#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MIB2	142678	hgsc.bcm.edu	37	1	1560565	1560565	+	Splice_Site	SNP	G	G	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr1:1560565G>C	ENST00000357210.4	+	6	1111	c.895G>C	c.(895-897)Ggc>Cgc	p.G299R	MIB2_ENST00000505820.2_Splice_Site_p.G356R|MIB2_ENST00000520777.1_Splice_Site_p.G356R|MIB2_ENST00000360522.4_Splice_Site_p.G299R|MIB2_ENST00000378710.3_Splice_Site_p.G299R|MIB2_ENST00000378708.1_Splice_Site_p.G241R|MIB2_ENST00000378712.1_Intron|MIB2_ENST00000504599.1_Splice_Site_p.G255R|MIB2_ENST00000355826.5_Splice_Site_p.G342R|MIB2_ENST00000518681.1_Intron	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	299					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCCAAGGCTCGGTATGAGGCT	0.642																																					p.G356R		Atlas-SNP	.											.	MIB2	62	.	0			c.G1066C						.						54.0	59.0	57.0					1																	1560565		2193	4285	6478	SO:0001630	splice_region_variant	142678	exon6			AGGCTCGGTATGA	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.895+1G>C	chr1.hg19:g.1560565G>C		39.0	0.0		36.0	17.0	NM_001170686	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Missense_Mutation	SNP	ENST00000357210.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.62|19.62	3.862378|3.862378	0.71949|0.71949	.|.	.|.	ENSG00000197530|ENSG00000197530	ENST00000520777;ENST00000357210;ENST00000360522;ENST00000378710;ENST00000355826;ENST00000505820;ENST00000504599;ENST00000378708|ENST00000514234	T;T;T;T;T;T;T;T|.	0.53857|.	0.6;0.65;0.71;0.7;0.64;0.6;0.68;0.76|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	0.057194|.	0.64402|.	D|.	0.000001|.	T|T	0.74199|0.74199	0.3685|0.3685	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;D;P;P|.	0.76494|.	0.999;0.968;0.953;0.947|.	D;P;P;D|.	0.70487|.	0.969;0.773;0.825;0.933|.	T|T	0.75016|0.75016	-0.3466|-0.3466	10|5	0.87932|.	D|.	0|.	-31.4742|-31.4742	16.6859|16.6859	0.85306|0.85306	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	299;356;285;299|.	Q96AX9-5;E9PGU1;Q96AX9-2;Q96AX9|.	.;.;.;MIB2_HUMAN|.	R|P	356;299;299;299;342;356;255;241|149	ENSP00000428660:G356R;ENSP00000349741:G299R;ENSP00000353713:G299R;ENSP00000367982:G299R;ENSP00000348081:G342R;ENSP00000426103:G356R;ENSP00000426128:G255R;ENSP00000367980:G241R|.	ENSP00000348081:G342R|.	G|R	+|+	1|2	0|0	MIB2|MIB2	1550428|1550428	1.000000|1.000000	0.71417|0.71417	0.731000|0.731000	0.30826|0.30826	0.320000|0.320000	0.28249|0.28249	9.327000|9.327000	0.96396|0.96396	2.180000|2.180000	0.69256|0.69256	0.455000|0.455000	0.32223|0.32223	GGC|CGG	.	.		0.642	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_080875	Missense_Mutation
COL16A1	1307	hgsc.bcm.edu	37	1	32133217	32133217	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr1:32133217C>T	ENST00000373672.3	-	52	3832	c.3316G>A	c.(3316-3318)Gag>Aag	p.E1106K	COL16A1_ENST00000271069.6_Missense_Mutation_p.E1106K	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1106	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TAGCCACGCTCCCCCTTGATG	0.622																																					p.E1106K	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.G3316A						.						21.0	26.0	25.0					1																	32133217		2124	4245	6369	SO:0001583	missense	1307	exon52			CACGCTCCCCCTT	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3316G>A	chr1.hg19:g.32133217C>T	ENSP00000362776:p.Glu1106Lys	119.0	0.0		83.0	41.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	hg19	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847933	0.51164	.	.	ENSG00000084636	ENST00000373672;ENST00000271069	D;D	0.93247	-3.19;-3.19	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.94594	0.8258	L	0.61036	1.89	0.40248	D	0.978037	D;D	0.67145	0.993;0.996	D;D	0.73708	0.956;0.981	D	0.92248	0.5806	10	0.07030	T	0.85	.	13.4522	0.61178	0.0:1.0:0.0:0.0	.	1106;1105	Q07092;Q07092-2	COGA1_HUMAN;.	K	1106	ENSP00000362776:E1106K;ENSP00000271069:E1106K	ENSP00000271069:E1106K	E	-	1	0	COL16A1	31905804	0.042000	0.20092	0.624000	0.29186	0.566000	0.35808	1.102000	0.31050	2.323000	0.78572	0.563000	0.77884	GAG	.	.		0.622	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
ZBTB7B	51043	hgsc.bcm.edu	37	1	154987493	154987493	+	Silent	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr1:154987493A>G	ENST00000368426.3	+	3	494	c.357A>G	c.(355-357)ccA>ccG	p.P119P	ZBTB7B_ENST00000417934.2_Silent_p.P153P|ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000535420.1_Silent_p.P119P|ZBTB7B_ENST00000292176.2_Silent_p.P119P	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	119					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCAACATGCCAGCTGTGCTCC	0.617																																					p.P153P		Atlas-SNP	.											.	ZBTB7B	69	.	0			c.A459G						.						34.0	38.0	37.0					1																	154987493		2203	4300	6503	SO:0001819	synonymous_variant	51043	exon4			CATGCCAGCTGTG	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.357A>G	chr1.hg19:g.154987493A>G		76.0	0.0		125.0	38.0	NM_001252406	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Silent	SNP	ENST00000368426.3	hg19	CCDS1081.1																																																																																			.	.		0.617	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872	
GPR37L1	9283	hgsc.bcm.edu	37	1	202097337	202097337	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr1:202097337G>A	ENST00000367282.5	+	2	1205	c.1099G>A	c.(1099-1101)Gtc>Atc	p.V367I		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	367					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.V367F(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						CCTGACCGTGGTCTACGCCTT	0.652																																					p.V367I		Atlas-SNP	.											GPR37L1,NS,carcinoma,0,1	GPR37L1	33	.	1	Substitution - Missense(1)	lung(1)	c.G1099A						.						149.0	132.0	138.0					1																	202097337		2203	4300	6503	SO:0001583	missense	9283	exon2			ACCGTGGTCTACG	AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.1099G>A	chr1.hg19:g.202097337G>A	ENSP00000356251:p.Val367Ile	62.0	0.0		104.0	56.0	NM_004767	B2R7M9|Q5SXP7|Q86VP7	Missense_Mutation	SNP	ENST00000367282.5	hg19	CCDS1420.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472533	0.43942	.	.	ENSG00000170075	ENST00000541334;ENST00000367282	T	0.75154	-0.91	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.133801	0.50627	D	0.000120	T	0.59528	0.2200	N	0.17474	0.49	0.44547	D	0.9975	B	0.31893	0.345	B	0.39119	0.291	T	0.55147	-0.8186	10	0.12430	T	0.62	-48.8695	9.9678	0.41734	0.1256:0.0:0.8744:0.0	.	367	O60883	ETBR2_HUMAN	I	234;367	ENSP00000356251:V367I	ENSP00000356251:V367I	V	+	1	0	GPR37L1	200363960	0.775000	0.28604	0.999000	0.59377	0.920000	0.55202	0.799000	0.27028	2.437000	0.82529	0.561000	0.74099	GTC	.	.		0.652	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767	
SLC41A1	254428	hgsc.bcm.edu	37	1	205764544	205764544	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr1:205764544C>T	ENST00000367137.3	-	9	2149	c.1135G>A	c.(1135-1137)Gga>Aga	p.G379R	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	379					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CCGGGCATTCCATTCATGTGC	0.592																																					p.G379R		Atlas-SNP	.											.	SLC41A1	46	.	0			c.G1135A						.						78.0	64.0	69.0					1																	205764544		2203	4300	6503	SO:0001583	missense	254428	exon9			GCATTCCATTCAT	AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.1135G>A	chr1.hg19:g.205764544C>T	ENSP00000356105:p.Gly379Arg	155.0	0.0		247.0	48.0	NM_173854	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	ENST00000367137.3	hg19	CCDS30988.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641874	0.47153	.	.	ENSG00000133065	ENST00000367137	T	0.28666	1.6	5.35	4.44	0.53790	MgtE magnesium transporter, integral membrane (1);	0.053284	0.85682	D	0.000000	T	0.26048	0.0635	L	0.40543	1.245	0.53688	D	0.999979	B	0.29270	0.24	B	0.35727	0.209	T	0.04900	-1.0919	10	0.17832	T	0.49	-2.0629	10.1077	0.42544	0.0:0.846:0.0:0.154	.	379	Q8IVJ1	S41A1_HUMAN	R	379	ENSP00000356105:G379R	ENSP00000356105:G379R	G	-	1	0	SLC41A1	204031167	1.000000	0.71417	0.925000	0.36789	0.008000	0.06430	5.620000	0.67736	1.489000	0.48450	-0.140000	0.14226	GGA	.	.		0.592	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087731.1		
USH2A	7399	hgsc.bcm.edu	37	1	215914870	215914870	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr1:215914870C>A	ENST00000307340.3	-	60	11944	c.11558G>T	c.(11557-11559)gGa>gTa	p.G3853V	USH2A_ENST00000366943.2_Missense_Mutation_p.G3853V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3853	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTGCTAACTCCACAACTTCC	0.358										HNSCC(13;0.011)																											p.G3853V		Atlas-SNP	.											.	USH2A	1168	.	0			c.G11558T						.						73.0	76.0	75.0					1																	215914870		2203	4300	6503	SO:0001583	missense	7399	exon60			CTAACTCCACAAC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11558G>T	chr1.hg19:g.215914870C>A	ENSP00000305941:p.Gly3853Val	87.0	0.0		117.0	35.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.620019	0.46736	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.63744	-0.06;-0.06	5.38	4.47	0.54385	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.000000	0.43919	D	0.000511	T	0.78654	0.4317	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81940	-0.0703	10	0.87932	D	0	.	13.8693	0.63608	0.0:0.9278:0.0:0.0722	.	3853	O75445	USH2A_HUMAN	V	3853	ENSP00000305941:G3853V;ENSP00000355910:G3853V	ENSP00000305941:G3853V	G	-	2	0	USH2A	213981493	1.000000	0.71417	1.000000	0.80357	0.433000	0.31745	4.286000	0.58995	1.502000	0.48669	0.655000	0.94253	GGA	.	.		0.358	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
GEMIN6	79833	hgsc.bcm.edu	37	2	39006178	39006178	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:39006178A>G	ENST00000281950.3	+	2	162	c.46A>G	c.(46-48)Att>Gtt	p.I16V	GEMIN6_ENST00000409011.1_Missense_Mutation_p.I16V|GEMIN6_ENST00000409566.1_Missense_Mutation_p.I16V	NM_024775.9	NP_079051.9	Q8WXD5	GEMI6_HUMAN	gem (nuclear organelle) associated protein 6	16					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				kidney(1)|large_intestine(3)|pancreas(1)	5		all_hematologic(82;0.21)				GCAAGATTACATTTACAAAGA	0.433																																					p.I16V		Atlas-SNP	.											.	GEMIN6	13	.	0			c.A46G						.						138.0	135.0	136.0					2																	39006178		2203	4300	6503	SO:0001583	missense	79833	exon2			GATTACATTTACA	AF453443	CCDS1799.1	2p22.1	2014-05-14			ENSG00000152147	ENSG00000152147			20044	protein-coding gene	gene with protein product		607006				11748230	Standard	NM_024775		Approved	FLJ23459	uc002rrc.3	Q8WXD5	OTTHUMG00000128588	ENST00000281950.3:c.46A>G	chr2.hg19:g.39006178A>G	ENSP00000281950:p.Ile16Val	188.0	0.0		145.0	70.0	NM_024775	B2RDP8|Q53SI5|Q8WVB4|Q9H5G6	Missense_Mutation	SNP	ENST00000281950.3	hg19	CCDS1799.1	.	.	.	.	.	.	.	.	.	.	A	2.942	-0.218659	0.06101	.	.	ENSG00000152147	ENST00000409011;ENST00000281950;ENST00000409566	T;T;T	0.37584	1.19;1.19;1.19	5.01	-1.72	0.08107	.	0.546567	0.18981	N	0.125871	T	0.06826	0.0174	N	0.00325	-1.645	0.21675	N	0.999594	B	0.02656	0.0	B	0.04013	0.001	T	0.41805	-0.9488	10	0.02654	T	1	-0.4869	8.6224	0.33868	0.1972:0.0:0.6543:0.1484	.	16	Q8WXD5	GEMI6_HUMAN	V	16	ENSP00000387191:I16V;ENSP00000281950:I16V;ENSP00000386613:I16V	ENSP00000281950:I16V	I	+	1	0	GEMIN6	38859682	0.421000	0.25465	0.992000	0.48379	0.987000	0.75469	0.186000	0.16978	-0.155000	0.11098	-0.256000	0.11100	ATT	.	.		0.433	GEMIN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250441.3		
SLC35F5	80255	hgsc.bcm.edu	37	2	114500441	114500441	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:114500441C>A	ENST00000245680.2	-	7	991	c.578G>T	c.(577-579)cGt>cTt	p.R193L	SLC35F5_ENST00000409342.1_Missense_Mutation_p.R187L	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	193					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						GAACCTCACACGAGACTTTTT	0.353																																					p.R193L		Atlas-SNP	.											.	SLC35F5	60	.	0			c.G578T						.						102.0	94.0	97.0					2																	114500441		2203	4300	6503	SO:0001583	missense	80255	exon7			CTCACACGAGACT	AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.578G>T	chr2.hg19:g.114500441C>A	ENSP00000245680:p.Arg193Leu	86.0	0.0		52.0	18.0	NM_025181	Q9H6P8|Q9H7D8	Missense_Mutation	SNP	ENST00000245680.2	hg19	CCDS2119.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622275	0.87460	.	.	ENSG00000115084	ENST00000245680;ENST00000409106;ENST00000409342	T;T	0.50277	0.75;0.76	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	L	0.34521	1.04	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.993	D;D;D	0.81914	0.995;0.986;0.982	T	0.49952	-0.8884	10	0.23302	T	0.38	-2.6917	18.5881	0.91197	0.0:1.0:0.0:0.0	.	193;187;193	B2RDY0;B8ZZV6;Q8WV83	.;.;S35F5_HUMAN	L	193;187;187	ENSP00000245680:R193L;ENSP00000386754:R187L	ENSP00000245680:R193L	R	-	2	0	SLC35F5	114216911	1.000000	0.71417	0.998000	0.56505	0.676000	0.39594	7.010000	0.76353	2.692000	0.91855	0.655000	0.94253	CGT	.	.		0.353	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098804	178098804	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:178098804C>G	ENST00000397062.3	-	2	795	c.241G>C	c.(241-243)Ggt>Cgt	p.G81R	NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65R|NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65R|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65R|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65R	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81S(2)|p.G81_F83delGEF(1)|p.G81C(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AGAAATTCACCTGTCTCTTCA	0.438			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.G81R		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,4	NFE2L2	225	.	4	Substitution - Missense(3)|Deletion - In frame(1)	lung(2)|liver(1)|endometrium(1)	c.G241C						.						143.0	142.0	142.0					2																	178098804		1901	4105	6006	SO:0001583	missense	4780	exon2			ATTCACCTGTCTC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.241G>C	chr2.hg19:g.178098804C>G	ENSP00000380252:p.Gly81Arg	83.0	0.0		51.0	28.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.1|20.1	3.933163|3.933163	0.73442|0.73442	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T|T;T;T;T;T;T	0.27890|0.52983	1.64|1.2;1.2;1.2;0.64;0.64;1.2	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75110|0.75110	0.3805|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999	T|T	0.78563|0.78563	-0.2156|-0.2156	7|10	0.18710|0.87932	T|D	0.47|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	P|R	65|65;81;65;65;65;65	ENSP00000391590:A65P|ENSP00000380253:G65R;ENSP00000380252:G81R;ENSP00000411575:G65R;ENSP00000400073:G65R;ENSP00000412191:G65R;ENSP00000410015:G65R	ENSP00000391590:A65P|ENSP00000380252:G81R	A|G	-|-	1|1	0|0	NFE2L2|NFE2L2	177807050|177807050	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.995000|0.995000	0.86356|0.86356	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	GCA|GGT	.	.		0.438	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
SLC39A10	57181	hgsc.bcm.edu	37	2	196573489	196573489	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:196573489T>G	ENST00000409086.3	+	5	1771	c.1496T>G	c.(1495-1497)cTt>cGt	p.L499R	SLC39A10_ENST00000541054.1_Missense_Mutation_p.L49R|SLC39A10_ENST00000359634.5_Missense_Mutation_p.L499R	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	499					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			TTGAAAGGACTTGTTGCTCTA	0.348																																					p.L499R		Atlas-SNP	.											.	SLC39A10	89	.	0			c.T1496G						.						121.0	111.0	114.0					2																	196573489		2203	4300	6503	SO:0001583	missense	57181	exon5			AAGGACTTGTTGC		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1496T>G	chr2.hg19:g.196573489T>G	ENSP00000386766:p.Leu499Arg	141.0	0.0		114.0	18.0	NM_020342	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	hg19	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.468444	0.84533	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.57752	0.38;0.38;0.38	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.74321	0.3701	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79212	-0.1896	10	0.87932	D	0	.	14.9168	0.70805	0.0:0.0:0.0:1.0	.	499	Q9ULF5	S39AA_HUMAN	R	499;499;49	ENSP00000386766:L499R;ENSP00000352655:L499R;ENSP00000437787:L49R	ENSP00000352655:L499R	L	+	2	0	SLC39A10	196281734	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.819000	0.86621	2.124000	0.65301	0.528000	0.53228	CTT	.	.		0.348	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
NBEAL1	65065	hgsc.bcm.edu	37	2	203996824	203996824	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:203996824T>G	ENST00000449802.1	+	25	3939	c.3606T>G	c.(3604-3606)atT>atG	p.I1202M		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1202										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CTTCTCTTATTAAAAACCTCA	0.333																																					p.I1202M		Atlas-SNP	.											.	NBEAL1	266	.	0			c.T3606G						.						103.0	89.0	93.0					2																	203996824		692	1591	2283	SO:0001583	missense	65065	exon25			TCTTATTAAAAAC	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3606T>G	chr2.hg19:g.203996824T>G	ENSP00000399903:p.Ile1202Met	347.0	0.0		233.0	108.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	T	12.98	2.100680	0.37048	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.56941	0.43	5.09	-1.14	0.09741	.	.	.	.	.	T	0.39517	0.1081	L	0.50333	1.59	0.38097	D	0.937143	B	0.32526	0.374	B	0.35470	0.203	T	0.33420	-0.9869	9	0.45353	T	0.12	.	1.8039	0.03076	0.3123:0.0719:0.2448:0.371	.	1202	Q6ZS30	NBEL1_HUMAN	M	1202	ENSP00000399903:I1202M	ENSP00000344985:I1202M	I	+	3	3	NBEAL1	203705069	0.981000	0.34729	0.983000	0.44433	0.765000	0.43378	0.069000	0.14552	-0.013000	0.14199	0.260000	0.18958	ATT	.	.		0.333	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
CPS1	1373	hgsc.bcm.edu	37	2	211465358	211465358	+	Silent	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:211465358T>C	ENST00000233072.5	+	15	1825	c.1629T>C	c.(1627-1629)gcT>gcC	p.A543A	CPS1_ENST00000430249.2_Silent_p.A549A|CPS1_ENST00000451903.2_Silent_p.A92A	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	543					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CCATTATGGCTACGGAAGACA	0.408																																					p.A549A		Atlas-SNP	.											.	CPS1	485	.	0			c.T1647C						.						119.0	118.0	119.0					2																	211465358		2203	4300	6503	SO:0001819	synonymous_variant	1373	exon16			TATGGCTACGGAA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1629T>C	chr2.hg19:g.211465358T>C		211.0	1.0		128.0	65.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	hg19	CCDS2393.1																																																																																			.	.		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	G	A	rs28931588|rs121913416|rs121913417		TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr3:41266097G>A	ENST00000349496.5	+	3	374	c.94G>A	c.(94-96)Gac>Aac	p.D32N	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25N|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32N	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32Y(128)|p.D32N(82)|p.A5_A80del(53)|p.D32H(40)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.D32fs*9(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32N	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,2	CTNNB1	4904	.	397	Substitution - Missense(250)|Deletion - In frame(120)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Complex - frameshift(1)	liver(155)|central_nervous_system(55)|endometrium(40)|stomach(36)|pancreas(28)|large_intestine(22)|pituitary(22)|skin(11)|ovary(9)|soft_tissue(4)|prostate(4)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|adrenal_gland(1)|biliary_tract(1)|urinary_tract(1)|lung(1)|NS(1)	c.G94A						.						92.0	77.0	82.0					3																	41266097		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TACCTGGACTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.94G>A	chr3.hg19:g.41266097G>A	ENSP00000344456:p.Asp32Asn	173.0	0.0		127.0	53.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	30	5.054970	0.93793	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.71567	0.3355	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.73824	-0.3861	10	0.87932	D	0	0.3843	19.9596	0.97236	0.0:0.0:1.0:0.0	.	32	P35222	CTNB1_HUMAN	N	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25N;ENSP00000385604:D32N;ENSP00000412219:D32N;ENSP00000379486:D32N;ENSP00000344456:D32N;ENSP00000411226:D25N;ENSP00000379488:D32N;ENSP00000409302:D32N;ENSP00000401599:D32N	ENSP00000344456:D32N	D	+	1	0	CTNNB1	41241101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAC	.	.		0.478	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
MCM2	4171	hgsc.bcm.edu	37	3	127336848	127336848	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr3:127336848A>G	ENST00000265056.7	+	12	2181	c.1937A>G	c.(1936-1938)aAc>aGc	p.N646S	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	646	MCM.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						TTCTCTGAGAACGTGGACCTC	0.582																																					p.N646S		Atlas-SNP	.											.	MCM2	79	.	0			c.A1937G						.						106.0	78.0	88.0					3																	127336848		2203	4300	6503	SO:0001583	missense	4171	exon12			CTGAGAACGTGGA	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.1937A>G	chr3.hg19:g.127336848A>G	ENSP00000265056:p.Asn646Ser	55.0	0.0		37.0	19.0	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	hg19	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	29.2|29.2	4.987677|4.987677	0.93106|0.93106	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142|ENST00000491422	T|.	0.09255|.	3.0|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88415|0.88415	0.6430|0.6430	H|H	0.97635|0.97635	4.045|4.045	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;1.0|.	D;D;D|.	0.97110|.	0.991;1.0;1.0|.	D|D	0.92399|0.92399	0.5928|0.5928	10|5	0.87932|.	D|.	0|.	-51.1147|-51.1147	15.8646|15.8646	0.79055|0.79055	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	696;516;646|.	F5H1E9;B4DSV5;P49736|.	.;.;MCM2_HUMAN|.	S|A	646;550;696|578	ENSP00000265056:N646S|.	ENSP00000265056:N646S|.	N|T	+|+	2|1	0|0	MCM2|MCM2	128819538|128819538	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.874000|0.874000	0.50279|0.50279	9.118000|9.118000	0.94355|0.94355	2.226000|2.226000	0.72624|0.72624	0.482000|0.482000	0.46254|0.46254	AAC|ACG	.	.		0.582	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
COPG1	22820	hgsc.bcm.edu	37	3	128987352	128987352	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr3:128987352A>T	ENST00000314797.6	+	17	1767	c.1663A>T	c.(1663-1665)Atc>Ttc	p.I555F		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	555					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										GACTGTGTCCATCCCTGGTCT	0.577																																					p.I555F		Atlas-SNP	.											.	.	.	.	0			c.A1663T						.						84.0	77.0	79.0					3																	128987352		2203	4300	6503	SO:0001583	missense	22820	exon17			GTGTCCATCCCTG	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1663A>T	chr3.hg19:g.128987352A>T	ENSP00000325002:p.Ile555Phe	87.0	0.0		73.0	33.0	NM_016128	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	hg19	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.361635	0.24684	.	.	ENSG00000181789	ENST00000314797	T	0.18174	2.23	6.07	2.39	0.29439	Armadillo-like helical (1);	0.070878	0.64402	D	0.000011	T	0.11665	0.0284	L	0.28014	0.82	0.46222	D	0.998932	B	0.29085	0.232	B	0.32533	0.147	T	0.17167	-1.0378	10	0.33141	T	0.24	-15.7601	8.0081	0.30336	0.6905:0.0:0.3095:0.0	.	555	Q9Y678	COPG_HUMAN	F	555	ENSP00000325002:I555F	ENSP00000325002:I555F	I	+	1	0	COPG	130470042	1.000000	0.71417	0.993000	0.49108	0.172000	0.22775	3.636000	0.54317	0.178000	0.19917	-0.290000	0.09829	ATC	.	.		0.577	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128	
BCHE	590	hgsc.bcm.edu	37	3	165548042	165548042	+	Silent	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr3:165548042C>T	ENST00000264381.3	-	2	946	c.780G>A	c.(778-780)gcG>gcA	p.A260A	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	260					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	GAGATGTTACCGCCCAAGGAG	0.428																																					p.A260A		Atlas-SNP	.											.	BCHE	136	.	0			c.G780A						.						98.0	102.0	101.0					3																	165548042		2203	4300	6503	SO:0001819	synonymous_variant	590	exon2			TGTTACCGCCCAA	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.780G>A	chr3.hg19:g.165548042C>T		212.0	0.0		184.0	76.0	NM_000055	A8K7P8	Silent	SNP	ENST00000264381.3	hg19	CCDS3198.1																																																																																			.	.		0.428	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
FIP1L1	81608	hgsc.bcm.edu	37	4	54256024	54256024	+	Silent	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr4:54256024A>G	ENST00000337488.6	+	6	575	c.381A>G	c.(379-381)agA>agG	p.R127R	FIP1L1_ENST00000507922.1_Silent_p.R112R|FIP1L1_ENST00000507166.1_Silent_p.R127R|FIP1L1_ENST00000306932.6_Silent_p.R112R|FIP1L1_ENST00000358575.5_Silent_p.R112R	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	127	Necessary for stimulating PAPOLA activity.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CAGGGGGAAGAGTTTATGGAA	0.313			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.R127R		Atlas-SNP	.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1	60	.	0			c.A381G						.						108.0	119.0	115.0					4																	54256024		2203	4300	6503	SO:0001819	synonymous_variant	81608	exon6			GGGAAGAGTTTAT	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.381A>G	chr4.hg19:g.54256024A>G		124.0	0.0		96.0	40.0	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Silent	SNP	ENST00000337488.6	hg19	CCDS3491.1																																																																																			.	.		0.313	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
WDFY3	23001	hgsc.bcm.edu	37	4	85663028	85663028	+	Silent	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr4:85663028T>C	ENST00000295888.4	-	38	6527	c.6120A>G	c.(6118-6120)gtA>gtG	p.V2040V	WDFY3_ENST00000322366.6_Silent_p.V2040V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2040					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGTTCACCAATACCTGGTAGC	0.378																																					p.V2040V		Atlas-SNP	.											.	WDFY3	314	.	0			c.A6120G						.						79.0	80.0	80.0					4																	85663028		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon38			CACCAATACCTGG	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6120A>G	chr4.hg19:g.85663028T>C		253.0	1.0		227.0	96.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	hg19	CCDS3609.1																																																																																			.	.		0.378	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
HHIP	64399	hgsc.bcm.edu	37	4	145567951	145567951	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr4:145567951G>T	ENST00000296575.3	+	1	779	c.124G>T	c.(124-126)Ggg>Tgg	p.G42W	HHIP-AS1_ENST00000503066.1_RNA|HHIP-AS1_ENST00000508269.1_RNA|HHIP-AS1_ENST00000512359.1_RNA|HHIP_ENST00000434550.2_Missense_Mutation_p.G42W	NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	42	Arg-rich.				carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		GTGCCTGAATGGGAACCCCCC	0.592																																					p.G42W		Atlas-SNP	.											.	HHIP	100	.	0			c.G124T						.						82.0	90.0	87.0					4																	145567951		2203	4300	6503	SO:0001583	missense	64399	exon1			CTGAATGGGAACC	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.124G>T	chr4.hg19:g.145567951G>T	ENSP00000296575:p.Gly42Trp	209.0	0.0		170.0	85.0	NM_022475	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	ENST00000296575.3	hg19	CCDS3762.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559029	0.65538	.	.	ENSG00000164161	ENST00000296575;ENST00000434550	T;T	0.78246	-1.16;-1.16	5.11	5.11	0.69529	Folate receptor-like (1);	0.000000	0.85682	D	0.000000	D	0.86522	0.5953	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85183	0.1005	10	0.35671	T	0.21	-10.106	18.5565	0.91086	0.0:0.0:1.0:0.0	.	42;42	Q96QV1;Q96QV1-2	HHIP_HUMAN;.	W	42	ENSP00000296575:G42W;ENSP00000408587:G42W	ENSP00000296575:G42W	G	+	1	0	HHIP	145787401	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	8.162000	0.89657	2.373000	0.80994	0.650000	0.86243	GGG	.	.		0.592	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2		
SLC6A19	340024	hgsc.bcm.edu	37	5	1221377	1221377	+	Silent	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr5:1221377C>T	ENST00000304460.10	+	11	1706	c.1650C>T	c.(1648-1650)ttC>ttT	p.F550F		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	550					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TCTTCTTCTTCGTGGTAGAGG	0.582																																					p.F550F		Atlas-SNP	.											.	SLC6A19	99	.	0			c.C1650T						.						158.0	117.0	131.0					5																	1221377		2203	4300	6503	SO:0001819	synonymous_variant	340024	exon11			CTTCTTCGTGGTA	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1650C>T	chr5.hg19:g.1221377C>T		55.0	0.0		54.0	16.0	NM_001003841	A8K446	Silent	SNP	ENST00000304460.10	hg19	CCDS34130.1																																																																																			.	.		0.582	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
CDH18	1016	hgsc.bcm.edu	37	5	19473502	19473502	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr5:19473502G>T	ENST00000507958.1	-	15	3196	c.2206C>A	c.(2206-2208)Cag>Aag	p.Q736K	CDH18_ENST00000274170.4_Missense_Mutation_p.Q736K|CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.Q736K			Q13634	CAD18_HUMAN	cadherin 18, type 2	736					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GCATAAGTCTGAAGAGAGTCA	0.473																																					p.Q736K		Atlas-SNP	.											.	CDH18	561	.	0			c.C2206A						.						123.0	120.0	121.0					5																	19473502		2203	4300	6503	SO:0001583	missense	1016	exon13			AAGTCTGAAGAGA	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.2206C>A	chr5.hg19:g.19473502G>T	ENSP00000425093:p.Gln736Lys	156.0	0.0		167.0	51.0	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902893	0.92035	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T	0.76968	-1.06;-1.06;-1.06	6.01	6.01	0.97437	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.87533	0.6201	M	0.70842	2.15	0.58432	D	0.999997	D	0.67145	0.996	D	0.70016	0.967	D	0.86056	0.1529	9	.	.	.	.	19.085	0.93200	0.0:0.0:1.0:0.0	.	736	Q13634	CAD18_HUMAN	K	736	ENSP00000371710:Q736K;ENSP00000425093:Q736K;ENSP00000274170:Q736K	.	Q	-	1	0	CDH18	19509259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.863000	0.99569	2.861000	0.98227	0.650000	0.86243	CAG	.	.		0.473	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
CDH9	1007	hgsc.bcm.edu	37	5	26881347	26881348	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr5:26881347_26881348GA>TT	ENST00000231021.4	-	12	2439_2440	c.2267_2268TC>AA	c.(2266-2268)cTC>cAA	p.L756Q		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	756					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AATCAGCTGTGAGAGATTCCAA	0.465																																					p.L756L|p.L756H	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.C2268A|c.T2267A						.																																			SO:0001583	missense	1007	exon12			AGCTGTGAGAGAT|GCTGTGAGAGATT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2267_2268delinsTT	chr5.hg19:g.26881347_26881348delinsTT	ENSP00000231021:p.Leu756Gln	118.0	0.0		152.0|153.0	61.0|62.0	NM_016279	Q3B7I5	Silent|Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1																																																																																			.	.		0.465	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
NUP153	9972	hgsc.bcm.edu	37	6	17628999	17628999	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr6:17628999T>C	ENST00000262077.2	-	18	3430	c.3431A>G	c.(3430-3432)gAg>gGg	p.E1144G	NUP153_ENST00000537253.1_Missense_Mutation_p.E1175G	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	1144					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGAAGAATTCTCATCTTTGGT	0.403																																					p.E1144G		Atlas-SNP	.											.	NUP153	116	.	0			c.A3431G						.						96.0	98.0	97.0					6																	17628999		2203	4300	6503	SO:0001583	missense	9972	exon18			GAATTCTCATCTT	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.3431A>G	chr6.hg19:g.17628999T>C	ENSP00000262077:p.Glu1144Gly	86.0	0.0		126.0	90.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	hg19	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.148919	0.57151	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.07567	3.18;3.18	5.75	5.75	0.90469	.	0.000000	0.50627	D	0.000112	T	0.12475	0.0303	M	0.68317	2.08	0.38685	D	0.952632	D;P;P	0.65815	0.995;0.846;0.7	P;B;B	0.61658	0.892;0.374;0.181	T	0.09487	-1.0672	10	0.26408	T	0.33	-16.2498	11.1491	0.48447	0.0:0.0713:0.0:0.9287	.	1175;1124;1144	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	G	1144;1124;1175	ENSP00000262077:E1144G;ENSP00000444029:E1175G	ENSP00000262077:E1144G	E	-	2	0	NUP153	17736978	0.999000	0.42202	1.000000	0.80357	0.979000	0.70002	3.701000	0.54793	2.195000	0.70347	0.533000	0.62120	GAG	.	.		0.403	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
MRPL14	64928	hgsc.bcm.edu	37	6	44081735	44081735	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr6:44081735G>A	ENST00000372014.3	-	3	414	c.283C>T	c.(283-285)Cga>Tga	p.R95*		NM_032111.2	NP_115487.2	Q6P1L8	RM14_HUMAN	mitochondrial ribosomal protein L14	95					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	12	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0181)			GGGGTCATTCGGGGGCCAGGC	0.567																																					p.R95X		Atlas-SNP	.											.	MRPL14	15	.	0			c.C283T						.						114.0	118.0	116.0					6																	44081735		2203	4300	6503	SO:0001587	stop_gained	64928	exon3			TCATTCGGGGGCC	AB051339	CCDS34460.1	6p21.3	2012-09-13			ENSG00000180992	ENSG00000180992		"""Mitochondrial ribosomal proteins / large subunits"""	14279	protein-coding gene	gene with protein product		611827					Standard	XM_005249300		Approved	RPML32, MRP-L32	uc003owp.3	Q6P1L8	OTTHUMG00000014756	ENST00000372014.3:c.283C>T	chr6.hg19:g.44081735G>A	ENSP00000361084:p.Arg95*	107.0	0.0		186.0	34.0	NM_032111	B2R575|Q96Q72	Nonsense_Mutation	SNP	ENST00000372014.3	hg19	CCDS34460.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924330	0.52653	.	.	ENSG00000180992	ENST00000372014	.	.	.	5.69	2.77	0.32553	.	0.692312	0.14538	N	0.313477	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.3243	0.07061	0.1308:0.1183:0.4923:0.2586	.	.	.	.	X	95	.	ENSP00000361084:R95X	R	-	1	2	MRPL14	44189713	0.987000	0.35691	0.377000	0.26055	0.338000	0.28826	2.468000	0.45102	1.373000	0.46208	0.561000	0.74099	CGA	.	.		0.567	MRPL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040707.1	NM_032111	
MANEA	79694	hgsc.bcm.edu	37	6	96034647	96034647	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr6:96034647A>G	ENST00000358812.4	+	2	466	c.332A>G	c.(331-333)tAt>tGt	p.Y111C	MANEA_ENST00000369293.1_Missense_Mutation_p.Y111C	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	111	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TACAGTTGGTATGGAAATCCA	0.368																																					p.Y111C		Atlas-SNP	.											.	MANEA	58	.	0			c.A332G						.						95.0	98.0	97.0					6																	96034647		2203	4300	6503	SO:0001583	missense	79694	exon2			GTTGGTATGGAAA	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.332A>G	chr6.hg19:g.96034647A>G	ENSP00000351669:p.Tyr111Cys	155.0	0.0		66.0	57.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	ENST00000358812.4	hg19	CCDS5032.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.110968	0.56398	.	.	ENSG00000172469	ENST00000358812;ENST00000369293;ENST00000542500	.	.	.	5.98	4.76	0.60689	.	0.233296	0.45606	D	0.000357	T	0.75170	0.3813	M	0.88979	2.995	0.44825	D	0.997832	D;D	0.89917	0.997;1.0	P;D	0.68943	0.874;0.961	T	0.80111	-0.1519	9	0.87932	D	0	-20.1259	10.1819	0.42972	0.7209:0.0:0.0:0.2791	.	111;111	Q5SRI9;Q8WWX4	MANEA_HUMAN;.	C	111	.	ENSP00000351669:Y111C	Y	+	2	0	MANEA	96141368	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.537000	0.45702	2.288000	0.76882	0.528000	0.53228	TAT	.	.		0.368	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
GRM1	2911	hgsc.bcm.edu	37	6	146480653	146480653	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr6:146480653C>A	ENST00000282753.1	+	2	1105	c.870C>A	c.(868-870)ttC>ttA	p.F290L	GRM1_ENST00000492807.2_Missense_Mutation_p.F290L|GRM1_ENST00000507907.1_Missense_Mutation_p.F290L|GRM1_ENST00000355289.4_Missense_Mutation_p.F290L|GRM1_ENST00000392299.2_Missense_Mutation_p.F290L|GRM1_ENST00000361719.2_Missense_Mutation_p.F290L			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	290					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TGGTCTGCTTCTGTGAAGGCA	0.547																																					p.F290L		Atlas-SNP	.											.	GRM1	419	.	0			c.C870A						.						89.0	82.0	84.0					6																	146480653		2203	4300	6503	SO:0001583	missense	2911	exon3			CTGCTTCTGTGAA	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.870C>A	chr6.hg19:g.146480653C>A	ENSP00000282753:p.Phe290Leu	100.0	0.0		39.0	37.0	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	hg19	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567417	0.86439	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.32	3.55	0.40652	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88332	0.6408	M	0.87038	2.855	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.83275	0.992;0.992;0.996;0.987	D	0.88762	0.3258	10	0.87932	D	0	.	9.1072	0.36705	0.0:0.7769:0.0:0.2231	.	290;290;285;290	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	L	290	ENSP00000354896:F290L;ENSP00000376119:F290L;ENSP00000424095:F290L;ENSP00000282753:F290L;ENSP00000347437:F290L;ENSP00000425599:F290L	ENSP00000282753:F290L	F	+	3	2	GRM1	146522346	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.801000	0.55545	0.643000	0.30638	0.655000	0.94253	TTC	.	.		0.547	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
ACAT2	39	hgsc.bcm.edu	37	6	160188168	160188168	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr6:160188168A>G	ENST00000367048.4	+	3	2082	c.322A>G	c.(322-324)Ata>Gta	p.I108V	ACAT2_ENST00000541436.1_Missense_Mutation_p.I137V	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	108					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GTCAATAGGGATAGGAGACTC	0.512																																					p.I108V		Atlas-SNP	.											.	ACAT2	32	.	0			c.A322G						.						174.0	151.0	159.0					6																	160188168		2203	4300	6503	SO:0001583	missense	39	exon3			ATAGGGATAGGAG	AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.322A>G	chr6.hg19:g.160188168A>G	ENSP00000356015:p.Ile108Val	150.0	0.0		56.0	50.0	NM_005891	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Missense_Mutation	SNP	ENST00000367048.4	hg19	CCDS5268.1	.	.	.	.	.	.	.	.	.	.	A	2.916	-0.224373	0.06061	.	.	ENSG00000120437	ENST00000367048;ENST00000541436	T;T	0.40756	1.02;1.02	5.46	-10.0	0.00425	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	1.054170	0.07364	N	0.884580	T	0.03136	0.0092	N	0.02111	-0.68	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.29336	-1.0015	10	0.33940	T	0.23	-2.4897	0.9502	0.01374	0.3266:0.1962:0.2872:0.19	.	137;108	B7Z233;Q9BWD1	.;THIC_HUMAN	V	108;137	ENSP00000356015:I108V;ENSP00000437850:I137V	ENSP00000356015:I108V	I	+	1	0	ACAT2	160108158	0.000000	0.05858	0.000000	0.03702	0.995000	0.86356	-0.119000	0.10676	-1.523000	0.01767	-0.327000	0.08410	ATA	.	.		0.512	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042912.1	NM_005891	
MLLT4	4301	hgsc.bcm.edu	37	6	168319445	168319445	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr6:168319445G>T	ENST00000447894.2	+	20	2719	c.2719G>T	c.(2719-2721)Gaa>Taa	p.E907*	MLLT4_ENST00000366806.2_Nonsense_Mutation_p.E907*|MLLT4_ENST00000392112.1_Nonsense_Mutation_p.E891*|MLLT4_ENST00000351017.4_Nonsense_Mutation_p.E914*|MLLT4_ENST00000400822.3_Nonsense_Mutation_p.E906*|MLLT4_ENST00000344191.4_Nonsense_Mutation_p.E907*|MLLT4_ENST00000392108.3_Nonsense_Mutation_p.E907*			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	907	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GACTGTGGCTGAAAACACTGC	0.463			T	MLL	AL																																p.E907X		Atlas-SNP	.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	351	.	0			c.G2719T						.						99.0	93.0	95.0					6																	168319445		2203	4300	6503	SO:0001587	stop_gained	4301	exon20			GTGGCTGAAAACA	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.2719G>T	chr6.hg19:g.168319445G>T	ENSP00000404595:p.Glu907*	118.0	0.0		47.0	43.0	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Nonsense_Mutation	SNP	ENST00000447894.2	hg19		.	.	.	.	.	.	.	.	.	.	G	42	9.621894	0.99221	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894;ENST00000497596	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-39.8268	19.4438	0.94838	0.0:0.0:1.0:0.0	.	.	.	.	X	907;914;907;907;891;907;906;907;70	.	ENSP00000345834:E907X	E	+	1	0	MLLT4	168062294	1.000000	0.71417	0.982000	0.44146	0.733000	0.41908	9.217000	0.95160	2.655000	0.90218	0.655000	0.94253	GAA	.	.		0.463	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
THSD7A	221981	hgsc.bcm.edu	37	7	11416274	11416274	+	Silent	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr7:11416274T>C	ENST00000423059.4	-	27	5063	c.4812A>G	c.(4810-4812)ctA>ctG	p.L1604L	AC004538.3_ENST00000445839.1_RNA|AC004538.3_ENST00000428967.1_RNA|AC004538.3_ENST00000595972.1_RNA|AC004538.3_ENST00000599875.1_RNA|AC004538.3_ENST00000421121.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1604					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CCCAGGTCTTTAGTCTCCCAT	0.343										HNSCC(18;0.044)																											p.L1604L		Atlas-SNP	.											.	THSD7A	219	.	0			c.A4812G						.						52.0	55.0	54.0					7																	11416274		1857	4092	5949	SO:0001819	synonymous_variant	221981	exon26			GGTCTTTAGTCTC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4812A>G	chr7.hg19:g.11416274T>C		55.0	0.0		61.0	40.0	NM_015204		Silent	SNP	ENST00000423059.4	hg19	CCDS47543.1																																																																																			.	.		0.343	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
RELN	5649	hgsc.bcm.edu	37	7	103214576	103214576	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr7:103214576C>T	ENST00000428762.1	-	30	4633	c.4474G>A	c.(4474-4476)Gaa>Aaa	p.E1492K	RELN_ENST00000343529.5_Missense_Mutation_p.E1492K|RELN_ENST00000424685.2_Missense_Mutation_p.E1492K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1492					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GTCCGGGCTTCCCTTTTCCCA	0.458																																					p.E1492K	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.G4474A						.						129.0	126.0	127.0					7																	103214576		2203	4300	6503	SO:0001583	missense	5649	exon30			GGGCTTCCCTTTT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4474G>A	chr7.hg19:g.103214576C>T	ENSP00000392423:p.Glu1492Lys	180.0	0.0		121.0	53.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	hg19	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079334	0.94050	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.44083	1.81;0.93;1.81	5.62	5.62	0.85841	.	0.110120	0.64402	D	0.000008	T	0.56352	0.1979	L	0.40543	1.245	0.58432	D	0.999999	D;D	0.67145	0.994;0.996	D;P	0.64144	0.922;0.807	T	0.52079	-0.8623	10	0.48119	T	0.1	.	20.024	0.97514	0.0:1.0:0.0:0.0	.	1492;1492	P78509-2;P78509	.;RELN_HUMAN	K	1492	ENSP00000392423:E1492K;ENSP00000345694:E1492K;ENSP00000388446:E1492K	ENSP00000345694:E1492K	E	-	1	0	RELN	103001812	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.809000	0.96659	0.655000	0.94253	GAA	.	.		0.458	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RINT1	60561	hgsc.bcm.edu	37	7	105183036	105183036	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr7:105183036T>A	ENST00000257700.2	+	4	686	c.455T>A	c.(454-456)aTt>aAt	p.I152N		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	152					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.I152T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						ATTAGCCAGATTGAAGAGATC	0.418																																					p.I152N		Atlas-SNP	.											RINT1,rectum,carcinoma,-1,1	RINT1	65	.	1	Substitution - Missense(1)	ovary(1)	c.T455A						.						130.0	115.0	120.0					7																	105183036		2203	4300	6503	SO:0001583	missense	60561	exon4			GCCAGATTGAAGA	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.455T>A	chr7.hg19:g.105183036T>A	ENSP00000257700:p.Ile152Asn	189.0	0.0		137.0	66.0	NM_021930	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	hg19	CCDS34726.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.742156	0.69418	.	.	ENSG00000135249	ENST00000257700;ENST00000493041	T	0.33654	1.4	5.16	5.16	0.70880	.	0.335699	0.33959	N	0.004385	T	0.35653	0.0939	L	0.46157	1.445	0.45806	D	0.998687	P	0.44478	0.836	B	0.41088	0.347	T	0.28004	-1.0057	10	0.66056	D	0.02	-9.2808	14.9865	0.71351	0.0:0.0:0.0:1.0	.	152	Q6NUQ1	RINT1_HUMAN	N	152;121	ENSP00000257700:I152N	ENSP00000257700:I152N	I	+	2	0	RINT1	104970272	1.000000	0.71417	0.835000	0.33067	0.434000	0.31775	7.287000	0.78681	1.929000	0.55896	0.379000	0.24179	ATT	.	.		0.418	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
GCC1	79571	hgsc.bcm.edu	37	7	127222825	127222825	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr7:127222825A>C	ENST00000321407.2	-	2	1995	c.1571T>G	c.(1570-1572)cTt>cGt	p.L524R	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	524					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CAGCTCTGCAAGCTGTTCCTG	0.547																																					p.L524R		Atlas-SNP	.											.	GCC1	83	.	0			c.T1571G						.						75.0	72.0	73.0					7																	127222825		2203	4300	6503	SO:0001583	missense	79571	exon2			TCTGCAAGCTGTT	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1571T>G	chr7.hg19:g.127222825A>C	ENSP00000318821:p.Leu524Arg	101.0	0.0		88.0	41.0	NM_024523	Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	hg19	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	A	17.01	3.279090	0.59758	.	.	ENSG00000179562	ENST00000321407	T	0.15718	2.4	5.29	5.29	0.74685	.	0.063696	0.64402	D	0.000004	T	0.39145	0.1067	M	0.68952	2.095	0.54753	D	0.999984	D	0.89917	1.0	D	0.73380	0.98	T	0.16541	-1.0399	10	0.59425	D	0.04	-8.9467	13.4815	0.61338	1.0:0.0:0.0:0.0	.	524	Q96CN9	GCC1_HUMAN	R	524	ENSP00000318821:L524R	ENSP00000318821:L524R	L	-	2	0	GCC1	127010061	1.000000	0.71417	0.984000	0.44739	0.962000	0.63368	5.574000	0.67424	2.123000	0.65237	0.533000	0.62120	CTT	.	.		0.547	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
TMEM140	55281	hgsc.bcm.edu	37	7	134849312	134849312	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr7:134849312C>G	ENST00000275767.3	+	2	342	c.119C>G	c.(118-120)aCt>aGt	p.T40S	C7orf49_ENST00000459937.1_Intron	NM_018295.3	NP_060765.4	Q9NV12	TM140_HUMAN	transmembrane protein 140	40						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)	5						GGCAACCTCACTGACCTGCCC	0.552																																					p.T40S		Atlas-SNP	.											.	TMEM140	18	.	0			c.C119G						.						151.0	137.0	142.0					7																	134849312		2203	4300	6503	SO:0001583	missense	55281	exon2			ACCTCACTGACCT	AK001862	CCDS5837.1	7q33	2006-03-17			ENSG00000146859	ENSG00000146859			21870	protein-coding gene	gene with protein product							Standard	NM_018295		Approved	FLJ11000	uc003vsi.3	Q9NV12	OTTHUMG00000155413	ENST00000275767.3:c.119C>G	chr7.hg19:g.134849312C>G	ENSP00000275767:p.Thr40Ser	119.0	0.0		107.0	13.0	NM_018295	A4D1P9|Q8WUC3	Missense_Mutation	SNP	ENST00000275767.3	hg19	CCDS5837.1	.	.	.	.	.	.	.	.	.	.	C	8.843	0.942814	0.18281	.	.	ENSG00000146859	ENST00000275767;ENST00000456488	T	0.22743	1.94	5.81	-7.01	0.01594	.	1.512540	0.03660	N	0.242408	T	0.23249	0.0562	L	0.54323	1.7	0.09310	N	1	B	0.30439	0.279	B	0.28011	0.085	T	0.28138	-1.0053	10	0.56958	D	0.05	0.1759	16.7955	0.85601	0.0:0.2503:0.0:0.7497	.	40	Q9NV12	TM140_HUMAN	S	40	ENSP00000275767:T40S	ENSP00000275767:T40S	T	+	2	0	TMEM140	134499852	0.000000	0.05858	0.000000	0.03702	0.311000	0.27955	-0.848000	0.04326	-1.756000	0.01318	-0.797000	0.03246	ACT	.	.		0.552	TMEM140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340017.2	NM_018295	
FAM167A	83648	hgsc.bcm.edu	37	8	11301674	11301674	+	Missense_Mutation	SNP	G	G	T	rs376899787		TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr8:11301674G>T	ENST00000528897.1	-	2	866	c.247C>A	c.(247-249)Ctc>Atc	p.L83I	FAM167A_ENST00000534308.1_Missense_Mutation_p.L83I|FAM167A_ENST00000531564.1_5'Flank|FAM167A_ENST00000284486.4_Missense_Mutation_p.L83I			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	83										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						CTCAGGGGGAGCAAGGGCTCC	0.687																																					p.L83I		Atlas-SNP	.											.	FAM167A	21	.	0			c.C247A						.	G	ILE/LEU	0,4382		0,0,2191	23.0	28.0	26.0		247	0.6	0.0	8		26	1,8569		0,1,4284	no	missense	FAM167A	NM_053279.2	5	0,1,6475	TT,TG,GG		0.0117,0.0,0.0077	benign	83/215	11301674	1,12951	2191	4285	6476	SO:0001583	missense	83648	exon2			GGGGGAGCAAGGG		CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.247C>A	chr8.hg19:g.11301674G>T	ENSP00000436655:p.Leu83Ile	84.0	0.0		22.0	17.0	NM_053279	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	ENST00000528897.1	hg19	CCDS5981.1	.	.	.	.	.	.	.	.	.	.	G	6.976	0.550098	0.13374	0.0	1.17E-4	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897;ENST00000531804	T;T;T;T	0.43688	3.09;3.09;3.09;0.94	4.78	0.606	0.17559	.	1.281020	0.05480	N	0.554563	T	0.24890	0.0604	N	0.22421	0.69	0.09310	N	1	B	0.24186	0.099	B	0.22601	0.04	T	0.18650	-1.0330	10	0.13108	T	0.6	-11.1218	3.6385	0.08158	0.403:0.0:0.4193:0.1777	.	83	Q96KS9	F167A_HUMAN	I	83	ENSP00000284486:L83I;ENSP00000432232:L83I;ENSP00000436655:L83I;ENSP00000431951:L83I	ENSP00000284486:L83I	L	-	1	0	FAM167A	11339084	0.008000	0.16893	0.000000	0.03702	0.035000	0.12851	0.869000	0.27996	0.163000	0.19507	0.655000	0.94253	CTC	.	.		0.687	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000383901.1		
PTK2B	2185	hgsc.bcm.edu	37	8	27315938	27315938	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr8:27315938A>G	ENST00000397501.1	+	36	3750	c.2942A>G	c.(2941-2943)cAc>cGc	p.H981R	PTK2B_ENST00000544172.1_Missense_Mutation_p.H981R|PTK2B_ENST00000346049.5_Missense_Mutation_p.H981R|PTK2B_ENST00000517339.1_Missense_Mutation_p.H939R|PTK2B_ENST00000338238.4_Missense_Mutation_p.H939R|PTK2B_ENST00000420218.2_Missense_Mutation_p.H939R	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	981	Focal adhesion targeting (FAT).|Interaction with TGFB1I1. {ECO:0000250}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	ACGGCTTCACACACCCTGGCT	0.612																																					p.H981R		Atlas-SNP	.											.	PTK2B	304	.	0			c.A2942G						.						74.0	50.0	58.0					8																	27315938		2203	4300	6503	SO:0001583	missense	2185	exon36			CTTCACACACCCT	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.2942A>G	chr8.hg19:g.27315938A>G	ENSP00000380638:p.His981Arg	130.0	0.0		51.0	42.0	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	hg19	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.444576	0.83993	.	.	ENSG00000120899	ENST00000397501;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339	T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79	4.91	4.91	0.64330	Focal adhesion kinase, targeting (FAT) domain (3);	0.000000	0.85682	D	0.000000	T	0.70193	0.3196	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.984;0.995	T	0.75769	-0.3201	10	0.87932	D	0	.	12.5376	0.56150	1.0:0.0:0.0:0.0	.	939;981	Q14289-2;Q14289	.;FAK2_HUMAN	R	981;939;981;981;939;939	ENSP00000380638:H981R;ENSP00000342242:H939R;ENSP00000440926:H981R;ENSP00000332816:H981R;ENSP00000391995:H939R;ENSP00000427931:H939R	ENSP00000342242:H939R	H	+	2	0	PTK2B	27371855	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.131000	0.94446	2.048000	0.60808	0.460000	0.39030	CAC	.	.		0.612	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
MRPL15	29088	hgsc.bcm.edu	37	8	55055240	55055240	+	Silent	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr8:55055240G>A	ENST00000260102.4	+	4	521	c.447G>A	c.(445-447)acG>acA	p.T149T		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	149					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			ACACCTTTACGGCAAAAGTTA	0.368																																					p.T149T		Atlas-SNP	.											.	MRPL15	26	.	0			c.G447A						.						91.0	84.0	86.0					8																	55055240		2203	4300	6503	SO:0001819	synonymous_variant	29088	exon4			CTTTACGGCAAAA	AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.447G>A	chr8.hg19:g.55055240G>A		243.0	0.0		373.0	31.0	NM_014175	Q96Q54|Q9H0Y1	Silent	SNP	ENST00000260102.4	hg19	CCDS6158.1																																																																																			.	.		0.368	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378254.1	NM_014175	
TMEM8B	51754	hgsc.bcm.edu	37	9	35853536	35853536	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr9:35853536C>T	ENST00000377991.4	+	14	2133	c.1118C>T	c.(1117-1119)cCa>cTa	p.P373L	TMEM8B_ENST00000377988.2_Missense_Mutation_p.P373L	NM_001042589.2	NP_001036054.1	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B	373					cell-matrix adhesion (GO:0007160)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle (GO:0007346)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	7						CACTGCTACCCACCCACGTGG	0.617																																					p.P373L		Atlas-SNP	.											.	TMEM8B	53	.	0			c.C1118T						.						52.0	53.0	53.0					9																	35853536		2039	4168	6207	SO:0001583	missense	51754	exon13			GCTACCCACCCAC	BC043384	CCDS6595.1, CCDS43800.1	9p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000137103	ENSG00000137103			21427	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma expressed 6"""		"""chromosome 9 open reading frame 127"""	C9orf127		12918109, 8619474	Standard	NM_016446		Approved	NAG-5, NGX6	uc003zym.4	A6NDV4	OTTHUMG00000019885	ENST00000377991.4:c.1118C>T	chr9.hg19:g.35853536C>T	ENSP00000367230:p.Pro373Leu	74.0	0.0		46.0	18.0	NM_001042590	B3KQF3|O75539|Q49AB1|Q4KMX5|Q5TCW5|Q9HBY2|Q9P0U7	Missense_Mutation	SNP	ENST00000377991.4	hg19	CCDS43800.1	.	.	.	.	.	.	.	.	.	.	C	32	5.150412	0.94645	.	.	ENSG00000137103	ENST00000377991;ENST00000377988	T;T	0.45668	0.89;0.89	5.28	5.28	0.74379	.	.	.	.	.	T	0.69043	0.3067	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72737	-0.4203	9	0.51188	T	0.08	.	17.5022	0.87735	0.0:1.0:0.0:0.0	.	373	A6NDV4	TMM8B_HUMAN	L	373	ENSP00000367230:P373L;ENSP00000367227:P373L	ENSP00000367227:P373L	P	+	2	0	TMEM8B	35843536	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.006000	0.70724	2.473000	0.83533	0.555000	0.69702	CCA	.	.		0.617	TMEM8B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052388.2	NM_016446	
TMC1	117531	hgsc.bcm.edu	37	9	75407157	75407157	+	Silent	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr9:75407157T>C	ENST00000297784.5	+	17	1995	c.1455T>C	c.(1453-1455)aaT>aaC	p.N485N	TMC1_ENST00000396237.3_Silent_p.N485N|TMC1_ENST00000340019.3_Silent_p.N485N|TMC1_ENST00000486417.1_3'UTR	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	485					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						GGGAAGCCAATATGATCAAGG	0.408																																					p.N485N	Pancreas(75;173 1345 14232 34245 43413)	Atlas-SNP	.											.	TMC1	87	.	0			c.T1455C						.						239.0	222.0	228.0					9																	75407157		2203	4300	6503	SO:0001819	synonymous_variant	117531	exon17			AGCCAATATGATC	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1455T>C	chr9.hg19:g.75407157T>C		197.0	0.0		140.0	57.0	NM_138691	A8MVZ2|B1AM91	Silent	SNP	ENST00000297784.5	hg19	CCDS6643.1																																																																																			.	.		0.408	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
NMRK1	54981	hgsc.bcm.edu	37	9	77681717	77681717	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr9:77681717A>G	ENST00000361092.4	-	8	772	c.536T>C	c.(535-537)tTg>tCg	p.L179S	NMRK1_ENST00000482537.1_5'UTR|NMRK1_ENST00000376811.1_Missense_Mutation_p.L183S|NMRK1_ENST00000376808.4_Missense_Mutation_p.L155S	NM_017881.2	NP_060351.1	Q9NWW6	NRK1_HUMAN	nicotinamide riboside kinase 1	179					NAD biosynthetic process (GO:0009435)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										ATATACTTGCAAAAAGAGGTC	0.368																																					p.L179S		Atlas-SNP	.											.	.	.	.	0			c.T536C						.						156.0	147.0	150.0					9																	77681717		2203	4300	6503	SO:0001583	missense	54981	exon8			ACTTGCAAAAAGA	AK097144	CCDS6650.1, CCDS47981.1	9q21.31	2012-03-30	2012-03-30	2012-03-30	ENSG00000106733	ENSG00000106733			26057	protein-coding gene	gene with protein product		608704	"""chromosome 9 open reading frame 95"""	C9orf95		15137942	Standard	NM_017881		Approved	FLJ20559, NRK1, bA235O14.2	uc004ajr.4	Q9NWW6	OTTHUMG00000020034	ENST00000361092.4:c.536T>C	chr9.hg19:g.77681717A>G	ENSP00000354387:p.Leu179Ser	132.0	0.0		127.0	54.0	NM_017881	Q5W124|Q8N430	Missense_Mutation	SNP	ENST00000361092.4	hg19	CCDS6650.1	.	.	.	.	.	.	.	.	.	.	A	0.693	-0.793848	0.02862	.	.	ENSG00000106733	ENST00000376811;ENST00000376794;ENST00000361092;ENST00000376808	T;T;T	0.26518	1.73;1.73;1.73	5.45	2.56	0.30785	.	0.789352	0.11813	N	0.526960	T	0.06325	0.0163	N	0.00483	-1.445	0.23537	N	0.997465	B;B;B	0.12013	0.0;0.005;0.001	B;B;B	0.06405	0.0;0.002;0.002	T	0.31447	-0.9943	10	0.07175	T	0.84	-10.7153	8.9807	0.35964	0.2368:0.0:0.7632:0.0	.	155;183;179	Q9NWW6-2;Q5W125;Q9NWW6	.;.;NRK1_HUMAN	S	183;183;179;155	ENSP00000366007:L183S;ENSP00000354387:L179S;ENSP00000366004:L155S	ENSP00000354387:L179S	L	-	2	0	C9orf95	76871537	0.311000	0.24536	0.964000	0.40570	0.446000	0.32137	1.317000	0.33631	1.286000	0.44565	-0.248000	0.11899	TTG	.	.		0.368	NMRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052705.1	NM_017881	
FAM171A1	221061	hgsc.bcm.edu	37	10	15255031	15255031	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr10:15255031C>A	ENST00000378116.4	-	8	2562	c.2556G>T	c.(2554-2556)caG>caT	p.Q852H	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	852						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CAGATCTTCTCTGGTGGGGGC	0.622																																					p.Q852H		Atlas-SNP	.											.	FAM171A1	252	.	0			c.G2556T						.						123.0	129.0	127.0					10																	15255031		2203	4300	6503	SO:0001583	missense	221061	exon8			TCTTCTCTGGTGG	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2556G>T	chr10.hg19:g.15255031C>A	ENSP00000367356:p.Gln852His	51.0	0.0		62.0	39.0	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	hg19	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	C	1.268	-0.613806	0.03690	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.30714	1.52	5.1	0.752	0.18398	.	0.873151	0.10347	N	0.685629	T	0.12689	0.0308	N	0.03115	-0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30446	-0.9978	10	0.27785	T	0.31	-1.244	7.4545	0.27258	0.3847:0.2511:0.3642:0.0	.	852	Q5VUB5	F1711_HUMAN	H	852;851	ENSP00000367356:Q852H	ENSP00000367356:Q852H	Q	-	3	2	FAM171A1	15295037	0.420000	0.25457	0.041000	0.18516	0.503000	0.33858	0.763000	0.26517	0.282000	0.22254	0.563000	0.77884	CAG	.	.		0.622	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
KCNC1	3746	hgsc.bcm.edu	37	11	17758086	17758086	+	Silent	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:17758086C>A	ENST00000379472.3	+	1	567	c.537C>A	c.(535-537)ctC>ctA	p.L179L	KCNC1_ENST00000265969.6_Silent_p.L179L	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	179					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	TCTGGGCGCTCTTCGAGGACC	0.682																																					p.L179L		Atlas-SNP	.											.	KCNC1	149	.	0			c.C537A						.						5.0	6.0	5.0					11																	17758086		1996	3948	5944	SO:0001819	synonymous_variant	3746	exon1			GGCGCTCTTCGAG	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.537C>A	chr11.hg19:g.17758086C>A		71.0	0.0		67.0	29.0	NM_004976	K4DI87	Silent	SNP	ENST00000379472.3	hg19	CCDS7827.1																																																																																			.	.		0.682	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976	
OR5M3	219482	hgsc.bcm.edu	37	11	56237301	56237301	+	Nonsense_Mutation	SNP	G	G	A	rs138643585		TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:56237301G>A	ENST00000312240.2	-	1	713	c.673C>T	c.(673-675)Cga>Tga	p.R225*		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GAGCGCATTCGCAGAATGGCA	0.403													g|||	1	0.000199681	0.0	0.0	5008	,	,		21550	0.0		0.001	False		,,,				2504	0.0				p.R225X		Atlas-SNP	.											.	OR5M3	103	.	0			c.C673T						.						65.0	64.0	64.0					11																	56237301		2201	4292	6493	SO:0001587	stop_gained	219482	exon1			GCATTCGCAGAAT	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.673C>T	chr11.hg19:g.56237301G>A	ENSP00000312208:p.Arg225*	230.0	0.0		197.0	86.0	NM_001004742	B2RNM7|Q6IEW4|Q96RC0	Nonsense_Mutation	SNP	ENST00000312240.2	hg19	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	4.951	0.176628	0.09443	.	.	ENSG00000174937	ENST00000312240	.	.	.	5.08	-10.2	0.00374	.	0.207799	0.23698	N	0.045442	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0585	5.4574	0.16598	0.1327:0.0774:0.1742:0.6158	.	.	.	.	X	225	.	ENSP00000312208:R225X	R	-	1	2	OR5M3	55993877	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-3.344000	0.00504	-2.305000	0.00654	-0.235000	0.12190	CGA	.	G|1.000;C|0.000		0.403	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
MS4A14	84689	hgsc.bcm.edu	37	11	60184358	60184358	+	Silent	SNP	G	G	T	rs375353153		TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:60184358G>T	ENST00000300187.6	+	5	2194	c.1917G>T	c.(1915-1917)ctG>ctT	p.L639L	MS4A14_ENST00000531783.1_Silent_p.L672L|MS4A14_ENST00000395005.2_Silent_p.L622L|MS4A14_ENST00000531787.1_Silent_p.L527L	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	639	Gln-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						TGCCAAAACTGTTATGCCAAG	0.473																																					p.L672L		Atlas-SNP	.											.	MS4A14	120	.	0			c.G2016T						.						84.0	84.0	84.0					11																	60184358		2203	4300	6503	SO:0001819	synonymous_variant	84689	exon6			AAAACTGTTATGC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1917G>T	chr11.hg19:g.60184358G>T		120.0	0.0		102.0	50.0	NM_001261828	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Silent	SNP	ENST00000300187.6	hg19	CCDS31569.1																																																																																			.	.		0.473	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
ME3	10873	hgsc.bcm.edu	37	11	86267694	86267694	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:86267694C>T	ENST00000393324.3	-	3	621	c.368G>A	c.(367-369)cGa>cAa	p.R123Q	ME3_ENST00000359636.2_Missense_Mutation_p.R123Q|ME3_ENST00000543262.1_Missense_Mutation_p.R123Q|ME3_ENST00000323418.6_Missense_Mutation_p.R61Q|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	123					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				AGTCAGCACTCGGTAGAAGAG	0.547																																					p.R123Q		Atlas-SNP	.											.	ME3	70	.	0			c.G368A						.						122.0	99.0	107.0					11																	86267694		2202	4299	6501	SO:0001583	missense	10873	exon4			AGCACTCGGTAGA	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.368G>A	chr11.hg19:g.86267694C>T	ENSP00000376998:p.Arg123Gln	93.0	0.0		68.0	23.0	NM_006680	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	hg19	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	36	5.609640	0.96637	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418;ENST00000530335	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.96	5.96	0.96718	Malic enzyme, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.63390	0.2507	M	0.87269	2.87	0.80722	D	1	D	0.63046	0.992	P	0.51550	0.673	T	0.67860	-0.5561	9	.	.	.	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	123	Q16798	MAON_HUMAN	Q	123;123;123;123;61;61;123	ENSP00000352657:R123Q;ENSP00000440246:R123Q;ENSP00000376998:R123Q;ENSP00000431182:R123Q;ENSP00000315255:R61Q;ENSP00000434690:R123Q	.	R	-	2	0	ME3	85945342	1.000000	0.71417	0.951000	0.38953	0.956000	0.61745	4.898000	0.63238	2.832000	0.97577	0.655000	0.94253	CGA	.	.		0.547	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
FAT3	120114	hgsc.bcm.edu	37	11	92533328	92533328	+	Silent	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:92533328C>T	ENST00000298047.6	+	9	7166	c.7149C>T	c.(7147-7149)taC>taT	p.Y2383Y	FAT3_ENST00000409404.2_Silent_p.Y2383Y|FAT3_ENST00000525166.1_Silent_p.Y2233Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2383	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTCATATCTACATCTCTGATG	0.428										TCGA Ovarian(4;0.039)																											p.Y2383Y		Atlas-SNP	.											.	FAT3	1822	.	0			c.C7149T						.						129.0	128.0	128.0					11																	92533328		1894	4110	6004	SO:0001819	synonymous_variant	120114	exon9			TATCTACATCTCT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7149C>T	chr11.hg19:g.92533328C>T		98.0	0.0		78.0	50.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	hg19																																																																																				.	.		0.428	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
EXPH5	23086	hgsc.bcm.edu	37	11	108385423	108385423	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:108385423T>C	ENST00000265843.4	-	6	921	c.811A>G	c.(811-813)Atc>Gtc	p.I271V	EXPH5_ENST00000443411.1_Missense_Mutation_p.I83V|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000428840.1_Missense_Mutation_p.I195V|EXPH5_ENST00000525344.1_Missense_Mutation_p.I264V	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	271					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		ATGTCATAGATAGACATATTG	0.383																																					p.I271V		Atlas-SNP	.											.	EXPH5	193	.	0			c.A811G						.						133.0	124.0	127.0					11																	108385423		2201	4298	6499	SO:0001583	missense	23086	exon6			CATAGATAGACAT		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.811A>G	chr11.hg19:g.108385423T>C	ENSP00000265843:p.Ile271Val	114.0	0.0		75.0	33.0	NM_015065	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	hg19	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	T	13.58	2.278281	0.40294	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.06218	3.9;3.82;3.67;3.9;3.71;3.33	5.67	4.54	0.55810	.	0.100838	0.43919	N	0.000517	T	0.09862	0.0242	M	0.71581	2.175	0.27942	N	0.937463	B	0.31193	0.312	B	0.29524	0.103	T	0.06844	-1.0804	10	0.56958	D	0.05	-8.7832	11.2781	0.49178	0.0:0.0721:0.0:0.9279	.	271	Q8NEV8	EXPH5_HUMAN	V	271;195;83;264;115;195;83	ENSP00000265843:I271V;ENSP00000391966:I195V;ENSP00000411390:I83V;ENSP00000432546:I264V;ENSP00000432683:I195V;ENSP00000446434:I83V	ENSP00000265843:I271V	I	-	1	0	EXPH5	107890633	0.975000	0.34042	0.997000	0.53966	0.998000	0.95712	1.437000	0.34991	0.976000	0.38417	0.533000	0.62120	ATC	.	.		0.383	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
ABCG4	64137	hgsc.bcm.edu	37	11	119025597	119025597	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr11:119025597C>T	ENST00000449422.2	+	6	846	c.658C>T	c.(658-660)Cct>Tct	p.P220S	ABCG4_ENST00000307417.3_Missense_Mutation_p.P220S|ABCG4_ENST00000531739.1_Missense_Mutation_p.P220S	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	220	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CAACAACCCGCCTGTCATGTT	0.632																																					p.P220S		Atlas-SNP	.											.	ABCG4	77	.	0			c.C658T						.						158.0	147.0	151.0					11																	119025597		2200	4295	6495	SO:0001583	missense	64137	exon6			AACCCGCCTGTCA	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.658C>T	chr11.hg19:g.119025597C>T	ENSP00000406874:p.Pro220Ser	97.0	0.0		78.0	24.0	NM_022169	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	hg19	CCDS8415.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647577	0.87958	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.25912	1.77;1.77;1.77	4.48	4.48	0.54585	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.106898	0.64402	D	0.000003	T	0.27063	0.0663	N	0.03050	-0.425	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.48019	-0.9071	10	0.36615	T	0.2	-12.1481	17.3381	0.87288	0.0:1.0:0.0:0.0	.	220	Q9H172	ABCG4_HUMAN	S	220	ENSP00000304111:P220S;ENSP00000406874:P220S;ENSP00000434318:P220S	ENSP00000304111:P220S	P	+	1	0	ABCG4	118530807	1.000000	0.71417	0.801000	0.32222	0.981000	0.71138	7.645000	0.83430	2.339000	0.79563	0.491000	0.48974	CCT	.	.		0.632	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
WBP11	51729	hgsc.bcm.edu	37	12	14948022	14948022	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:14948022T>A	ENST00000261167.2	-	6	637	c.404A>T	c.(403-405)gAa>gTa	p.E135V		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	135					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						ACTCTCCACTTCCACATGCTG	0.418																																					p.E135V		Atlas-SNP	.											.	WBP11	66	.	0			c.A404T						.						97.0	88.0	91.0					12																	14948022		2203	4300	6503	SO:0001583	missense	51729	exon6			TCCACTTCCACAT	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.404A>T	chr12.hg19:g.14948022T>A	ENSP00000261167:p.Glu135Val	49.0	0.0		46.0	24.0	NM_016312	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	hg19	CCDS8666.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717052	0.68844	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.77536	-0.2551	9	0.87932	D	0	-22.0807	13.2723	0.60167	0.0:0.0:0.0:1.0	.	135	Q9Y2W2	WBP11_HUMAN	V	135	.	ENSP00000261167:E135V	E	-	2	0	WBP11	14839289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.791000	0.85805	2.030000	0.59900	0.533000	0.62120	GAA	.	.		0.418	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
HELB	92797	hgsc.bcm.edu	37	12	66731799	66731799	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:66731799G>C	ENST00000247815.4	+	13	3240	c.3181G>C	c.(3181-3183)Gtg>Ctg	p.V1061L		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	1061					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		ATCTCCACAAGTGTCTTCCAG	0.338																																					p.V1061L		Atlas-SNP	.											.	HELB	90	.	0			c.G3181C						.						59.0	61.0	60.0					12																	66731799		2203	4299	6502	SO:0001583	missense	92797	exon13			CCACAAGTGTCTT	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.3181G>C	chr12.hg19:g.66731799G>C	ENSP00000247815:p.Val1061Leu	117.0	0.0		70.0	37.0	NM_033647	A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	hg19	CCDS8976.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966614	0.74131	.	.	ENSG00000127311	ENST00000247815	T	0.17054	2.3	5.5	4.61	0.57282	.	0.197175	0.30410	N	0.009691	T	0.17195	0.0413	M	0.64997	1.995	0.35656	D	0.812173	P	0.48407	0.91	B	0.35182	0.197	T	0.30736	-0.9968	9	.	.	.	-13.8094	14.1357	0.65287	0.0722:0.0:0.9278:0.0	.	1061	Q8NG08	HELB_HUMAN	L	1061	ENSP00000247815:V1061L	.	V	+	1	0	HELB	65018066	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.753000	0.55180	1.304000	0.44892	0.655000	0.94253	GTG	.	.		0.338	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1		
CAND1	55832	hgsc.bcm.edu	37	12	67705572	67705572	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:67705572A>G	ENST00000545606.1	+	14	3897	c.3460A>G	c.(3460-3462)Aca>Gca	p.T1154A		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	1154					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TGCAACATGTACAACTAAGGT	0.408																																					p.T1154A		Atlas-SNP	.											.	CAND1	100	.	0			c.A3460G						.						128.0	113.0	118.0					12																	67705572		2203	4300	6503	SO:0001583	missense	55832	exon14			ACATGTACAACTA		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.3460A>G	chr12.hg19:g.67705572A>G	ENSP00000442318:p.Thr1154Ala	142.0	0.0		127.0	64.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.604299	0.46423	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	T;T	0.65549	-0.16;-0.16	5.93	4.76	0.60689	TATA-binding protein interacting (TIP20) (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.046490	0.85682	D	0.000000	T	0.62159	0.2405	M	0.75884	2.315	0.80722	D	1	B;B	0.23442	0.085;0.078	B;B	0.24974	0.028;0.057	T	0.57888	-0.7733	9	.	.	.	-13.2711	13.1441	0.59450	0.8664:0.1336:0.0:0.0	.	986;1154	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	A	1154;1154;694	ENSP00000442318:T1154A;ENSP00000444089:T694A	.	T	+	1	0	CAND1	65991839	1.000000	0.71417	0.992000	0.48379	0.319000	0.28217	7.222000	0.78025	1.036000	0.39998	0.482000	0.46254	ACA	.	.		0.408	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
MED13L	23389	hgsc.bcm.edu	37	12	116444191	116444191	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:116444191T>C	ENST00000281928.3	-	12	2470	c.2264A>G	c.(2263-2265)gAt>gGt	p.D755G		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	755						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TGTAGTGACATCCTTGGTACC	0.408																																					p.D755G		Atlas-SNP	.											.	MED13L	193	.	0			c.A2264G						.						101.0	97.0	98.0					12																	116444191		2203	4300	6503	SO:0001583	missense	23389	exon12			GTGACATCCTTGG	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.2264A>G	chr12.hg19:g.116444191T>C	ENSP00000281928:p.Asp755Gly	125.0	0.0		103.0	48.0	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	hg19	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.760142	0.49468	.	.	ENSG00000123066	ENST00000281928	T	0.74106	-0.81	5.83	5.83	0.93111	.	0.175735	0.49305	D	0.000158	T	0.56834	0.2012	N	0.08118	0	0.42120	D	0.991425	B	0.23316	0.083	B	0.19391	0.025	T	0.54754	-0.8246	10	0.26408	T	0.33	.	16.1952	0.82023	0.0:0.0:0.0:1.0	.	755	Q71F56	MD13L_HUMAN	G	755	ENSP00000281928:D755G	ENSP00000281928:D755G	D	-	2	0	MED13L	114928574	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.154000	0.71826	2.236000	0.73375	0.482000	0.46254	GAT	.	.		0.408	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
SETD1B	23067	hgsc.bcm.edu	37	12	122247901	122247901	+	Silent	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:122247901G>A	ENST00000604567.1	+	6	1118	c.1050G>A	c.(1048-1050)tcG>tcA	p.S350S	SETD1B_ENST00000267197.5_Silent_p.S350S|SETD1B_ENST00000542440.1_Silent_p.S350S			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	350					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GGGGTTCCTCGGACCTCCCGT	0.642																																					p.S350S		Atlas-SNP	.											.	SETD1B	105	.	0			c.G1050A						.						9.0	12.0	11.0					12																	122247901		691	1588	2279	SO:0001819	synonymous_variant	23067	exon5			TTCCTCGGACCTC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1050G>A	chr12.hg19:g.122247901G>A		63.0	0.0		64.0	36.0	NM_015048	F6MFW1	Silent	SNP	ENST00000604567.1	hg19																																																																																				.	.		0.642	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
HCAR2	338442	hgsc.bcm.edu	37	12	123186897	123186897	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:123186897A>G	ENST00000328880.5	-	1	993	c.934T>C	c.(934-936)Tgc>Cgc	p.C312R	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	312					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	CTCTGGAGGCAGCGGTTGATC	0.552																																					p.C312R		Atlas-SNP	.											.	HCAR2	36	.	0			c.T934C						.						133.0	107.0	116.0					12																	123186897		2203	4300	6503	SO:0001583	missense	338442	exon1			GGAGGCAGCGGTT	AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.934T>C	chr12.hg19:g.123186897A>G	ENSP00000375066:p.Cys312Arg	261.0	0.0		212.0	54.0	NM_177551	A0PJL5|A7LGG3	Missense_Mutation	SNP	ENST00000328880.5	hg19	CCDS9235.1	.	.	.	.	.	.	.	.	.	.	A	8.755	0.922293	0.17982	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.36157	1.27	5.6	4.46	0.54185	.	0.295501	0.24240	U	0.040270	T	0.29061	0.0722	L	0.53249	1.67	0.52501	D	0.99995	B	0.11235	0.004	B	0.06405	0.002	T	0.11470	-1.0586	10	0.24483	T	0.36	-28.934	6.4677	0.21991	0.8292:0.0:0.1708:0.0	.	312	Q8TDS4	HCAR2_HUMAN	R	312	ENSP00000375066:C312R	ENSP00000375066:C312R	C	-	1	0	HCAR2	121752850	0.999000	0.42202	1.000000	0.80357	0.781000	0.44180	1.470000	0.35354	2.248000	0.74166	0.460000	0.39030	TGC	.	.		0.552	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370202.1	NM_177551	
HSPA2	3306	hgsc.bcm.edu	37	14	65008434	65008434	+	Silent	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr14:65008434G>A	ENST00000394709.1	+	2	943	c.867G>A	c.(865-867)tcG>tcA	p.S289S	HSPA2_ENST00000247207.6_Silent_p.S289S|RP11-973N13.4_ENST00000554918.1_RNA			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	289					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		AGATCGACTCGCTCTACGAGG	0.672																																					p.S289S	Pancreas(136;1211 1835 24894 31984 38227)	Atlas-SNP	.											.	HSPA2	83	.	0			c.G867A						.						20.0	20.0	20.0					14																	65008434		2201	4299	6500	SO:0001819	synonymous_variant	3306	exon1			CGACTCGCTCTAC	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.867G>A	chr14.hg19:g.65008434G>A		59.0	0.0		40.0	21.0	NM_021979	Q15508|Q53XM3|Q9UE78	Silent	SNP	ENST00000394709.1	hg19	CCDS9766.1																																																																																			.	.		0.672	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
LTBP2	4053	hgsc.bcm.edu	37	14	74988710	74988710	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr14:74988710C>A	ENST00000261978.4	-	17	3078	c.2692G>T	c.(2692-2694)Gga>Tga	p.G898*	LTBP2_ENST00000556690.1_Nonsense_Mutation_p.G898*	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	898	Cys-rich.|EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CGCCCTTTTCCCTTGCAGGGG	0.617																																					p.G898X		Atlas-SNP	.											.	LTBP2	158	.	0			c.G2692T						.						71.0	64.0	66.0					14																	74988710		2203	4300	6503	SO:0001587	stop_gained	4053	exon17			CTTTTCCCTTGCA		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2692G>T	chr14.hg19:g.74988710C>A	ENSP00000261978:p.Gly898*	103.0	0.0		96.0	16.0	NM_000428	Q99907|Q9NS51	Nonsense_Mutation	SNP	ENST00000261978.4	hg19	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	C	43	9.943815	0.99302	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	.	.	.	3.99	3.99	0.46301	.	0.189851	0.25616	N	0.029453	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	13.9681	0.64221	0.0:1.0:0.0:0.0	.	.	.	.	X	898	.	ENSP00000261978:G898X	G	-	1	0	LTBP2	74058463	0.998000	0.40836	0.220000	0.23810	0.691000	0.40173	5.806000	0.69150	2.214000	0.71695	0.462000	0.41574	GGA	.	.		0.617	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
FLRT2	23768	hgsc.bcm.edu	37	14	86089396	86089396	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr14:86089396C>A	ENST00000330753.4	+	2	2305	c.1538C>A	c.(1537-1539)aCc>aAc	p.T513N	FLRT2_ENST00000554746.1_Missense_Mutation_p.T513N	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	513	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TCAGAGGCCACCACCCATGCC	0.557																																					p.T513N		Atlas-SNP	.											.	FLRT2	168	.	0			c.C1538A						.						120.0	113.0	115.0					14																	86089396		2203	4300	6503	SO:0001583	missense	23768	exon2			AGGCCACCACCCA	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1538C>A	chr14.hg19:g.86089396C>A	ENSP00000332879:p.Thr513Asn	139.0	0.0		119.0	49.0	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	hg19	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401811	0.25291	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.55930	0.49;0.49	6.17	6.17	0.99709	.	0.201639	0.51477	D	0.000083	T	0.34774	0.0909	N	0.19112	0.55	0.37130	D	0.901206	B	0.33073	0.396	B	0.21360	0.034	T	0.36114	-0.9761	10	0.32370	T	0.25	-24.1914	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	513	O43155	FLRT2_HUMAN	N	513;513;166	ENSP00000332879:T513N;ENSP00000451050:T513N	ENSP00000332879:T513N	T	+	2	0	FLRT2	85159149	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	2.121000	0.41977	2.941000	0.99782	0.655000	0.94253	ACC	.	.		0.557	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
PRSS41	360226	hgsc.bcm.edu	37	16	2855034	2855034	+	RNA	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr16:2855034T>C	ENST00000399677.1	+	0	858							Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										CCAACATCAGTGTGTACTTCC	0.577																																					p.S286S		Atlas-SNP	.											.	.	.	.	0			c.T858C						.						214.0	178.0	189.0					16																	2855034		692	1591	2283			360226	exon5			CATCAGTGTGTAC			16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		chr16.hg19:g.2855034T>C		100.0	0.0		98.0	50.0	NM_001135086		Silent	SNP	ENST00000399677.1	hg19																																																																																				.	.		0.577	PRSS41-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000436450.1	NM_183379	
ITGAM	3684	hgsc.bcm.edu	37	16	31341476	31341476	+	Silent	SNP	C	C	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr16:31341476C>G	ENST00000287497.8	+	26	3126	c.3051C>G	c.(3049-3051)gcC>gcG	p.A1017A	ITGAM_ENST00000544665.3_Silent_p.A1018A			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1017					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						TTCGGAAGGCCCCCGTGGTGG	0.602																																					p.A1018A		Atlas-SNP	.											.	ITGAM	137	.	0			c.C3054G						.						30.0	32.0	32.0					16																	31341476		2020	4160	6180	SO:0001819	synonymous_variant	3684	exon26			GAAGGCCCCCGTG	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3051C>G	chr16.hg19:g.31341476C>G		97.0	0.0		67.0	27.0	NM_001145808	Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	ENST00000287497.8	hg19	CCDS45470.1																																																																																			.	.		0.602	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
FAM65A	79567	hgsc.bcm.edu	37	16	67579380	67579380	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr16:67579380G>C	ENST00000379312.3	+	18	3266	c.3145G>C	c.(3145-3147)Gtg>Ctg	p.V1049L	CTD-2012K14.4_ENST00000564717.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.V1064L|FAM65A_ENST00000042381.4_Missense_Mutation_p.V1045L|FAM65A_ENST00000422602.2_Missense_Mutation_p.V1065L|FAM65A_ENST00000428437.2_Missense_Mutation_p.V1059L	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	1049						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CTGGAGTTTTGTGGAAACCTT	0.612																																					p.V1065L		Atlas-SNP	.											.	FAM65A	104	.	0			c.G3193C						.						54.0	60.0	58.0					16																	67579380		2198	4300	6498	SO:0001583	missense	79567	exon18			AGTTTTGTGGAAA	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.3145G>C	chr16.hg19:g.67579380G>C	ENSP00000368614:p.Val1049Leu	169.0	0.0		113.0	54.0	NM_001193523	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	hg19	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.114|8.114	0.779446|0.779446	0.16120|0.16120	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|T;T;T	.|0.71934	.|-0.61;-0.61;-0.61	5.63|5.63	-1.82|-1.82	0.07857|0.07857	.|.	.|0.333489	.|0.31566	.|N	.|0.007440	T|T	0.28732|0.28732	0.0712|0.0712	N|N	0.01352|0.01352	-0.895|-0.895	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.22346	.|0.068;0.068;0.068	.|B;B;B	.|0.23150	.|0.044;0.044;0.044	T|T	0.27400|0.27400	-1.0075|-1.0075	5|10	.|0.13108	.|T	.|0.6	-1.6938|-1.6938	1.0646|1.0646	0.01608|0.01608	0.3738:0.0952:0.1936:0.3373|0.3738:0.0952:0.1936:0.3373	.|.	.|1059;1065;1049	.|B4DIM2;E9PBS3;Q6ZS17	.|.;.;FA65A_HUMAN	S|L	1038|1049;1045;1065;1059	.|ENSP00000368614:V1049L;ENSP00000042381:V1045L;ENSP00000400099:V1065L	.|ENSP00000042381:V1045L	C|V	+|+	2|1	0|0	FAM65A|FAM65A	66136881|66136881	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.714000|0.714000	0.41099|0.41099	-0.043000|-0.043000	0.12043|0.12043	-0.128000|-0.128000	0.11641|0.11641	0.655000|0.655000	0.94253|0.94253	TGT|GTG	.	.		0.612	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
PLA2G15	23659	hgsc.bcm.edu	37	16	68289848	68289848	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr16:68289848G>A	ENST00000219345.5	+	5	765	c.682G>A	c.(682-684)Gcg>Acg	p.A228T	PLA2G15_ENST00000413021.2_Missense_Mutation_p.A134T|RP11-96D1.7_ENST00000563175.1_RNA|PLA2G15_ENST00000566188.1_Missense_Mutation_p.C186Y|RP11-96D1.7_ENST00000569843.1_RNA|PLA2G15_ENST00000444212.2_Intron	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	228					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)			kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						GTCACTGGGTGCGCCCTGGGG	0.637																																					p.A228T		Atlas-SNP	.											.	PLA2G15	30	.	0			c.G682A						.						29.0	32.0	31.0					16																	68289848		2198	4300	6498	SO:0001583	missense	23659	exon5			CTGGGTGCGCCCT	AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.682G>A	chr16.hg19:g.68289848G>A	ENSP00000219345:p.Ala228Thr	88.0	0.0		85.0	36.0	NM_012320	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Missense_Mutation	SNP	ENST00000219345.5	hg19	CCDS10864.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662937	0.88251	.	.	ENSG00000103066	ENST00000413021;ENST00000219345	D;D	0.94687	-3.49;-3.49	5.61	4.65	0.58169	.	0.151409	0.64402	D	0.000014	D	0.95230	0.8453	L	0.48935	1.535	0.80722	D	1	D;D	0.69078	0.997;0.978	D;P	0.64776	0.929;0.875	D	0.93463	0.6812	10	0.20046	T	0.44	-30.5189	16.0158	0.80439	0.0:0.1413:0.8587:0.0	.	134;228	B4DUD1;Q8NCC3	.;PAG15_HUMAN	T	134;228	ENSP00000394197:A134T;ENSP00000219345:A228T	ENSP00000219345:A228T	A	+	1	0	PLA2G15	66847349	0.999000	0.42202	0.955000	0.39395	0.991000	0.79684	3.210000	0.51129	1.361000	0.45981	0.591000	0.81541	GCG	.	.		0.637	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268888.2	NM_012320	
ITGAE	3682	hgsc.bcm.edu	37	17	3664407	3664407	+	Silent	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:3664407A>G	ENST00000263087.4	-	6	596	c.498T>C	c.(496-498)ggT>ggC	p.G166G		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	166	X-domain (extra domain).				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CGTCTTCTCCACCGCCTTCTT	0.537																																					p.G166G	NSCLC(182;635 2928 8995 38788)	Atlas-SNP	.											.	ITGAE	96	.	0			c.T498C						.						207.0	197.0	200.0					17																	3664407		2203	4300	6503	SO:0001819	synonymous_variant	3682	exon6			TTCTCCACCGCCT	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.498T>C	chr17.hg19:g.3664407A>G		38.0	0.0		32.0	19.0	NM_002208	Q17RS6|Q9NZU9	Silent	SNP	ENST00000263087.4	hg19	CCDS32531.1																																																																																			.	.		0.537	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208	
ANKFY1	51479	hgsc.bcm.edu	37	17	4080548	4080548	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:4080548T>C	ENST00000341657.4	-	19	2683	c.2648A>G	c.(2647-2649)gAt>gGt	p.D883G	ANKFY1_ENST00000574367.1_Missense_Mutation_p.D884G|CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000570535.1_Missense_Mutation_p.D925G	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	883					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						ACTTTCAATATCAGAGTTCTG	0.473																																					p.D925G		Atlas-SNP	.											.	ANKFY1	81	.	0			c.A2774G						.						144.0	135.0	138.0					17																	4080548		1985	4164	6149	SO:0001583	missense	51479	exon19			TCAATATCAGAGT	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.2648A>G	chr17.hg19:g.4080548T>C	ENSP00000343362:p.Asp883Gly	190.0	0.0		140.0	71.0	NM_001257999	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	hg19		.	.	.	.	.	.	.	.	.	.	T	24.2	4.500281	0.85176	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	5.95	5.95	0.96441	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;1.0;1.0	D;D;D;D	0.87578	0.995;0.986;0.998;0.998	T	0.78422	-0.2210	9	0.46703	T	0.11	-26.3638	15.5912	0.76530	0.0:0.0:0.0:1.0	.	825;883;884;925	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	G	884;825	.	ENSP00000343362:D884G	D	-	2	0	ANKFY1	4027297	1.000000	0.71417	0.995000	0.50966	0.716000	0.41182	7.831000	0.86748	2.280000	0.76307	0.460000	0.39030	GAT	.	.		0.473	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
GGNBP2	79893	hgsc.bcm.edu	37	17	34945708	34945708	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:34945708A>G	ENST00000304718.4	+	14	2277	c.1961A>G	c.(1960-1962)aAt>aGt	p.N654S	DHRS11_ENST00000251312.5_5'Flank|DHRS11_ENST00000590554.1_5'Flank	NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	654					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTTATGGCTAATAACCAGTCT	0.358																																					p.N654S		Atlas-SNP	.											.	GGNBP2	72	.	0			c.A1961G						.						147.0	163.0	158.0					17																	34945708		2203	4300	6503	SO:0001583	missense	79893	exon14			TGGCTAATAACCA	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1961A>G	chr17.hg19:g.34945708A>G	ENSP00000307617:p.Asn654Ser	140.0	0.0		112.0	38.0	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	hg19	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	A	4.859	0.159701	0.09287	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.85	5.85	0.93711	.	0.207165	0.51477	D	0.000099	T	0.37679	0.1012	N	0.08118	0	0.80722	D	1	B	0.14012	0.009	B	0.15484	0.013	T	0.23440	-1.0188	9	0.41790	T	0.15	-19.1435	12.1411	0.53998	0.8573:0.1427:0.0:0.0	.	654	Q9H3C7	GGNB2_HUMAN	S	654	.	ENSP00000307617:N654S	N	+	2	0	GGNBP2	32019821	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.644000	0.54381	2.237000	0.73441	0.459000	0.35465	AAT	.	.		0.358	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
KRT20	54474	hgsc.bcm.edu	37	17	39036074	39036074	+	Silent	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:39036074A>G	ENST00000167588.3	-	5	950	c.909T>C	c.(907-909)caT>caC	p.H303H		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	303	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				CCATGCTGAGATGGGACTGGA	0.418																																					p.H303H		Atlas-SNP	.											.	KRT20	38	.	0			c.T909C						.						110.0	99.0	103.0					17																	39036074		2203	4300	6503	SO:0001819	synonymous_variant	54474	exon5			GCTGAGATGGGAC	BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.909T>C	chr17.hg19:g.39036074A>G		78.0	0.0		59.0	26.0	NM_019010	B2R6W7	Silent	SNP	ENST00000167588.3	hg19	CCDS11379.1																																																																																			.	.		0.418	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257202.2		
KRT38	8687	hgsc.bcm.edu	37	17	39593759	39593759	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:39593759A>T	ENST00000246646.3	-	7	1275	c.1276T>A	c.(1276-1278)Tgc>Agc	p.C426S		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	426	Tail.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				GCAGTCACGCAGGAGGGAGAC	0.622																																					p.C426S		Atlas-SNP	.											.	KRT38	63	.	0			c.T1276A						.						34.0	29.0	31.0					17																	39593759		2203	4299	6502	SO:0001583	missense	8687	exon7			TCACGCAGGAGGG	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.1276T>A	chr17.hg19:g.39593759A>T	ENSP00000246646:p.Cys426Ser	248.0	0.0		192.0	83.0	NM_006771	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	hg19	CCDS11392.1	.	.	.	.	.	.	.	.	.	.	.	6.670	0.492139	0.12702	.	.	ENSG00000171360	ENST00000246646	D	0.81579	-1.51	2.36	1.24	0.21308	.	0.254426	0.28230	N	0.016101	T	0.52869	0.1761	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34428	-0.9829	10	0.07990	T	0.79	.	4.5883	0.12294	0.7141:0.0:0.0:0.2859	.	426	O76015	KRT38_HUMAN	S	426	ENSP00000246646:C426S	ENSP00000246646:C426S	C	-	1	0	KRT38	36847285	0.365000	0.25006	0.009000	0.14445	0.226000	0.24999	0.932000	0.28884	0.331000	0.23511	0.459000	0.35465	TGC	.	.		0.622	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
PTRF	284119	hgsc.bcm.edu	37	17	40575009	40575009	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:40575009G>T	ENST00000357037.5	-	1	526	c.107C>A	c.(106-108)tCg>tAg	p.S36*		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		GCCGGCCCCCGACGGCTCCTC	0.672																																					p.S36X		Atlas-SNP	.											.	PTRF	48	.	0			c.C107A						.						18.0	18.0	18.0					17																	40575009		2196	4282	6478	SO:0001587	stop_gained	284119	exon1			GCCCCCGACGGCT	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.107C>A	chr17.hg19:g.40575009G>T	ENSP00000349541:p.Ser36*	126.0	0.0		110.0	47.0	NM_012232		Nonsense_Mutation	SNP	ENST00000357037.5	hg19	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	G	36	5.698984	0.96802	.	.	ENSG00000177469	ENST00000357037	.	.	.	5.13	5.13	0.70059	.	0.744958	0.11938	N	0.514971	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3283	13.9417	0.64059	0.0761:0.0:0.9239:0.0	.	.	.	.	X	36	.	ENSP00000349541:S36X	S	-	2	0	PTRF	37828535	0.905000	0.30787	1.000000	0.80357	0.546000	0.35178	2.121000	0.41977	2.373000	0.80994	0.561000	0.74099	TCG	.	.		0.672	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
PCYT2	5833	hgsc.bcm.edu	37	17	79862774	79862775	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:79862774_79862775CC>AG	ENST00000538936.2	-	13	1212_1213	c.1104_1105GG>CT	c.(1102-1107)ctGGcc>ctCTcc	p.A369S	PCYT2_ENST00000331285.3_Missense_Mutation_p.A291S|PCYT2_ENST00000570391.1_Missense_Mutation_p.A337S|PCYT2_ENST00000571105.1_Missense_Mutation_p.A347S|PCYT2_ENST00000538721.2_Missense_Mutation_p.A387S|PCYT2_ENST00000570388.1_Missense_Mutation_p.A291S	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	369					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	TCCAGGAAGGCCAGCTCCTTGG	0.668																																					p.A387S|p.L386L		Atlas-SNP	.											.	PCYT2	23	.	0			c.G1159T|c.G1158C						.																																			SO:0001583	missense	5833	exon14			GGAAGGCCAGCTC|GAAGGCCAGCTCC	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.1104_1105delinsAG	chr17.hg19:g.79862774_79862775delinsAG	ENSP00000439245:p.Ala369Ser	71.0|73.0	0.0		58.0|59.0	24.0	NM_001184917	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation|Silent	SNP	ENST00000538936.2	hg19	CCDS11791.1																																																																																			.	.		0.668	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	
ZNF750	79755	hgsc.bcm.edu	37	17	80789233	80789233	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr17:80789233G>T	ENST00000269394.3	-	2	1931	c.1098C>A	c.(1096-1098)aaC>aaA	p.N366K	TBCD_ENST00000355528.4_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_5'UTR	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	366					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GGTCCGAAGGGTTTAACCTGG	0.547																																					p.N366K		Atlas-SNP	.											.	ZNF750	60	.	0			c.C1098A						.						103.0	112.0	109.0					17																	80789233		2203	4300	6503	SO:0001583	missense	79755	exon2			CGAAGGGTTTAAC	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1098C>A	chr17.hg19:g.80789233G>T	ENSP00000269394:p.Asn366Lys	74.0	0.0		60.0	29.0	NM_024702	Q9H899	Missense_Mutation	SNP	ENST00000269394.3	hg19	CCDS11819.1	.	.	.	.	.	.	.	.	.	.	G	2.774	-0.254934	0.05829	.	.	ENSG00000141579	ENST00000269394	T	0.21932	1.98	4.61	0.0378	0.14198	.	0.278860	0.30159	N	0.010277	T	0.15912	0.0383	L	0.54323	1.7	0.09310	N	0.999998	B	0.32160	0.358	B	0.25140	0.058	T	0.15206	-1.0445	9	.	.	.	-20.6767	9.6525	0.39906	0.5044:0.0:0.4956:0.0	.	366	Q32MQ0	ZN750_HUMAN	K	366	ENSP00000269394:N366K	.	N	-	3	2	ZNF750	78382522	0.074000	0.21230	0.001000	0.08648	0.107000	0.19398	0.708000	0.25719	0.101000	0.17610	0.557000	0.71058	AAC	.	.		0.547	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702	
MUC16	94025	hgsc.bcm.edu	37	19	9056223	9056223	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:9056223C>T	ENST00000397910.4	-	3	31426	c.31223G>A	c.(31222-31224)gGa>gAa	p.G10408E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10410	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTCACTGTTCCCAGCTCAAC	0.478																																					p.G10408E		Atlas-SNP	.											.	MUC16	4315	.	0			c.G31223A						.						201.0	199.0	200.0					19																	9056223		2019	4185	6204	SO:0001583	missense	94025	exon3			ACTGTTCCCAGCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31223G>A	chr19.hg19:g.9056223C>T	ENSP00000381008:p.Gly10408Glu	106.0	0.0		71.0	27.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	7.977	0.750294	0.15778	.	.	ENSG00000181143	ENST00000397910	T	0.03553	3.89	3.94	-5.11	0.02901	.	.	.	.	.	T	0.01627	0.0052	N	0.12182	0.205	.	.	.	P	0.46142	0.873	B	0.36959	0.237	T	0.38564	-0.9655	8	0.87932	D	0	.	1.6852	0.02840	0.1438:0.2584:0.1411:0.4567	.	10408	B5ME49	.	E	10408	ENSP00000381008:G10408E	ENSP00000381008:G10408E	G	-	2	0	MUC16	8917223	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.018000	0.03626	-0.905000	0.03871	-0.890000	0.02929	GGA	.	.		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
COLGALT1	79709	hgsc.bcm.edu	37	19	17691643	17691643	+	Silent	SNP	G	G	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:17691643G>T	ENST00000252599.4	+	11	1650	c.1530G>T	c.(1528-1530)ctG>ctT	p.L510L		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	510					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										GCAAACTGCTGGCTGCTGAGC	0.637																																					p.L510L		Atlas-SNP	.											.	.	.	.	0			c.G1530T						.						67.0	61.0	63.0					19																	17691643		2203	4300	6503	SO:0001819	synonymous_variant	79709	exon11			ACTGCTGGCTGCT	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1530G>T	chr19.hg19:g.17691643G>T		69.0	0.0		60.0	30.0	NM_024656	Q8NC64	Silent	SNP	ENST00000252599.4	hg19	CCDS12363.1																																																																																			.	.		0.637	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656	
ZNF729	100287226	hgsc.bcm.edu	37	19	22496791	22496791	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:22496791T>A	ENST00000601693.1	+	4	690	c.572T>A	c.(571-573)aTg>aAg	p.M191K	ZNF729_ENST00000357491.6_Missense_Mutation_p.M191K			A6NN14	ZN729_HUMAN	zinc finger protein 729	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TCATTTTTCATGCTTTCATGC	0.284																																					p.M191K		Atlas-SNP	.											.	ZNF729	78	.	0			c.T572A						.																																			SO:0001583	missense	100287226	exon4			TTTTCATGCTTTC		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.572T>A	chr19.hg19:g.22496791T>A	ENSP00000469582:p.Met191Lys	18.0	0.0		20.0	12.0	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	1.402	-0.577761	0.03854	.	.	ENSG00000196350	ENST00000357491	T	0.59638	0.25	1.4	-2.8	0.05823	.	.	.	.	.	T	0.30262	0.0759	N	0.13352	0.335	.	.	.	.	.	.	.	.	.	T	0.22626	-1.0211	6	0.20046	T	0.44	.	2.5083	0.04650	0.4365:0.0:0.3304:0.2331	.	.	.	.	K	191	ENSP00000350085:M191K	ENSP00000350085:M191K	M	+	2	0	ZNF729	22288631	0.002000	0.14202	0.001000	0.08648	0.036000	0.12997	0.605000	0.24179	-0.615000	0.05679	0.254000	0.18369	ATG	.	.		0.284	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
MEGF8	1954	hgsc.bcm.edu	37	19	42880311	42880311	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:42880311A>G	ENST00000251268.6	+	42	7922	c.7922A>G	c.(7921-7923)cAg>cGg	p.Q2641R	MEGF8_ENST00000334370.4_Missense_Mutation_p.Q2574R|MEGF8_ENST00000378073.4_Missense_Mutation_p.Q235R	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2641					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TTCTTCCGGCAGGACCAGGCC	0.612																																					p.Q2641R		Atlas-SNP	.											.	MEGF8	358	.	0			c.A7922G						.						28.0	26.0	26.0					19																	42880311		2203	4298	6501	SO:0001583	missense	1954	exon42			TCCGGCAGGACCA	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7922A>G	chr19.hg19:g.42880311A>G	ENSP00000251268:p.Gln2641Arg	57.0	0.0		53.0	19.0	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	A	21.9	4.221361	0.79464	.	.	ENSG00000105429	ENST00000334370;ENST00000251268;ENST00000378073	T;T;T	0.42131	0.99;0.98;1.12	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000003	T	0.63438	0.2511	M	0.75884	2.315	0.80722	D	1	D;D;D	0.63880	0.989;0.993;0.989	D;D;D	0.72982	0.969;0.958;0.979	T	0.68398	-0.5419	10	0.87932	D	0	-4.1057	13.6587	0.62354	1.0:0.0:0.0:0.0	.	235;2641;2574	F5GZG7;Q7Z7M0;Q7Z7M0-2	.;MEGF8_HUMAN;.	R	2574;2641;235	ENSP00000334219:Q2574R;ENSP00000251268:Q2641R;ENSP00000367313:Q235R	ENSP00000251268:Q2641R	Q	+	2	0	MEGF8	47572151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.524000	0.90579	1.941000	0.56285	0.459000	0.35465	CAG	.	.		0.612	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
ZNF296	162979	hgsc.bcm.edu	37	19	45575426	45575426	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:45575426C>A	ENST00000303809.2	-	3	1075	c.861G>T	c.(859-861)caG>caT	p.Q287H		NM_145288.1	NP_660331.1	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	287					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|lung(3)|prostate(1)|urinary_tract(2)	7						TGAGGGGGCTCTGGGGCGGCA	0.697																																					p.Q287H		Atlas-SNP	.											.	ZNF296	22	.	0			c.G861T						.						31.0	40.0	37.0					19																	45575426		2198	4290	6488	SO:0001583	missense	162979	exon3			GGGGCTCTGGGGC	BC019352	CCDS12653.1	19q13.32	2013-01-08	2008-06-24	2008-06-24		ENSG00000170684		"""Zinc fingers, C2H2-type"""	15981	protein-coding gene	gene with protein product		613226	"""zinc finger protein 342"""	ZNF342		11063263, 14633674	Standard	NM_145288		Approved		uc002pao.3	Q8WUU4		ENST00000303809.2:c.861G>T	chr19.hg19:g.45575426C>A	ENSP00000302770:p.Gln287His	106.0	0.0		87.0	42.0	NM_145288		Missense_Mutation	SNP	ENST00000303809.2	hg19	CCDS12653.1	.	.	.	.	.	.	.	.	.	.	C	8.659	0.899976	0.17686	.	.	ENSG00000170684	ENST00000303809;ENST00000545481	T	0.05025	3.51	5.47	-2.97	0.05530	.	1.087690	0.07054	N	0.832555	T	0.05960	0.0155	N	0.24115	0.695	0.09310	N	1	P	0.48162	0.906	P	0.44732	0.459	T	0.43507	-0.9387	10	0.59425	D	0.04	-3.8448	9.6673	0.39992	0.0:0.401:0.0:0.599	.	287	Q8WUU4	ZN296_HUMAN	H	287;263	ENSP00000302770:Q287H	ENSP00000302770:Q287H	Q	-	3	2	ZNF296	50267266	0.000000	0.05858	0.015000	0.15790	0.000000	0.00434	-0.536000	0.06135	-0.323000	0.08602	-0.768000	0.03414	CAG	.	.		0.697	ZNF296-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457529.1	NM_145288	
KLK13	26085	hgsc.bcm.edu	37	19	51563812	51563812	+	Silent	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:51563812G>A	ENST00000595793.1	-	2	159	c.117C>T	c.(115-117)ggC>ggT	p.G39G	KLK13_ENST00000596955.1_Silent_p.G39G|KLK13_ENST00000595547.1_Silent_p.G39G|KLK13_ENST00000335422.3_Intron	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13	39	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		AGCAGGTGTAGCCACCTGGGA	0.567																																					p.G39G		Atlas-SNP	.											.	KLK13	40	.	0			c.C117T						.						100.0	104.0	102.0					19																	51563812		2203	4300	6503	SO:0001819	synonymous_variant	26085	exon2			GGTGTAGCCACCT		CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.117C>T	chr19.hg19:g.51563812G>A		147.0	0.0		131.0	8.0	NM_015596	A7UNK6|Q86VI8|Q9Y433	Silent	SNP	ENST00000595793.1	hg19	CCDS12822.1																																																																																			.	.		0.567	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464298.2	NM_015596	
ZNF471	57573	hgsc.bcm.edu	37	19	57027696	57027696	+	Missense_Mutation	SNP	A	A	C	rs150191675		TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:57027696A>C	ENST00000308031.5	+	3	219	c.86A>C	c.(85-87)cAa>cCa	p.Q29P	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Missense_Mutation_p.Q29P	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	29	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		GAAGAATGGCAATGGATGAAC	0.423																																					p.Q29P	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	Atlas-SNP	.											.	ZNF471	99	.	0			c.A86C						.						161.0	146.0	151.0					19																	57027696		2203	4300	6503	SO:0001583	missense	57573	exon3			AATGGCAATGGAT	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.86A>C	chr19.hg19:g.57027696A>C	ENSP00000309161:p.Gln29Pro	190.0	0.0		128.0	64.0	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	hg19	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.582547	0.28180	.	.	ENSG00000196263	ENST00000308031	T	0.01887	4.58	3.77	0.448	0.16614	Krueppel-associated box (4);	.	.	.	.	T	0.03053	0.0090	M	0.64260	1.97	0.09310	N	0.999996	B	0.31383	0.321	B	0.32677	0.15	T	0.39418	-0.9615	9	0.52906	T	0.07	.	4.0047	0.09595	0.596:0.1867:0.2173:0.0	.	29	Q9BX82	ZN471_HUMAN	P	29	ENSP00000309161:Q29P	ENSP00000309161:Q29P	Q	+	2	0	ZNF471	61719508	0.022000	0.18835	0.993000	0.49108	0.998000	0.95712	0.093000	0.15086	0.152000	0.19188	0.528000	0.53228	CAA	.	A|1.000;T|0.000		0.423	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ZNF606	80095	hgsc.bcm.edu	37	19	58489957	58489957	+	Silent	SNP	T	T	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr19:58489957T>C	ENST00000341164.4	-	7	2711	c.2091A>G	c.(2089-2091)gcA>gcG	p.A697A	ZNF606_ENST00000536132.1_Silent_p.A607A	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	697					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TTCTCCGGTGTGCAATGAGGT	0.408																																					p.A697A		Atlas-SNP	.											.	ZNF606	155	.	0			c.A2091G						.						99.0	98.0	99.0					19																	58489957		2203	4300	6503	SO:0001819	synonymous_variant	80095	exon7			CCGGTGTGCAATG	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2091A>G	chr19.hg19:g.58489957T>C		161.0	0.0		112.0	52.0	NM_025027	A8KAN2|Q8NE04|Q96JH5	Silent	SNP	ENST00000341164.4	hg19	CCDS12968.1																																																																																			.	.		0.408	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	NM_025027	
REM1	28954	hgsc.bcm.edu	37	20	30064277	30064277	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr20:30064277A>G	ENST00000201979.2	+	2	322	c.29A>G	c.(28-30)aAg>aGg	p.K10R	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	10					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CAGGAAGCAAAGACCCCTCTG	0.597																																					p.K10R		Atlas-SNP	.											.	REM1	54	.	0			c.A29G						.						103.0	117.0	112.0					20																	30064277		2203	4300	6503	SO:0001583	missense	28954	exon2			AAGCAAAGACCCC	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.29A>G	chr20.hg19:g.30064277A>G	ENSP00000201979:p.Lys10Arg	164.0	0.0		149.0	63.0	NM_014012	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	ENST00000201979.2	hg19	CCDS13181.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879027	0.33162	.	.	ENSG00000088320	ENST00000201979	T	0.65732	-0.17	4.55	4.55	0.56014	.	0.302146	0.25270	N	0.031896	T	0.39253	0.1071	N	0.17082	0.46	0.32009	N	0.60234	B	0.19445	0.036	B	0.15052	0.012	T	0.39292	-0.9621	10	0.14656	T	0.56	.	6.7031	0.23236	0.8966:0.0:0.1034:0.0	.	10	O75628	REM1_HUMAN	R	10	ENSP00000201979:K10R	ENSP00000201979:K10R	K	+	2	0	REM1	29527938	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.097000	0.57741	1.905000	0.55150	0.533000	0.62120	AAG	.	.		0.597	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012	
SLC12A5	57468	hgsc.bcm.edu	37	20	44678266	44678266	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr20:44678266A>T	ENST00000454036.2	+	17	2136	c.2087A>T	c.(2086-2088)cAg>cTg	p.Q696L	SLC12A5_ENST00000243964.3_Missense_Mutation_p.Q673L	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	696					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TTCAGGCCACAGCTGCTGGTG	0.567																																					p.Q696L		Atlas-SNP	.											.	SLC12A5	181	.	0			c.A2087T						.						48.0	37.0	41.0					20																	44678266		2203	4300	6503	SO:0001583	missense	57468	exon17			GGCCACAGCTGCT	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2087A>T	chr20.hg19:g.44678266A>T	ENSP00000387694:p.Gln696Leu	77.0	0.0		44.0	19.0	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	hg19	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.767447	0.49574	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.98862	-5.19;-5.19	4.34	4.34	0.51931	Amino acid permease domain (1);	0.151012	0.46145	D	0.000312	D	0.99432	0.9799	H	0.97896	4.1	0.80722	D	1	B;D	0.89917	0.081;1.0	B;D	0.91635	0.174;0.999	D	0.98264	1.0500	10	0.87932	D	0	.	12.4905	0.55897	1.0:0.0:0.0:0.0	.	696;673	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	L	696;673	ENSP00000387694:Q696L;ENSP00000243964:Q673L	ENSP00000243964:Q673L	Q	+	2	0	SLC12A5	44111673	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	9.097000	0.94193	1.812000	0.52913	0.377000	0.23210	CAG	.	.		0.567	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
PMEPA1	56937	hgsc.bcm.edu	37	20	56284608	56284608	+	Missense_Mutation	SNP	C	C	T	rs532526691		TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr20:56284608C>T	ENST00000341744.3	-	1	350	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	PMEPA1_ENST00000395816.3_Intron|PMEPA1_ENST00000472841.1_Intron|PMEPA1_ENST00000347215.4_Intron|PMEPA1_ENST00000265626.4_Intron	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	11					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						gcggcggcggcggTGCTGTTG	0.751													.|||	1	0.000199681	0.0	0.0	5008	,	,		3302	0.0		0.0	False		,,,				2504	0.001				p.A11T		Atlas-SNP	.											.	PMEPA1	29	.	0			c.G31A						.						21.0	18.0	19.0					20																	56284608		2097	4124	6221	SO:0001583	missense	56937	exon1			CGGCGGCGGTGCT	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.31G>A	chr20.hg19:g.56284608C>T	ENSP00000345826:p.Ala11Thr	90.0	0.0		80.0	4.0	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	ENST00000341744.3	hg19	CCDS13463.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739763	0.49045	.	.	ENSG00000124225	ENST00000341744;ENST00000395819	T;T	0.54279	0.84;0.58	2.87	2.87	0.33458	.	.	.	.	.	T	0.27900	0.0687	N	0.08118	0	0.80722	D	1	B	0.24576	0.106	B	0.11329	0.006	T	0.05971	-1.0853	9	0.14656	T	0.56	-6.3608	11.1595	0.48507	0.0:1.0:0.0:0.0	.	11	Q969W9	PMEPA_HUMAN	T	11	ENSP00000345826:A11T;ENSP00000379164:A11T	ENSP00000345826:A11T	A	-	1	0	PMEPA1	55718014	0.998000	0.40836	0.975000	0.42487	0.817000	0.46193	1.549000	0.36212	1.142000	0.42291	0.163000	0.16589	GCC	.	.		0.751	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
COL20A1	57642	hgsc.bcm.edu	37	20	61948009	61948009	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr20:61948009C>T	ENST00000358894.6	+	21	2729	c.2629C>T	c.(2629-2631)Ctc>Ttc	p.L877F	COL20A1_ENST00000326996.6_Missense_Mutation_p.L877F|COL20A1_ENST00000435874.1_Missense_Mutation_p.L884F|COL20A1_ENST00000422202.1_Missense_Mutation_p.L884F	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	877	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GACCTTCACGCTCTTCAAGGA	0.637																																					p.L877F		Atlas-SNP	.											.	COL20A1	137	.	0			c.C2629T						.						23.0	26.0	25.0					20																	61948009		1982	4133	6115	SO:0001583	missense	57642	exon21			TTCACGCTCTTCA	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2629C>T	chr20.hg19:g.61948009C>T	ENSP00000351767:p.Leu877Phe	52.0	0.0		43.0	5.0	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	hg19	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.824388	0.71143	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.01725	4.67;4.67;4.67;4.67	4.22	3.26	0.37387	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.081539	0.51477	D	0.000096	T	0.08582	0.0213	M	0.81497	2.545	0.40869	D	0.983893	D;D	0.63880	0.993;0.989	D;P	0.64506	0.926;0.845	T	0.01375	-1.1371	10	0.62326	D	0.03	.	10.629	0.45525	0.1926:0.8074:0.0:0.0	.	884;877	Q9P218-2;Q9P218	.;COKA1_HUMAN	F	877;877;884;884	ENSP00000351767:L877F;ENSP00000323077:L877F;ENSP00000408690:L884F;ENSP00000414753:L884F	ENSP00000323077:L877F	L	+	1	0	COL20A1	61418454	0.980000	0.34600	0.951000	0.38953	0.523000	0.34469	2.527000	0.45615	0.761000	0.33130	0.289000	0.19496	CTC	.	.		0.637	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
XBP1	7494	hgsc.bcm.edu	37	22	29196386	29196386	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr22:29196386G>A	ENST00000216037.6	-	1	199	c.127C>T	c.(127-129)Cag>Tag	p.Q43*	XBP1_ENST00000405219.3_5'Flank|CTA-292E10.6_ENST00000585003.1_RNA|CTA-292E10.6_ENST00000418292.1_RNA|CTA-292E10.6_ENST00000458080.1_RNA|XBP1_ENST00000344347.5_Nonsense_Mutation_p.Q43*|CTA-292E10.6_ENST00000451486.1_RNA|XBP1_ENST00000403532.3_Nonsense_Mutation_p.Q43*	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1	43					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						GCCCCTCTCTGGGCTGGCACC	0.761																																					p.Q43X		Atlas-SNP	.											.	XBP1	37	.	0			c.C127T						.						2.0	3.0	2.0					22																	29196386		1448	3100	4548	SO:0001587	stop_gained	7494	exon1			CTCTCTGGGCTGG	M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.127C>T	chr22.hg19:g.29196386G>A	ENSP00000216037:p.Gln43*	78.0	0.0		74.0	52.0	NM_001079539	Q8WYK6|Q969P1|Q96BD7	Nonsense_Mutation	SNP	ENST00000216037.6	hg19	CCDS13847.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724567	0.68959	.	.	ENSG00000100219	ENST00000216037;ENST00000403532;ENST00000344347	.	.	.	3.65	1.44	0.22558	.	0.440036	0.21629	N	0.071510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	8.0386	0.30508	0.0:0.1746:0.6451:0.1802	.	.	.	.	X	43	.	ENSP00000216037:Q43X	Q	-	1	0	XBP1	27526386	0.975000	0.34042	0.031000	0.17742	0.616000	0.37450	3.219000	0.51200	0.481000	0.27557	-0.309000	0.09137	CAG	.	.		0.761	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321274.1	NM_005080	
MAP3K15	389840	hgsc.bcm.edu	37	X	19416359	19416359	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chrX:19416359G>C	ENST00000338883.4	-	15	2050	c.2051C>G	c.(2050-2052)cCg>cGg	p.P684R	MAP3K15_ENST00000469203.2_Missense_Mutation_p.P516R|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Missense_Mutation_p.P119R	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	684	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					ATCTCTCTCCGGGATTTCTTT	0.547																																					p.P684R		Atlas-SNP	.											.	MAP3K15	108	.	0			c.C2051G						.						174.0	162.0	166.0					X																	19416359		2203	4300	6503	SO:0001583	missense	389840	exon15			CTCTCCGGGATTT	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2051C>G	chrX.hg19:g.19416359G>C	ENSP00000345629:p.Pro684Arg	49.0	0.0		38.0	35.0	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	hg19		.	.	.	.	.	.	.	.	.	.	G	22.1	4.244085	0.79912	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.64260	-0.09;-0.09;-0.09	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.100126	0.64402	D	0.000001	T	0.65037	0.2653	N	0.11818	0.18	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.69654	0.965;0.944	T	0.71048	-0.4705	10	0.51188	T	0.08	.	18.1681	0.89734	0.0:0.0:1.0:0.0	.	159;684	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	R	684;119;516	ENSP00000345629:P684R;ENSP00000352093:P119R;ENSP00000428356:P516R	ENSP00000345629:P684R	P	-	2	0	MAP3K15	19326280	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	9.382000	0.97209	2.227000	0.72691	0.519000	0.50382	CCG	.	.		0.547	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
ARMCX3	51566	hgsc.bcm.edu	37	X	100880445	100880445	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chrX:100880445T>A	ENST00000341189.4	+	5	1342	c.476T>A	c.(475-477)aTt>aAt	p.I159N	RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3_ENST00000537169.1_Missense_Mutation_p.I159N|ARMCX3_ENST00000471229.2_Missense_Mutation_p.I159N|ARMCX3-AS1_ENST00000454228.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	159					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						AGAGATATTATTCGTGATCTG	0.393																																					p.I159N		Atlas-SNP	.											.	ARMCX3	33	.	0			c.T476A						.						84.0	82.0	83.0					X																	100880445		2203	4297	6500	SO:0001583	missense	51566	exon5			ATATTATTCGTGA	AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.476T>A	chrX.hg19:g.100880445T>A	ENSP00000340672:p.Ile159Asn	115.0	0.0		188.0	89.0	NM_016607	Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	hg19	CCDS14489.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620372	0.46736	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.42900	0.96;0.96	4.29	4.29	0.51040	Armadillo-like helical (1);Armadillo-type fold (1);	0.048223	0.85682	D	0.000000	T	0.53722	0.1814	L	0.49571	1.57	0.45035	D	0.998057	D	0.89917	1.0	D	0.97110	1.0	T	0.51379	-0.8713	9	.	.	.	-19.302	8.882	0.35380	0.0:0.0:0.0:1.0	.	159	Q9UH62	ARMX3_HUMAN	N	159	ENSP00000340672:I159N;ENSP00000439032:I159N	.	I	+	2	0	ARMCX3	100767101	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.714000	0.47202	1.919000	0.55581	0.430000	0.28490	ATT	.	.		0.393	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607	
GPR101	83550	hgsc.bcm.edu	37	X	136113550	136113550	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chrX:136113550A>G	ENST00000298110.1	-	1	283	c.284T>C	c.(283-285)cTc>cCc	p.L95P		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					GGGCCAGAAGAGAGGCACAGA	0.597																																					p.L95P		Atlas-SNP	.											.	GPR101	96	.	0			c.T284C						.						56.0	48.0	51.0					X																	136113550		2203	4300	6503	SO:0001583	missense	83550	exon1			CAGAAGAGAGGCA	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.284T>C	chrX.hg19:g.136113550A>G	ENSP00000298110:p.Leu95Pro	67.0	0.0		126.0	122.0	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	hg19	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	A	6.684	0.494762	0.12702	.	.	ENSG00000165370	ENST00000298110	T	0.19806	2.12	4.85	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.14227	0.0344	L	0.33137	0.985	0.21064	N	0.999796	B	0.15141	0.012	B	0.16722	0.016	T	0.21895	-1.0232	9	0.66056	D	0.02	-3.8782	1.7199	0.02909	0.5246:0.0:0.189:0.2864	.	95	Q96P66	GP101_HUMAN	P	95	ENSP00000298110:L95P	ENSP00000298110:L95P	L	-	2	0	GPR101	135941216	0.051000	0.20477	0.885000	0.34714	0.995000	0.86356	0.615000	0.24329	1.595000	0.50050	0.441000	0.28932	CTC	.	.		0.597	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
ABCA12	26154	hgsc.bcm.edu	37	2	215880217	215880217	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr2:215880217delG	ENST00000272895.7	-	15	2172	c.1953delC	c.(1951-1953)tacfs	p.Y651fs	ABCA12_ENST00000389661.4_Frame_Shift_Del_p.Y333fs	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	651				Y -> D (in Ref. 1; AAP21093). {ECO:0000305}.	cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AACTTGCCTTGTATGTGAAGT	0.358																																					p.K652fs	Ovarian(66;664 1488 5121 34295)	Atlas-INDEL	.											.	ABCA12	368	.	0			c.1954delA						.						76.0	73.0	74.0					2																	215880217		2203	4300	6503	SO:0001589	frameshift_variant	26154	exon15			.	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1953delC	chr2.hg19:g.215880217delG	ENSP00000272895:p.Tyr651fs	161.0	0.0		110.0	52.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Frame_Shift_Del	DEL	ENST00000272895.7	hg19	CCDS33372.1																																																																																			.	.		0.358	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
DLEC1	9940	hgsc.bcm.edu	37	3	38127869	38127870	+	Splice_Site	DEL	GT	GT	-			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr3:38127869_38127870delGT	ENST00000308059.6	+	9	1593		c.e9+1		DLEC1_ENST00000452631.2_Splice_Site|DLEC1_ENST00000346219.3_Splice_Site					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AAGTTTCAAGGTGAGTGATCAC	0.431																																					p.524_524del		Atlas-INDEL	.											.	DLEC1	278	.	0			c.1572_1572del						.																																			SO:0001630	splice_region_variant	9940	exon9			.	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1572+1GT>-	chr3.hg19:g.38127869_38127870delGT		138.0	0.0		88.0	40.0	NM_007335		Frame_Shift_Del	DEL	ENST00000308059.6	hg19	CCDS2672.2																																																																																			.	.		0.431	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	Intron
RPLP0	6175	hgsc.bcm.edu	37	12	120634712	120634715	+	Frame_Shift_Del	DEL	GATG	GATG	-			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	GATG	GATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chr12:120634712_120634715delGATG	ENST00000551150.1	-	7	1130_1133	c.815_818delCATC	c.(814-819)ccatctfs	p.PS272fs	RPLP0_ENST00000552292.1_Frame_Shift_Del_p.PS62fs|RPLP0_ENST00000550296.1_5'Flank|RPLP0_ENST00000392514.4_Frame_Shift_Del_p.PS272fs|GCN1L1_ENST00000300648.6_5'Flank|RPLP0_ENST00000228306.4_Frame_Shift_Del_p.PS272fs|RPLP0_ENST00000546989.1_Frame_Shift_Del_p.PS236fs|RPLP0_ENST00000313104.5_Frame_Shift_Del_p.PS210fs			P05388	RLA0_HUMAN	ribosomal protein, large, P0	272					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACAAAGGCAGATGGATCAGCCAA	0.578																																					p.272_273del		Atlas-INDEL	.											.	RPLP0	27	.	0			c.816_819del						.																																			SO:0001589	frameshift_variant	6175	exon8			.	AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.815_818delCATC	chr12.hg19:g.120634712_120634715delGATG	ENSP00000449328:p.Pro272fs	367.0	0.0		236.0	81.0	NM_053275	Q3B7A4|Q9BVK4	Frame_Shift_Del	DEL	ENST00000551150.1	hg19	CCDS9193.1																																																																																			.	.		0.578	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403448.3	NM_053275	
PLP1	5354	hgsc.bcm.edu	37	X	103041449	103041449	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAVY-01A-11D-A40R-10	TCGA-DD-AAVY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5a40648e-66fb-456f-bb65-eb211084f42c	6cc223ac-a900-47e6-95c6-bef64dca1158	g.chrX:103041449delG	ENST00000303958.2	+	3	393	c.247delG	c.(247-249)gggfs	p.G83fs	PLP1_ENST00000361621.2_Frame_Shift_Del_p.G83fs|PLP1_ENST00000418604.1_Frame_Shift_Del_p.G83fs	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	83					astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						CTTCCTTTATGGGGCCCTCCT	0.522																																					p.Y82X		Atlas-INDEL	.											.	PLP1	37	.	0			c.246delT						.						120.0	114.0	116.0					X																	103041449		2203	4300	6503	SO:0001589	frameshift_variant	5354	exon3			.	M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.247delG	chrX.hg19:g.103041449delG	ENSP00000305152:p.Gly83fs	198.0	0.0		239.0	110.0	NM_199478	P04400|P06905|Q502Y1|Q6FHZ6	Frame_Shift_Del	DEL	ENST00000303958.2	hg19	CCDS14513.1																																																																																			.	.		0.522	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057743.2		
