hg19:g.26217258C>T	ENSP00000303373:p.Ser19Phe	141.0	0.0		139.0	59.0	NM_021052	P28001|Q76P63	Missense_Mutation	SNP	ENST00000303910.2	hg19	CCDS4595.1	.	.	.	.	.	.	.	.	.	.	.	9.131	1.011378	0.19277	.	.	ENSG00000168274	ENST00000303910	T	0.71698	-0.59	3.99	3.99	0.46301	.	0.000000	0.33110	U	0.005279	D	0.91099	0.7198	H	0.99929	4.97	0.53688	D	0.999971	.	.	.	.	.	.	D	0.95024	0.8163	8	0.87932	D	0	.	15.5885	0.76506	0.0:1.0:0.0:0.0	.	.	.	.	F	19	ENSP00000303373:S19F	ENSP00000303373:S19F	S	+	2	0	HIST1H2AE	26325237	1.000000	0.71417	0.027000	0.17364	0.125000	0.20455	7.473000	0.81007	2.219000	0.72066	0.591000	0.81541	TCT	.	.		0.557	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
TBX18	9096	hgsc.bcm.edu	37	6	85446717	85446717	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr6:85446717A>T	ENST00000369663.5	-	8	1847	c.1510T>A	c.(1510-1512)Tcc>Acc	p.S504T	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	504					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GCATTGCTGGAGGGTGATGGC	0.507																																					p.S504T		Atlas-SNP	.											.	TBX18	131	.	0			c.T1510A						.						165.0	173.0	170.0					6																	85446717		2203	4300	6503	SO:0001583	missense	9096	exon8			TGCTGGAGGGTGA	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1510T>A	chr6.hg19:g.85446717A>T	ENSP00000358677:p.Ser504Thr	111.0	0.0		115.0	55.0	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	hg19	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	A	8.114	0.779463	0.16120	.	.	ENSG00000112837	ENST00000369663	D	0.88664	-2.41	5.48	1.5	0.22942	.	0.127443	0.53938	D	0.000048	T	0.56717	0.2004	N	0.17082	0.46	0.28197	N	0.927514	B	0.15473	0.013	B	0.12156	0.007	T	0.48917	-0.8992	10	0.22706	T	0.39	.	3.891	0.09119	0.59:0.0:0.1505:0.2595	.	504	O95935	TBX18_HUMAN	T	504	ENSP00000358677:S504T	ENSP00000358677:S504T	S	-	1	0	TBX18	85503436	0.849000	0.29639	0.992000	0.48379	0.633000	0.38033	1.026000	0.30103	0.015000	0.14971	-0.334000	0.08254	TCC	.	.		0.507	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
BACH2	60468	hgsc.bcm.edu	37	6	90661177	90661177	+	Silent	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr6:90661177G>A	ENST00000257749.4	-	7	1355	c.648C>T	c.(646-648)acC>acT	p.T216T	BACH2_ENST00000343122.3_Silent_p.T216T|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Silent_p.T216T|RP3-512E2.2_ENST00000413986.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	216						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		AGCTCTCCTTGGTGTCTGTGG	0.532																																					p.T216T		Atlas-SNP	.											.	BACH2	224	.	0			c.C648T						.						139.0	130.0	133.0					6																	90661177		2203	4300	6503	SO:0001819	synonymous_variant	60468	exon7			CTCCTTGGTGTCT	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.648C>T	chr6.hg19:g.90661177G>A		104.0	0.0		77.0	31.0	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	ENST00000257749.4	hg19	CCDS5026.1																																																																																			.	.		0.532	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
EPHA7	2045	hgsc.bcm.edu	37	6	94120371	94120371	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr6:94120371A>G	ENST00000369303.4	-	3	864	c.680T>C	c.(679-681)tTa>tCa	p.L227S	EPHA7_ENST00000369297.1_Missense_Mutation_p.L227S	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	227	Cys-rich.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		AACCTCGACTAAAGAGGAAAA	0.468																																					p.L227S		Atlas-SNP	.											.	EPHA7	251	.	0			c.T680C						.						69.0	71.0	70.0					6																	94120371		2203	4300	6503	SO:0001583	missense	2045	exon3			TCGACTAAAGAGG	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.680T>C	chr6.hg19:g.94120371A>G	ENSP00000358309:p.Leu227Ser	174.0	0.0		154.0	64.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	hg19	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218328	0.79464	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.75704	-0.96;4.0	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	D	0.87752	0.6256	M	0.92169	3.28	0.51482	D	0.999923	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.97110	0.986;1.0;0.999;0.998	D	0.90843	0.4725	10	0.87932	D	0	.	15.8204	0.78638	1.0:0.0:0.0:0.0	.	227;227;227;227	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	S	227	ENSP00000358309:L227S;ENSP00000358303:L227S	ENSP00000358303:L227S	L	-	2	0	EPHA7	94177092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	2.196000	0.70406	0.533000	0.62120	TTA	.	.		0.468	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
ANK1	286	hgsc.bcm.edu	37	8	41550170	41550170	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr8:41550170A>T	ENST00000347528.4	-	31	3937	c.3854T>A	c.(3853-3855)aTa>aAa	p.I1285K	ANK1_ENST00000265709.8_Missense_Mutation_p.I1326K|ANK1_ENST00000379758.2_Missense_Mutation_p.I1285K|ANK1_ENST00000289734.7_Missense_Mutation_p.I1285K|ANK1_ENST00000352337.4_Missense_Mutation_p.I1285K|ANK1_ENST00000396942.1_Missense_Mutation_p.I1285K|ANK1_ENST00000396945.1_Missense_Mutation_p.I1285K	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1285	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGTTACCTCTATGTCCCTGCT	0.602																																					p.I1326K		Atlas-SNP	.											.	ANK1	497	.	0			c.T3977A						.						153.0	175.0	167.0					8																	41550170		2203	4300	6503	SO:0001583	missense	286	exon32			ACCTCTATGTCCC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3854T>A	chr8.hg19:g.41550170A>T	ENSP00000339620:p.Ile1285Lys	46.0	0.0		79.0	10.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	hg19	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.0|28.0	4.880070|4.880070	0.91740|0.91740	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.|T;T;T;T;T;T;T	.|0.26810	.|1.71;1.71;1.71;1.71;1.71;1.71;1.71	4.26|4.26	4.26|4.26	0.50523|0.50523	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48466|0.48466	0.1501|0.1501	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	.|P;P;D;D;P;D	.|0.71674	.|0.954;0.9;0.991;0.998;0.954;0.994	.|P;B;P;P;P;P	.|0.62089	.|0.804;0.386;0.898;0.891;0.804;0.825	T|T	0.55970|0.55970	-0.8056|-0.8056	5|10	.|0.87932	.|D	.|0	.|.	13.8755|13.8755	0.63651|0.63651	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1326;1285;1285;1285;1285;601	.|P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.|.;.;ANK1_HUMAN;.;.;.	Q|K	606|1285;1285;1285;1285;1285;1285;1326;1285	.|ENSP00000339620:I1285K;ENSP00000289734:I1285K;ENSP00000369082:I1285K;ENSP00000380149:I1285K;ENSP00000380147:I1285K;ENSP00000309131:I1285K;ENSP00000265709:I1326K	.|ENSP00000265709:I1326K	H|I	-|-	3|2	2|0	ANK1|ANK1	41669327|41669327	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	9.119000|9.119000	0.94362|0.94362	1.933000|1.933000	0.56026|0.56026	0.383000|0.383000	0.25322|0.25322	CAT|ATA	.	.		0.602	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
KANK1	23189	hgsc.bcm.edu	37	9	711611	711611	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr9:711611G>A	ENST00000382303.1	+	7	1497	c.845G>A	c.(844-846)cGa>cAa	p.R282Q	KANK1_ENST00000382297.2_Missense_Mutation_p.R282Q|KANK1_ENST00000382293.3_Missense_Mutation_p.R124Q|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	282					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GAGCAGGTGCGAACCATCCCT	0.547																																					p.R282Q		Atlas-SNP	.											.	KANK1	231	.	0			c.G845A						.						87.0	81.0	83.0					9																	711611		2203	4300	6503	SO:0001583	missense	23189	exon7			AGGTGCGAACCAT	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.845G>A	chr9.hg19:g.711611G>A	ENSP00000371740:p.Arg282Gln	95.0	0.0		41.0	29.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642865	0.67244	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.00816	5.66;5.66;5.66	5.93	5.93	0.95920	.	0.000000	0.49305	D	0.000149	T	0.00936	0.0031	N	0.14661	0.345	0.80722	D	1	D;D	0.54601	0.963;0.967	P;B	0.46299	0.511;0.229	T	0.76318	-0.3003	10	0.46703	T	0.11	-1.3225	7.779	0.29054	0.188:0.0:0.812:0.0	.	282;282	Q5W0W1;Q14678	.;KANK1_HUMAN	Q	282;282;282;124	ENSP00000371740:R282Q;ENSP00000371734:R282Q;ENSP00000371730:R124Q	ENSP00000346479:R282Q	R	+	2	0	KANK1	701611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.128000	0.77217	2.826000	0.97356	0.655000	0.94253	CGA	.	.		0.547	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
SLC44A1	23446	hgsc.bcm.edu	37	9	108126972	108126972	+	Silent	SNP	A	A	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr9:108126972A>C	ENST00000374720.3	+	10	1471	c.1224A>C	c.(1222-1224)gcA>gcC	p.A408A	SLC44A1_ENST00000343170.7_Silent_p.A200A|SLC44A1_ENST00000374723.1_Silent_p.A408A|SLC44A1_ENST00000374724.1_Silent_p.A408A	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	408					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TGACAGTGGCAGGAGCTGTGG	0.453																																					p.A408A		Atlas-SNP	.											.	SLC44A1	61	.	0			c.A1224C						.						137.0	126.0	130.0					9																	108126972		2203	4300	6503	SO:0001819	synonymous_variant	23446	exon10			AGTGGCAGGAGCT	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1224A>C	chr9.hg19:g.108126972A>C		143.0	0.0		88.0	81.0	NM_080546	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Silent	SNP	ENST00000374720.3	hg19	CCDS6763.1																																																																																			.	.		0.453	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546	
ASTN2	23245	hgsc.bcm.edu	37	9	119249699	119249699	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr9:119249699C>A	ENST00000313400.4	-	20	3536	c.3436G>T	c.(3436-3438)Gtc>Ttc	p.V1146F	ASTN2_ENST00000361477.3_Missense_Mutation_p.V198F|ASTN2_ENST00000373996.3_Missense_Mutation_p.V1142F|ASTN2_ENST00000288520.5_Missense_Mutation_p.V247F|ASTN2_ENST00000341734.4_Missense_Mutation_p.V198F|ASTN2_ENST00000361209.2_Missense_Mutation_p.V1095F			O75129	ASTN2_HUMAN	astrotactin 2	1146	Fibronectin type-III.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACTTCAGGGACCTCTCCATGG	0.502																																					p.V1095F		Atlas-SNP	.											.	ASTN2	307	.	0			c.G3283T						.						111.0	100.0	104.0					9																	119249699		2203	4300	6503	SO:0001583	missense	23245	exon19			CAGGGACCTCTCC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3436G>T	chr9.hg19:g.119249699C>A	ENSP00000314038:p.Val1146Phe	78.0	0.0		40.0	33.0	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	hg19		.	.	.	.	.	.	.	.	.	.	C	15.13	2.743335	0.49151	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.49	3.62	0.41486	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.574679	0.19379	N	0.115713	T	0.36413	0.0966	N	0.24115	0.695	0.27369	N	0.955756	B;B;B;B;P;B;B	0.37398	0.073;0.073;0.058;0.09;0.593;0.073;0.062	B;B;B;B;B;B;B	0.40506	0.041;0.041;0.007;0.02;0.331;0.041;0.034	T	0.31475	-0.9942	10	0.66056	D	0.02	-22.2596	10.4469	0.44499	0.0:0.7913:0.0:0.2087	.	198;198;1095;1146;1142;198;247	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	F	1146;1142;247;198;869;1095;198	ENSP00000314038:V1146F;ENSP00000363108:V1142F;ENSP00000288520:V247F;ENSP00000339925:V198F;ENSP00000363098:V869F;ENSP00000354504:V1095F;ENSP00000355116:V198F	ENSP00000288520:V247F	V	-	1	0	ASTN2	118289520	0.613000	0.27009	1.000000	0.80357	0.997000	0.91878	0.497000	0.22514	1.476000	0.48215	-0.122000	0.15005	GTC	.	.		0.502	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
CPEB3	22849	hgsc.bcm.edu	37	10	93904825	93904825	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr10:93904825T>A	ENST00000265997.4	-	5	1412	c.1240A>T	c.(1240-1242)Agc>Tgc	p.S414C	CPEB3_ENST00000412050.4_Missense_Mutation_p.S400C	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	414					3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				TCACCATGGCTATCATCCAGG	0.423																																					p.S414C		Atlas-SNP	.											.	CPEB3	43	.	0			c.A1240T						.						102.0	91.0	95.0					10																	93904825		2203	4300	6503	SO:0001583	missense	22849	exon5			CATGGCTATCATC	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.1240A>T	chr10.hg19:g.93904825T>A	ENSP00000265997:p.Ser414Cys	112.0	0.0		115.0	36.0	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Missense_Mutation	SNP	ENST00000265997.4	hg19	CCDS31246.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.993817	0.74703	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.47177	0.85;0.86	5.39	4.26	0.50523	.	0.190023	0.64402	D	0.000014	T	0.44244	0.1284	N	0.22421	0.69	0.38958	D	0.958499	D;D;D	0.62365	0.991;0.964;0.979	P;B;P	0.54759	0.76;0.338;0.634	T	0.48091	-0.9065	10	0.72032	D	0.01	-2.4026	8.4764	0.33016	0.0:0.1499:0.0:0.8501	.	414;400;400	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	C	400;400;414	ENSP00000398310:S400C;ENSP00000265997:S414C	ENSP00000265997:S414C	S	-	1	0	CPEB3	93894805	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.583000	0.46094	0.891000	0.36235	-0.256000	0.11100	AGC	.	.		0.423	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
PIDD1	55367	hgsc.bcm.edu	37	11	802041	802041	+	Missense_Mutation	SNP	C	C	T	rs554590814		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr11:802041C>T	ENST00000347755.5	-	7	1367	c.1226G>A	c.(1225-1227)cGt>cAt	p.R409H	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.R409H	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CACCACTTCACGGCAGCGCCG	0.677													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13336	0.0		0.0	False		,,,				2504	0.0				p.R409H		Atlas-SNP	.											.	PIDD	76	.	0			c.G1226A						.						24.0	22.0	23.0					11																	802041		2194	4290	6484	SO:0001583	missense	55367	exon7			ACTTCACGGCAGC																												ENST00000347755.5:c.1226G>A	chr11.hg19:g.802041C>T	ENSP00000337797:p.Arg409His	91.0	0.0		71.0	30.0	NM_145887		Missense_Mutation	SNP	ENST00000347755.5	hg19	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.422422	0.25639	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.42900	0.96;0.96	4.16	1.03	0.20045	ZU5 (2);	0.173432	0.35207	N	0.003377	T	0.25901	0.0631	L	0.32530	0.975	0.09310	N	1	B;B;B	0.27264	0.173;0.108;0.116	B;B;B	0.19946	0.027;0.012;0.017	T	0.16158	-1.0412	10	0.62326	D	0.03	.	5.4151	0.16370	0.1406:0.6151:0.0:0.2442	.	409;263;409	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	H	409	ENSP00000416801:R409H;ENSP00000337797:R409H	ENSP00000337797:R409H	R	-	2	0	PIDD	792041	0.061000	0.20836	0.695000	0.30226	0.309000	0.27889	1.204000	0.32296	0.413000	0.25759	0.561000	0.74099	CGT	.	.		0.677	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1		
MUC2	4583	hgsc.bcm.edu	37	11	1092675	1092675	+	Silent	SNP	C	C	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr11:1092675C>A	ENST00000441003.2	+	30	4521	c.4494C>A	c.(4492-4494)acC>acA	p.T1498T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.T1499T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4233	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caccaaccaccactcccagcc	0.627																																					p.T1498T		Atlas-SNP	.											.	MUC2	614	.	0			c.C4494A						.						376.0	554.0	492.0					11																	1092675		1763	3316	5079	SO:0001819	synonymous_variant	4583	exon30			AACCACCACTCCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4494C>A	chr11.hg19:g.1092675C>A		257.0	0.0		198.0	19.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
AMBRA1	55626	hgsc.bcm.edu	37	11	46456546	46456546	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr11:46456546C>T	ENST00000458649.2	-	13	3092	c.2674G>A	c.(2674-2676)Gat>Aat	p.D892N	AMBRA1_ENST00000426438.1_Missense_Mutation_p.D863N|AMBRA1_ENST00000534300.1_Missense_Mutation_p.D832N|AMBRA1_ENST00000533727.1_Missense_Mutation_p.D773N|AMBRA1_ENST00000314845.3_Missense_Mutation_p.D802N|AMBRA1_ENST00000528950.1_Missense_Mutation_p.D863N|AMBRA1_ENST00000298834.3_Missense_Mutation_p.D832N			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	892					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CAGCTGGCATCATTGTAGATC	0.478																																					p.D895N		Atlas-SNP	.											.	AMBRA1	201	.	0			c.G2683A						.						42.0	38.0	39.0					11																	46456546		2201	4299	6500	SO:0001583	missense	55626	exon15			TGGCATCATTGTA	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2674G>A	chr11.hg19:g.46456546C>T	ENSP00000415327:p.Asp892Asn	101.0	0.0		105.0	50.0	NM_001267782	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.861776	0.97036	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.05447	3.44;3.44;3.44;3.44;3.44;3.44;3.44	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	M	0.71036	2.16	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;0.998;0.998;0.998	D;D;D;D;D;D	0.87578	0.989;0.998;0.998;0.995;0.995;0.995	T	0.00121	-1.2028	10	0.87932	D	0	.	20.1772	0.98182	0.0:1.0:0.0:0.0	.	892;863;832;773;895;802	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	N	802;773;832;863;832;892;863	ENSP00000318313:D802N;ENSP00000433372:D773N;ENSP00000431926:D832N;ENSP00000410899:D863N;ENSP00000298834:D832N;ENSP00000415327:D892N;ENSP00000433945:D863N	ENSP00000298834:D832N	D	-	1	0	AMBRA1	46413122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.636000	0.83301	2.778000	0.95560	0.655000	0.94253	GAT	.	.		0.478	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
FOLR4	390243	hgsc.bcm.edu	37	11	94040366	94040366	+	Silent	SNP	T	T	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr11:94040366T>C	ENST00000440961.2	+	3	407	c.363T>C	c.(361-363)aaT>aaC	p.N121N		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	128					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.N122K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						GAGTTGTGAATGTGCCGCTGT	0.537																																					p.N128N		Atlas-SNP	.											FOLR4,NS,carcinoma,0,1	FOLR4	31	.	1	Substitution - Missense(1)	ovary(1)	c.T384C						.						93.0	100.0	98.0					11																	94040366		2185	4286	6471	SO:0001819	synonymous_variant	390243	exon3			TGTGAATGTGCCG			11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.363T>C	chr11.hg19:g.94040366T>C		112.0	0.0		104.0	50.0	NM_001199206		Silent	SNP	ENST00000440961.2	hg19		.	.	.	.	.	.	.	.	.	.	T	4.151	0.026365	0.08054	.	.	ENSG00000183560	ENST00000328458	.	.	.	4.57	-6.96	0.01622	.	.	.	.	.	T	0.30448	0.0765	.	.	.	0.34156	D	0.668073	.	.	.	.	.	.	T	0.37526	-0.9702	4	.	.	.	-15.711	3.8329	0.08882	0.1055:0.2616:0.1047:0.5283	.	.	.	.	T	122	.	.	M	+	2	0	FOLR4	93680014	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.849000	0.01672	-1.309000	0.02315	0.402000	0.26972	ATG	.	.		0.537	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000396420.1	NM_001080486	
DRD2	1813	hgsc.bcm.edu	37	11	113288785	113288785	+	Missense_Mutation	SNP	G	G	A	rs201724929		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr11:113288785G>A	ENST00000362072.3	-	3	703	c.359C>T	c.(358-360)gCg>gTg	p.A120V	DRD2_ENST00000538967.1_Missense_Mutation_p.A120V|DRD2_ENST00000544518.1_Missense_Mutation_p.A119V|DRD2_ENST00000346454.3_Missense_Mutation_p.A120V|DRD2_ENST00000535984.1_5'UTR|DRD2_ENST00000542968.1_Missense_Mutation_p.A120V|DRD2_ENST00000355319.2_Missense_Mutation_p.A120V	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	120					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CAGGATGCTCGCCGTGCACAT	0.542																																					p.A120V		Atlas-SNP	.											.	DRD2	98	.	0			c.C359T						.						173.0	120.0	138.0					11																	113288785		2201	4296	6497	SO:0001583	missense	1813	exon3			ATGCTCGCCGTGC	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.359C>T	chr11.hg19:g.113288785G>A	ENSP00000354859:p.Ala120Val	68.0	0.0		58.0	21.0	NM_016574	Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	hg19	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	G	35	5.457579	0.96240	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967;ENST00000543292	T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.146095	0.64402	D	0.000008	D	0.89705	0.6792	M	0.92555	3.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.977;0.977;0.977;0.991	D	0.91984	0.5597	10	0.87932	D	0	.	18.7905	0.91973	0.0:0.0:1.0:0.0	.	119;120;120;120	F8VUV1;P14416-3;P14416-2;P14416	.;.;.;DRD2_HUMAN	V	120;120;120;119;120;120;120	ENSP00000347474:A120V;ENSP00000278597:A120V;ENSP00000354859:A120V;ENSP00000441068:A119V;ENSP00000442172:A120V;ENSP00000438215:A120V;ENSP00000438419:A120V	ENSP00000278597:A120V	A	-	2	0	DRD2	112793995	1.000000	0.71417	0.994000	0.49952	0.877000	0.50540	9.768000	0.98965	2.591000	0.87537	0.655000	0.94253	GCG	.	.		0.542	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
NPFF	8620	hgsc.bcm.edu	37	12	53899546	53899546	+	IGR	SNP	C	C	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr12:53899546C>G	ENST00000267017.3	-	0	592				TARBP2_ENST00000456234.2_Silent_p.G264G|TARBP2_ENST00000552857.1_Missense_Mutation_p.L152V|TARBP2_ENST00000266987.2_Silent_p.G285G|TARBP2_ENST00000394357.2_Silent_p.G264G	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GCTCCCTGGGCTCCCTGGGTG	0.597																																					p.G285G		Atlas-SNP	.											.	TARBP2	35	.	0			c.C855G						.						79.0	82.0	81.0					12																	53899546		2203	4300	6503	SO:0001628	intergenic_variant	6895	exon8			CCTGGGCTCCCTG	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		chr12.hg19:g.53899546C>G		69.0	0.0		25.0	21.0	NM_134323	Q3SXL4	Silent	SNP	ENST00000267017.3	hg19	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	C	9.802	1.180730	0.21787	.	.	ENSG00000139546	ENST00000552857;ENST00000550407	.	.	.	4.98	0.906	0.19314	.	.	.	.	.	T	0.30070	0.0753	.	.	.	0.53005	D	0.999967	.	.	.	.	.	.	T	0.08493	-1.0719	5	0.06757	T	0.87	-6.723	7.4954	0.27485	0.0:0.4611:0.3861:0.1528	.	.	.	.	V	152;144	.	ENSP00000447767:L144V	L	+	1	0	TARBP2	52185813	0.000000	0.05858	0.684000	0.30055	0.993000	0.82548	-0.368000	0.07543	0.062000	0.16340	0.561000	0.74099	CTC	.	.		0.597	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
ACACB	32	hgsc.bcm.edu	37	12	109692040	109692040	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr12:109692040A>G	ENST00000338432.7	+	44	6186	c.6067A>G	c.(6067-6069)Atc>Gtc	p.I2023V	ACACB_ENST00000543201.1_Missense_Mutation_p.I689V|ACACB_ENST00000377854.5_Missense_Mutation_p.I1953V|ACACB_ENST00000377848.3_Missense_Mutation_p.I2023V			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2023	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CCCTGTCCCTATCATCACACC	0.498																																					p.I2023V		Atlas-SNP	.											.	ACACB	330	.	0			c.A6067G						.						255.0	240.0	245.0					12																	109692040		2203	4300	6503	SO:0001583	missense	32	exon43			GTCCCTATCATCA	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6067A>G	chr12.hg19:g.109692040A>G	ENSP00000341044:p.Ile2023Val	132.0	0.0		66.0	52.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	hg19	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.325474	0.24080	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	5.27	2.9	0.33743	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.239612	0.45126	N	0.000387	T	0.21590	0.0520	L	0.38175	1.15	0.30748	N	0.745382	B	0.02656	0.0	B	0.09377	0.004	T	0.12502	-1.0545	10	0.33141	T	0.24	.	8.3136	0.32086	0.6995:0.0:0.3005:0.0	.	2023	O00763	ACACB_HUMAN	V	2023;2023;1953;1254;689	ENSP00000341044:I2023V;ENSP00000367079:I2023V;ENSP00000367085:I1953V;ENSP00000444075:I689V	ENSP00000341044:I2023V	I	+	1	0	ACACB	108176423	0.152000	0.22762	0.678000	0.29963	0.985000	0.73830	0.614000	0.24314	0.416000	0.25844	-0.290000	0.09829	ATC	.	.		0.498	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
RPGRIP1	57096	hgsc.bcm.edu	37	14	21769132	21769132	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr14:21769132A>T	ENST00000400017.2	+	3	226	c.226A>T	c.(226-228)Acc>Tcc	p.T76S	RPGRIP1_ENST00000556336.1_Missense_Mutation_p.T76S|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.T76S|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.T76S	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	76					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CAGGCTGAGGACCACCTTGCT	0.567																																					p.T76S		Atlas-SNP	.											.	RPGRIP1	213	.	0			c.A226T						.						53.0	57.0	56.0					14																	21769132		1896	4060	5956	SO:0001583	missense	57096	exon3			CTGAGGACCACCT	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.226A>T	chr14.hg19:g.21769132A>T	ENSP00000382895:p.Thr76Ser	126.0	0.0		86.0	17.0	NM_020366	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	hg19	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	a	15.33	2.801322	0.50315	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	3.86	3.86	0.44501	.	0.401084	0.23608	N	0.046379	T	0.81059	0.4744	L	0.61218	1.895	0.80722	D	1	B	0.25719	0.132	B	0.17433	0.018	T	0.80238	-0.1465	10	0.62326	D	0.03	-0.5253	9.2661	0.37641	1.0:0.0:0.0:0.0	.	76	Q96KN7	RPGR1_HUMAN	S	76	ENSP00000450445:T76S;ENSP00000451219:T76S;ENSP00000382895:T76S;ENSP00000206660:T76S	ENSP00000206660:T76S	T	+	1	0	RPGRIP1	20838972	0.825000	0.29262	0.932000	0.37286	0.067000	0.16453	2.234000	0.43035	1.761000	0.52028	0.369000	0.22263	ACC	.	.		0.567	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
CHD8	57680	hgsc.bcm.edu	37	14	21896309	21896309	+	Silent	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr14:21896309C>T	ENST00000557364.1	-	4	1583	c.1320G>A	c.(1318-1320)tcG>tcA	p.S440S	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Silent_p.S161S|CHD8_ENST00000399982.2_Silent_p.S440S|RN7SL650P_ENST00000583681.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	440					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TCTTTCCCCCCGAATGAGGAG	0.527																																					p.S440S		Atlas-SNP	.											.	CHD8	339	.	0			c.G1320A						.						182.0	176.0	178.0					14																	21896309		1957	4143	6100	SO:0001819	synonymous_variant	57680	exon3			TCCCCCCGAATGA	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1320G>A	chr14.hg19:g.21896309C>T		125.0	0.0		93.0	31.0	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	ENST00000557364.1	hg19	CCDS53885.1																																																																																			.	.		0.527	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
NRXN3	9369	hgsc.bcm.edu	37	14	79434578	79434578	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr14:79434578T>A	ENST00000554719.1	+	11	2403	c.1912T>A	c.(1912-1914)Tct>Act	p.S638T	NRXN3_ENST00000335750.5_Missense_Mutation_p.S638T	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	244					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GCTCGTGGCCTCTCGAGATGG	0.507																																					p.S638T		Atlas-SNP	.											.	NRXN3	342	.	0			c.T1912A						.						133.0	116.0	122.0					14																	79434578		2203	4300	6503	SO:0001583	missense	9369	exon11			GTGGCCTCTCGAG	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1912T>A	chr14.hg19:g.79434578T>A	ENSP00000451648:p.Ser638Thr	124.0	0.0		103.0	66.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	hg19	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760307	0.89932	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.76578	-1.03;-1.03	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	.	.	.	0.58432	D	0.999993	D;P	0.53462	0.96;0.837	P;B	0.51657	0.676;0.356	T	0.81982	-0.0683	8	.	.	.	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	1011;638	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	T	1011;1000;638;638	ENSP00000451648:S638T;ENSP00000338349:S638T	.	S	+	1	0	NRXN3	78504331	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	6.248000	0.72418	2.302000	0.77476	0.533000	0.62120	TCT	.	.		0.507	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
SERPINA5	5104	hgsc.bcm.edu	37	14	95053895	95053895	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr14:95053895T>G	ENST00000554866.1	+	2	310	c.196T>G	c.(196-198)Ttc>Gtc	p.F66V	SERPINA5_ENST00000553780.1_Missense_Mutation_p.F66V|SERPINA5_ENST00000329597.7_Missense_Mutation_p.F66V|SERPINA5_ENST00000554276.1_Missense_Mutation_p.F66V			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	66					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	CCAGAGCATCTTCTTCTCCCC	0.622																																					p.F66V		Atlas-SNP	.											.	SERPINA5	69	.	0			c.T196G						.						35.0	34.0	35.0					14																	95053895		2203	4300	6503	SO:0001583	missense	5104	exon3			AGCATCTTCTTCT	M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.196T>G	chr14.hg19:g.95053895T>G	ENSP00000451126:p.Phe66Val	95.0	0.0		82.0	49.0	NM_000624	Q07616|Q9UG30	Missense_Mutation	SNP	ENST00000554866.1	hg19	CCDS9928.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.548933	0.45383	.	.	ENSG00000188488	ENST00000554220;ENST00000553780;ENST00000554760;ENST00000554866;ENST00000329597;ENST00000556775;ENST00000553511;ENST00000554633;ENST00000555681;ENST00000554276;ENST00000557598	D;D;D;D;D;D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	4.11	-0.223	0.13118	Serpin domain (3);	0.084800	0.50627	D	0.000118	T	0.76786	0.4036	M	0.67517	2.055	0.41583	D	0.988756	B;B	0.19331	0.028;0.035	B;B	0.25884	0.064;0.035	T	0.63897	-0.6533	10	0.17369	T	0.5	.	9.1347	0.36866	0.4507:0.0:0.0:0.5493	.	66;66	G3V5Q9;P05154	.;IPSP_HUMAN	V	66	ENSP00000450484:F66V;ENSP00000450837:F66V;ENSP00000452469:F66V;ENSP00000451126:F66V;ENSP00000333203:F66V;ENSP00000450745:F66V;ENSP00000451215:F66V;ENSP00000451697:F66V;ENSP00000451650:F66V;ENSP00000451610:F66V;ENSP00000450485:F66V	ENSP00000333203:F66V	F	+	1	0	SERPINA5	94123648	1.000000	0.71417	0.966000	0.40874	0.206000	0.24218	0.976000	0.29462	0.180000	0.19960	0.459000	0.35465	TTC	.	.		0.622	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410726.1	NM_000624	
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32925232	32925232	+	Silent	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr15:32925232A>G	ENST00000361627.3	+	9	1880	c.1158A>G	c.(1156-1158)gtA>gtG	p.V386V	ARHGAP11A_ENST00000543522.1_Silent_p.V197V|ARHGAP11A_ENST00000565905.1_Silent_p.V197V|ARHGAP11A_ENST00000563864.1_Intron|ARHGAP11A_ENST00000567348.1_Silent_p.V386V	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	386					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		TCTCTCCTGTACTCATTGGTG	0.393																																					p.V386V	Colon(45;757 1134 30003 36652)	Atlas-SNP	.											.	ARHGAP11A	84	.	0			c.A1158G						.						157.0	152.0	154.0					15																	32925232		2201	4300	6501	SO:0001819	synonymous_variant	9824	exon9			TCCTGTACTCATT	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1158A>G	chr15.hg19:g.32925232A>G		134.0	0.0		154.0	72.0	NM_199357	B4DZN9|Q6PI96|Q9Y3S6	Silent	SNP	ENST00000361627.3	hg19	CCDS10028.1																																																																																			.	.		0.393	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
TLN2	83660	hgsc.bcm.edu	37	15	62990037	62990037	+	Silent	SNP	G	G	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr15:62990037G>T	ENST00000561311.1	+	14	1673	c.1443G>T	c.(1441-1443)ggG>ggT	p.G481G	TLN2_ENST00000306829.6_Silent_p.G481G			Q9Y4G6	TLN2_HUMAN	talin 2	481					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TCATGGTTGGGCAGATGCACC	0.672																																					p.G481G		Atlas-SNP	.											.	TLN2	253	.	0			c.G1443T						.						34.0	32.0	32.0					15																	62990037		2202	4299	6501	SO:0001819	synonymous_variant	83660	exon12			GGTTGGGCAGATG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.1443G>T	chr15.hg19:g.62990037G>T		111.0	0.0		81.0	37.0	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	hg19	CCDS32261.1																																																																																			.	.		0.672	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
IGDCC4	57722	hgsc.bcm.edu	37	15	65689263	65689263	+	Silent	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr15:65689263C>T	ENST00000352385.2	-	6	1115	c.906G>A	c.(904-906)gcG>gcA	p.A302A		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	302	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GCCAGGGCTGCGCGTTGGCAA	0.672																																					p.A302A		Atlas-SNP	.											.	IGDCC4	95	.	0			c.G906A						.						38.0	36.0	37.0					15																	65689263		2190	4289	6479	SO:0001819	synonymous_variant	57722	exon6			GGGCTGCGCGTTG		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.906G>A	chr15.hg19:g.65689263C>T		128.0	0.0		128.0	68.0	NM_020962	Q9HCE4	Silent	SNP	ENST00000352385.2	hg19	CCDS10206.1																																																																																			.	.		0.672	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
GOLGA6B	55889	hgsc.bcm.edu	37	15	72955008	72955008	+	Missense_Mutation	SNP	G	G	C	rs199550549	byFrequency	TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr15:72955008G>C	ENST00000421285.3	+	11	1263	c.1263G>C	c.(1261-1263)gaG>gaC	p.E421D	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	421						Golgi apparatus (GO:0005794)		p.E421D(1)		NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						AGAAGGAGGAGAGGCTACAAA	0.587																																					p.E421D		Atlas-SNP	.											GOLGA6B,NS,malignant_melanoma,0,1	GOLGA6B	30	.	1	Substitution - Missense(1)	NS(1)	c.G1263C						.						1.0	1.0	1.0					15																	72955008		108	305	413	SO:0001583	missense	55889	exon11			GGAGGAGAGGCTA		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1263G>C	chr15.hg19:g.72955008G>C	ENSP00000408132:p.Glu421Asp	53.0	0.0		66.0	3.0	NM_018652	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	hg19	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	3.065	-0.192360	0.06259	.	.	ENSG00000215186	ENST00000421285	T	0.07444	3.19	.	.	.	.	.	.	.	.	T	0.06962	0.0177	L	0.47190	1.495	0.22888	N	0.99861	P	0.49961	0.93	B	0.40444	0.329	T	0.30208	-0.9986	8	0.62326	D	0.03	.	2.6645	0.05037	0.4931:0.0:0.5069:0.0	.	421	A6NDN3	GOG6B_HUMAN	D	421	ENSP00000408132:E421D	ENSP00000408132:E421D	E	+	3	2	GOLGA6B	70742062	0.998000	0.40836	0.134000	0.22075	0.265000	0.26407	0.636000	0.24644	0.088000	0.17205	0.089000	0.15464	GAG	.	G|1.000;|0.000		0.587	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652	
AXIN1	8312	hgsc.bcm.edu	37	16	360038	360038	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr16:360038G>A	ENST00000262320.3	-	4	1422	c.1051C>T	c.(1051-1053)Cag>Tag	p.Q351*	AXIN1_ENST00000481769.1_5'UTR|AXIN1_ENST00000354866.3_Nonsense_Mutation_p.Q351*	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	351	Interaction with GSK3B. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CTGCGGTGCTGCTTACGGATC	0.612																																					p.Q351X		Atlas-SNP	.											.	AXIN1	290	.	0			c.C1051T						.						86.0	55.0	65.0					16																	360038		2203	4300	6503	SO:0001587	stop_gained	8312	exon4			GGTGCTGCTTACG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1051C>T	chr16.hg19:g.360038G>A	ENSP00000262320:p.Gln351*	81.0	0.0		48.0	39.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	G	38	7.226415	0.98146	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	4.84	4.84	0.62591	.	0.287890	0.34959	N	0.003549	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.9962	0.89185	0.0:0.0:1.0:0.0	.	.	.	.	X	351	.	ENSP00000262320:Q351X	Q	-	1	0	AXIN1	300039	1.000000	0.71417	0.995000	0.50966	0.471000	0.32888	9.476000	0.97823	2.257000	0.74773	0.456000	0.33151	CAG	.	.		0.612	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
SERPINF1	5176	hgsc.bcm.edu	37	17	1678371	1678371	+	Silent	SNP	T	T	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr17:1678371T>C	ENST00000254722.4	+	6	826	c.663T>C	c.(661-663)ttT>ttC	p.F221F		NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	221					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						TAACAAAGTTTGACTCCAGAA	0.522																																					p.F221F		Atlas-SNP	.											.	SERPINF1	31	.	0			c.T663C						.						88.0	87.0	87.0					17																	1678371		2203	4300	6503	SO:0001819	synonymous_variant	5176	exon6			AAAGTTTGACTCC	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.663T>C	chr17.hg19:g.1678371T>C		100.0	0.0		43.0	35.0	NM_002615	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Silent	SNP	ENST00000254722.4	hg19	CCDS11012.1																																																																																			.	.		0.522	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	
TP53	7157	hgsc.bcm.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr17:7578268A>C	ENST00000269305.4	-	6	770	c.581T>G	c.(580-582)cTt>cGt	p.L194R	TP53_ENST00000413465.2_Missense_Mutation_p.L194R|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.L194R|TP53_ENST00000455263.2_Missense_Mutation_p.L194R|TP53_ENST00000420246.2_Missense_Mutation_p.L194R|TP53_ENST00000359597.4_Missense_Mutation_p.L194R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTCGGATAAGATGCTGAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.L194R	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,colon,carcinoma,-1,1	TP53	33396	.	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)	c.T581G						.						97.0	87.0	90.0					17																	7578268		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGGATAAGATGCT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.581T>G	chr17.hg19:g.7578268A>C	ENSP00000269305:p.Leu194Arg	183.0	1.0		117.0	105.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029856	0.54790	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.984;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194R;ENSP00000352610:L194R;ENSP00000269305:L194R;ENSP00000398846:L194R;ENSP00000391127:L194R;ENSP00000391478:L194R;ENSP00000425104:L62R;ENSP00000423862:L101R	ENSP00000269305:L194R	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT	.	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7720679	7720679	+	Silent	SNP	A	A	G	rs375895814		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr17:7720679A>G	ENST00000572933.1	+	65	11426	c.9966A>G	c.(9964-9966)ggA>ggG	p.G3322G	DNAH2_ENST00000389173.2_Silent_p.G3322G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3322					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G3322G(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTACATGGGACCCTTCCTGA	0.607																																					p.G3322G		Atlas-SNP	.											DNAH2,colon,carcinoma,0,1	DNAH2	498	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A9966G						.						83.0	87.0	86.0					17																	7720679		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon64			CATGGGACCCTTC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9966A>G	chr17.hg19:g.7720679A>G		46.0	0.0		31.0	26.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	hg19	CCDS32551.1																																																																																			.	.		0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
TNFRSF13B	23495	hgsc.bcm.edu	37	17	16843680	16843680	+	Silent	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr17:16843680G>A	ENST00000261652.2	-	4	603	c.591C>T	c.(589-591)ccC>ccT	p.P197P	TNFRSF13B_ENST00000583789.1_Silent_p.P151P|TNFRSF13B_ENST00000437538.2_Silent_p.P151P|TNFRSF13B_ENST00000579315.1_Intron|TNFRSF13B_ENST00000581616.2_5'Flank	NM_012452.2	NP_036584.1	O14836	TR13B_HUMAN	tumor necrosis factor receptor superfamily, member 13B	197					B cell homeostasis (GO:0001782)|cell surface receptor signaling pathway (GO:0007166)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of B cell proliferation (GO:0030889)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|skin(1)	16						GCCTTGAGCGGGGCTGGCAGG	0.657									IgA Deficiency, Selective																												p.P197P		Atlas-SNP	.											.	TNFRSF13B	34	.	0			c.C591T						.						89.0	94.0	92.0					17																	16843680		2203	4300	6503	SO:0001819	synonymous_variant	23495	exon4	Familial Cancer Database	IGAD1, IGAD2	TGAGCGGGGCTGG	AF023614	CCDS11181.1	17p11.2	2014-09-17			ENSG00000240505	ENSG00000240505		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18153	protein-coding gene	gene with protein product		604907				9311921	Standard	NM_012452		Approved	TACI, CD267	uc002gqs.1	O14836	OTTHUMG00000059262	ENST00000261652.2:c.591C>T	chr17.hg19:g.16843680G>A		121.0	0.0		41.0	4.0	NM_012452	B2R8B0|B7Z6V8|Q32LX4|Q7Z6F5	Silent	SNP	ENST00000261652.2	hg19	CCDS11181.1																																																																																			.	.		0.657	TNFRSF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131474.2		
PLCD3	113026	hgsc.bcm.edu	37	17	43190626	43190626	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr17:43190626C>T	ENST00000540511.1	-	13	2082		c.e13-1		PLCD3_ENST00000322765.5_Splice_Site			Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3						angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						CAGTCAGCACCTGTGGGTGAG	0.632																																					.		Atlas-SNP	.											.	PLCD3	78	.	0			c.1995-1G>A						.						13.0	14.0	13.0					17																	43190626		2093	4214	6307	SO:0001630	splice_region_variant	113026	exon14			CAGCACCTGTGGG	AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000540511.1:c.4025-1G>A	chr17.hg19:g.43190626C>T		49.0	0.0		42.0	18.0	NM_133373	Q8TEC1|Q8TF37|Q96FL6	Splice_Site	SNP	ENST00000540511.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.76	3.887551	0.72410	.	.	ENSG00000161714	ENST00000322765;ENST00000539433	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8544	0.88758	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLCD3	40546152	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	7.609000	0.82925	2.615000	0.88500	0.555000	0.69702	.	.	.		0.632	PLCD3-001	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000397579.1	NM_133373	Intron
SCRN2	90507	hgsc.bcm.edu	37	17	45915690	45915690	+	Silent	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr17:45915690C>T	ENST00000290216.9	-	7	1190	c.1065G>A	c.(1063-1065)cgG>cgA	p.R355R	SCRN2_ENST00000407215.3_Silent_p.R355R|SCRN2_ENST00000584123.1_Silent_p.R363R	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	355						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						AGAGGGTATGCCGACGATCTA	0.627																																					p.R355R		Atlas-SNP	.											.	SCRN2	35	.	0			c.G1065A						.						67.0	70.0	69.0					17																	45915690		2203	4300	6503	SO:0001819	synonymous_variant	90507	exon7			GGTATGCCGACGA	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1065G>A	chr17.hg19:g.45915690C>T		129.0	0.0		121.0	47.0	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	hg19	CCDS11519.1																																																																																			.	.		0.627	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
DCC	1630	hgsc.bcm.edu	37	18	50731599	50731599	+	Silent	SNP	G	G	C			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr18:50731599G>C	ENST00000442544.2	+	10	2203	c.1587G>C	c.(1585-1587)ggG>ggC	p.G529G	DCC_ENST00000412726.1_Silent_p.G377G|DCC_ENST00000581580.1_Silent_p.G184G	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	529					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AAGTTCCAGGGCCAGTAGAAA	0.378																																					p.G529G		Atlas-SNP	.											.	DCC	360	.	0			c.G1587C						.						152.0	159.0	157.0					18																	50731599		2203	4300	6503	SO:0001819	synonymous_variant	1630	exon10			TCCAGGGCCAGTA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1587G>C	chr18.hg19:g.50731599G>C		88.0	0.0		105.0	37.0	NM_005215		Silent	SNP	ENST00000442544.2	hg19	CCDS11952.1																																																																																			.	.		0.378	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
TNFRSF11A	8792	hgsc.bcm.edu	37	18	60028929	60028929	+	Silent	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr18:60028929G>A	ENST00000586569.1	+	7	671	c.633G>A	c.(631-633)ttG>ttA	p.L211L	TNFRSF11A_ENST00000269485.7_Intron	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	211					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				ATGTTTACTTGCCCGGTTTAA	0.408																																					p.L211L		Atlas-SNP	.											.	TNFRSF11A	51	.	0			c.G633A						.						247.0	245.0	246.0					18																	60028929		2203	4300	6503	SO:0001819	synonymous_variant	8792	exon7			TTACTTGCCCGGT	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.633G>A	chr18.hg19:g.60028929G>A		175.0	0.0		160.0	75.0	NM_001270949	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Silent	SNP	ENST00000586569.1	hg19	CCDS11980.1																																																																																			.	.		0.408	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2		
PTBP1	5725	hgsc.bcm.edu	37	19	804891	804891	+	Silent	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr19:804891G>A	ENST00000349038.4	+	7	742	c.669G>A	c.(667-669)caG>caA	p.Q223Q	MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000394601.4_Silent_p.Q223Q|PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000356948.6_Silent_p.Q223Q	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	223	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGTTCCAGGCCCTGCTGC	0.657																																					p.Q223Q		Atlas-SNP	.											.	PTBP1	43	.	0			c.G669A						.						96.0	88.0	91.0					19																	804891		2203	4300	6503	SO:0001819	synonymous_variant	5725	exon7			GTTCCAGGCCCTG	X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.669G>A	chr19.hg19:g.804891G>A		103.0	0.0		69.0	34.0	NM_031990	Q9BUQ0	Silent	SNP	ENST00000349038.4	hg19	CCDS32859.1																																																																																			.	.		0.657	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457605.1		
EMR1	2015	hgsc.bcm.edu	37	19	6896547	6896547	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr19:6896547G>A	ENST00000312053.4	+	3	270	c.233G>A	c.(232-234)tGc>tAc	p.C78Y	EMR1_ENST00000381407.5_Missense_Mutation_p.C78Y|EMR1_ENST00000450315.3_Missense_Mutation_p.C78Y|EMR1_ENST00000601198.1_3'UTR|EMR1_ENST00000250572.8_Missense_Mutation_p.C78Y|EMR1_ENST00000381404.4_Missense_Mutation_p.C78Y|AC020895.1_ENST00000580648.1_RNA	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	78	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					GGAGTGCGATGCAAAGGTGAG	0.498																																					p.C78Y		Atlas-SNP	.											.	EMR1	153	.	0			c.G233A						.						116.0	84.0	95.0					19																	6896547		2203	4300	6503	SO:0001583	missense	2015	exon3			TGCGATGCAAAGG	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.233G>A	chr19.hg19:g.6896547G>A	ENSP00000311545:p.Cys78Tyr	104.0	0.0		104.0	49.0	NM_001256252	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	hg19	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210817	0.39102	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	D;D;D;D;D	0.92965	-1.71;-2.46;-1.71;-3.14;-1.71	3.91	3.91	0.45181	Epidermal growth factor-like (1);	.	.	.	.	D	0.96399	0.8825	M	0.89715	3.055	0.09310	N	0.999996	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.991;0.999	D;D;D;P;D	0.91635	0.998;0.999;0.999;0.872;0.983	D	0.89870	0.4022	9	0.87932	D	0	.	11.748	0.51832	0.0:0.0:1.0:0.0	.	78;78;78;78;78	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	Y	78	ENSP00000311545:C78Y;ENSP00000370811:C78Y;ENSP00000250572:C78Y;ENSP00000370814:C78Y;ENSP00000405974:C78Y	ENSP00000250572:C78Y	C	+	2	0	EMR1	6847547	0.794000	0.28838	0.013000	0.15412	0.033000	0.12548	2.674000	0.46867	1.877000	0.54381	0.543000	0.68304	TGC	.	.		0.498	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
PCP2	126006	hgsc.bcm.edu	37	19	7697616	7697616	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr19:7697616T>A	ENST00000311069.5	-	2	442	c.152A>T	c.(151-153)cAg>cTg	p.Q51L	CTD-3214H19.4_ENST00000595866.1_Intron|CTD-3214H19.6_ENST00000601797.1_RNA|PCP2_ENST00000598935.1_Missense_Mutation_p.Q35L	NM_174895.1	NP_777555.1	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2	51					rhodopsin mediated signaling pathway (GO:0016056)	neuronal cell body (GO:0043025)	GTPase regulator activity (GO:0030695)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|urinary_tract(1)	2						CTTGGTGGTCTGGCCCGGCCC	0.682																																					p.Q51L		Atlas-SNP	.											.	PCP2	6	.	0			c.A152T						.						31.0	28.0	29.0					19																	7697616		2191	4292	6483	SO:0001583	missense	126006	exon2			GTGGTCTGGCCCG	BC025387	CCDS32893.1, CCDS62521.1	19p13.3	2008-02-05				ENSG00000174788			30209	protein-coding gene	gene with protein product						12477932	Standard	NM_174895		Approved	MGC41903, GPSM4	uc031rjd.1	Q8IVA1		ENST00000311069.5:c.152A>T	chr19.hg19:g.7697616T>A	ENSP00000310585:p.Gln51Leu	43.0	0.0		32.0	16.0	NM_174895	M0R2R7|Q3KRG7	Missense_Mutation	SNP	ENST00000311069.5	hg19	CCDS32893.1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.966344	0.34659	.	.	ENSG00000174788	ENST00000311069	.	.	.	4.52	-2.23	0.06930	.	0.776961	0.10520	N	0.665045	T	0.25975	0.0633	N	0.19112	0.55	0.09310	N	1	B	0.23650	0.089	B	0.16289	0.015	T	0.16158	-1.0412	9	0.25751	T	0.34	-0.0355	14.0196	0.64545	0.0:0.0:0.1789:0.8211	.	51	Q8IVA1	PCP2_HUMAN	L	51	.	ENSP00000310585:Q51L	Q	-	2	0	PCP2	7603616	0.038000	0.19896	0.000000	0.03702	0.473000	0.32948	0.082000	0.14847	-0.223000	0.09943	0.459000	0.35465	CAG	.	.		0.682	PCP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461026.2	XM_058956	
OLFM2	93145	hgsc.bcm.edu	37	19	9968430	9968430	+	Silent	SNP	G	G	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr19:9968430G>A	ENST00000264833.4	-	3	506	c.321C>T	c.(319-321)ctC>ctT	p.L107L	OLFM2_ENST00000590841.1_Silent_p.L29L	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	107					protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						CAGCTGCCCGGAGCCGCGCAT	0.592																																					p.L107L		Atlas-SNP	.											.	OLFM2	42	.	0			c.C321T						.						43.0	47.0	45.0					19																	9968430		2203	4300	6503	SO:0001819	synonymous_variant	93145	exon3			TGCCCGGAGCCGC	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.321C>T	chr19.hg19:g.9968430G>A		103.0	0.0		119.0	60.0	NM_058164	Q6IMJ3|Q96FC2	Silent	SNP	ENST00000264833.4	hg19	CCDS12221.1																																																																																			.	.		0.592	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1		
ZNF765	91661	hgsc.bcm.edu	37	19	53911921	53911921	+	Silent	SNP	A	A	G			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr19:53911921A>G	ENST00000396408.3	+	4	1230	c.1113A>G	c.(1111-1113)acA>acG	p.T371T	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		CACATTTTACATGCCATCATA	0.413																																					p.T371T		Atlas-SNP	.											.	ZNF765	61	.	0			c.A1113G						.						116.0	118.0	117.0					19																	53911921		2203	4300	6503	SO:0001819	synonymous_variant	91661	exon4			TTTTACATGCCAT	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.1113A>G	chr19.hg19:g.53911921A>G		118.0	0.0		125.0	46.0	NM_001040185	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Silent	SNP	ENST00000396408.3	hg19	CCDS46171.1																																																																																			.	.		0.413	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372	
DEFB123	245936	hgsc.bcm.edu	37	20	30037860	30037860	+	Silent	SNP	T	T	C	rs377702716		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr20:30037860T>C	ENST00000376309.3	+	2	267	c.87T>C	c.(85-87)taT>taC	p.Y29Y		NM_153324.2	NP_697019.1	Q8N688	DB123_HUMAN	defensin, beta 123	29					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.Y29*(1)|p.Y29Y(1)		kidney(1)|lung(2)	3	Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GGAATCTTTATGGCAAATGCC	0.428																																					p.Y29Y		Atlas-SNP	.											DEFB123,NS,carcinoma,0,2	DEFB123	7	.	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)	c.T87C						.	T		1,4405	2.1+/-5.4	0,1,2202	152.0	150.0	151.0		87	-2.0	0.6	20		151	0,8600		0,0,4300	no	coding-synonymous	DEFB123	NM_153324.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		29/68	30037860	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	245936	exon2			TCTTTATGGCAAA	AA933749	CCDS13180.1	20q11.1	2008-07-17			ENSG00000180424	ENSG00000180424		"""Defensins, beta"""	18103	protein-coding gene	gene with protein product	"""beta defensin 23"""					11854508	Standard	NM_153324		Approved	DEFB-23	uc002wvy.3	Q8N688	OTTHUMG00000032170	ENST00000376309.3:c.87T>C	chr20.hg19:g.30037860T>C		85.0	0.0		99.0	40.0	NM_153324		Silent	SNP	ENST00000376309.3	hg19	CCDS13180.1																																																																																			.	.		0.428	DEFB123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078510.2	NM_153324	
COL18A1	80781	hgsc.bcm.edu	37	21	46888354	46888354	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr21:46888354C>T	ENST00000359759.4	+	2	1571	c.1550C>T	c.(1549-1551)aCa>aTa	p.T517I	COL18A1_ENST00000400337.2_Missense_Mutation_p.T102I|COL18A1_ENST00000355480.5_Missense_Mutation_p.T282I			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	517	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGGCCAGCCACAGAGGGCCCA	0.637																																					p.T282I		Atlas-SNP	.											.	COL18A1	129	.	0			c.C845T						.						70.0	83.0	79.0					21																	46888354		2112	4231	6343	SO:0001583	missense	80781	exon2			CAGCCACAGAGGG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1550C>T	chr21.hg19:g.46888354C>T	ENSP00000352798:p.Thr517Ile	88.0	0.0		71.0	23.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	hg19		.	.	.	.	.	.	.	.	.	.	C	11.55	1.672545	0.29693	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.47528	0.84;0.84;0.84	4.65	3.71	0.42584	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	0.261461	0.37437	N	0.002093	T	0.61825	0.2378	L	0.59436	1.845	0.41290	D	0.986975	D;D;D	0.62365	0.991;0.989;0.98	D;P;P	0.64877	0.93;0.885;0.731	T	0.67260	-0.5715	10	0.87932	D	0	.	14.168	0.65490	0.0:0.8495:0.1505:0.0	.	517;282;102	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	I	102;102;282;517;517	ENSP00000383191:T102I;ENSP00000347665:T282I;ENSP00000352798:T517I	ENSP00000347665:T282I	T	+	2	0	COL18A1	45712782	0.989000	0.36119	0.052000	0.19188	0.011000	0.07611	5.527000	0.67123	2.289000	0.77006	0.655000	0.94253	ACA	.	.		0.637	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
NCF4	4689	hgsc.bcm.edu	37	22	37272068	37272068	+	Intron	SNP	T	T	A			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr22:37272068T>A	ENST00000248899.6	+	9	942				NCF4_ENST00000397147.4_Nonsense_Mutation_p.L334*	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	GTCACCCCCTTAGGGACATCG	0.612																																					p.L334X		Atlas-SNP	.											.	NCF4	66	.	0			c.T1001A						.						31.0	30.0	31.0					22																	37272068		2203	4300	6503	SO:0001627	intron_variant	4689	exon8			CCCCCTTAGGGAC	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.759-3T>A	chr22.hg19:g.37272068T>A		154.0	0.0		140.0	51.0	NM_013416	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Nonsense_Mutation	SNP	ENST00000248899.6	hg19	CCDS13934.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.524790	0.44969	.	.	ENSG00000100365	ENST00000397147	.	.	.	5.05	-1.04	0.10068	.	3.473280	0.01360	N	0.012219	.	.	.	.	.	.	0.48236	A	0.99961	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.3677	9.407	0.38469	0.0:0.4026:0.0:0.5974	.	.	.	.	X	334	.	.	L	+	2	0	NCF4	35602014	0.484000	0.25964	0.010000	0.14722	0.001000	0.01503	0.592000	0.23984	-0.627000	0.05589	-0.973000	0.02599	TTA	.	.		0.612	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24381762	24381762	+	IGR	SNP	C	C	T	rs368897164		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chrX:24381762C>T								AC004552.1 (14739 upstream) : PDK3 (101575 downstream)																							CGTGGAAAGGCAGACCCTGTG	0.502																																					p.G295G		Atlas-SNP	.											.	.	.	.	0			c.C885T						.	C		0,2627		0,0,0,1059,509	154.0	126.0	135.0		885	-1.4	0.0	X		135	1,5497		0,0,1,1916,1665	no	coding-synonymous	FAM48B1	NM_001136234.1		0,0,1,2975,2174	TT,TC,T,CC,C		0.0182,0.0,0.0123		295/888	24381762	1,8124	1568	3582	5150	SO:0001628	intergenic_variant	100130302	exon1			GAAAGGCAGACCC																													chrX.hg19:g.24381762C>T		292.0	0.0		269.0	229.0	NM_001136234		Silent	SNP		hg19																																																																																				.	.	0	0.502								
MT-ND1	4535	hgsc.bcm.edu	37	M	4139	4139	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chrM:4139C>T	ENST00000361390.2	+	1	833	c.833C>T	c.(832-834)cCc>cTc	p.P278L	MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	278					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AACAGCATACCCCCGATTCCG	0.423																																					p.P278L		Atlas-SNP	.											.	.	.	.	0			c.C833T						.																																			SO:0001583	missense	10625	exon1			CATACCCCCGATT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.833C>T	chrM.hg19:g.4139C>T	ENSP00000354687:p.Pro278Leu	12.0	0.0		50.0	45.0	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.		0.423	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
RIMS2	9699	hgsc.bcm.edu	37	8	104973332	104973332	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr8:104973332delA	ENST00000436393.2	+	13	2316	c.2075delA	c.(2074-2076)gacfs	p.D692fs	RIMS2_ENST00000507740.1_Frame_Shift_Del_p.D706fs|RIMS2_ENST00000262231.10_Frame_Shift_Del_p.D753fs|RIMS2_ENST00000406091.3_Frame_Shift_Del_p.D914fs			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	976	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCTGACTATGACTGTGATGAT	0.289										HNSCC(12;0.0054)																											p.D914fs		Atlas-INDEL	.											.	RIMS2	1357	.	0			c.2740delG						.						106.0	114.0	112.0					8																	104973332		1799	4058	5857	SO:0001589	frameshift_variant	9699	exon15			.	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2075delA	chr8.hg19:g.104973332delA	ENSP00000390665:p.Asp692fs	132.0	0.0		178.0	142.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Frame_Shift_Del	DEL	ENST00000436393.2	hg19																																																																																				.	.		0.289	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
CENPC	1060	hgsc.bcm.edu	37	4	68379975	68379976	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr4:68379975_68379976insT	ENST00000273853.6	-	8	1510_1511	c.1260_1261insA	c.(1258-1263)aaacagfs	p.Q421fs		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	421					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										TTTCTTCTCTGTTTTTGTTTTA	0.322																																					p.Q421fs		Atlas-INDEL	.											.	CENPC1	66	.	0			c.1261_1262insA						.																																			SO:0001589	frameshift_variant	1060	exon8			.	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.1261dupA	chr4.hg19:g.68379980_68379980dupT	ENSP00000273853:p.Gln421fs	79.0	0.0		43.0	15.0	NM_001812	Q8IW27|Q9P0M5	Frame_Shift_Ins	INS	ENST00000273853.6	hg19	CCDS47063.1																																																																																			.	.		0.322	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
ALB	213	hgsc.bcm.edu	37	4	74274521	74274524	+	Splice_Site	DEL	AAGT	AAGT	-	rs17853494		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr4:74274521_74274524delAAGT	ENST00000295897.4	+	4	570_571	c.481_482delAAGT	c.(481-483)aag>g	p.K161fs	ALB_ENST00000509063.1_Splice_Site_p.K161fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000503124.1_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000401494.3_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTTTTGAAAAAGTAAGTAATCAG	0.348																																					p.160_161del		Atlas-INDEL	.											.	ALB	132	.	0			c.480_482del						.																																			SO:0001630	splice_region_variant	213	exon4			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.482+1AAGT>-	chr4.hg19:g.74274525_74274528delAAGT		119.0	0.0		62.0	22.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	In_Frame_Del	DEL	ENST00000295897.4	hg19	CCDS3555.1																																																																																			.	.		0.348	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	Frame_Shift_Del
ODF1	4956	hgsc.bcm.edu	37	8	103573034	103573042	+	In_Frame_Del	DEL	CCCGTGCAG	CCCGTGCAG	-	rs143802899|rs199994329|rs568456031|rs372688769|rs59109601|rs377699584|rs11992195|rs62523273|rs386728348|rs58232162	byFrequency	TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	CCCGTGCAG	CCCGTGCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr8:103573034_103573042delCCCGTGCAG	ENST00000285402.3	+	2	831_839	c.675_683delCCCGTGCAG	c.(673-684)aacccgtgcagc>aac	p.PCS226del	ODF1_ENST00000518835.1_In_Frame_Del_p.PCS19del	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	226	C-X-P repeat region.		Missing. {ECO:0000269|PubMed:8111388}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.C218_P226delCNPCSPCNP(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			gcccctgcaacccgtgcagcccATATGAT	0.541																																					p.225_228del		Atlas-INDEL	.											ODF1,NS,carcinoma,0,1	ODF1	55	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.674_682del						.																																			SO:0001651	inframe_deletion	4956	exon2			.	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.675_683delCCCGTGCAG	chr8.hg19:g.103573034_103573042delCCCGTGCAG	ENSP00000285402:p.Pro226_Ser228del	59.0	0.0		78.0	58.0	NM_024410	Q3SX72	In_Frame_Del	DEL	ENST00000285402.3	hg19	CCDS6293.1																																																																																			.	.		0.541	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
ZNF793	390927	hgsc.bcm.edu	37	19	38024289	38024289	+	Frame_Shift_Del	DEL	G	G	-	rs370904763		TCGA-DD-AAVU-01A-11D-A40R-10	TCGA-DD-AAVU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c522957e-6571-4b4e-9ab2-8726a74d13e6	ae0c3d36-3ce4-478c-9a80-7446e1da38b1	g.chr19:38024289delG	ENST00000587143.1	+	5	457	c.222delG	c.(220-222)ccgfs	p.P74fs	ZNF793_ENST00000542455.1_Frame_Shift_Del_p.P74fs|ZNF793_ENST00000587986.1_Frame_Shift_Del_p.P74fs|ZNF793_ENST00000588578.1_Frame_Shift_Del_p.P74fs|ZNF793_ENST00000589319.1_Frame_Shift_Del_p.P74fs|ZNF793_ENST00000445217.1_Frame_Shift_Del_p.P74fs			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGCATGCCCGGGCTGCCACT	0.498																																					p.P74fs	Melanoma(44;400 1431 1499 19093)	Atlas-INDEL	.											.	ZNF793	50	.	0			c.221delC						.						71.0	74.0	73.0					19																	38024289		1936	4128	6064	SO:0001589	frameshift_variant	390927	exon7			.	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.222delG	chr19.hg19:g.38024289delG	ENSP00000468605:p.Pro74fs	136.0	0.0		131.0	58.0	NM_001013659	E9PGN4|Q7Z3Q9	Frame_Shift_Del	DEL	ENST00000587143.1	hg19	CCDS46062.1																																																																																			.	.		0.498	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
