#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD2	57540	hgsc.bcm.edu	37	1	11591031	11591031	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:11591031A>T	ENST00000294484.6	+	16	3308	c.3170A>T	c.(3169-3171)aAg>aTg	p.K1057M	PTCHD2_ENST00000304391.6_5'Flank|PTCHD2_ENST00000389575.3_Missense_Mutation_p.K1057M	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1057					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CACCTCTGCAAGGCCATCGCA	0.622																																					p.K1057M		Atlas-SNP	.											.	PTCHD2	193	.	0			c.A3170T						.						88.0	101.0	97.0					1																	11591031		2078	4203	6281	SO:0001583	missense	57540	exon16			TCTGCAAGGCCAT	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3170A>T	chr1.hg19:g.11591031A>T	ENSP00000294484:p.Lys1057Met	70.0	0.0		80.0	35.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	hg19	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.247580	0.80024	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.92699	-3.04;-3.09	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.93278	0.7858	L	0.32530	0.975	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.94154	0.7408	10	0.87932	D	0	-27.4336	13.8596	0.63552	1.0:0.0:0.0:0.0	.	1057	Q9P2K9	PTHD2_HUMAN	M	1057	ENSP00000294484:K1057M;ENSP00000374226:K1057M	ENSP00000294484:K1057M	K	+	2	0	PTCHD2	11513618	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	9.078000	0.94023	1.878000	0.54408	0.482000	0.46254	AAG	.	.		0.622	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
ZBTB17	7709	hgsc.bcm.edu	37	1	16271442	16271442	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:16271442T>C	ENST00000375743.4	-	7	1149	c.917A>G	c.(916-918)cAc>cGc	p.H306R	ZBTB17_ENST00000375733.2_Missense_Mutation_p.H306R|ZBTB17_ENST00000537142.1_Missense_Mutation_p.H224R|ZBTB17_ENST00000448462.2_Missense_Mutation_p.H243R|ZBTB17_ENST00000479282.1_5'Flank	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	306	Interaction with MYC.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CTCGCACTTGTGGATGACGGA	0.716																																					p.H306R		Atlas-SNP	.											.	ZBTB17	45	.	0			c.A917G						.						28.0	33.0	31.0					1																	16271442		2197	4292	6489	SO:0001583	missense	7709	exon7			CACTTGTGGATGA	U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.917A>G	chr1.hg19:g.16271442T>C	ENSP00000364895:p.His306Arg	32.0	0.0		33.0	14.0	NM_003443	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	ENST00000375743.4	hg19	CCDS165.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414375	0.83449	.	.	ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142;ENST00000448462	T;T;T;T	0.77750	-1.12;-1.12;-1.12;1.55	5.06	3.88	0.44766	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.80854	0.4703	L	0.34521	1.04	0.54753	D	0.99998	D;D;D;D;D;D	0.89917	0.991;0.978;0.996;0.999;1.0;0.997	D;D;D;D;D;D	0.80764	0.989;0.942;0.99;0.971;0.994;0.915	T	0.82559	-0.0397	10	0.72032	D	0.01	.	11.9656	0.53033	0.0:0.0:0.1448:0.8552	.	230;243;306;224;306;306	B4DYU5;E7EPQ4;Q13105-2;F5H411;B2RCP2;Q13105	.;.;.;.;.;ZBT17_HUMAN	R	306;306;225;224;243	ENSP00000364895:H306R;ENSP00000364885:H306R;ENSP00000438529:H224R;ENSP00000391002:H243R	ENSP00000364885:H306R	H	-	2	0	ZBTB17	16144029	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.819000	0.62664	1.898000	0.54952	0.459000	0.35465	CAC	.	.		0.716	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	NM_003443	
PADI4	23569	hgsc.bcm.edu	37	1	17690224	17690224	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:17690224T>A	ENST00000375448.4	+	16	1992	c.1966T>A	c.(1966-1968)Ttc>Atc	p.F656I		NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	656					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	GCCCTTCTCCTTCAAGTGGTG	0.597																																					p.F656I		Atlas-SNP	.											.	PADI4	70	.	0			c.T1966A						.						82.0	68.0	73.0					1																	17690224		2203	4300	6503	SO:0001583	missense	23569	exon16			TTCTCCTTCAAGT	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1966T>A	chr1.hg19:g.17690224T>A	ENSP00000364597:p.Phe656Ile	134.0	0.0		129.0	52.0	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	hg19	CCDS180.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.952279	0.73787	.	.	ENSG00000159339	ENST00000375448	T	0.32753	1.44	4.62	3.46	0.39613	Protein-arginine deiminase, C-terminal (1);	0.123147	0.56097	D	0.000036	T	0.52092	0.1713	M	0.92459	3.31	0.33086	D	0.537281	D	0.53619	0.961	P	0.55508	0.777	T	0.65623	-0.6123	10	0.59425	D	0.04	-25.0211	5.6269	0.17487	0.0:0.0899:0.174:0.736	.	656	Q9UM07	PADI4_HUMAN	I	656	ENSP00000364597:F656I	ENSP00000364597:F656I	F	+	1	0	PADI4	17562811	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	3.157000	0.50716	0.691000	0.31592	0.459000	0.35465	TTC	.	.		0.597	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
PAX7	5081	hgsc.bcm.edu	37	1	19018334	19018334	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:19018334A>T	ENST00000375375.3	+	5	1271	c.673A>T	c.(673-675)Acg>Tcg	p.T225S	PAX7_ENST00000400661.3_Missense_Mutation_p.T223S|PAX7_ENST00000420770.2_Missense_Mutation_p.T225S	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	225					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GACCACATTCACGGCCGAGCA	0.627			T	FOXO1A	alveolar rhabdomyosarcoma																																p.T225S		Atlas-SNP	.		Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	PAX7	127	.	0			c.A673T						.						42.0	36.0	38.0					1																	19018334		2202	4300	6502	SO:0001583	missense	5081	exon5			ACATTCACGGCCG	X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.673A>T	chr1.hg19:g.19018334A>T	ENSP00000364524:p.Thr225Ser	158.0	0.0		165.0	53.0	NM_002584	E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	ENST00000375375.3	hg19	CCDS186.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406392	0.83230	.	.	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.96774	-4.12;-4.12;-4.12	4.98	4.98	0.66077	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95771	0.8624	N	0.22421	0.69	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.996;0.994;0.999	D	0.94598	0.7793	10	0.27082	T	0.32	.	13.4979	0.61436	1.0:0.0:0.0:0.0	.	225;223;225	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	S	225;225;223	ENSP00000364524:T225S;ENSP00000403389:T225S;ENSP00000383502:T223S	ENSP00000364524:T225S	T	+	1	0	PAX7	18890921	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.297000	0.96120	1.875000	0.54330	0.533000	0.62120	ACG	.	.		0.627	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
CSMD2	114784	hgsc.bcm.edu	37	1	33985196	33985196	+	Silent	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:33985196G>A	ENST00000373381.4	-	70	10994	c.10818C>T	c.(10816-10818)taC>taT	p.Y3606Y		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3462						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGTTGCGGTCGTACATTGGGT	0.557																																					p.Y3462Y		Atlas-SNP	.											.	CSMD2	946	.	0			c.C10386T						.						320.0	270.0	287.0					1																	33985196		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon69			GCGGTCGTACATT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10818C>T	chr1.hg19:g.33985196G>A		73.0	0.0		124.0	55.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	hg19																																																																																				.	.		0.557	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
SLC2A1	6513	hgsc.bcm.edu	37	1	43393339	43393339	+	Silent	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:43393339G>A	ENST00000426263.3	-	9	1393	c.1215C>T	c.(1213-1215)gcC>gcT	p.A405A	SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	405			A -> D (in GLUT1DS1). {ECO:0000269|PubMed:20129935}.		carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	AGCCTGCAACGGCAATGGCAG	0.552																																					p.A405A		Atlas-SNP	.											.	SLC2A1	36	.	0			c.C1215T						.						69.0	65.0	66.0					1																	43393339		2203	4300	6503	SO:0001819	synonymous_variant	6513	exon9			TGCAACGGCAATG	K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.1215C>T	chr1.hg19:g.43393339G>A		179.0	0.0		213.0	88.0	NM_006516	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	ENST00000426263.3	hg19	CCDS477.1																																																																																			.	.		0.552	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020358.2	NM_006516	
CYP4B1	1580	hgsc.bcm.edu	37	1	47278257	47278257	+	Missense_Mutation	SNP	T	T	A	rs539678720		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:47278257T>A	ENST00000271153.4	+	4	493	c.457T>A	c.(457-459)Tat>Aat	p.Y153N	CYP4B1_ENST00000371923.4_Missense_Mutation_p.Y153N|CYP4B1_ENST00000371919.4_Missense_Mutation_p.Y138N|CYP4B1_ENST00000452782.2_De_novo_Start_OutOfFrame			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	153					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GCTGAAGCCCTATGTGGCCGT	0.592																																					p.Y153N		Atlas-SNP	.											.	CYP4B1	81	.	0			c.T457A						.						163.0	132.0	143.0					1																	47278257		2203	4300	6503	SO:0001583	missense	1580	exon4			AAGCCCTATGTGG	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.457T>A	chr1.hg19:g.47278257T>A	ENSP00000271153:p.Tyr153Asn	118.0	0.0		128.0	41.0	NM_000779	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	hg19	CCDS542.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.800886	0.90538	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919	T;T;T	0.70282	-0.47;-0.47;-0.47	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	M	0.90705	3.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;0.998	D	0.89728	0.3924	10	0.87932	D	0	.	16.3337	0.83051	0.0:0.0:0.0:1.0	.	138;153;153	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	N	153;153;138	ENSP00000360991:Y153N;ENSP00000271153:Y153N;ENSP00000360987:Y138N	ENSP00000271153:Y153N	Y	+	1	0	CYP4B1	47050844	1.000000	0.71417	0.994000	0.49952	0.853000	0.48598	5.968000	0.70413	2.260000	0.74910	0.482000	0.46254	TAT	.	.		0.592	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
PYGO2	90780	hgsc.bcm.edu	37	1	154931788	154931788	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:154931788G>A	ENST00000368457.2	-	3	859	c.688C>T	c.(688-690)Cct>Tct	p.P230S	RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000483463.1_5'Flank|PYGO2_ENST00000368456.1_Missense_Mutation_p.P193S	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	230	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCCTGACCAGGTCTCTGGAGA	0.637																																					p.P230S	NSCLC(87;357 1460 1955 21029 23522)	Atlas-SNP	.											.	PYGO2	32	.	0			c.C688T						.						28.0	33.0	31.0					1																	154931788		2203	4300	6503	SO:0001583	missense	90780	exon3			GACCAGGTCTCTG	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.688C>T	chr1.hg19:g.154931788G>A	ENSP00000357442:p.Pro230Ser	124.0	0.0		211.0	119.0	NM_138300	Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	hg19	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	G	7.696	0.691987	0.15039	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.43294	0.95;0.97	4.72	4.72	0.59763	.	0.475485	0.19349	N	0.116460	T	0.30355	0.0762	N	0.19112	0.55	0.39525	D	0.968574	D	0.69078	0.997	P	0.57911	0.829	T	0.03259	-1.1055	10	0.22109	T	0.4	-3.6966	14.7378	0.69430	0.0:0.0:1.0:0.0	.	230	Q9BRQ0	PYGO2_HUMAN	S	230;193	ENSP00000357442:P230S;ENSP00000357441:P193S	ENSP00000357441:P193S	P	-	1	0	PYGO2	153198412	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.146000	0.64845	2.454000	0.82982	0.462000	0.41574	CCT	.	.		0.637	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300	
CLK2	1196	hgsc.bcm.edu	37	1	155239305	155239305	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:155239305T>A	ENST00000368361.4	-	3	688	c.373A>T	c.(373-375)Agc>Tgc	p.S125C	CLK2_ENST00000536801.1_Missense_Mutation_p.S125C|CLK2_ENST00000355560.4_Missense_Mutation_p.S124C|CLK2_ENST00000497188.1_5'Flank|CLK2_ENST00000361168.5_Missense_Mutation_p.S125C			P49760	CLK2_HUMAN	CDC-like kinase 2	125					negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AATGTCCGGCTGCGCCTCCTC	0.592								Other conserved DNA damage response genes																													p.S125C		Atlas-SNP	.											.	CLK2	55	.	0			c.A373T						.						71.0	65.0	67.0					1																	155239305		2203	4300	6503	SO:0001583	missense	1196	exon3			TCCGGCTGCGCCT	L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.373A>T	chr1.hg19:g.155239305T>A	ENSP00000357345:p.Ser125Cys	47.0	0.0		77.0	46.0	NM_003993	B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	ENST00000368361.4	hg19		.	.	.	.	.	.	.	.	.	.	.	19.80	3.895106	0.72639	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000536801	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	4.96	4.96	0.65561	.	0.583777	0.19910	N	0.103315	T	0.31638	0.0803	N	0.21282	0.65	0.49483	D	0.999798	P;D	0.54964	0.947;0.969	B;P	0.47162	0.339;0.54	T	0.08932	-1.0698	10	0.34782	T	0.22	.	13.6318	0.62200	0.0:0.0:0.0:1.0	.	125;125	P49760;P49760-3	CLK2_HUMAN;.	C	125;125;124;125	ENSP00000354856:S125C;ENSP00000357345:S125C;ENSP00000347759:S124C;ENSP00000441023:S125C	ENSP00000347759:S124C	S	-	1	0	CLK2	153505929	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.637000	0.83313	2.099000	0.63709	0.529000	0.55759	AGC	.	.		0.592	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000087391.1	NM_003993	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161021132	161021132	+	Silent	SNP	A	A	T	rs144785706	byFrequency	TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:161021132A>T	ENST00000368013.3	-	10	1712	c.1392T>A	c.(1390-1392)ccT>ccA	p.P464P	ARHGAP30_ENST00000368015.1_Silent_p.P287P|ARHGAP30_ENST00000368016.3_Silent_p.P464P	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	464					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			ggccagggccagggccagggc	0.622																																					p.P464P		Atlas-SNP	.											.	ARHGAP30	105	.	0			c.T1392A						.						30.0	32.0	31.0					1																	161021132		2203	4299	6502	SO:0001819	synonymous_variant	257106	exon10			AGGGCCAGGGCCA	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.1392T>A	chr1.hg19:g.161021132A>T		66.0	0.0		103.0	33.0	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	ENST00000368013.3	hg19	CCDS30918.1																																																																																			.	A|0.999;G|0.001		0.622	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
MROH9	80133	hgsc.bcm.edu	37	1	170967477	170967477	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:170967477C>A	ENST00000367758.3	+	15	1757	c.1658C>A	c.(1657-1659)tCa>tAa	p.S553*	MROH9_ENST00000367759.4_Intron	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	553																	AAATTTAAATCAAAATTCCAG	0.388																																					p.S553X		Atlas-SNP	.											.	.	.	.	0			c.C1658A						.						184.0	161.0	168.0					1																	170967477		1834	4085	5919	SO:0001587	stop_gained	80133	exon15			TTAAATCAAAATT	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1658C>A	chr1.hg19:g.170967477C>A	ENSP00000356732:p.Ser553*	61.0	0.0		91.0	28.0	NM_025063	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Nonsense_Mutation	SNP	ENST00000367758.3	hg19	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552741	0.65425	.	.	ENSG00000117501	ENST00000367758	.	.	.	3.5	0.416	0.16416	.	1.170700	0.06403	N	0.719257	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.8232	5.62	0.17451	0.0:0.6075:0.0:0.3925	.	.	.	.	X	553	.	ENSP00000356732:S553X	S	+	2	0	C1orf129	169234101	0.001000	0.12720	0.000000	0.03702	0.031000	0.12232	1.013000	0.29937	-0.018000	0.14079	0.446000	0.29264	TCA	.	.		0.388	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	
TNN	63923	hgsc.bcm.edu	37	1	175053028	175053028	+	Silent	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:175053028T>A	ENST00000239462.4	+	5	1304	c.1191T>A	c.(1189-1191)acT>acA	p.T397T		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	397	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CTGAGGTCACTGTGCCCAAGA	0.532																																					p.T397T		Atlas-SNP	.											.	TNN	297	.	0			c.T1191A						.						133.0	108.0	116.0					1																	175053028		2203	4300	6503	SO:0001819	synonymous_variant	63923	exon5			GGTCACTGTGCCC	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1191T>A	chr1.hg19:g.175053028T>A		93.0	0.0		140.0	85.0	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	hg19	CCDS30943.1																																																																																			.	.		0.532	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
KIF14	9928	hgsc.bcm.edu	37	1	200558393	200558393	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:200558393T>C	ENST00000367350.4	-	18	3504	c.3066A>G	c.(3064-3066)atA>atG	p.I1022M		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1022	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TGTTGACATATATTTCCTGTT	0.323																																					p.I1022M		Atlas-SNP	.											.	KIF14	156	.	0			c.A3066G						.						158.0	149.0	152.0					1																	200558393		2202	4300	6502	SO:0001583	missense	9928	exon18			GACATATATTTCC	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.3066A>G	chr1.hg19:g.200558393T>C	ENSP00000356319:p.Ile1022Met	89.0	0.0		122.0	70.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	hg19	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	T	13.06	2.123903	0.37533	.	.	ENSG00000118193	ENST00000367350	T	0.17054	2.3	5.25	-7.71	0.01254	.	0.360755	0.24630	N	0.036888	T	0.10078	0.0247	L	0.58101	1.795	0.09310	N	1	B	0.27625	0.183	B	0.25884	0.064	T	0.11616	-1.0580	10	0.48119	T	0.1	.	2.0133	0.03493	0.2909:0.2749:0.3139:0.1203	.	1022	Q15058	KIF14_HUMAN	M	1022	ENSP00000356319:I1022M	ENSP00000356319:I1022M	I	-	3	3	KIF14	198825016	0.000000	0.05858	0.000000	0.03702	0.946000	0.59487	-1.756000	0.01813	-1.000000	0.03438	0.454000	0.30748	ATA	.	.		0.323	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
SMYD2	56950	hgsc.bcm.edu	37	1	214504364	214504364	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr1:214504364A>T	ENST00000366957.5	+	9	910	c.888A>T	c.(886-888)agA>agT	p.R296S	SMYD2_ENST00000491455.1_3'UTR|SMYD2_ENST00000415093.2_Intron	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	296					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		ACATGGTCAGATATGCACGCA	0.507																																					p.R296S		Atlas-SNP	.											.	SMYD2	40	.	0			c.A888T						.						138.0	135.0	136.0					1																	214504364		2203	4300	6503	SO:0001583	missense	56950	exon9			GGTCAGATATGCA	AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.888A>T	chr1.hg19:g.214504364A>T	ENSP00000355924:p.Arg296Ser	156.0	0.0		177.0	52.0	NM_020197	B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Missense_Mutation	SNP	ENST00000366957.5	hg19	CCDS31022.1	.	.	.	.	.	.	.	.	.	.	A	17.13	3.310795	0.60414	.	.	ENSG00000143499	ENST00000366957;ENST00000416415	T	0.17528	2.27	5.84	2.32	0.28847	.	0.687749	0.15232	N	0.273343	T	0.10637	0.0260	L	0.36672	1.1	0.80722	D	1	B;B	0.26902	0.068;0.163	B;B	0.18263	0.011;0.021	T	0.14090	-1.0485	10	0.08599	T	0.76	-1.9832	8.1984	0.31411	0.781:0.0:0.219:0.0	.	296;280	Q9NRG4;Q05C86	SMYD2_HUMAN;.	S	296;15	ENSP00000355924:R296S	ENSP00000355924:R296S	R	+	3	2	SMYD2	212570987	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	1.064000	0.30579	0.148000	0.19059	0.533000	0.62120	AGA	.	.		0.507	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089998.1	NM_020197	
PXDN	7837	hgsc.bcm.edu	37	2	1652300	1652300	+	Silent	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:1652300C>T	ENST00000252804.4	-	17	3302	c.3252G>A	c.(3250-3252)ctG>ctA	p.L1084L		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1084					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGTTCTCGTCCAGCCGGTAAA	0.577																																					p.L1084L		Atlas-SNP	.											.	PXDN	255	.	0			c.G3252A						.						47.0	57.0	54.0					2																	1652300		2163	4263	6426	SO:0001819	synonymous_variant	7837	exon17			CTCGTCCAGCCGG	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3252G>A	chr2.hg19:g.1652300C>T		70.0	0.0		75.0	32.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	hg19	CCDS46221.1																																																																																			.	.		0.577	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
DNAJC27	51277	hgsc.bcm.edu	37	2	25179973	25179973	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:25179973T>G	ENST00000264711.2	-	5	656	c.467A>C	c.(466-468)aAa>aCa	p.K156T	DNAJC27_ENST00000468467.1_5'Flank|DNAJC27_ENST00000534855.1_Missense_Mutation_p.K85T	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	156					small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CAGGAACCCTTTGCTTTCAGC	0.423																																					p.K156T		Atlas-SNP	.											.	DNAJC27	37	.	0			c.A467C						.						154.0	145.0	148.0					2																	25179973		2203	4300	6503	SO:0001583	missense	51277	exon5			AACCCTTTGCTTT		CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.467A>C	chr2.hg19:g.25179973T>G	ENSP00000264711:p.Lys156Thr	118.0	0.0		127.0	50.0	NM_016544	Q5JV88|Q86Y24	Missense_Mutation	SNP	ENST00000264711.2	hg19	CCDS1716.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.020881	0.54576	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	T;T	0.76968	-1.06;-0.8	5.8	-0.989	0.10242	Small GTP-binding protein domain (1);	0.216129	0.53938	D	0.000056	T	0.74253	0.3692	M	0.65498	2.005	0.32586	N	0.527858	B;B	0.20780	0.039;0.048	B;B	0.34873	0.06;0.191	T	0.69982	-0.4997	10	0.32370	T	0.25	-12.6012	10.2276	0.43236	0.0:0.4994:0.0:0.5006	.	156;156	Q9NZQ0-3;Q9NZQ0	.;DJC27_HUMAN	T	156;85	ENSP00000264711:K156T;ENSP00000440086:K85T	ENSP00000264711:K156T	K	-	2	0	DNAJC27	25033477	0.925000	0.31364	0.990000	0.47175	0.996000	0.88848	1.217000	0.32455	-0.113000	0.11958	0.528000	0.53228	AAA	.	.		0.423	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246855.3	NM_016544	
TMEM131	23505	hgsc.bcm.edu	37	2	98543941	98543941	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:98543941T>A	ENST00000186436.5	-	2	425	c.197A>T	c.(196-198)cAg>cTg	p.Q66L	TMEM131_ENST00000425805.2_Missense_Mutation_p.Q17L	NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	66						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GCTCTCTGACTGAACGAATGC	0.289																																					p.Q66L		Atlas-SNP	.											.	TMEM131	258	.	0			c.A197T						.						72.0	67.0	69.0					2																	98543941		1871	4097	5968	SO:0001583	missense	23505	exon2			TCTGACTGAACGA	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.197A>T	chr2.hg19:g.98543941T>A	ENSP00000186436:p.Gln66Leu	904.0	1.0		870.0	353.0	NM_015348		Missense_Mutation	SNP	ENST00000186436.5	hg19	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	T	14.46	2.542423	0.45280	.	.	ENSG00000075568	ENST00000186436;ENST00000425805	T	0.33654	1.4	5.16	3.98	0.46160	.	.	.	.	.	T	0.42832	0.1220	L	0.43923	1.385	0.37148	D	0.902029	D;B	0.58268	0.982;0.0	P;B	0.55545	0.778;0.002	T	0.45716	-0.9242	9	0.42905	T	0.14	.	11.3129	0.49375	0.0:0.0:0.153:0.847	.	17;66	B4DMG2;Q92545	.;TM131_HUMAN	L	66;17	ENSP00000186436:Q66L	ENSP00000186436:Q66L	Q	-	2	0	TMEM131	97910373	1.000000	0.71417	0.995000	0.50966	0.884000	0.51177	4.064000	0.57506	0.964000	0.38108	0.455000	0.32223	CAG	.	.		0.289	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
DDX18	8886	hgsc.bcm.edu	37	2	118577227	118577227	+	Missense_Mutation	SNP	A	A	T	rs375147442		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:118577227A>T	ENST00000263239.2	+	3	501	c.373A>T	c.(373-375)Acg>Tcg	p.T125S	DDX18_ENST00000474694.1_3'UTR	NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	125					ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AACCAAAGATACGAAAAAAGC	0.303											OREG0003814	type=REGULATORY REGION|Gene=DDX18|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T125S		Atlas-SNP	.											.	DDX18	79	.	0			c.A373T						.						40.0	39.0	39.0					2																	118577227		2203	4300	6503	SO:0001583	missense	8886	exon3			AAAGATACGAAAA	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.373A>T	chr2.hg19:g.118577227A>T	ENSP00000263239:p.Thr125Ser	586.0	0.0	1489	528.0	204.0	NM_006773	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	ENST00000263239.2	hg19	CCDS2120.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.602732	0.00849	.	.	ENSG00000088205	ENST00000263239	T	0.22743	1.94	3.49	-6.8	0.01709	.	4.794660	0.00397	N	0.000041	T	0.10551	0.0258	N	0.25647	0.755	0.09310	N	0.999996	B	0.02656	0.0	B	0.06405	0.002	T	0.27536	-1.0071	10	0.09084	T	0.74	3.6558	2.7859	0.05374	0.4351:0.1098:0.3381:0.1169	.	125	Q9NVP1	DDX18_HUMAN	S	125	ENSP00000263239:T125S	ENSP00000263239:T125S	T	+	1	0	DDX18	118293697	0.001000	0.12720	0.019000	0.16419	0.030000	0.12068	-0.321000	0.08018	-2.018000	0.00943	-1.699000	0.00722	ACG	.	.		0.303	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129632.3	NM_006773	
MMADHC	27249	hgsc.bcm.edu	37	2	150435994	150435994	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:150435994G>A	ENST00000428879.1	-	3	827	c.323C>T	c.(322-324)tCa>tTa	p.S108L	MMADHC_ENST00000303319.5_Missense_Mutation_p.S108L|MMADHC_ENST00000422782.2_Missense_Mutation_p.S108L			Q9H3L0	MMAD_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria	108			S -> SLAEPLS (in MMAHCD; cblD variant 2).		cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(2)	11						TCTTTCACTTGATAAAGGTTC	0.368																																					p.S108L		Atlas-SNP	.											.	MMADHC	20	.	0			c.C323T						.						96.0	94.0	95.0					2																	150435994		2203	4300	6503	SO:0001583	missense	27249	exon4			TCACTTGATAAAG	BC023995	CCDS2189.1	2q23	2011-05-12	2009-01-08	2009-01-08	ENSG00000168288	ENSG00000168288			25221	protein-coding gene	gene with protein product		611935	"""chromosome 2 open reading frame 25"""	C2orf25		18385497	Standard	NM_015702		Approved	CL25022, cblD	uc002txc.3	Q9H3L0	OTTHUMG00000155558	ENST00000428879.1:c.323C>T	chr2.hg19:g.150435994G>A	ENSP00000389060:p.Ser108Leu	156.0	0.0		171.0	8.0	NM_015702	B2R895|D3DP91|O95891	Missense_Mutation	SNP	ENST00000428879.1	hg19	CCDS2189.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551154	0.65311	.	.	ENSG00000168288	ENST00000303319;ENST00000428879;ENST00000422782	D;D;D	0.89196	-2.48;-2.48;-2.48	5.19	5.19	0.71726	.	0.467513	0.23008	N	0.052992	D	0.88559	0.6469	M	0.63428	1.95	0.38452	D	0.946974	P;B	0.36392	0.551;0.298	B;B	0.37833	0.23;0.259	D	0.88849	0.3318	10	0.39692	T	0.17	-15.3331	18.0635	0.89384	0.0:0.0:1.0:0.0	.	108;108	F8WEC0;Q9H3L0	.;MMAD_HUMAN	L	108	ENSP00000301920:S108L;ENSP00000389060:S108L;ENSP00000408331:S108L	ENSP00000301920:S108L	S	-	2	0	MMADHC	150144240	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.694000	0.68272	2.570000	0.86706	0.557000	0.71058	TCA	.	.		0.368	MMADHC-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332312.1	NM_015702	
KCNH7	90134	hgsc.bcm.edu	37	2	163292032	163292032	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:163292032A>T	ENST00000332142.5	-	8	1729	c.1630T>A	c.(1630-1632)Tat>Aat	p.Y544N	KCNH7_ENST00000328032.4_Missense_Mutation_p.Y537N	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	544					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TATTCTGAATATCGATCCAGT	0.453																																					p.Y544N	GBM(196;1492 2208 17507 24132 45496)	Atlas-SNP	.											.	KCNH7	378	.	0			c.T1630A						.						76.0	73.0	74.0					2																	163292032		2203	4300	6503	SO:0001583	missense	90134	exon8			CTGAATATCGATC	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1630T>A	chr2.hg19:g.163292032A>T	ENSP00000331727:p.Tyr544Asn	98.0	0.0		86.0	26.0	NM_033272	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	hg19	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	A	31	5.059558	0.93846	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.98512	-4.97;-4.97	6.16	6.16	0.99307	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98661	0.9551	M	0.64404	1.975	0.80722	D	1	D;P	0.89917	1.0;0.873	D;P	0.97110	1.0;0.588	D	0.99871	1.1096	10	0.66056	D	0.02	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	537;544	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	N	544;537	ENSP00000331727:Y544N;ENSP00000333781:Y537N	ENSP00000333781:Y537N	Y	-	1	0	KCNH7	163000278	1.000000	0.71417	0.992000	0.48379	0.953000	0.61014	9.339000	0.96797	2.367000	0.80283	0.528000	0.53228	TAT	.	.		0.453	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
PLCL1	5334	hgsc.bcm.edu	37	2	198950034	198950034	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:198950034G>A	ENST00000428675.1	+	2	2191	c.1793G>A	c.(1792-1794)aGg>aAg	p.R598K	PLCL1_ENST00000437704.2_Missense_Mutation_p.R500K	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	598	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GTTCAATACAGGGATTTTGAA	0.408																																					p.R598K		Atlas-SNP	.											PLCL1_ENST00000428675,NS,carcinoma,0,2	PLCL1	358	.	0			c.G1793A						.						67.0	70.0	69.0					2																	198950034		2203	4300	6503	SO:0001583	missense	5334	exon2			AATACAGGGATTT	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1793G>A	chr2.hg19:g.198950034G>A	ENSP00000402861:p.Arg598Lys	119.0	0.0		127.0	59.0	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	hg19	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	G	0.280	-0.986934	0.02180	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.66099	-0.19;-0.19	5.36	5.36	0.76844	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.075564	0.56097	D	0.000027	T	0.35068	0.0919	N	0.04636	-0.2	0.38370	D	0.94485	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.34925	-0.9809	9	.	.	.	.	8.925	0.35634	0.0839:0.1536:0.7625:0.0	.	598;524	Q15111;B4DYZ4	PLCL1_HUMAN;.	K	598;500	ENSP00000402861:R598K;ENSP00000414138:R500K	.	R	+	2	0	PLCL1	198658279	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.751000	0.55165	2.793000	0.96121	0.561000	0.74099	AGG	.	.		0.408	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
ZNF142	7701	hgsc.bcm.edu	37	2	219513536	219513536	+	Silent	SNP	G	G	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:219513536G>T	ENST00000449707.1	-	6	1516	c.1095C>A	c.(1093-1095)ggC>ggA	p.G365G	ZNF142_ENST00000411696.2_Silent_p.G365G	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TGCCAGGGTGGCCCTGCTTCT	0.537											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G365G	Colon(170;867 1942 8995 15834 18053)	Atlas-SNP	.											.	ZNF142	190	.	0			c.C1095A						.						69.0	68.0	69.0					2																	219513536		2078	4228	6306	SO:0001819	synonymous_variant	7701	exon6			AGGGTGGCCCTGC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1095C>A	chr2.hg19:g.219513536G>T		126.0	0.0	2259	121.0	49.0	NM_001105537	Q92510	Silent	SNP	ENST00000449707.1	hg19	CCDS42817.1																																																																																			.	.		0.537	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
NR2C2	7182	hgsc.bcm.edu	37	3	15084400	15084400	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:15084400A>G	ENST00000425241.1	+	14	2038	c.1676A>G	c.(1675-1677)gAa>gGa	p.E559G	NR2C2_ENST00000393102.3_Missense_Mutation_p.E559G|NR2C2_ENST00000406272.2_Missense_Mutation_p.E559G|MRPS25_ENST00000496484.1_5'UTR|NR2C2_ENST00000323373.6_Missense_Mutation_p.E578G|NR2C2_ENST00000478572.1_3'UTR			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	559					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AACATAACAGAAGAACTTTTT	0.458																																					p.E578G		Atlas-SNP	.											.	NR2C2	44	.	0			c.A1733G						.						86.0	76.0	80.0					3																	15084400		2203	4300	6503	SO:0001583	missense	7182	exon15			TAACAGAAGAACT	L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.1676A>G	chr3.hg19:g.15084400A>G	ENSP00000388387:p.Glu559Gly	222.0	0.0		229.0	106.0	NM_003298	A8K3H5|B6ZGT8|P55092	Missense_Mutation	SNP	ENST00000425241.1	hg19		.	.	.	.	.	.	.	.	.	.	A	24.4	4.531998	0.85812	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000406272	T;T;T;T	0.61040	0.14;0.14;0.14;0.14	5.76	5.76	0.90799	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	T	0.81403	0.4815	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.85721	0.1325	10	0.87932	D	0	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	559;578	P49116;F2YGU2	NR2C2_HUMAN;.	G	559;578;559;559	ENSP00000388387:E559G;ENSP00000320447:E578G;ENSP00000376814:E559G;ENSP00000384463:E559G	ENSP00000320447:E578G	E	+	2	0	NR2C2	15059404	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	9.334000	0.96470	2.324000	0.78689	0.533000	0.62120	GAA	.	.		0.458	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000340729.1	NM_003298	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	G	rs121913396|rs121913416		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:41266098A>G	ENST00000349496.5	+	3	375	c.95A>G	c.(94-96)gAc>gGc	p.D32G	CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25G|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32G	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,128	CTNNB1	4904	.	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95G						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>G	chr3.hg19:g.41266098A>G	ENSP00000344456:p.Asp32Gly	189.0	1.0		197.0	98.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308122	0.81247	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.74137	-0.3762	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	G	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25G;ENSP00000385604:D32G;ENSP00000412219:D32G;ENSP00000379486:D32G;ENSP00000344456:D32G;ENSP00000411226:D25G;ENSP00000379488:D32G;ENSP00000409302:D32G;ENSP00000401599:D32G	ENSP00000344456:D32G	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
APEH	327	hgsc.bcm.edu	37	3	49721754	49721754	+	IGR	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:49721754G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Missense_Mutation_p.A670V|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AACCTCACAGGCCCCCACAGG	0.567																																					p.A670V		Atlas-SNP	.											.	MST1	84	.	0			c.C2009T						.						25.0	30.0	28.0					3																	49721754		2199	4290	6489	SO:0001628	intergenic_variant	4485	exon17			TCACAGGCCCCCA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		chr3.hg19:g.49721754G>A		193.0	0.0		204.0	72.0	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	hg19	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.009361	0.93346	.	.	ENSG00000173531	ENST00000449682	D	0.93426	-3.22	5.59	5.59	0.84812	.	0.000000	0.42172	D	0.000758	D	0.95689	0.8598	L	0.52759	1.655	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94744	0.7921	10	0.39692	T	0.17	.	19.5863	0.95490	0.0:0.0:1.0:0.0	.	670	G3XAK1	.	V	670	ENSP00000414287:A670V	ENSP00000414287:A670V	A	-	2	0	MST1	49696758	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.932000	0.92897	2.621000	0.88768	0.655000	0.94253	GCC	.	.		0.567	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
EPHA6	285220	hgsc.bcm.edu	37	3	97367160	97367160	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:97367160T>A	ENST00000514100.1	+	13	1425	c.1183T>A	c.(1183-1185)Tgc>Agc	p.C395S	EPHA6_ENST00000389672.5_Intron|EPHA6_ENST00000502694.1_Missense_Mutation_p.C331S	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						ACTTAACCTCTGCTATTCTGC	0.328																																					p.C331S		Atlas-SNP	.											.	EPHA6	439	.	0			c.T991A						.						100.0	92.0	94.0					3																	97367160		1814	4083	5897	SO:0001583	missense	285220	exon13			AACCTCTGCTATT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.1183T>A	chr3.hg19:g.97367160T>A	ENSP00000421711:p.Cys395Ser	128.0	0.0		82.0	40.0	NM_173655	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.18	1.280165	0.23392	.	.	ENSG00000080224	ENST00000514100;ENST00000502694	D;T	0.81499	-1.5;-1.37	3.77	-3.32	0.04973	.	.	.	.	.	T	0.67116	0.2859	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.54549	-0.8277	8	0.87932	D	0	.	5.1581	0.15046	0.1541:0.2544:0.0:0.5916	.	331;395	Q9UF33-2;D6RAL5	.;.	S	395;331	ENSP00000421711:C395S;ENSP00000423950:C331S	ENSP00000423950:C331S	C	+	1	0	EPHA6	98849850	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.804000	0.04535	-0.807000	0.04393	-1.414000	0.01117	TGC	.	.		0.328	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
CFAP44	55779	hgsc.bcm.edu	37	3	113120468	113120468	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:113120468T>A	ENST00000295868.2	-	10	1451	c.1289A>T	c.(1288-1290)aAa>aTa	p.K430I	WDR52-AS1_ENST00000498480.1_RNA|WDR52-AS1_ENST00000473329.1_RNA|WDR52_ENST00000393845.2_Missense_Mutation_p.K430I	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TTCATTCATTTTTATCATAGA	0.348																																					p.K430I		Atlas-SNP	.											.	WDR52	151	.	0			c.A1289T						.						122.0	121.0	121.0					3																	113120468		2203	4300	6503	SO:0001583	missense	55779	exon10			TTCATTTTTATCA																												ENST00000295868.2:c.1289A>T	chr3.hg19:g.113120468T>A	ENSP00000295868:p.Lys430Ile	171.0	0.0		190.0	84.0	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	hg19	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.072432	0.76415	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.50813	2.62;0.73	5.47	5.47	0.80525	WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.68650	0.3024	M	0.77820	2.39	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.73649	-0.3916	9	0.87932	D	0	.	15.5536	0.76173	0.0:0.0:0.0:1.0	.	430	Q96MT7	WDR52_HUMAN	I	430	ENSP00000377428:K430I;ENSP00000295868:K430I	ENSP00000295868:K430I	K	-	2	0	WDR52	114603158	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	3.465000	0.53064	2.066000	0.61787	0.533000	0.62120	AAA	.	.		0.348	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
ZBTB38	253461	hgsc.bcm.edu	37	3	141163168	141163168	+	Silent	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:141163168T>C	ENST00000514251.1	+	4	2217	c.1938T>C	c.(1936-1938)aaT>aaC	p.N646N	ZBTB38_ENST00000321464.5_Silent_p.N647N|ZBTB38_ENST00000441582.2_Silent_p.N646N					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						CTTCTGCCAATGTACAAAATG	0.433																																					p.N646N		Atlas-SNP	.											.	ZBTB38	92	.	0			c.T1938C						.						94.0	91.0	92.0					3																	141163168		1919	4138	6057	SO:0001819	synonymous_variant	253461	exon8			TGCCAATGTACAA	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1938T>C	chr3.hg19:g.141163168T>C		92.0	0.0		69.0	28.0	NM_001080412		Silent	SNP	ENST00000514251.1	hg19	CCDS43157.1																																																																																			.	.		0.433	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2		
C3orf58	205428	hgsc.bcm.edu	37	3	143704424	143704424	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:143704424C>G	ENST00000315691.3	+	2	1232	c.697C>G	c.(697-699)Ctt>Gtt	p.L233V	C3orf58_ENST00000493396.1_Intron|C3orf58_ENST00000495414.1_Missense_Mutation_p.L24V|C3orf58_ENST00000441925.2_5'UTR	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	233					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGCAAAGTATCTTGGAGCTTG	0.393																																					p.L233V		Atlas-SNP	.											.	C3orf58	36	.	0			c.C697G						.						152.0	151.0	152.0					3																	143704424		2203	4300	6503	SO:0001583	missense	205428	exon2			AAGTATCTTGGAG	AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.697C>G	chr3.hg19:g.143704424C>G	ENSP00000320081:p.Leu233Val	167.0	0.0		186.0	66.0	NM_173552	B2RCF2|B7Z1W3	Missense_Mutation	SNP	ENST00000315691.3	hg19	CCDS3130.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.573485	0.45902	.	.	ENSG00000181744	ENST00000315691;ENST00000495414;ENST00000492452	T	0.36878	1.23	5.24	4.37	0.52481	.	0.000000	0.64402	D	0.000001	T	0.46698	0.1406	M	0.73217	2.22	0.80722	D	1	P;D	0.56287	0.915;0.975	P;P	0.52957	0.596;0.714	T	0.45731	-0.9241	10	0.51188	T	0.08	.	8.7331	0.34512	0.0:0.7811:0.0:0.2189	.	24;233	B7Z1W3;Q8NDZ4	.;CC058_HUMAN	V	233;24;39	ENSP00000320081:L233V	ENSP00000320081:L233V	L	+	1	0	C3orf58	145187114	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.837000	0.55820	1.228000	0.43614	-0.136000	0.14681	CTT	.	.		0.393	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355038.1	NM_173552	
CCDC39	339829	hgsc.bcm.edu	37	3	180378364	180378364	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:180378364T>G	ENST00000442201.2	-	4	629	c.510A>C	c.(508-510)aaA>aaC	p.K170N	CCDC39_ENST00000273654.4_Missense_Mutation_p.K254N	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	170					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCACCCTGATTTTATTATCAT	0.373																																					p.K170N		Atlas-SNP	.											.	CCDC39	242	.	0			c.A510C						.						108.0	101.0	103.0					3																	180378364		1842	4087	5929	SO:0001583	missense	339829	exon4			CCTGATTTTATTA	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.510A>C	chr3.hg19:g.180378364T>G	ENSP00000405708:p.Lys170Asn	121.0	0.0		103.0	39.0	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	hg19	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.526912	0.64860	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.22336	1.96;1.96	5.6	3.17	0.36434	.	0.136287	0.64402	D	0.000004	T	0.44030	0.1274	M	0.81341	2.54	0.41505	D	0.988306	D	0.76494	0.999	D	0.70935	0.971	T	0.30416	-0.9979	10	0.48119	T	0.1	-32.7871	10.1634	0.42866	0.0:0.1265:0.0:0.8735	.	170	Q9UFE4	CCD39_HUMAN	N	254;170	ENSP00000273654:K254N;ENSP00000405708:K170N	ENSP00000273654:K254N	K	-	3	2	CCDC39	181861058	1.000000	0.71417	0.998000	0.56505	0.761000	0.43186	1.066000	0.30604	0.399000	0.25367	0.477000	0.44152	AAA	.	.		0.373	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
ADIPOQ	9370	hgsc.bcm.edu	37	3	186572279	186572279	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:186572279G>A	ENST00000412955.2	+	3	662	c.521G>A	c.(520-522)aGc>aAc	p.S174N	ADIPOQ_ENST00000320741.2_Missense_Mutation_p.S174N|ADIPOQ_ENST00000444204.2_Missense_Mutation_p.S174N|ADIPOQ-AS1_ENST00000422718.1_RNA			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	174	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		GTGAAGGTCAGCCTCTTCAAG	0.488																																					p.S174N		Atlas-SNP	.											.	ADIPOQ	35	.	0			c.G521A						.						146.0	130.0	136.0					3																	186572279		2203	4300	6503	SO:0001583	missense	9370	exon4			AGGTCAGCCTCTT	D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.521G>A	chr3.hg19:g.186572279G>A	ENSP00000405611:p.Ser174Asn	130.0	0.0		158.0	74.0	NM_001177800	Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	hg19	CCDS3284.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928388	0.73327	.	.	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	T;T;T	0.75477	-0.94;-0.94;-0.94	5.38	5.38	0.77491	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.054006	0.64402	D	0.000001	T	0.81880	0.4916	L	0.53671	1.685	0.46631	D	0.999134	D	0.67145	0.996	D	0.68353	0.957	T	0.76934	-0.2775	10	0.20046	T	0.44	.	16.9985	0.86375	0.0:0.0:1.0:0.0	.	174	Q15848	ADIPO_HUMAN	N	174	ENSP00000405611:S174N;ENSP00000320709:S174N;ENSP00000389814:S174N	ENSP00000320709:S174N	S	+	2	0	ADIPOQ	188054973	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.222000	0.65277	2.700000	0.92200	0.655000	0.94253	AGC	.	.		0.488	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797	
TMEM44	93109	hgsc.bcm.edu	37	3	194349215	194349215	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr3:194349215T>A	ENST00000392432.2	-	2	366	c.161A>T	c.(160-162)cAg>cTg	p.Q54L	TMEM44_ENST00000273580.7_Missense_Mutation_p.Q54L|TMEM44_ENST00000330115.3_5'UTR|TMEM44_ENST00000473092.1_Missense_Mutation_p.Q54L|TMEM44_ENST00000381975.3_Missense_Mutation_p.Q54L|TMEM44_ENST00000347147.4_Missense_Mutation_p.Q54L	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	54						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		TCTGGGTTTCTGTGCACATCT	0.552																																					p.Q54L		Atlas-SNP	.											.	TMEM44	42	.	0			c.A161T						.						66.0	60.0	62.0					3																	194349215		2203	4300	6503	SO:0001583	missense	93109	exon2			GGTTTCTGTGCAC	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.161A>T	chr3.hg19:g.194349215T>A	ENSP00000376227:p.Gln54Leu	93.0	0.0		80.0	32.0	NM_138399	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	hg19	CCDS54699.1	.	.	.	.	.	.	.	.	.	.	T	10.61	1.397505	0.25205	.	.	ENSG00000145014	ENST00000392432;ENST00000273580;ENST00000347147;ENST00000381975;ENST00000473092	T;T;T;T;T	0.30981	1.94;1.52;1.52;1.51;1.52	5.23	1.3	0.21679	.	0.695149	0.13367	N	0.393223	T	0.13884	0.0336	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.20368	0.007;0.044;0.007;0.007;0.007	B;B;B;B;B	0.17979	0.009;0.02;0.013;0.009;0.009	T	0.20538	-1.0272	10	0.51188	T	0.08	-4.488	4.503	0.11874	0.0:0.1796:0.1661:0.6543	.	54;54;54;54;54	E9PGA9;Q2T9K0;Q2T9K0-4;Q2T9K0-2;Q2T9K0-6	.;TMM44_HUMAN;.;.;.	L	54	ENSP00000376227:Q54L;ENSP00000273580:Q54L;ENSP00000333355:Q54L;ENSP00000371402:Q54L;ENSP00000418674:Q54L	ENSP00000273580:Q54L	Q	-	2	0	TMEM44	195830504	0.194000	0.23325	0.020000	0.16555	0.394000	0.30568	0.091000	0.15046	-0.017000	0.14103	0.459000	0.35465	CAG	.	.		0.552	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
ZNF595	152687	hgsc.bcm.edu	37	4	53384	53384	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr4:53384T>A	ENST00000509152.2	+	1	187	c.2T>A	c.(1-3)aTg>aAg	p.M1K	ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_Splice_Site_p.M1K			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		AGTCGGGAAATGGTGAGTGTG	0.642																																					p.M1K		Atlas-SNP	.											.	.	.	.	0			c.T2A						.						205.0	234.0	224.0					4																	53384		2203	4300	6503	SO:0001630	splice_region_variant	255403	exon1			GGGAAATGGTGAG	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.3+1T>A	chr4.hg19:g.53384T>A		88.0	0.0		119.0	6.0	NM_001039127		Missense_Mutation	SNP	ENST00000509152.2	hg19		.	.	.	.	.	.	.	.	.	.	T	13.72	2.321870	0.41096	.	.	ENSG00000197701	ENST00000509152;ENST00000526473	T;T	0.01092	5.35;5.41	0.51	0.51	0.16983	.	.	.	.	.	T	0.01320	0.0043	.	.	.	0.80722	D	1	B;B	0.22003	0.061;0.063	B;B	0.20577	0.03;0.026	T	0.54964	-0.8214	7	0.87932	D	0	.	.	.	.	.	1;1	Q8IYB9;Q3SXZ3	ZN595_HUMAN;ZN718_HUMAN	K	1	ENSP00000434858:M1K;ENSP00000437878:M1K	ENSP00000434858:M1K	M	+	2	0	ZNF595	43384	0.013000	0.17824	0.112000	0.21494	0.021000	0.10359	0.310000	0.19356	0.436000	0.26393	0.260000	0.18958	ATG	.	.		0.642	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524	Missense_Mutation
CLNK	116449	hgsc.bcm.edu	37	4	10522420	10522420	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr4:10522420T>C	ENST00000226951.6	-	15	1006	c.767A>G	c.(766-768)aAc>aGc	p.N256S		NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	256					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						CTTACCTCTGTTTTGCACACT	0.378																																					p.N256S	GBM(87;402 1286 6949 13902 35851)	Atlas-SNP	.											.	CLNK	85	.	0			c.A767G						.						140.0	125.0	130.0					4																	10522420		1858	4107	5965	SO:0001583	missense	116449	exon15			CCTCTGTTTTGCA	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.767A>G	chr4.hg19:g.10522420T>C	ENSP00000226951:p.Asn256Ser	128.0	0.0		109.0	45.0	NM_052964	Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	hg19	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	T	1.473	-0.559360	0.03967	.	.	ENSG00000109684	ENST00000226951;ENST00000429087	T	0.20463	2.07	3.58	-1.9	0.07665	.	1.529250	0.03878	N	0.276734	T	0.11110	0.0271	N	0.24115	0.695	0.35541	D	0.803033	B	0.02656	0.0	B	0.01281	0.0	T	0.45011	-0.9290	10	0.06365	T	0.9	-4.8736	4.3691	0.11239	0.0:0.4209:0.2125:0.3666	.	256	Q7Z7G1	CLNK_HUMAN	S	256;220	ENSP00000226951:N256S	ENSP00000226951:N256S	N	-	2	0	CLNK	10131518	0.002000	0.14202	0.585000	0.28666	0.534000	0.34807	-0.658000	0.05329	-0.327000	0.08551	0.379000	0.24179	AAC	.	.		0.378	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964	
HELQ	113510	hgsc.bcm.edu	37	4	84361091	84361091	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr4:84361091T>A	ENST00000295488.3	-	8	1895	c.1733A>T	c.(1732-1734)tAt>tTt	p.Y578F	HELQ_ENST00000510985.1_Missense_Mutation_p.Y511F	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	578	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TAAGCAGGAATAATTGGGAAT	0.323								Other identified genes with known or suspected DNA repair function																													p.Y578F		Atlas-SNP	.											.	HELQ	95	.	0			c.A1733T						.						78.0	80.0	79.0					4																	84361091		2203	4299	6502	SO:0001583	missense	113510	exon8			CAGGAATAATTGG	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.1733A>T	chr4.hg19:g.84361091T>A	ENSP00000295488:p.Tyr578Phe	648.0	2.0		718.0	287.0	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	hg19	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.248743	0.39797	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;D	0.91180	-0.52;-2.8	5.68	5.68	0.88126	Helicase, C-terminal (1);	0.429052	0.27567	N	0.018797	D	0.86016	0.5832	L	0.45352	1.415	0.47584	D	0.999463	P;B	0.36086	0.536;0.009	B;B	0.29862	0.108;0.011	D	0.84904	0.0844	10	0.32370	T	0.25	.	15.9199	0.79556	0.0:0.0:0.0:1.0	.	511;578	E3W980;Q8TDG4	.;HELQ_HUMAN	F	578;511	ENSP00000295488:Y578F;ENSP00000424539:Y511F	ENSP00000295488:Y578F	Y	-	2	0	HELQ	84580115	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.015000	0.88690	2.161000	0.67846	0.533000	0.62120	TAT	.	.		0.323	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
CDS1	1040	hgsc.bcm.edu	37	4	85564293	85564293	+	Silent	SNP	C	C	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr4:85564293C>A	ENST00000295887.5	+	11	1572	c.1149C>A	c.(1147-1149)atC>atA	p.I383I		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		CCTTCAAAATCAAGGTGTGTG	0.383																																					p.I383I		Atlas-SNP	.											.	CDS1	58	.	0			c.C1149A						.						109.0	116.0	113.0					4																	85564293		2203	4300	6503	SO:0001819	synonymous_variant	1040	exon11			CAAAATCAAGGTG	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.1149C>A	chr4.hg19:g.85564293C>A		86.0	0.0		58.0	20.0	NM_001263	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000295887.5	hg19	CCDS3608.1																																																																																			.	.		0.383	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2		
PAM	5066	hgsc.bcm.edu	37	5	102360941	102360941	+	Silent	SNP	G	G	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr5:102360941G>T	ENST00000438793.3	+	23	3062	c.2592G>T	c.(2590-2592)gtG>gtT	p.V864V	PAM_ENST00000379787.4_Silent_p.V244V|PAM_ENST00000455264.2_Intron|PAM_ENST00000274392.9_Silent_p.V766V|PAM_ENST00000346918.2_Intron|PAM_ENST00000348126.2_Silent_p.V757V|PAM_ENST00000304400.7_Silent_p.V864V	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	864					central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GCTCGGGAGTGCCTGTTGTTC	0.468																																					p.V864V		Atlas-SNP	.											.	PAM	180	.	0			c.G2592T						.						111.0	123.0	119.0					5																	102360941		2203	4300	6503	SO:0001819	synonymous_variant	5066	exon23			GGGAGTGCCTGTT	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2592G>T	chr5.hg19:g.102360941G>T		198.0	0.0		200.0	89.0	NM_001177306	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Silent	SNP	ENST00000438793.3	hg19	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	G	3.524	-0.097064	0.07010	.	.	ENSG00000145730	ENST00000504691	.	.	.	5.69	1.52	0.23074	.	.	.	.	.	T	0.46737	0.1408	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32134	-0.9918	4	.	.	.	.	4.5002	0.11860	0.1416:0.0922:0.5848:0.1814	.	.	.	.	F	159	.	.	C	+	2	0	PAM	102388840	0.998000	0.40836	0.995000	0.50966	0.483000	0.33249	0.558000	0.23469	0.758000	0.33059	-0.205000	0.12727	TGC	.	.		0.468	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PCDHGB7	56099	hgsc.bcm.edu	37	5	140799184	140799184	+	Silent	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr5:140799184C>T	ENST00000398594.2	+	1	1758	c.1758C>T	c.(1756-1758)taC>taT	p.Y586Y	PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	586	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCAGGCTACCTGGTGACCA	0.701																																					p.Y586Y		Atlas-SNP	.											.	PCDHGB7	117	.	0			c.C1758T						.						28.0	33.0	31.0					5																	140799184		2195	4294	6489	SO:0001819	synonymous_variant	56099	exon1			AGGCTACCTGGTG	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1758C>T	chr5.hg19:g.140799184C>T		71.0	0.0		98.0	42.0	NM_018927	Q9UN63	Silent	SNP	ENST00000398594.2	hg19	CCDS47293.1																																																																																			.	.		0.701	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
MYLIP	29116	hgsc.bcm.edu	37	6	16143347	16143347	+	Silent	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr6:16143347A>T	ENST00000356840.3	+	4	759	c.561A>T	c.(559-561)atA>atT	p.I187I	MYLIP_ENST00000349606.4_Silent_p.I6I|MIR4639_ENST00000584938.1_RNA	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	187	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			ACTATGGCATAGAATGGCATT	0.453																																					p.I187I		Atlas-SNP	.											.	MYLIP	44	.	0			c.A561T						.						144.0	137.0	140.0					6																	16143347		2203	4300	6503	SO:0001819	synonymous_variant	29116	exon4			TGGCATAGAATGG	AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.561A>T	chr6.hg19:g.16143347A>T		154.0	0.0		177.0	75.0	NM_013262	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Silent	SNP	ENST00000356840.3	hg19	CCDS4536.1																																																																																			.	.		0.453	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043864.1	NM_013262	
CCHCR1	54535	hgsc.bcm.edu	37	6	31110818	31110818	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr6:31110818C>A	ENST00000376266.5	-	17	2268	c.2146G>T	c.(2146-2148)Gtg>Ttg	p.V716L	CCHCR1_ENST00000396263.2_Missense_Mutation_p.V663L|CCHCR1_ENST00000451521.2_Missense_Mutation_p.V769L|CCHCR1_ENST00000396268.3_Missense_Mutation_p.V805L	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	716					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						GGGCTGGACACCACAGATTTC	0.557																																					p.V805L		Atlas-SNP	.											.	CCHCR1	68	.	0			c.G2413T						.						236.0	275.0	261.0					6																	31110818		1511	2709	4220	SO:0001583	missense	54535	exon17			TGGACACCACAGA	AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.2146G>T	chr6.hg19:g.31110818C>A	ENSP00000365442:p.Val716Leu	173.0	0.0		210.0	84.0	NM_001105564	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	ENST00000376266.5	hg19	CCDS4695.1	.	.	.	.	.	.	.	.	.	.	C	10.27	1.304523	0.23736	.	.	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521	T;T;T;T	0.03358	3.96;3.98;3.96;3.96	4.9	4.02	0.46733	.	0.800888	0.10538	N	0.663055	T	0.01092	0.0036	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.26775	0.038;0.054;0.159;0.031	B;B;B;B	0.24541	0.05;0.054;0.054;0.03	T	0.47394	-0.9121	10	0.28530	T	0.3	-0.065	11.0522	0.47896	0.0:0.8124:0.1876:0.0	.	702;716;769;805	B4DIA2;Q8TD31;E9PE84;Q8TD31-2	.;CCHCR_HUMAN;.;.	L	805;716;663;702;769	ENSP00000379566:V805L;ENSP00000365442:V716L;ENSP00000379561:V663L;ENSP00000401039:V769L	ENSP00000365442:V716L	V	-	1	0	CCHCR1	31218797	0.000000	0.05858	0.005000	0.12908	0.035000	0.12851	0.467000	0.22035	1.258000	0.44101	0.549000	0.68633	GTG	.	.		0.557	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076190.5	NM_019052	
COL19A1	1310	hgsc.bcm.edu	37	6	70890392	70890392	+	Missense_Mutation	SNP	C	C	G	rs369271643		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr6:70890392C>G	ENST00000322773.4	+	44	2854	c.2752C>G	c.(2752-2754)Cca>Gca	p.P918A	COL19A1_ENST00000393344.1_Missense_Mutation_p.P540A	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	918	Collagen-like 10.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.P918T(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TTTCCCTGGACCAGAAGGACC	0.408																																					p.P918A		Atlas-SNP	.											COL19A1,NS,carcinoma,0,1	COL19A1	232	.	1	Substitution - Missense(1)	lung(1)	c.C2752G						.	C	ALA/PRO	0,4406		0,0,2203	149.0	149.0	149.0		2752	5.5	1.0	6		149	1,8599		0,1,4299	no	missense	COL19A1	NM_001858.4	27	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging	918/1143	70890392	1,13005	2203	4300	6503	SO:0001583	missense	1310	exon44			CCTGGACCAGAAG		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2752C>G	chr6.hg19:g.70890392C>G	ENSP00000316030:p.Pro918Ala	143.0	0.0		124.0	49.0	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	hg19	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365675	0.61513	0.0	1.16E-4	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.98633	-5.04;-1.53	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000001	D	0.98134	0.9384	L	0.58101	1.795	0.51482	D	0.999921	D	0.89917	1.0	D	0.87578	0.998	D	0.97929	1.0319	10	0.05721	T	0.95	.	17.591	0.87997	0.0:1.0:0.0:0.0	.	918	Q14993	COJA1_HUMAN	A	918;540	ENSP00000316030:P918A;ENSP00000377013:P540A	ENSP00000316030:P918A	P	+	1	0	COL19A1	70947113	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.485000	0.53208	2.590000	0.87494	0.484000	0.47621	CCA	.	.		0.408	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
MCM9	254394	hgsc.bcm.edu	37	6	119147392	119147392	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr6:119147392G>A	ENST00000316316.6	-	12	2165	c.1879C>T	c.(1879-1881)Cag>Tag	p.Q627*	MCM9_ENST00000505485.1_5'Flank	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	627					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		CTCTGGTACTGCTCTCCAGGG	0.498																																					p.Q627X		Atlas-SNP	.											.	MCM9	73	.	0			c.C1879T						.																																			SO:0001587	stop_gained	254394	exon11			GGTACTGCTCTCC	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.1879C>T	chr6.hg19:g.119147392G>A	ENSP00000314505:p.Gln627*	117.0	0.0		97.0	37.0	NM_017696	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Nonsense_Mutation	SNP	ENST00000316316.6	hg19	CCDS56447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.323190|5.323190	0.95708|0.95708	.|.	.|.	ENSG00000111877|ENSG00000111877	ENST00000458674|ENST00000316316;ENST00000243218	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.316567	.|0.35436	.|N	.|0.003216	T|.	0.70745|.	0.3259|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.70070|.	-0.4973|.	4|.	.|0.44086	.|T	.|0.13	.|.	19.2383|19.2383	0.93871|0.93871	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	118|627;246	.|.	.|ENSP00000243218:Q246X	A|Q	-|-	2|1	0|0	MCM9|MCM9	119254084|119254084	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.982000|0.982000	0.71751|0.71751	9.471000|9.471000	0.97696|0.97696	2.525000|2.525000	0.85131|0.85131	0.655000|0.655000	0.94253|0.94253	GCA|CAG	.	.		0.498	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	
BCLAF1	9774	hgsc.bcm.edu	37	6	136582573	136582573	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr6:136582573C>T	ENST00000531224.1	-	12	2839	c.2587G>A	c.(2587-2589)Gga>Aga	p.G863R	BCLAF1_ENST00000527759.1_Missense_Mutation_p.G861R|BCLAF1_ENST00000527536.1_Missense_Mutation_p.G814R|BCLAF1_ENST00000353331.4_Missense_Mutation_p.G812R|BCLAF1_ENST00000530767.1_Missense_Mutation_p.G690R|BCLAF1_ENST00000392348.2_Missense_Mutation_p.G812R|BCLAF1_ENST00000031135.9_Missense_Mutation_p.G81R|BCLAF1_ENST00000529917.1_5'UTR	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	863					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CGACCTCTTCCTCTTTTGGCC	0.408																																					p.G863R	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.G2587A						.						197.0	198.0	197.0					6																	136582573		2203	4300	6503	SO:0001583	missense	9774	exon12			CTCTTCCTCTTTT	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2587G>A	chr6.hg19:g.136582573C>T	ENSP00000435210:p.Gly863Arg	115.0	0.0		133.0	40.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.223322|4.223322	0.79464|0.79464	.|.	.|.	ENSG00000029363|ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000031135;ENST00000392348|ENST00000534762	T;T;T;T;T;T;T|T	0.57436|0.50813	2.08;1.61;1.62;1.88;2.07;0.4;1.61|0.73	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.000000|.	0.64402|.	D|.	0.000006|.	T|T	0.55832|0.55832	0.1945|0.1945	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;1.0;0.999;0.999;0.999|.	T|T	0.57283|0.57283	-0.7838|-0.7838	10|7	0.52906|0.62326	T|D	0.07|0.03	-18.0574|-18.0574	19.3961|19.3961	0.94607|0.94607	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	861;142;812;863;690|.	Q9NYF8-2;B7Z8J9;Q9NYF8-3;Q9NYF8;Q9NYF8-4|.	.;.;.;BCLF1_HUMAN;.|.	R|K	863;812;814;690;861;81;812|129	ENSP00000435210:G863R;ENSP00000229446:G812R;ENSP00000435441:G814R;ENSP00000436501:G690R;ENSP00000434826:G861R;ENSP00000031135:G81R;ENSP00000376159:G812R|ENSP00000437018:R129K	ENSP00000031135:G81R|ENSP00000437018:R129K	G|R	-|-	1|2	0|0	BCLAF1|BCLAF1	136624266|136624266	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.778000|4.778000	0.62368|0.62368	2.581000|2.581000	0.87130|0.87130	0.655000|0.655000	0.94253|0.94253	GGA|AGG	.	.		0.408	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
IKZF1	10320	hgsc.bcm.edu	37	7	50468300	50468300	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:50468300G>A	ENST00000331340.3	+	8	1690	c.1535G>A	c.(1534-1536)gGg>gAg	p.G512E	IKZF1_ENST00000357364.4_Missense_Mutation_p.G425E|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000438033.1_Missense_Mutation_p.G425E|IKZF1_ENST00000439701.1_Missense_Mutation_p.G470E|IKZF1_ENST00000359197.5_Missense_Mutation_p.G470E|IKZF1_ENST00000346667.4_Missense_Mutation_p.G282E|IKZF1_ENST00000349824.4_Missense_Mutation_p.G369E|IKZF1_ENST00000343574.5_Missense_Mutation_p.G425E	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	512					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				ATAACGCGAGGGGAGCACCGC	0.632			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.G512E		Atlas-SNP	.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	IKZF1	613	.	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)	c.G1535A						.						47.0	48.0	48.0					7																	50468300		2151	4265	6416	SO:0001583	missense	10320	exon8			CGCGAGGGGAGCA	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1535G>A	chr7.hg19:g.50468300G>A	ENSP00000331614:p.Gly512Glu	51.0	0.0		43.0	14.0	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	hg19		.	.	.	.	.	.	.	.	.	.	G	33	5.239947	0.95240	.	.	ENSG00000185811	ENST00000346667;ENST00000343574;ENST00000359197;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.69260	0.3091	.	.	.	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.72097	-0.4393	9	0.87932	D	0	-16.1653	19.9376	0.97146	0.0:0.0:1.0:0.0	.	425;282;425;470;512	Q13422-2;Q13422-6;Q13422-3;Q13422-7;Q13422	.;.;.;.;IKZF1_HUMAN	E	282;425;470;369;425;512;425;470	ENSP00000340080:G282E;ENSP00000342750:G425E;ENSP00000352123:G470E;ENSP00000342485:G369E;ENSP00000349928:G425E;ENSP00000331614:G512E;ENSP00000396554:G425E;ENSP00000413025:G470E	ENSP00000331614:G512E	G	+	2	0	IKZF1	50435794	1.000000	0.71417	0.728000	0.30774	0.925000	0.55904	9.758000	0.98927	2.711000	0.92665	0.655000	0.94253	GGG	.	.		0.632	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
CHCHD2	51142	hgsc.bcm.edu	37	7	56170565	56170565	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:56170565G>C	ENST00000395422.3	-	3	602	c.440C>G	c.(439-441)gCa>gGa	p.A147G	snoU13_ENST00000458988.1_RNA	NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2	147	CHCH.					mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CCTACCGTTTGCAAGTCGGCA	0.423																																					p.A147G		Atlas-SNP	.											.	CHCHD2	10	.	0			c.C440G						.						75.0	69.0	71.0					7																	56170565		2203	4300	6503	SO:0001583	missense	51142	exon3			CCGTTTGCAAGTC	AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.440C>G	chr7.hg19:g.56170565G>C	ENSP00000378812:p.Ala147Gly	68.0	0.0		69.0	25.0	NM_016139	Q498C3|Q6NZ50	Missense_Mutation	SNP	ENST00000395422.3	hg19	CCDS5526.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346236	0.82022	.	.	ENSG00000106153	ENST00000395422	T	0.51574	0.7	5.35	5.35	0.76521	.	0.233360	0.42294	D	0.000731	T	0.74604	0.3738	M	0.92507	3.315	0.52099	D	0.999949	D	0.61697	0.99	D	0.66196	0.942	T	0.77365	-0.2615	10	0.32370	T	0.25	.	18.0268	0.89271	0.0:0.0:1.0:0.0	.	147	Q9Y6H1	CHCH2_HUMAN	G	147	ENSP00000378812:A147G	ENSP00000378812:A147G	A	-	2	0	CHCHD2	56138059	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	6.268000	0.72552	2.498000	0.84270	0.557000	0.71058	GCA	.	.		0.423	CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251589.1	NM_016139	
CLIP2	7461	hgsc.bcm.edu	37	7	73790427	73790427	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:73790427A>T	ENST00000395060.1	+	9	1696	c.1696A>T	c.(1696-1698)Aaa>Taa	p.K566*	CLIP2_ENST00000361545.5_Nonsense_Mutation_p.K531*|CLIP2_ENST00000223398.6_Nonsense_Mutation_p.K566*			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	566						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GCTGCGGGATAAATACGAGAA	0.657																																					p.K566X		Atlas-SNP	.											.	CLIP2	134	.	0			c.A1696T						.						28.0	31.0	30.0					7																	73790427		2203	4300	6503	SO:0001587	stop_gained	7461	exon10			CGGGATAAATACG	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.1696A>T	chr7.hg19:g.73790427A>T	ENSP00000378500:p.Lys566*	202.0	0.0		193.0	73.0	NM_003388	O14527|O43611	Nonsense_Mutation	SNP	ENST00000395060.1	hg19	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	A	39	7.566374	0.98361	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	.	.	.	5.02	5.02	0.67125	.	0.292075	0.37348	N	0.002131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.6181	13.6265	0.62168	1.0:0.0:0.0:0.0	.	.	.	.	X	566;566;531;566	.	ENSP00000223398:K566X	K	+	1	0	CLIP2	73428363	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	5.963000	0.70372	1.894000	0.54839	0.456000	0.33151	AAA	.	.		0.657	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
PCLO	27445	hgsc.bcm.edu	37	7	82435068	82435068	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:82435068T>C	ENST00000333891.9	-	21	15206	c.14869A>G	c.(14869-14871)Agc>Ggc	p.S4957G		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTGTCCACGCTATACCCACTG	0.517																																					p.S4957G		Atlas-SNP	.											.	PCLO	1506	.	0			c.A14869G						.						56.0	57.0	57.0					7																	82435068		2039	4200	6239	SO:0001583	missense	27445	exon21			CCACGCTATACCC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14869A>G	chr7.hg19:g.82435068T>C	ENSP00000334319:p.Ser4957Gly	136.0	0.0		114.0	42.0	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.240496	0.39598	.	.	ENSG00000186472	ENST00000333891	T	0.20738	2.05	5.69	5.69	0.88448	.	.	.	.	.	T	0.17152	0.0412	L	0.29908	0.895	0.80722	D	1	B	0.20368	0.044	B	0.22753	0.041	T	0.03630	-1.1018	9	0.87932	D	0	.	10.3136	0.43723	0.0:0.0735:0.0:0.9265	.	4957	Q9Y6V0-5	.	G	4957	ENSP00000334319:S4957G	ENSP00000334319:S4957G	S	-	1	0	PCLO	82273004	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.221000	0.58574	2.154000	0.67381	0.455000	0.32223	AGC	.	.		0.517	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ABCB1	5243	hgsc.bcm.edu	37	7	87175239	87175239	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:87175239T>A	ENST00000265724.3	-	16	2244	c.1827A>T	c.(1825-1827)aaA>aaT	p.K609N	ABCB1_ENST00000543898.1_Missense_Mutation_p.K545N	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	609	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CATGATTTCCTTTCTCCACAA	0.408																																					p.K609N		Atlas-SNP	.											.	ABCB1	263	.	0			c.A1827T						.						159.0	130.0	140.0					7																	87175239		2203	4300	6503	SO:0001583	missense	5243	exon16			ATTTCCTTTCTCC	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1827A>T	chr7.hg19:g.87175239T>A	ENSP00000265724:p.Lys609Asn	119.0	0.0		140.0	47.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	hg19	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.260832	0.59431	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	T;T	0.67171	-0.25;-0.25	5.62	3.25	0.37280	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.624535	0.18300	N	0.145449	T	0.50582	0.1624	N	0.21448	0.665	0.33337	D	0.569323	B;B	0.26120	0.005;0.142	B;B	0.20184	0.004;0.028	T	0.57441	-0.7811	10	0.72032	D	0.01	-1.671	10.2704	0.43479	0.0:0.1341:0.0:0.8659	.	545;609	B5AK60;P08183	.;MDR1_HUMAN	N	390;609;545	ENSP00000265724:K609N;ENSP00000444095:K545N	ENSP00000265724:K609N	K	-	3	2	ABCB1	87013175	0.476000	0.25901	0.922000	0.36590	0.945000	0.59286	0.681000	0.25320	0.504000	0.28082	0.528000	0.53228	AAA	.	.		0.408	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
WASL	8976	hgsc.bcm.edu	37	7	123346348	123346348	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:123346348C>T	ENST00000223023.4	-	4	751	c.419G>A	c.(418-420)cGt>cAt	p.R140H		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	140	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCTTTGTCGACGGCCCAAAAG	0.363																																					p.R140H		Atlas-SNP	.											.	WASL	70	.	0			c.G419A						.						68.0	68.0	68.0					7																	123346348		2203	4300	6503	SO:0001583	missense	8976	exon4			TGTCGACGGCCCA	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.419G>A	chr7.hg19:g.123346348C>T	ENSP00000223023:p.Arg140His	90.0	0.0		113.0	40.0	NM_003941	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	hg19	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962656	0.74016	.	.	ENSG00000106299	ENST00000223023	D	0.99511	-6.05	5.77	5.77	0.91146	EVH1 (1);Pleckstrin homology-type (1);	0.052002	0.85682	D	0.000000	D	0.99199	0.9722	L	0.38838	1.175	0.80722	D	1	D	0.64830	0.994	D	0.71870	0.975	D	0.99904	1.1174	10	0.72032	D	0.01	-13.4183	20.3627	0.98863	0.0:1.0:0.0:0.0	.	140	O00401	WASL_HUMAN	H	140	ENSP00000223023:R140H	ENSP00000223023:R140H	R	-	2	0	WASL	123133584	0.993000	0.37304	0.925000	0.36789	0.964000	0.63967	3.476000	0.53143	2.885000	0.99019	0.655000	0.94253	CGT	.	.		0.363	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1	NM_003941	
DENND2A	27147	hgsc.bcm.edu	37	7	140223158	140223158	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:140223158T>A	ENST00000275884.6	-	16	3031	c.2614A>T	c.(2614-2616)Agg>Tgg	p.R872W	DENND2A_ENST00000537639.1_Missense_Mutation_p.R872W|DENND2A_ENST00000496613.1_Missense_Mutation_p.R872W			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	872					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					AGCTCGTTCCTCTGTTCCAGA	0.602																																					p.R872W		Atlas-SNP	.											.	DENND2A	132	.	0			c.A2614T						.						87.0	90.0	89.0					7																	140223158		2018	4176	6194	SO:0001583	missense	27147	exon15			CGTTCCTCTGTTC	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2614A>T	chr7.hg19:g.140223158T>A	ENSP00000275884:p.Arg872Trp	62.0	0.0		63.0	26.0	NM_015689	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	hg19	CCDS43659.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.124893	0.77436	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613	T;T;T	0.05996	3.36;3.36;3.36	5.49	1.45	0.22620	.	0.527177	0.21485	N	0.073771	T	0.19565	0.0470	M	0.64404	1.975	0.49389	D	0.999786	D	0.76494	0.999	D	0.70935	0.971	T	0.00653	-1.1625	10	0.66056	D	0.02	-26.1182	13.5321	0.61627	0.0:0.0:0.5319:0.4681	.	872	Q9ULE3	DEN2A_HUMAN	W	872	ENSP00000275884:R872W;ENSP00000442245:R872W;ENSP00000419654:R872W	ENSP00000275884:R872W	R	-	1	2	DENND2A	139869627	1.000000	0.71417	0.968000	0.41197	0.867000	0.49689	2.476000	0.45171	0.345000	0.23873	0.459000	0.35465	AGG	.	.		0.602	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
DENND2A	27147	hgsc.bcm.edu	37	7	140273641	140273641	+	Silent	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:140273641T>A	ENST00000275884.6	-	5	1830	c.1413A>T	c.(1411-1413)ccA>ccT	p.P471P	DENND2A_ENST00000537639.1_Silent_p.P471P|DENND2A_ENST00000492720.1_Silent_p.P471P|DENND2A_ENST00000496613.1_Silent_p.P471P			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	471					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TGCCGTTCTGTGGGTCTCCAA	0.512																																					p.P471P		Atlas-SNP	.											.	DENND2A	132	.	0			c.A1413T						.						198.0	199.0	198.0					7																	140273641		1936	4149	6085	SO:0001819	synonymous_variant	27147	exon4			GTTCTGTGGGTCT	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1413A>T	chr7.hg19:g.140273641T>A		177.0	0.0		169.0	85.0	NM_015689	C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	hg19	CCDS43659.1																																																																																			.	.		0.512	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
TAS2R38	5726	hgsc.bcm.edu	37	7	141673266	141673266	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:141673266G>T	ENST00000547270.1	-	1	307	c.224C>A	c.(223-225)gCt>gAt	p.A75D		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	75					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					AAGCTGGATAGCACTCAGGAA	0.512																																					p.A75D		Atlas-SNP	.											.	TAS2R38	51	.	0			c.C224A						.						142.0	135.0	138.0					7																	141673266		2203	4300	6503	SO:0001583	missense	5726	exon1			TGGATAGCACTCA	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.224C>A	chr7.hg19:g.141673266G>T	ENSP00000448219:p.Ala75Asp	96.0	0.0		97.0	42.0	NM_176817	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	hg19	CCDS34765.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326344	0.24080	.	.	ENSG00000257138	ENST00000547270	T	0.38722	1.12	5.1	4.2	0.49525	.	0.313947	0.29246	N	0.012719	T	0.44623	0.1302	M	0.70595	2.14	0.23401	N	0.99776	B	0.32968	0.392	B	0.38296	0.27	T	0.45934	-0.9227	10	0.56958	D	0.05	.	9.7331	0.40372	0.096:0.0:0.904:0.0	.	75	P59533	T2R38_HUMAN	D	75	ENSP00000448219:A75D	ENSP00000331291:A75D	A	-	2	0	TAS2R38	141319735	0.135000	0.22499	0.814000	0.32528	0.054000	0.15201	2.645000	0.46621	2.659000	0.90383	0.655000	0.94253	GCT	.	.		0.512	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817	
EPHB6	2051	hgsc.bcm.edu	37	7	142563322	142563322	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:142563322G>C	ENST00000392957.2	+	8	1826	c.1039G>C	c.(1039-1041)Gtt>Ctt	p.V347L	EPHB6_ENST00000411471.2_Missense_Mutation_p.V70L|EPHB6_ENST00000442129.1_Missense_Mutation_p.V347L	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	347	Cys-rich.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.V332I(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					AGCAGCCCCCGTTTGCCCCTG	0.652																																					p.V347L		Atlas-SNP	.											EPHB6,NS,carcinoma,0,1	EPHB6	168	.	1	Substitution - Missense(1)	kidney(1)	c.G1039C						.						36.0	36.0	36.0					7																	142563322		2203	4300	6503	SO:0001583	missense	2051	exon8			GCCCCCGTTTGCC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1039G>C	chr7.hg19:g.142563322G>C	ENSP00000376684:p.Val347Leu	63.0	0.0		47.0	2.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	hg19	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	0.209	-1.038157	0.02013	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.70986	-0.48;-0.48;-0.53	5.43	-8.87	0.00792	.	1.203620	0.06175	N	0.678426	T	0.48095	0.1481	N	0.25957	0.775	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.38887	-0.9640	10	0.08837	T	0.75	.	9.4073	0.38469	0.5527:0.2561:0.1912:0.0	.	347	O15197	EPHB6_HUMAN	L	347;347;70	ENSP00000376684:V347L;ENSP00000410789:V347L;ENSP00000409061:V70L	ENSP00000376684:V347L	V	+	1	0	EPHB6	142273444	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.698000	0.05092	-1.875000	0.01132	-1.615000	0.00797	GTT	.	.		0.652	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
PKHD1L1	93035	hgsc.bcm.edu	37	8	110376804	110376804	+	Silent	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr8:110376804A>T	ENST00000378402.5	+	2	206	c.102A>T	c.(100-102)acA>acT	p.T34T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	34	IPT/TIG 1.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCAAAGTCACAGAAATAATAC	0.323										HNSCC(38;0.096)																											p.T34T		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.A102T						.						52.0	49.0	50.0					8																	110376804		1813	4070	5883	SO:0001819	synonymous_variant	93035	exon2			AGTCACAGAAATA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.102A>T	chr8.hg19:g.110376804A>T		66.0	0.0		141.0	98.0	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	hg19	CCDS47911.1																																																																																			.	.		0.323	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CCDC180	100499483	hgsc.bcm.edu	37	9	100080860	100080860	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr9:100080860A>T	ENST00000357054.1	+	24	2559	c.1624A>T	c.(1624-1626)Atc>Ttc	p.I542F	CCDC180_ENST00000411667.2_Missense_Mutation_p.I400F|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_Intron|CCDC180_ENST00000375202.2_Missense_Mutation_p.I403F|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.I403F			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	542						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TCTCTGCACCATCTGGTATGG	0.607																																					p.I403F		Atlas-SNP	.											.	.	.	.	0			c.A1207T						.						61.0	52.0	55.0					9																	100080860		2203	4300	6503	SO:0001583	missense	0	exon10			TGCACCATCTGGT	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1624A>T	chr9.hg19:g.100080860A>T	ENSP00000349562:p.Ile542Phe	47.0	0.0		56.0	29.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.53	2.264216	0.39995	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	4.61	-2.71	0.05986	.	0.685427	0.13838	N	0.359248	T	0.18425	0.0442	L	0.60455	1.87	0.09310	N	1	B;B;B;B	0.22003	0.063;0.009;0.025;0.009	B;B;B;B	0.19946	0.018;0.016;0.027;0.016	T	0.22487	-1.0215	10	0.40728	T	0.16	-4.2907	2.5815	0.04819	0.2864:0.4495:0.0983:0.1657	.	400;542;403;542	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	F	542;403;400;426;403	ENSP00000349562:I542F;ENSP00000364348:I403F;ENSP00000414000:I400F;ENSP00000434727:I403F	ENSP00000349562:I542F	I	+	1	0	C9orf174	99120681	0.006000	0.16342	0.065000	0.19835	0.757000	0.42996	-0.142000	0.10311	-0.254000	0.09500	0.460000	0.39030	ATC	.	.		0.607	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
FAS	355	hgsc.bcm.edu	37	10	90768661	90768661	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr10:90768661T>C	ENST00000355279.2	+	4	350	c.350T>C	c.(349-351)aTa>aCa	p.I117T	FAS_ENST00000357339.2_Missense_Mutation_p.I117T|FAS_ENST00000352159.4_Missense_Mutation_p.I117T|FAS_ENST00000313771.5_3'UTR|FAS_ENST00000355740.2_Missense_Mutation_p.I117T			P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	GAAGTGGAAATAAACTGCACC	0.398																																					p.I117T		Atlas-SNP	.											.	FAS	47	.	0			c.T350C						.						223.0	247.0	239.0					10																	90768661		2203	4300	6503	SO:0001583	missense	355	exon4			TGGAAATAAACTG	M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355279.2:c.350T>C	chr10.hg19:g.90768661T>C	ENSP00000347426:p.Ile117Thr	117.0	0.0		139.0	47.0	NM_152872	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355279.2	hg19	CCDS7395.1	.	.	.	.	.	.	.	.	.	.	T	1.430	-0.570482	0.03910	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000352159;ENST00000357339;ENST00000355279;ENST00000371875	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	4.2	-6.35	0.01975	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.748086	0.12752	N	0.442089	T	0.55893	0.1949	N	0.00308	-1.67	0.09310	N	1	B;B;B	0.15473	0.007;0.013;0.004	B;B;B	0.24701	0.007;0.055;0.009	T	0.66344	-0.5947	10	0.02654	T	1	-5.664	1.1022	0.01686	0.1974:0.3021:0.2936:0.2069	.	117;117;117	P25445-6;Q5T9P3;P25445	.;.;TNR6_HUMAN	T	144;117;117;117;117;117	ENSP00000347979:I117T;ENSP00000345601:I117T;ENSP00000349896:I117T;ENSP00000347426:I117T	ENSP00000345601:I117T	I	+	2	0	FAS	90758641	0.000000	0.05858	0.037000	0.18230	0.220000	0.24768	-0.773000	0.04689	-1.254000	0.02485	-1.437000	0.01076	ATA	.	.		0.398	FAS-011	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000049280.2		
TRPM5	29850	hgsc.bcm.edu	37	11	2436237	2436237	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:2436237A>T	ENST00000155858.6	-	10	1528	c.1520T>A	c.(1519-1521)cTg>cAg	p.L507Q	TRPM5_ENST00000528453.1_Missense_Mutation_p.L507Q|TRPM5_ENST00000533060.1_Missense_Mutation_p.L507Q|TRPM5_ENST00000452833.1_Missense_Mutation_p.L509Q	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CAGGTCCAGCAGCCACTTCTG	0.697																																					p.L507Q	NSCLC(1;49 61 17205 18850 43201)	Atlas-SNP	.											.	TRPM5	86	.	0			c.T1520A						.						19.0	26.0	23.0					11																	2436237		2167	4262	6429	SO:0001583	missense	29850	exon10			TCCAGCAGCCACT	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.1520T>A	chr11.hg19:g.2436237A>T	ENSP00000155858:p.Leu507Gln	54.0	0.0		68.0	29.0	NM_014555		Missense_Mutation	SNP	ENST00000155858.6	hg19	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.359442	0.61403	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	3.68	-7.35	0.01422	.	1.962480	0.02611	N	0.102143	T	0.71264	0.3319	L	0.42245	1.32	0.36686	D	0.879339	P;P;P	0.44195	0.809;0.828;0.565	B;P;P	0.47705	0.353;0.555;0.543	T	0.63954	-0.6520	10	0.20519	T	0.43	-1.3285	6.8708	0.24119	0.1962:0.0:0.5473:0.2565	.	507;509;507	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	Q	501;507;509;507;507;507	ENSP00000434383:L501Q;ENSP00000155858:L507Q;ENSP00000387965:L509Q;ENSP00000434121:L507Q;ENSP00000436809:L507Q	ENSP00000155858:L507Q	L	-	2	0	TRPM5	2392813	0.012000	0.17670	0.828000	0.32881	0.990000	0.78478	0.122000	0.15687	-1.643000	0.01519	0.402000	0.26972	CTG	.	.		0.697	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	
ANO5	203859	hgsc.bcm.edu	37	11	22257809	22257809	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:22257809A>G	ENST00000324559.8	+	8	1066	c.749A>G	c.(748-750)tAt>tGt	p.Y250C		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	250					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCATCTGCCTATCCACTCCAT	0.388																																					p.Y250C		Atlas-SNP	.											.	ANO5	162	.	0			c.A749G						.						125.0	107.0	113.0					11																	22257809		2203	4300	6503	SO:0001583	missense	203859	exon8			CTGCCTATCCACT	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.749A>G	chr11.hg19:g.22257809A>G	ENSP00000315371:p.Tyr250Cys	111.0	0.0		97.0	41.0	NM_213599		Missense_Mutation	SNP	ENST00000324559.8	hg19	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.656247	0.47467	.	.	ENSG00000171714	ENST00000324559	T	0.70631	-0.5	5.64	1.71	0.24356	.	0.222686	0.48286	D	0.000196	D	0.83672	0.5305	M	0.91140	3.18	0.53688	D	0.999979	D	0.63880	0.993	P	0.61275	0.886	D	0.84460	0.0593	10	0.87932	D	0	.	11.1309	0.48347	0.605:0.0:0.0:0.395	.	250	Q75V66	ANO5_HUMAN	C	250	ENSP00000315371:Y250C	ENSP00000315371:Y250C	Y	+	2	0	ANO5	22214385	0.995000	0.38212	0.994000	0.49952	0.616000	0.37450	2.161000	0.42358	0.075000	0.16796	0.455000	0.32223	TAT	.	.		0.388	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
OR8U1	219417	hgsc.bcm.edu	37	11	56143291	56143291	+	Silent	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:56143291C>T	ENST00000302270.1	+	1	192	c.192C>T	c.(190-192)agC>agT	p.S64S		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					TCTTTCTTAGCAACCTAGCTT	0.388																																					p.S64S		Atlas-SNP	.											.	OR8U1	59	.	0			c.C192T						.						360.0	319.0	332.0					11																	56143291		1967	4166	6133	SO:0001819	synonymous_variant	219417	exon1			TCTTAGCAACCTA	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.192C>T	chr11.hg19:g.56143291C>T		103.0	0.0		81.0	33.0	NM_001005204		Silent	SNP	ENST00000302270.1	hg19	CCDS41647.1																																																																																			.	.		0.388	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
OR5B21	219968	hgsc.bcm.edu	37	11	58274925	58274925	+	Silent	SNP	T	T	A	rs146969149		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:58274925T>A	ENST00000360374.2	-	1	653	c.654A>T	c.(652-654)atA>atT	p.I218I		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TGGTGATGCATATGAAGAAGT	0.468																																					p.I218I		Atlas-SNP	.											.	OR5B21	59	.	0			c.A654T						.						73.0	70.0	71.0					11																	58274925		2201	4295	6496	SO:0001819	synonymous_variant	219968	exon1			GATGCATATGAAG		CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283		"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product							Standard	NM_001005218		Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.654A>T	chr11.hg19:g.58274925T>A		150.0	0.0		142.0	51.0	NM_001005218		Silent	SNP	ENST00000360374.2	hg19	CCDS31552.1																																																																																			.	T|1.000;C|0.000		0.468	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394891.1	NM_001005218	
KIAA1731	85459	hgsc.bcm.edu	37	11	93432696	93432696	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:93432696A>T	ENST00000325212.6	+	15	4780	c.4618A>T	c.(4618-4620)Agg>Tgg	p.R1540W	KIAA1731_ENST00000411936.1_Missense_Mutation_p.R1540W|KIAA1731_ENST00000531700.1_Intron|KIAA1731_ENST00000344196.4_De_novo_Start_InFrame			Q9C0D2	K1731_HUMAN	KIAA1731	1540						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATTGGAGAAAAGGGTATCATC	0.408																																					p.R1540W		Atlas-SNP	.											.	KIAA1731	173	.	0			c.A4618T						.						56.0	45.0	48.0					11																	93432696		692	1591	2283	SO:0001583	missense	85459	exon15			GAGAAAAGGGTAT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.4618A>T	chr11.hg19:g.93432696A>T	ENSP00000316681:p.Arg1540Trp	171.0	0.0		161.0	68.0	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	hg19	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.194829	0.38806	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.22945	1.93;1.93	5.11	2.82	0.32997	.	0.333388	0.26435	N	0.024396	T	0.41373	0.1156	L	0.58810	1.83	0.34367	D	0.691604	D	0.69078	0.997	D	0.74348	0.983	T	0.53315	-0.8456	10	0.87932	D	0	-2.5467	7.3781	0.26839	0.8577:0.0:0.1423:0.0	.	1540	Q9C0D2	K1731_HUMAN	W	1540	ENSP00000316681:R1540W;ENSP00000406505:R1540W	ENSP00000316681:R1540W	R	+	1	2	KIAA1731	93072344	1.000000	0.71417	0.429000	0.26710	0.218000	0.24690	1.037000	0.30241	0.523000	0.28482	0.533000	0.62120	AGG	.	.		0.408	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
ARHGAP42	143872	hgsc.bcm.edu	37	11	100807044	100807044	+	Silent	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:100807044T>C	ENST00000298815.8	+	8	816	c.813T>C	c.(811-813)taT>taC	p.Y271Y	snoU13_ENST00000459511.1_RNA|ARHGAP42_ENST00000524892.2_Silent_p.Y237Y	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	271	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						TGGAAGGCTATCTGTATGTCC	0.438																																					p.Y271Y		Atlas-SNP	.											.	ARHGAP42	32	.	0			c.T813C						.						72.0	66.0	68.0					11																	100807044		692	1591	2283	SO:0001819	synonymous_variant	143872	exon8			AGGCTATCTGTAT			11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.813T>C	chr11.hg19:g.100807044T>C		171.0	0.0		178.0	67.0	NM_152432	Q96M56	Silent	SNP	ENST00000298815.8	hg19																																																																																				.	.		0.438	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152432	
MMP10	4319	hgsc.bcm.edu	37	11	102650037	102650037	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:102650037T>A	ENST00000279441.4	-	3	439	c.403A>T	c.(403-405)Aaa>Taa	p.K135*		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	135					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	TTCAGAGCTTTCTCAATGGCA	0.408																																					p.K135X		Atlas-SNP	.											.	MMP10	44	.	0			c.A403T						.						157.0	154.0	155.0					11																	102650037		2203	4299	6502	SO:0001587	stop_gained	4319	exon3			GAGCTTTCTCAAT	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.403A>T	chr11.hg19:g.102650037T>A	ENSP00000279441:p.Lys135*	134.0	0.0		133.0	48.0	NM_002425	B2R9X9|Q53HH9	Nonsense_Mutation	SNP	ENST00000279441.4	hg19	CCDS8321.1	.	.	.	.	.	.	.	.	.	.	t	13.95	2.388969	0.42308	.	.	ENSG00000166670	ENST00000279441;ENST00000539681	.	.	.	4.38	4.38	0.52667	.	0.815163	0.10845	N	0.627772	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4803	0.38898	0.1577:0.0:0.0:0.8423	.	.	.	.	X	135	.	ENSP00000279441:K135X	K	-	1	0	MMP10	102155247	0.002000	0.14202	1.000000	0.80357	0.227000	0.25037	1.314000	0.33597	1.961000	0.56991	0.482000	0.46254	AAA	.	.		0.408	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1		
ZC3H12C	85463	hgsc.bcm.edu	37	11	110007788	110007788	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:110007788A>C	ENST00000278590.3	+	2	473	c.422A>C	c.(421-423)aAa>aCa	p.K141T	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.K142T|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.K110T	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	141							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CAAGACTTTAAACCTGAAGAG	0.438																																					p.K141T		Atlas-SNP	.											.	ZC3H12C	83	.	0			c.A422C						.						62.0	58.0	59.0					11																	110007788		1851	4092	5943	SO:0001583	missense	85463	exon2			ACTTTAAACCTGA		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.422A>C	chr11.hg19:g.110007788A>C	ENSP00000278590:p.Lys141Thr	116.0	0.0		82.0	29.0	NM_033390	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	hg19	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	a	13.47	2.246967	0.39697	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.36520	1.25;1.25;1.26	5.63	3.22	0.36961	.	0.805415	0.09259	U	0.826854	T	0.35158	0.0922	M	0.61703	1.905	0.39981	D	0.974919	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.07635	-1.0762	10	0.36615	T	0.2	-8.612	7.3993	0.26954	0.6548:0.2703:0.0749:0.0	.	142;141;141	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	T	141;142;110	ENSP00000278590:K141T;ENSP00000431821:K142T;ENSP00000413094:K110T	ENSP00000278590:K141T	K	+	2	0	ZC3H12C	109512998	0.588000	0.26799	0.999000	0.59377	0.987000	0.75469	1.352000	0.34033	0.372000	0.24591	0.528000	0.53228	AAA	.	.		0.438	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
SPA17	53340	hgsc.bcm.edu	37	11	124551357	124551357	+	Splice_Site	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:124551357T>C	ENST00000532692.1	+	2	1646		c.e2+2		SPA17_ENST00000524614.1_Splice_Site|SIAE_ENST00000525730.1_Intron|SPA17_ENST00000227135.2_Splice_Site			Q15506	SP17_HUMAN	sperm autoantigenic protein 17						binding of sperm to zona pellucida (GO:0007339)|epithelial cilium movement (GO:0003351)|single fertilization (GO:0007338)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|primary cilium (GO:0072372)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	5	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0223)		GCATTCGAGGTATGGTCCTTT	0.393																																					.		Atlas-SNP	.											.	SPA17	16	.	0			c.225+2T>C						.						104.0	98.0	100.0					11																	124551357		2201	4299	6500	SO:0001630	splice_region_variant	53340	exon3			TCGAGGTATGGTC	AF334735	CCDS8450.1	11q24.2	2009-03-12			ENSG00000064199	ENSG00000064199			11210	protein-coding gene	gene with protein product	"""cancer/testis antigen 22"""	608621				8688458	Standard	NM_017425		Approved	SP17, CT22	uc001qap.3	Q15506	OTTHUMG00000165927	ENST00000532692.1:c.225+2T>C	chr11.hg19:g.124551357T>C		135.0	0.0		152.0	44.0	NM_017425	B2R4F2|Q9BXF7	Splice_Site	SNP	ENST00000532692.1	hg19	CCDS8450.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.312605	0.60414	.	.	ENSG00000064199	ENST00000227135;ENST00000532692	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1564	0.72746	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPA17	124056567	1.000000	0.71417	0.998000	0.56505	0.603000	0.37013	5.632000	0.67819	2.221000	0.72209	0.455000	0.32223	.	.	.		0.393	SPA17-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387075.1	NM_017425	Intron
NOP2	4839	hgsc.bcm.edu	37	12	6666361	6666361	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr12:6666361T>C	ENST00000322166.5	-	16	2358	c.2237A>G	c.(2236-2238)cAt>cGt	p.H746R	NOP2_ENST00000382421.3_Missense_Mutation_p.H779R|IFFO1_ENST00000336604.4_5'Flank|NOP2_ENST00000545200.1_3'UTR|IFFO1_ENST00000356896.4_5'Flank|NOP2_ENST00000541778.1_Missense_Mutation_p.H742R|NOP2_ENST00000399466.2_Missense_Mutation_p.H742R|NOP2_ENST00000537442.1_Missense_Mutation_p.H746R|IFFO1_ENST00000396840.2_5'Flank|NOP2_ENST00000542015.1_5'Flank	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	746					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						AAGGGGCTGATGATGGTCCTT	0.557																																					p.H779R		Atlas-SNP	.											.	NOP2	44	.	0			c.A2336G						.						141.0	141.0	141.0					12																	6666361		1938	4164	6102	SO:0001583	missense	4839	exon17			GGCTGATGATGGT		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.2237A>G	chr12.hg19:g.6666361T>C	ENSP00000313272:p.His746Arg	193.0	0.0		210.0	80.0	NM_001258309	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	hg19	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	T	4.962	0.178738	0.09443	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000399466;ENST00000322166;ENST00000541778	T;T;T;T;T	0.13196	2.61;2.61;2.61;2.61;2.61	4.8	-9.61	0.00550	.	1.957170	0.02489	N	0.089278	T	0.04497	0.0123	N	0.08118	0	0.09310	N	1	B;B	0.14805	0.011;0.008	B;B	0.16289	0.01;0.015	T	0.34254	-0.9836	10	0.15952	T	0.53	7.426	0.546	0.00654	0.2117:0.1569:0.2598:0.3715	.	746;742	P46087;P46087-2	NOP2_HUMAN;.	R	746;779;742;746;742	ENSP00000444437:H746R;ENSP00000371858:H779R;ENSP00000382392:H742R;ENSP00000313272:H746R;ENSP00000443150:H742R	ENSP00000313272:H746R	H	-	2	0	NOP2	6536622	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-3.144000	0.00585	-2.937000	0.00298	0.533000	0.62120	CAT	.	.		0.557	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170	
TAS2R31	259290	hgsc.bcm.edu	37	12	11183213	11183213	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr12:11183213T>A	ENST00000390675.2	-	1	793	c.722A>T	c.(721-723)tAc>tTc	p.Y241F	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	241					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						GGACAGAAAGTAAACGGCACA	0.403																																					p.Y241F		Atlas-SNP	.											.	TAS2R31	24	.	0			c.A722T						.						189.0	195.0	193.0					12																	11183213		2202	4299	6501	SO:0001583	missense	259290	exon1			AGAAAGTAAACGG	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.722A>T	chr12.hg19:g.11183213T>A	ENSP00000375093:p.Tyr241Phe	256.0	1.0		274.0	118.0	NM_176885	P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	hg19	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	2.379	-0.342482	0.05243	.	.	ENSG00000256436	ENST00000390675	T	0.01172	5.23	2.42	2.42	0.29668	.	.	.	.	.	T	0.01592	0.0051	L	0.41236	1.265	0.09310	N	1	B	0.31581	0.329	B	0.40375	0.327	T	0.49062	-0.8978	9	0.23302	T	0.38	.	6.6665	0.23042	0.0:0.0:0.0:1.0	.	241	P59538	T2R31_HUMAN	F	241	ENSP00000375093:Y241F	ENSP00000375093:Y241F	Y	-	2	0	TAS2R31	11074480	0.001000	0.12720	0.006000	0.13384	0.070000	0.16714	0.679000	0.25291	1.132000	0.42129	0.163000	0.16589	TAC	.	.		0.403	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
PPP1R12A	4659	hgsc.bcm.edu	37	12	80328602	80328602	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr12:80328602T>C	ENST00000450142.2	-	1	376	c.110A>G	c.(109-111)aAg>aGg	p.K37R	PPP1R12A_ENST00000550107.1_Missense_Mutation_p.K37R|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.K37R|RP11-84G21.1_ENST00000552885.1_RNA|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.K37R	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	37					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						ATCGTCGAACTTCACCTTGGT	0.637																																					p.K37R		Atlas-SNP	.											PPP1R12A,bladder,carcinoma,0,1	PPP1R12A	76	.	0			c.A110G						.						42.0	48.0	46.0					12																	80328602		2042	4202	6244	SO:0001583	missense	4659	exon1			TCGAACTTCACCT	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.110A>G	chr12.hg19:g.80328602T>C	ENSP00000389168:p.Lys37Arg	96.0	0.0		89.0	36.0	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	hg19	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	T	7.015	0.557564	0.13436	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000550107;ENST00000547330	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.01	3.86	0.44501	Ankyrin repeat-containing domain (1);	0.156299	0.56097	D	0.000025	T	0.41743	0.1172	N	0.11284	0.12	0.58432	D	0.999995	P;B;B;P	0.47604	0.855;0.003;0.001;0.898	P;B;B;P	0.61397	0.888;0.021;0.002;0.836	T	0.19224	-1.0312	10	0.19590	T	0.45	.	9.3024	0.37853	0.0:0.0818:0.0:0.9182	.	37;37;37;37	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	R	37	ENSP00000261207:K37R;ENSP00000389168:K37R;ENSP00000416769:K37R;ENSP00000446855:K37R;ENSP00000446816:K37R	ENSP00000261207:K37R	K	-	2	0	PPP1R12A	78852733	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.139000	0.77314	0.930000	0.37217	0.533000	0.62120	AAG	.	.		0.637	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
STAB2	55576	hgsc.bcm.edu	37	12	104149232	104149232	+	Missense_Mutation	SNP	C	C	G	rs375211716		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr12:104149232C>G	ENST00000388887.2	+	62	7071	c.6867C>G	c.(6865-6867)tgC>tgG	p.C2289W	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						ATGTCTTCTGCTATCGGATGA	0.557																																					p.C2289W		Atlas-SNP	.											.	STAB2	370	.	0			c.C6867G						.						137.0	117.0	124.0					12																	104149232		2203	4300	6503	SO:0001583	missense	55576	exon62			CTTCTGCTATCGG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6867C>G	chr12.hg19:g.104149232C>G	ENSP00000373539:p.Cys2289Trp	89.0	0.0		83.0	38.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	hg19	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071949	0.55646	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	T	0.24538	1.85	5.26	1.33	0.21861	C-type lectin fold (1);Link (3);C-type lectin-like (1);FAS1 domain (1);	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	H	0.95365	3.66	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.65236	-0.6217	10	0.87932	D	0	.	9.5713	0.39429	0.0:0.6513:0.0:0.3487	.	2289	Q8WWQ8	STAB2_HUMAN	W	2289;976	ENSP00000373539:C2289W	ENSP00000258495:C976W	C	+	3	2	STAB2	102673362	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.999000	0.29757	0.592000	0.29728	0.650000	0.86243	TGC	.	.		0.557	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
ISCU	23479	hgsc.bcm.edu	37	12	108960984	108960984	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr12:108960984A>T	ENST00000311893.9	+	4	380	c.358A>T	c.(358-360)Atc>Ttc	p.I120F	ISCU_ENST00000431221.2_Missense_Mutation_p.I120F|ISCU_ENST00000547005.1_Missense_Mutation_p.I120F|ISCU_ENST00000535729.1_Missense_Mutation_p.I120F|ISCU_ENST00000392807.4_Missense_Mutation_p.I95F|ISCU_ENST00000539593.1_Missense_Mutation_p.I120F|ISCU_ENST00000338291.4_Missense_Mutation_p.I95F	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	120					iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)			kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						AGCCTTGACTATCAAAAACAC	0.488																																					p.I120F		Atlas-SNP	.											.	ISCU	19	.	0			c.A358T						.						147.0	128.0	134.0					12																	108960984		2203	4300	6503	SO:0001583	missense	23479	exon4			TTGACTATCAAAA	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.358A>T	chr12.hg19:g.108960984A>T	ENSP00000310623:p.Ile120Phe	84.0	0.0		58.0	22.0	NM_213595	Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	hg19	CCDS44966.1	.	.	.	.	.	.	.	.	.	.	A	29.0	4.964934	0.92855	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000392807;ENST00000338291;ENST00000539593	T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	5.59	5.59	0.84812	NIF system FeS cluster assembly, NifU, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91660	0.7364	M	0.92268	3.29	0.80722	D	1	D;D;D;D;D;D	0.71674	0.995;0.998;0.984;0.994;0.986;0.983	D;D;D;D;D;P	0.72075	0.976;0.974;0.935;0.959;0.942;0.904	D	0.93544	0.6880	10	0.87932	D	0	.	14.759	0.69590	1.0:0.0:0.0:0.0	.	120;120;120;120;95;95	B3KQ30;Q9H1K1;B4DNC9;F5H5N2;B1P7G3;Q9H1K1-2	.;ISCU_HUMAN;.;.;.;.	F	120;120;120;120;95;95;120	ENSP00000445598:I120F;ENSP00000411108:I120F;ENSP00000446606:I120F;ENSP00000310623:I120F;ENSP00000376554:I95F;ENSP00000344584:I95F;ENSP00000443272:I120F	ENSP00000310623:I120F	I	+	1	0	ISCU	107485113	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.294000	0.89934	2.137000	0.66172	0.533000	0.62120	ATC	.	.		0.488	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301	
NAA16	79612	hgsc.bcm.edu	37	13	41946367	41946367	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr13:41946367A>T	ENST00000379406.3	+	16	2300	c.1976A>T	c.(1975-1977)aAg>aTg	p.K659M	NAA16_ENST00000497143.1_3'UTR	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	659					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GAAGCCGTTAAGTTCCTTATA	0.284																																					p.K659M		Atlas-SNP	.											.	NAA16	74	.	0			c.A1976T						.						78.0	80.0	80.0					13																	41946367		2203	4289	6492	SO:0001583	missense	79612	exon16			CCGTTAAGTTCCT	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1976A>T	chr13.hg19:g.41946367A>T	ENSP00000368716:p.Lys659Met	272.0	0.0		251.0	101.0	NM_024561	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	hg19	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287525	0.80803	.	.	ENSG00000172766	ENST00000379406	T	0.54866	0.55	5.03	5.03	0.67393	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000001	T	0.74921	0.3780	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.79543	-0.1760	10	0.62326	D	0.03	-13.1982	14.7201	0.69300	1.0:0.0:0.0:0.0	.	659	Q6N069	NAA16_HUMAN	M	659	ENSP00000368716:K659M	ENSP00000368716:K659M	K	+	2	0	NAA16	40844367	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.654000	0.91092	1.876000	0.54355	0.482000	0.46254	AAG	.	.		0.284	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
DLEU7	220107	hgsc.bcm.edu	37	13	51417697	51417697	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr13:51417697C>T	ENST00000504404.1	-	1	135	c.86G>A	c.(85-87)gGc>gAc	p.G29D	DLEU7-AS1_ENST00000413510.2_RNA|DLEU7_ENST00000400393.3_Missense_Mutation_p.G29D			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	29													Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		GTCCCCCCAGCCCCACTCCTG	0.741																																					p.G29D		Atlas-SNP	.											.	DLEU7	6	.	0			c.G86A						.						2.0	3.0	3.0					13																	51417697		1396	3132	4528	SO:0001583	missense	220107	exon1			CCCCAGCCCCACT	AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.86G>A	chr13.hg19:g.51417697C>T	ENSP00000427177:p.Gly29Asp	26.0	0.0		22.0	12.0	NM_198989	Q2M2E4|Q6ZT82	Missense_Mutation	SNP	ENST00000504404.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.43	2.234208	0.39498	.	.	ENSG00000186047	ENST00000400393;ENST00000504404;ENST00000335465	T;T	0.55413	0.52;0.61	4.11	2.16	0.27623	.	0.277119	0.26203	N	0.025729	T	0.39733	0.1089	L	0.43152	1.355	0.42061	D	0.991166	B;B	0.31413	0.322;0.322	B;B	0.28784	0.065;0.094	T	0.38779	-0.9645	10	0.72032	D	0.01	.	7.2979	0.26403	0.0:0.7541:0.0:0.2459	.	29;29	Q6UYE1;Q6UYE1-2	LEU7_HUMAN;.	D	29	ENSP00000420976:G29D;ENSP00000427177:G29D	ENSP00000439677:G29D	G	-	2	0	DLEU7	50315698	0.992000	0.36948	0.992000	0.48379	0.990000	0.78478	1.189000	0.32114	0.924000	0.37069	0.561000	0.74099	GGC	.	.		0.741	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045005.2	NM_198989	
LINC00283	100874057	hgsc.bcm.edu	37	13	103398417	103398417	+	RNA	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr13:103398417C>T	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		TTTTCTGTTTCGTTGGCTTTT	0.418																																					p.E1544K		Atlas-SNP	.											.	.	.	.	0			c.G4630A						.						159.0	139.0	145.0					13																	103398417		692	1590	2282			643677	exon4			CTGTTTCGTTGGC			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103398417C>T		125.0	0.0		139.0	45.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.418	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
DLGAP5	9787	hgsc.bcm.edu	37	14	55650384	55650384	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr14:55650384T>A	ENST00000247191.2	-	3	542	c.326A>T	c.(325-327)cAg>cTg	p.Q109L	DLGAP5_ENST00000395425.2_Missense_Mutation_p.Q109L	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	109					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						TTTCTCTCTCTGCTCTTTCAA	0.368																																					p.Q109L		Atlas-SNP	.											.	DLGAP5	84	.	0			c.A326T						.						87.0	75.0	79.0					14																	55650384		2203	4299	6502	SO:0001583	missense	9787	exon3			TCTCTCTGCTCTT	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.326A>T	chr14.hg19:g.55650384T>A	ENSP00000247191:p.Gln109Leu	172.0	0.0		165.0	62.0	NM_014750	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	hg19	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.631196	0.87660	.	.	ENSG00000126787	ENST00000395425;ENST00000247191;ENST00000557645;ENST00000554067	T;T;T;T	0.46063	2.46;2.46;2.46;0.88	5.55	5.55	0.83447	.	0.139018	0.50627	D	0.000104	T	0.63873	0.2548	M	0.76002	2.32	0.45150	D	0.998169	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.961	T	0.64550	-0.6381	10	0.42905	T	0.14	.	15.6662	0.77230	0.0:0.0:0.0:1.0	.	109;109	A8MTM6;Q15398	.;DLGP5_HUMAN	L	109	ENSP00000378815:Q109L;ENSP00000247191:Q109L;ENSP00000451747:Q109L;ENSP00000452168:Q109L	ENSP00000247191:Q109L	Q	-	2	0	DLGAP5	54720137	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.830000	0.62745	2.243000	0.73865	0.533000	0.62120	CAG	.	.		0.368	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
PGF	5228	hgsc.bcm.edu	37	14	75412966	75412966	+	Intron	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr14:75412966C>T	ENST00000405431.2	-	6	638				PGF_ENST00000238607.6_Silent_p.K144K|PGF_ENST00000555567.1_Silent_p.K145K|PGF_ENST00000553716.1_Intron			P49763	PLGF_HUMAN	placental growth factor						branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of morphogenesis of a branching structure (GO:0060688)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.00668)	Aflibercept(DB08885)	TCCCCCTGCCCTTGGGTCTCC	0.657											OREG0022810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K145K	GBM(127;389 2301 5452 48547)	Atlas-SNP	.											.	PGF	23	.	0			c.G435A						.						103.0	83.0	89.0					14																	75412966		2203	4300	6503	SO:0001627	intron_variant	5228	exon6			CCTGCCCTTGGGT	S72960	CCDS9835.1, CCDS55932.1, CCDS73664.1	14q24.3	2013-02-18	2008-03-20		ENSG00000119630	ENSG00000119630			8893	protein-coding gene	gene with protein product	"""placenta growth factor"""	601121	"""placental growth factor-like"", ""placental growth factor, vascular endothelial growth factor-related protein"""	PGFL		7681160	Standard	NM_002632		Approved	PLGF, PlGF-2, PlGF, SHGC-10760, D12S1900	uc001xqz.3	P49763	OTTHUMG00000171496	ENST00000405431.2:c.638+115G>A	chr14.hg19:g.75412966C>T		66.0	0.0	1160	67.0	27.0	NM_002632	Q07101|Q9BV78|Q9Y6S8	Silent	SNP	ENST00000405431.2	hg19	CCDS9835.1																																																																																			.	.		0.657	PGF-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414064.1	NM_002632	
DMXL2	23312	hgsc.bcm.edu	37	15	51860705	51860705	+	Silent	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr15:51860705T>A	ENST00000251076.5	-	3	551	c.264A>T	c.(262-264)atA>atT	p.I88I	DMXL2_ENST00000449909.3_Silent_p.I88I|DMXL2_ENST00000543779.2_Silent_p.I88I|DMXL2_ENST00000560421.1_5'UTR	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	88						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TATGAGAATTTATGCCCAAGG	0.269																																					p.I88I		Atlas-SNP	.											.	DMXL2	262	.	0			c.A264T						.						30.0	30.0	30.0					15																	51860705		2186	4273	6459	SO:0001819	synonymous_variant	23312	exon3			AGAATTTATGCCC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.264A>T	chr15.hg19:g.51860705T>A		503.0	1.0		482.0	214.0	NM_001174117	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	hg19	CCDS10141.1																																																																																			.	.		0.269	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
DYX1C1	161582	hgsc.bcm.edu	37	15	55759146	55759146	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr15:55759146T>A	ENST00000321149.3	-	5	986	c.619A>T	c.(619-621)Aga>Tga	p.R207*	DYX1C1_ENST00000348518.3_Nonsense_Mutation_p.R207*|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000380679.1_Nonsense_Mutation_p.R207*|DYX1C1_ENST00000448430.2_Nonsense_Mutation_p.R207*|DYX1C1_ENST00000457155.2_Nonsense_Mutation_p.R207*	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	207					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		GCAAGATTTCTAGATGCCAAA	0.269																																					p.R207X		Atlas-SNP	.											.	DYX1C1	54	.	0			c.A619T						.						38.0	42.0	41.0					15																	55759146		2189	4275	6464	SO:0001587	stop_gained	161582	exon5			GATTTCTAGATGC		CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.619A>T	chr15.hg19:g.55759146T>A	ENSP00000323275:p.Arg207*	284.0	0.0		242.0	91.0	NM_001033560	Q6P5Y9|Q8N1S6	Nonsense_Mutation	SNP	ENST00000321149.3	hg19	CCDS10154.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.626501	0.46840	.	.	ENSG00000256061	ENST00000420792;ENST00000448430;ENST00000380679;ENST00000457155;ENST00000321149;ENST00000348518	.	.	.	3.61	3.61	0.41365	.	0.994303	0.08132	U	0.992929	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	8.9152	0.35576	0.0:0.0:0.0:1.0	.	.	.	.	X	207	.	ENSP00000323275:R207X	R	-	1	2	DYX1C1	53546438	0.008000	0.16893	0.003000	0.11579	0.016000	0.09150	1.322000	0.33689	1.873000	0.54277	0.460000	0.39030	AGA	.	.		0.269	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1	NM_130810	
C15orf39	56905	hgsc.bcm.edu	37	15	75501101	75501101	+	Silent	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr15:75501101G>A	ENST00000360639.2	+	2	3032	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	C15orf39_ENST00000394987.4_Silent_p.Q904Q|RP11-69H7.3_ENST00000563568.1_RNA|C15orf39_ENST00000567617.1_Silent_p.Q904Q			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	904						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CGCTGCGCCAGCTGCCGGACA	0.697																																					p.Q904Q		Atlas-SNP	.											.	C15orf39	64	.	0			c.G2712A						.						26.0	24.0	25.0					15																	75501101		2197	4293	6490	SO:0001819	synonymous_variant	56905	exon2			GCGCCAGCTGCCG	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2712G>A	chr15.hg19:g.75501101G>A		29.0	0.0		52.0	22.0	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Silent	SNP	ENST00000360639.2	hg19	CCDS10276.1																																																																																			.	.		0.697	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
AKAP13	11214	hgsc.bcm.edu	37	15	86122602	86122602	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr15:86122602G>T	ENST00000394518.2	+	7	1398	c.1303G>T	c.(1303-1305)Gac>Tac	p.D435Y	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.D435Y	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	435					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						AATGCCCACAGACCAGGAGTC	0.522																																					p.D435Y	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.G1303T						.						58.0	63.0	61.0					15																	86122602		2202	4299	6501	SO:0001583	missense	11214	exon7			CCCACAGACCAGG	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1303G>T	chr15.hg19:g.86122602G>T	ENSP00000378026:p.Asp435Tyr	179.0	0.0		143.0	56.0	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648623	0.47258	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.11604	2.76;2.76	5.46	0.979	0.19745	.	.	.	.	.	T	0.08044	0.0201	L	0.27053	0.805	0.09310	N	1	B;B	0.14012	0.005;0.009	B;B	0.14023	0.005;0.01	T	0.32241	-0.9914	9	0.62326	D	0.03	.	8.2193	0.31532	0.0:0.1432:0.3882:0.4686	.	435;435	Q12802;Q12802-2	AKP13_HUMAN;.	Y	435;435;434;434	ENSP00000354718:D435Y;ENSP00000378026:D435Y	ENSP00000354718:D435Y	D	+	1	0	AKAP13	83923606	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.258000	0.18387	0.307000	0.22880	-0.182000	0.12963	GAC	.	.		0.522	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
SV2B	9899	hgsc.bcm.edu	37	15	91769596	91769596	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr15:91769596G>A	ENST00000394232.1	+	2	573	c.103G>A	c.(103-105)Gtc>Atc	p.V35I	SV2B_ENST00000545111.2_Intron|SV2B_ENST00000557291.1_Intron|SV2B_ENST00000330276.4_Missense_Mutation_p.V35I	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	35					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			ACAGAGTGATGTCACCGAAGG	0.532																																					p.V35I		Atlas-SNP	.											.	SV2B	98	.	0			c.G103A						.						145.0	117.0	126.0					15																	91769596		2198	4298	6496	SO:0001583	missense	9899	exon3			AGTGATGTCACCG	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.103G>A	chr15.hg19:g.91769596G>A	ENSP00000377779:p.Val35Ile	81.0	0.0		79.0	38.0	NM_014848	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	hg19	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064438	0.55432	.	.	ENSG00000185518	ENST00000394232;ENST00000330276	T;T	0.28666	1.6;1.6	5.71	5.71	0.89125	.	0.097447	0.64402	D	0.000002	T	0.26159	0.0638	N	0.22421	0.69	0.34581	D	0.714444	B	0.26120	0.142	B	0.25759	0.063	T	0.28808	-1.0032	10	0.66056	D	0.02	-22.1591	18.4162	0.90571	0.0:0.0:1.0:0.0	.	35	Q7L1I2	SV2B_HUMAN	I	35	ENSP00000377779:V35I;ENSP00000332818:V35I	ENSP00000332818:V35I	V	+	1	0	SV2B	89570600	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	4.022000	0.57203	2.703000	0.92315	0.563000	0.77884	GTC	.	.		0.532	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
TAT	6898	hgsc.bcm.edu	37	16	71602186	71602186	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr16:71602186C>A	ENST00000355962.4	-	12	1359	c.1226G>T	c.(1225-1227)tGc>tTc	p.C409F	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	409					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	GTACTCAAAGCACTGCAAAAA	0.502																																					p.C409F	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Atlas-SNP	.											.	TAT	80	.	0			c.G1226T						.						54.0	45.0	48.0					16																	71602186		2198	4300	6498	SO:0001630	splice_region_variant	6898	exon12			TCAAAGCACTGCA		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.1225-1G>T	chr16.hg19:g.71602186C>A		89.0	0.0		92.0	40.0	NM_000353	B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	hg19	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.149970	0.57151	.	.	ENSG00000198650	ENST00000355962	D	0.90324	-2.65	6.02	6.02	0.97574	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.089128	0.85682	D	0.000000	D	0.96144	0.8743	M	0.88450	2.955	0.80722	D	1	D	0.76494	0.999	D	0.65773	0.938	D	0.95834	0.8860	10	0.66056	D	0.02	-19.3887	20.5407	0.99260	0.0:1.0:0.0:0.0	.	409	P17735	ATTY_HUMAN	F	409	ENSP00000348234:C409F	ENSP00000348234:C409F	C	-	2	0	TAT	70159687	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	5.165000	0.64959	2.865000	0.98341	0.655000	0.94253	TGC	.	.		0.502	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		Missense_Mutation
USP22	23326	hgsc.bcm.edu	37	17	20908264	20908264	+	Silent	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr17:20908264C>T	ENST00000261497.4	-	11	1565	c.1362G>A	c.(1360-1362)acG>acA	p.T454T	USP22_ENST00000537526.2_Silent_p.T442T|RP11-344E13.3_ENST00000583481.1_RNA|RP11-344E13.3_ENST00000581958.1_RNA|USP22_ENST00000455117.2_Intron	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	454	USP.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						TGAGACTGTCCGTGGGCTGCT	0.542																																					p.T454T		Atlas-SNP	.											.	USP22	45	.	0			c.G1362A						.						239.0	250.0	246.0					17																	20908264		2063	4209	6272	SO:0001819	synonymous_variant	23326	exon11			ACTGTCCGTGGGC	AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.1362G>A	chr17.hg19:g.20908264C>T		74.0	0.0		109.0	43.0	NM_015276	A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Silent	SNP	ENST00000261497.4	hg19	CCDS42285.1																																																																																			.	.		0.542	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1		
SPATA32	124783	hgsc.bcm.edu	37	17	43332862	43332862	+	Silent	SNP	G	G	A	rs373812499		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr17:43332862G>A	ENST00000331780.4	-	4	782	c.687C>T	c.(685-687)tcC>tcT	p.S229S	MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA|SPATA32_ENST00000543122.1_Silent_p.S208S|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	229					spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)											GGAGATCTGAGGACAGGAGGG	0.612																																					p.S229S		Atlas-SNP	.											.	.	.	.	0			c.C687T						.						89.0	70.0	77.0					17																	43332862		2203	4300	6503	SO:0001819	synonymous_variant	124783	exon4			ATCTGAGGACAGG	AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.687C>T	chr17.hg19:g.43332862G>A		89.0	0.0		103.0	51.0	NM_152343	Q7Z4U1|Q8N6V6	Silent	SNP	ENST00000331780.4	hg19	CCDS32669.1																																																																																			.	.		0.612	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450946.1	NM_152343	
CA10	56934	hgsc.bcm.edu	37	17	49825104	49825104	+	Silent	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr17:49825104A>T	ENST00000285273.4	-	5	1465	c.354T>A	c.(352-354)tcT>tcA	p.S118S	CA10_ENST00000570565.1_Silent_p.S43S|CA10_ENST00000340813.6_Silent_p.S124S|CA10_ENST00000571918.1_5'UTR|CA10_ENST00000442502.2_Silent_p.S118S|CA10_ENST00000451037.2_Silent_p.S118S	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	118					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TGGGCCCTCCAGATATGTTGA	0.552																																					p.S118S		Atlas-SNP	.											.	CA10	84	.	0			c.T354A						.						164.0	150.0	154.0					17																	49825104		2203	4300	6503	SO:0001819	synonymous_variant	56934	exon5			CCCTCCAGATATG	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.354T>A	chr17.hg19:g.49825104A>T		183.0	0.0		303.0	93.0	NM_001082534	B2R7J0|B4DGL6	Silent	SNP	ENST00000285273.4	hg19	CCDS32684.1																																																																																			.	.		0.552	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
ABCA8	10351	hgsc.bcm.edu	37	17	66865908	66865908	+	Silent	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr17:66865908C>T	ENST00000269080.2	-	36	4661	c.4524G>A	c.(4522-4524)ctG>ctA	p.L1508L	ABCA8_ENST00000430352.2_Silent_p.L1548L|ABCA8_ENST00000586539.1_Silent_p.L1548L	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1508					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TATAAACCATCAGAGAGGAGT	0.418																																					p.L1508L		Atlas-SNP	.											.	ABCA8	213	.	0			c.G4524A						.						102.0	100.0	100.0					17																	66865908		2203	4300	6503	SO:0001819	synonymous_variant	10351	exon36			AACCATCAGAGAG	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4524G>A	chr17.hg19:g.66865908C>T		283.0	0.0		395.0	107.0	NM_007168	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	hg19	CCDS11680.1																																																																																			.	.		0.418	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
DOT1L	84444	hgsc.bcm.edu	37	19	2216983	2216983	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:2216983C>T	ENST00000398665.3	+	21	2474	c.2438C>T	c.(2437-2439)cCc>cTc	p.P813L	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	813					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACGGCCTTCCCTACCAGAGC	0.657																																					p.P813L		Atlas-SNP	.											.	DOT1L	205	.	0			c.C2438T						.						40.0	44.0	43.0					19																	2216983		2109	4208	6317	SO:0001583	missense	84444	exon21			GCCTTCCCTACCA	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2438C>T	chr19.hg19:g.2216983C>T	ENSP00000381657:p.Pro813Leu	104.0	0.0		120.0	53.0	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	hg19	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.43|11.43	1.635793|1.635793	0.29068|0.29068	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000398665;ENST00000221482|ENST00000440640	T|T	0.21932|0.40225	1.98|1.04	4.89|4.89	3.83|3.83	0.44106|0.44106	.|.	0.552403|0.552403	0.19937|0.19937	N|N	0.102737|0.102737	T|T	0.52108|0.52108	0.1714|0.1714	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	0.999995|0.999995	B;B|.	0.34103|.	0.437;0.169|.	B;B|.	0.32864|.	0.154;0.079|.	T|T	0.48958|0.48958	-0.8988|-0.8988	10|8	0.87932|0.62326	D|D	0|0.03	-17.4826|-17.4826	14.2074|14.2074	0.65744|0.65744	0.0:0.8495:0.1505:0.0|0.0:0.8495:0.1505:0.0	.|.	813;813|.	Q8TEK3;Q8TEK3-2|.	DOT1L_HUMAN;.|.	L|S	813|600	ENSP00000381657:P813L|ENSP00000388276:P600S	ENSP00000221482:P813L|ENSP00000388276:P600S	P|P	+|+	2|1	0|0	DOT1L|DOT1L	2167983|2167983	0.005000|0.005000	0.15991|0.15991	0.093000|0.093000	0.20910|0.20910	0.312000|0.312000	0.27988|0.27988	1.751000|1.751000	0.38339|0.38339	1.030000|1.030000	0.39839|0.39839	0.655000|0.655000	0.94253|0.94253	CCC|CCT	.	.		0.657	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
STAP2	55620	hgsc.bcm.edu	37	19	4325516	4325516	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:4325516T>A	ENST00000594605.1	-	10	979	c.856A>T	c.(856-858)Aag>Tag	p.K286*	STAP2_ENST00000600324.1_Nonsense_Mutation_p.K286*|STAP2_ENST00000597593.1_5'UTR	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	286	Pro-rich.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GACAGCGGCTTGGGGCCACCT	0.622																																					p.K286X		Atlas-SNP	.											.	STAP2	38	.	0			c.A856T						.						74.0	82.0	79.0					19																	4325516		2203	4300	6503	SO:0001587	stop_gained	55620	exon10			GCGGCTTGGGGCC	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.856A>T	chr19.hg19:g.4325516T>A	ENSP00000471052:p.Lys286*	42.0	0.0		64.0	24.0	NM_001013841	A6NKK3|Q9NXI2	Nonsense_Mutation	SNP	ENST00000594605.1	hg19	CCDS45926.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.687924	0.88639	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.66	4.66	0.58398	.	1.536070	0.03701	U	0.248577	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.2639	10.5268	0.44954	0.0:0.0:0.0:1.0	.	.	.	.	X	286	.	ENSP00000317912:K286X	K	-	1	0	STAP2	4276516	0.044000	0.20184	0.366000	0.25914	0.089000	0.18198	1.276000	0.33156	1.752000	0.51891	0.393000	0.25936	AAG	.	.		0.622	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841	
MUC16	94025	hgsc.bcm.edu	37	19	9075725	9075725	+	Silent	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:9075725C>T	ENST00000397910.4	-	3	11924	c.11721G>A	c.(11719-11721)ctG>ctA	p.L3907L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3908	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAGCGTATTCAGGGTCCTTA	0.473																																					p.L3907L		Atlas-SNP	.											.	MUC16	4315	.	0			c.G11721A						.						88.0	81.0	83.0					19																	9075725		1919	4120	6039	SO:0001819	synonymous_variant	94025	exon3			CGTATTCAGGGTC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11721G>A	chr19.hg19:g.9075725C>T		115.0	0.0		148.0	72.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
OR7G3	390883	hgsc.bcm.edu	37	19	9236857	9236857	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:9236857C>A	ENST00000305444.2	-	1	769	c.770G>T	c.(769-771)gGg>gTg	p.G257V		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						AAGGTACACCCCAAACCCTGT	0.463																																					p.G257V		Atlas-SNP	.											.	OR7G3	41	.	0			c.G770T						.						94.0	89.0	90.0					19																	9236857		2203	4300	6503	SO:0001583	missense	390883	exon1			TACACCCCAAACC		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.770G>T	chr19.hg19:g.9236857C>A	ENSP00000302867:p.Gly257Val	192.0	0.0		183.0	91.0	NM_001001958	Q6IFJ6|Q96R99	Missense_Mutation	SNP	ENST00000305444.2	hg19	CCDS32899.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427306	0.25726	.	.	ENSG00000170920	ENST00000305444	T	0.00034	8.87	3.74	3.74	0.42951	GPCR, rhodopsin-like superfamily (1);	0.171581	0.27311	U	0.019951	T	0.00271	0.0008	L	0.44542	1.39	0.20703	N	0.999868	D	0.69078	0.997	P	0.61201	0.885	T	0.56475	-0.7973	10	0.66056	D	0.02	.	8.963	0.35858	0.2213:0.7786:0.0:0.0	.	257	Q8NG95	OR7G3_HUMAN	V	257	ENSP00000302867:G257V	ENSP00000302867:G257V	G	-	2	0	OR7G3	9097857	0.000000	0.05858	0.543000	0.28128	0.118000	0.20060	0.749000	0.26320	2.139000	0.66308	0.551000	0.68910	GGG	.	.		0.463	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1		
ZNF99	7652	hgsc.bcm.edu	37	19	22940239	22940239	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:22940239T>A	ENST00000596209.1	-	4	2562	c.2472A>T	c.(2470-2472)aaA>aaT	p.K824N	ZNF99_ENST00000397104.3_Intron|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	824					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACTGAAAAGCTTTACCACATT	0.353																																					p.K824N		Atlas-SNP	.											.	ZNF99	273	.	0			c.A2472T						.						27.0	29.0	29.0					19																	22940239		2029	4200	6229	SO:0001583	missense	7652	exon4			AAAAGCTTTACCA	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2472A>T	chr19.hg19:g.22940239T>A	ENSP00000472969:p.Lys824Asn	24.0	0.0		29.0	13.0	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF578	147660	hgsc.bcm.edu	37	19	53014421	53014421	+	Missense_Mutation	SNP	A	A	T	rs199506035		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:53014421A>T	ENST00000421239.2	+	6	1031	c.787A>T	c.(787-789)Ata>Tta	p.I263L	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TAAATTTGATATATGTGGCAA	0.358																																					p.I263L		Atlas-SNP	.											.	.	.	.	0			c.A787T						.	A	LEU/ILE	0,4396		0,0,2198	91.0	98.0	95.0		787	-2.6	0.0	19		95	1,8593		0,1,4296	no	missense	ZNF578	NM_001099694.1	5	0,1,6494	TT,TA,AA		0.0116,0.0,0.0077	benign	263/591	53014421	1,12989	2198	4297	6495	SO:0001583	missense	147660	exon6			TTTGATATATGTG	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.787A>T	chr19.hg19:g.53014421A>T	ENSP00000459216:p.Ile263Leu	239.0	0.0		233.0	97.0	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	hg19	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	5.452	0.268581	0.10349	0.0	1.16E-4	ENSG00000258405	ENST00000553364	.	.	.	1.48	-2.63	0.06133	.	.	.	.	.	T	0.15609	0.0376	N	0.16037	0.36	0.09310	N	1	B	0.20671	0.047	B	0.15484	0.013	T	0.26052	-1.0114	7	.	.	.	.	3.5799	0.07949	0.3271:0.2117:0.4612:0.0	.	263	G3V4F6	.	L	263	.	.	I	+	1	0	ZNF578	57706233	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-0.394000	0.07296	-0.017000	0.14103	-0.779000	0.03376	ATA	.	.		0.358	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
NLRP12	91662	hgsc.bcm.edu	37	19	54310876	54310876	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:54310876C>G	ENST00000324134.6	-	4	2284	c.2116G>C	c.(2116-2118)Gca>Cca	p.A706P	NLRP12_ENST00000391773.1_Missense_Mutation_p.A707P|NLRP12_ENST00000345770.5_Missense_Mutation_p.A707P|NLRP12_ENST00000351894.4_Missense_Mutation_p.A706P|NLRP12_ENST00000354278.3_Missense_Mutation_p.A706P|NLRP12_ENST00000391775.3_Missense_Mutation_p.A706P|NLRP12_ENST00000391772.1_Missense_Mutation_p.A707P|NLRP12_ENST00000535162.1_Missense_Mutation_p.A706P	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	706					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AGGGCCGCTGCCAGATGTTCA	0.562																																					p.L706L		Atlas-SNP	.											.	NLRP12	236	.	0			c.C2116C						.						108.0	92.0	97.0					19																	54310876		2203	4300	6503	SO:0001583	missense	91662	exon4			CCGCTGCCAGATG	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2116G>C	chr19.hg19:g.54310876C>G	ENSP00000319377:p.Ala706Pro	103.0	0.0		126.0	53.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	hg19	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144639	0.37825	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.90504	-2.37;-2.37;-2.37;-2.37;-2.37;-2.68;-2.68	3.77	1.26	0.21427	.	0.232869	0.21831	U	0.068479	D	0.91178	0.7221	L	0.57536	1.79	0.21020	N	0.999804	D;D;D;D	0.60160	0.987;0.96;0.978;0.977	P;P;P;P	0.59825	0.827;0.864;0.719;0.864	T	0.82675	-0.0340	10	0.52906	T	0.07	.	7.7211	0.28733	0.4775:0.5225:0.0:0.0	.	707;706;706;706	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	P	706;706;706;706;706;707;707;707	ENSP00000319377:A706P;ENSP00000438030:A706P;ENSP00000340473:A706P;ENSP00000346231:A706P;ENSP00000375655:A706P;ENSP00000375653:A707P;ENSP00000375652:A707P	ENSP00000319377:A706P	A	-	1	0	NLRP12	59002688	0.001000	0.12720	0.008000	0.14137	0.065000	0.16274	-0.337000	0.07852	0.841000	0.35020	0.485000	0.47835	GCA	.	.		0.562	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
ZNF17	7565	hgsc.bcm.edu	37	19	57929405	57929405	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr19:57929405A>G	ENST00000601808.1	+	2	354	c.141A>G	c.(139-141)gtA>gtG	p.V47V	ZNF17_ENST00000595206.1_Intron|ZNF17_ENST00000307658.7_Splice_Site_p.V49V|AC004076.7_ENST00000597410.1_Intron|AC003002.6_ENST00000596400.1_Splice_Site_p.V59V	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TGTCCTCAGTAGGTAAGGCCC	0.488																																					p.V47V	Melanoma(149;1637 1853 29914 42869 44988)	Atlas-SNP	.											.	ZNF17	49	.	0			c.A141G						.						166.0	160.0	162.0					19																	57929405		2203	4300	6503	SO:0001630	splice_region_variant	7565	exon2			CTCAGTAGGTAAG	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.142+1A>G	chr19.hg19:g.57929405A>G		124.0	0.0		109.0	46.0	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Silent	SNP	ENST00000601808.1	hg19	CCDS42636.1																																																																																			.	.		0.488	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	Silent
SRC	6714	hgsc.bcm.edu	37	20	36014520	36014520	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr20:36014520G>T	ENST00000373578.2	+	5	642	c.293G>T	c.(292-294)aGg>aTg	p.R98M	SRC_ENST00000358208.4_Missense_Mutation_p.R98M|SRC_ENST00000360723.4_Missense_Mutation_p.R98M|SRC_ENST00000445403.1_Missense_Mutation_p.R98M|SRC_ENST00000373567.2_Missense_Mutation_p.R98M|SRC_ENST00000373558.2_Missense_Mutation_p.R98M	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	98	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	TATGAGTCTAGGACGGAGACA	0.597																																					p.R98M		Atlas-SNP	.											.	SRC	52	.	0			c.G293T						.						196.0	187.0	190.0					20																	36014520		2203	4300	6503	SO:0001583	missense	6714	exon5			AGTCTAGGACGGA	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.293G>T	chr20.hg19:g.36014520G>T	ENSP00000362680:p.Arg98Met	83.0	0.0		108.0	48.0	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	hg19	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143941	0.77888	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	3.99	3.99	0.46301	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	M	0.78049	2.395	0.80722	D	1	D	0.64830	0.994	P	0.62491	0.903	T	0.68911	-0.5284	10	0.49607	T	0.09	.	13.9562	0.64150	0.0:0.0:1.0:0.0	.	98	P12931	SRC_HUMAN	M	98	ENSP00000408503:R98M;ENSP00000362680:R98M;ENSP00000353950:R98M;ENSP00000350941:R98M;ENSP00000362668:R98M;ENSP00000362659:R98M	ENSP00000350941:R98M	R	+	2	0	SRC	35447934	1.000000	0.71417	0.845000	0.33349	0.949000	0.60115	9.546000	0.98097	2.222000	0.72286	0.561000	0.74099	AGG	.	.		0.597	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
PTPRT	11122	hgsc.bcm.edu	37	20	41419871	41419871	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr20:41419871C>A	ENST00000373187.1	-	3	449	c.450G>T	c.(448-450)gaG>gaT	p.E150D	PTPRT_ENST00000373198.4_Missense_Mutation_p.E150D|PTPRT_ENST00000356100.2_Missense_Mutation_p.E150D|PTPRT_ENST00000373184.1_Missense_Mutation_p.E150D|PTPRT_ENST00000373193.3_Missense_Mutation_p.E150D|PTPRT_ENST00000373190.1_Missense_Mutation_p.E150D|PTPRT_ENST00000373201.1_Missense_Mutation_p.E150D			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	150	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGATGGCGAGCTCTGCCTTCA	0.488																																					p.E150D		Atlas-SNP	.											.	PTPRT	372	.	0			c.G450T						.						92.0	96.0	95.0					20																	41419871		2013	4195	6208	SO:0001583	missense	11122	exon3			GGCGAGCTCTGCC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.450G>T	chr20.hg19:g.41419871C>A	ENSP00000362283:p.Glu150Asp	163.0	0.0		175.0	78.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.780753	0.70222	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02323	4.34;4.34;4.34;4.34;4.34;4.34;4.34	5.67	2.11	0.27256	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.14570	0.0352	M	0.85373	2.75	0.46981	D	0.999279	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.00329	-1.1813	10	0.72032	D	0.01	.	10.4604	0.44577	0.0:0.657:0.0:0.343	.	150;150	O14522-1;O14522	.;PTPRT_HUMAN	D	150	ENSP00000362286:E150D;ENSP00000362283:E150D;ENSP00000362289:E150D;ENSP00000348408:E150D;ENSP00000362294:E150D;ENSP00000362280:E150D;ENSP00000362297:E150D	ENSP00000348408:E150D	E	-	3	2	PTPRT	40853285	0.846000	0.29590	1.000000	0.80357	0.997000	0.91878	0.030000	0.13688	0.480000	0.27534	0.561000	0.74099	GAG	.	.		0.488	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
TPTE	7179	hgsc.bcm.edu	37	21	10969094	10969094	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr21:10969094C>T	ENST00000361285.4	-	7	483	c.154G>A	c.(154-156)Gtg>Atg	p.V52M	TPTE_ENST00000342420.5_Intron|TPTE_ENST00000415664.2_Intron|TPTE_ENST00000298232.7_Intron	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	52					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATAGGTGACACCCGGGCTGCT	0.448																																					p.V52M		Atlas-SNP	.											.	TPTE	513	.	0			c.G154A						.						244.0	227.0	232.0					21																	10969094		2203	4300	6503	SO:0001583	missense	7179	exon7			GTGACACCCGGGC	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.154G>A	chr21.hg19:g.10969094C>T	ENSP00000355208:p.Val52Met	96.0	0.0		125.0	22.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	hg19	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	C	2.201	-0.382944	0.04966	.	.	ENSG00000166157	ENST00000361285;ENST00000328758	D	0.95412	-3.7	0.558	0.558	0.17266	.	8.382320	0.01685	U	0.026352	D	0.89375	0.6697	N	0.14661	0.345	0.09310	N	1	B	0.30406	0.278	B	0.21917	0.037	T	0.83140	-0.0109	9	0.45353	T	0.12	3.485	.	.	.	.	52	P56180	TPTE_HUMAN	M	52;34	ENSP00000355208:V52M	ENSP00000399471:V34M	V	-	1	0	TPTE	9990965	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.613000	0.02059	0.578000	0.29487	0.400000	0.26472	GTG	.	.		0.448	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
GRIK1	2897	hgsc.bcm.edu	37	21	30927428	30927428	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr21:30927428A>T	ENST00000399907.1	-	16	2963	c.2552T>A	c.(2551-2553)tTt>tAt	p.F851Y	GRIK1_ENST00000389125.3_Missense_Mutation_p.F836Y|GRIK1_ENST00000399913.1_Missense_Mutation_p.F851Y|GRIK1_ENST00000309434.7_Missense_Mutation_p.F853Y|GRIK1_ENST00000327783.4_Missense_Mutation_p.F851Y|GRIK1_ENST00000399914.1_Missense_Mutation_p.F836Y|GRIK1_ENST00000399909.1_Missense_Mutation_p.F836Y|GRIK1_ENST00000535441.1_Missense_Mutation_p.F853Y|GRIK1_ENST00000389124.2_Missense_Mutation_p.F851Y	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	851					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	AATAGCTACAAATACAGAAAG	0.428																																					p.F851Y		Atlas-SNP	.											.	GRIK1	293	.	0			c.T2552A						.						78.0	78.0	78.0					21																	30927428		2203	4300	6503	SO:0001583	missense	2897	exon16			GCTACAAATACAG		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2552T>A	chr21.hg19:g.30927428A>T	ENSP00000382791:p.Phe851Tyr	72.0	0.0		76.0	37.0	NM_000830	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	hg19	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.688568	0.88639	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.13196	2.61;2.68;2.67;2.62;2.67;2.64;2.68;2.68;2.68	4.88	4.88	0.63580	.	0.047550	0.85682	D	0.000000	T	0.12008	0.0292	N	0.08118	0	0.80722	D	1	P;P;P;P	0.51449	0.898;0.908;0.898;0.945	P;B;P;P	0.49140	0.493;0.397;0.493;0.601	T	0.14980	-1.0453	10	0.87932	D	0	.	14.5982	0.68422	1.0:0.0:0.0:0.0	.	836;851;851;836	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	Y	851;836;851;836;853;712;851;851;836;853	ENSP00000327687:F851Y;ENSP00000373777:F836Y;ENSP00000382797:F851Y;ENSP00000382798:F836Y;ENSP00000446326:F853Y;ENSP00000373776:F851Y;ENSP00000382791:F851Y;ENSP00000382793:F836Y;ENSP00000311646:F853Y	ENSP00000311646:F853Y	F	-	2	0	GRIK1	29849299	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.257000	0.78362	2.169000	0.68431	0.528000	0.53228	TTT	.	.		0.428	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
TOP3B	8940	hgsc.bcm.edu	37	22	22322015	22322015	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr22:22322015T>C	ENST00000398793.2	-	8	1246	c.812A>G	c.(811-813)cAg>cGg	p.Q271R	TOP3B_ENST00000413067.2_5'UTR|TOP3B_ENST00000357179.5_Missense_Mutation_p.Q271R	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	271					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TAAAAACATCTGTGCGATCTC	0.502																																					p.Q271R		Atlas-SNP	.											.	TOP3B	107	.	0			c.A812G						.						165.0	139.0	148.0					22																	22322015		2203	4300	6503	SO:0001583	missense	8940	exon8			AACATCTGTGCGA	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.812A>G	chr22.hg19:g.22322015T>C	ENSP00000381773:p.Gln271Arg	56.0	0.0		72.0	32.0	NM_003935	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	hg19	CCDS13797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.76|12.76	2.035030|2.035030	0.35893|0.35893	.|.	.|.	ENSG00000100038|ENSG00000100038	ENST00000357179;ENST00000398793|ENST00000457270	T;T|.	0.22134|.	1.97;1.97|.	4.71|4.71	4.71|4.71	0.59529|0.59529	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central (1);|.	0.054213|.	0.85682|.	D|.	0.000000|.	T|T	0.42040|0.42040	0.1185|0.1185	N|N	0.12961|0.12961	0.28|0.28	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.31251|0.31251	-0.9950|-0.9950	10|5	0.11485|.	T|.	0.65|.	.|.	14.3402|14.3402	0.66619|0.66619	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	271|.	O95985|.	TOP3B_HUMAN|.	R|G	271|66	ENSP00000349705:Q271R;ENSP00000381773:Q271R|.	ENSP00000349705:Q271R|.	Q|R	-|-	2|1	0|2	TOP3B|TOP3B	20652015|20652015	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.699000|7.699000	0.84547|0.84547	1.974000|1.974000	0.57490|0.57490	0.533000|0.533000	0.62120|0.62120	CAG|AGA	.	.		0.502	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935	
ENTHD1	150350	hgsc.bcm.edu	37	22	40283506	40283506	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr22:40283506T>A	ENST00000325157.6	-	2	497	c.247A>T	c.(247-249)Aag>Tag	p.K83*		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	83	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.									breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GATCCATTCTTGATGAGATAA	0.408																																					p.K83X		Atlas-SNP	.											.	ENTHD1	83	.	0			c.A247T						.						158.0	160.0	159.0					22																	40283506		2203	4300	6503	SO:0001587	stop_gained	150350	exon2			CATTCTTGATGAG	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.247A>T	chr22.hg19:g.40283506T>A	ENSP00000317431:p.Lys83*	106.0	0.0		114.0	53.0	NM_152512	B0QYD5|Q5H9F7|Q96LK3	Nonsense_Mutation	SNP	ENST00000325157.6	hg19	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	T	39	7.757699	0.98474	.	.	ENSG00000176177	ENST00000325157	.	.	.	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.5867	12.8344	0.57765	0.0:0.0:0.1358:0.8642	.	.	.	.	X	83	.	ENSP00000317431:K83X	K	-	1	0	ENTHD1	38613452	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.257000	0.72480	2.183000	0.69458	0.533000	0.62120	AAG	.	.		0.408	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	
SLC25A6	293	hgsc.bcm.edu	37	X	1508319	1508319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chrX:1508319C>T	ENST00000381401.5	-	2	1127	c.413G>A	c.(412-414)aGa>aAa	p.R138K	SLC25A6_ENST00000475167.1_5'UTR	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	138					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	CAGGCGGGTTCTGGCGAAATC	0.657																																					p.R138K		Atlas-SNP	.											.	SLC25A6	27	.	0			c.G413A						.						110.0	118.0	115.0					X																	1508319		2203	4296	6499	SO:0001583	missense	293	exon2			CGGGTTCTGGCGA	AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.413G>A	chrX.hg19:g.1508319C>T	ENSP00000370808:p.Arg138Lys	181.0	0.0		202.0	81.0	NM_001636	Q96C49	Missense_Mutation	SNP	ENST00000381401.5	hg19	CCDS14114.1	.	.	.	.	.	.	.	.	.	.	.	18.83	3.706665	0.68615	.	.	ENSG00000169100	ENST00000381401;ENST00000447786	T	0.64991	-0.13	1.85	1.85	0.25348	Mitochondrial carrier domain (2);	0.000000	0.47455	D	0.000230	T	0.71281	0.3321	L	0.52126	1.63	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62812	-0.6775	10	0.87932	D	0	.	12.0543	0.53524	0.0:1.0:0.0:0.0	.	138	P12236	ADT3_HUMAN	K	138	ENSP00000370808:R138K	ENSP00000370808:R138K	R	-	2	0	SLC25A6	1468319	1.000000	0.71417	0.116000	0.21606	0.609000	0.37215	5.896000	0.69822	0.982000	0.38575	0.402000	0.26972	AGA	.	.		0.657	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055596.1	NM_001636	
AR	367	hgsc.bcm.edu	37	X	66765228	66765229	+	Missense_Mutation	DNP	AG	AG	GC			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chrX:66765228_66765229AG>GC	ENST00000374690.3	+	1	764_765	c.240_241AG>GC	c.(238-243)caAGag>caGCag	p.E81Q	AR_ENST00000396044.3_Missense_Mutation_p.E81Q|AR_ENST00000504326.1_Missense_Mutation_p.E81Q|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	79	Gln-rich.|Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcaagagactagccc	0.644									Androgen Insensitivity Syndrome																												p.Q80Q|p.E81Q		Atlas-SNP	.											.	AR	249	.	0			c.A240G|c.G241C						.																																			SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GCAGCAAGAGACT|CAGCAAGAGACTA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	chrX.hg19:g.66765228_66765229delinsGC	ENSP00000363822:p.Glu81Gln	97.0|96.0	0.0		311.0|313.0	16.0|13.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent|Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.		0.644	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
MPP1	4354	hgsc.bcm.edu	37	X	154020561	154020561	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chrX:154020561C>T	ENST00000369534.3	-	2	250		c.e2-1		MPP1_ENST00000462825.1_Intron|MPP1_ENST00000393531.1_Splice_Site|MPP1_ENST00000413259.3_Splice_Site	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa						nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCGATACAGCCTGCCAAGCCA	0.517																																					.		Atlas-SNP	.											.	MPP1	52	.	0			c.103-1G>A						.						62.0	53.0	56.0					X																	154020561		2203	4300	6503	SO:0001630	splice_region_variant	4354	exon3			TACAGCCTGCCAA		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.103-1G>A	chrX.hg19:g.154020561C>T		56.0	0.0		115.0	95.0	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Splice_Site	SNP	ENST00000369534.3	hg19	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089769	0.36855	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000369531	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1399	0.65313	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MPP1	153673755	1.000000	0.71417	0.040000	0.18447	0.009000	0.06853	4.642000	0.61383	2.074000	0.62210	0.513000	0.50165	.	.	.		0.517	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	Intron
MT-ND1	4535	hgsc.bcm.edu	37	M	4130	4130	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chrM:4130C>T	ENST00000361390.2	+	1	824	c.824C>T	c.(823-825)aCa>aTa	p.T275I	MT-TA_ENST00000387392.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TQ_ENST00000387372.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	275					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ATGAATTCGAACAGCATACCC	0.438																																					p.T275M		Atlas-SNP	.											.	.	.	.	0			c.C824T						.																																			SO:0001583	missense	10625	exon1			TTCGAACAGCATA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.824C>T	chrM.hg19:g.4130C>T	ENSP00000354687:p.Thr275Ile	18.0	0.0		79.0	8.0	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	A|0.996;G|0.004		0.438	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-CYB	4519	hgsc.bcm.edu	37	M	15047	15047	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chrM:15047G>A	ENST00000361789.2	+	1	301	c.301G>A	c.(301-303)Ggc>Agc	p.G101S	MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	101					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACATCGGGCGAGGCCTATATT	0.473																																					p.G101S		Atlas-SNP	.											.	.	.	.	0			c.G301A						.																																			SO:0001583	missense	0	exon1			GGGCGAGGCCTAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.301G>A	chrM.hg19:g.15047G>A	ENSP00000354554:p.Gly101Ser	20.0	0.0		138.0	35.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.473	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
DYNC1I2	1781	hgsc.bcm.edu	37	2	172563798	172563799	+	Splice_Site	INS	-	-	CCT			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:172563798_172563799insCCT	ENST00000397119.3	+	5	413_414	c.246_247insCCT	c.(247-249)cct>CCTcct	p.83_83P>PP	DYNC1I2_ENST00000508530.1_Splice_Site_p.77_77P>PP|DYNC1I2_ENST00000263811.4_Splice_Site_p.77_77P>PP|DYNC1I2_ENST00000340296.4_Splice_Site_p.77_77P>PP|DYNC1I2_ENST00000358002.6_In_Frame_Ins_p.95_95P>PP|DYNC1I2_ENST00000409317.1_Splice_Site_p.77_77P>PP|DYNC1I2_ENST00000534253.2_In_Frame_Ins_p.83_83P>PP|DYNC1I2_ENST00000409453.1_Splice_Site_p.83_83P>PP|DYNC1I2_ENST00000409197.1_Splice_Site_p.77_77P>PP|DYNC1I2_ENST00000410079.3_In_Frame_Ins_p.95_95P>PP|DYNC1I2_ENST00000409773.1_Splice_Site_p.83_83P>PP|AC068039.1_ENST00000598148.1_Intron	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	83					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			ACTATTTAGTCCCTCCTCCTAT	0.421																																					p.V94delinsVP		Atlas-INDEL	.											.	DYNC1I2	43	.	0			c.282_283insCCT						.																																			SO:0001630	splice_region_variant	1781	exon4			.	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.245-1->CCT	chr2.hg19:g.172563805_172563807dupCCT		277.0	0.0		269.0	91.0	NM_001271786	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	In_Frame_Ins	INS	ENST00000397119.3	hg19	CCDS46450.1																																																																																			.	.		0.421	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333683.2	NM_001378	In_Frame_Ins
OR1L3	26735	hgsc.bcm.edu	37	9	125437433	125437434	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr9:125437433_125437434delCT	ENST00000304820.2	+	1	119_120	c.25_26delCT	c.(25-27)ctcfs	p.L9fs		NM_001005234.1	NP_001005234.1	Q8NH93	OR1L3_HUMAN	olfactory receptor, family 1, subfamily L, member 3	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	16						CCTGACAAGACTCTCTGAATTT	0.411																																					p.8_9del		Atlas-INDEL	.											.	OR1L3	51	.	0			c.24_25del						.																																			SO:0001589	frameshift_variant	26735	exon1			.		CCDS35128.1	9q33.2	2013-09-20			ENSG00000171481	ENSG00000171481		"""GPCR / Class A : Olfactory receptors"""	8215	protein-coding gene	gene with protein product							Standard	NM_001005234		Approved	OR9-D	uc011lzb.2	Q8NH93	OTTHUMG00000020619	ENST00000304820.2:c.25_26delCT	chr9.hg19:g.125437437_125437438delCT	ENSP00000302863:p.Leu9fs	101.0	0.0		73.0	25.0	NM_001005234	B2RNF4|Q6IFN1	Frame_Shift_Del	DEL	ENST00000304820.2	hg19	CCDS35128.1																																																																																			.	.		0.411	OR1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053950.1		
ABCC11	85320	hgsc.bcm.edu	37	16	48278525	48278525	+	Intron	DEL	C	C	-			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr16:48278525delC	ENST00000356608.2	-	1	81				LONP2_ENST00000535754.1_Frame_Shift_Del_p.L76fs|ABCC11_ENST00000537808.1_Intron|LONP2_ENST00000285737.4_Frame_Shift_Del_p.L76fs			Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11						organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	CCTGCCGCCGCTGCACAGGTA	0.756																																					p.P75fs		Atlas-INDEL	.											.	LONP2	63	.	0			c.225delG						.						4.0	3.0	3.0					16																	48278525		1393	2779	4172	SO:0001627	intron_variant	83752	exon1			.	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000356608.2:c.17+2699G>-	chr16.hg19:g.48278525delC		43.0	0.0		33.0	14.0	NM_031490	Q8TDJ0|Q96JA6|Q9BX80	Frame_Shift_Del	DEL	ENST00000356608.2	hg19	CCDS10732.1																																																																																			.	.		0.756	ABCC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256843.1	NM_032583	
MEF2C	4208	hgsc.bcm.edu	37	5	88056848	88056849	+	Intron	INS	-	-	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr5:88056848_88056849insT	ENST00000437473.2	-	4	820				MEF2C_ENST00000514015.1_Intron|MEF2C_ENST00000539796.1_Intron|MEF2C_ENST00000508569.1_Intron|MEF2C_ENST00000510942.1_Intron|MEF2C_ENST00000424173.2_Frame_Shift_Ins_p.I118fs|MEF2C_ENST00000340208.5_Frame_Shift_Ins_p.I138fs|MEF2C_ENST00000503554.1_Intron|MEF2C_ENST00000514028.1_Intron|MEF2C_ENST00000506554.1_Intron|MEF2C_ENST00000504921.2_Intron	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C						apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TTCTTCATTAATTTTTTTGTAT	0.401										HNSCC(66;0.2)																											p.I138fs		Atlas-INDEL	.											MEF2C_ENST00000424173,caecum,carcinoma,0,2	MEF2C	184	.	0			c.413_414insA						.																																			SO:0001627	intron_variant	4208	exon6			.	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.402+152->A	chr5.hg19:g.88056855_88056855dupT		203.0	0.0		174.0	59.0	NM_001193347	C9JMZ0|D7F7N5|F8W7V7	Frame_Shift_Ins	INS	ENST00000437473.2	hg19	CCDS47245.1																																																																																			.	.		0.401	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
USP54	159195	hgsc.bcm.edu	37	10	75283430	75283448	+	Frame_Shift_Del	DEL	CGAAGTTCCTGTTCCTGCG	CGAAGTTCCTGTTCCTGCG	-	rs199524864|rs370753309|rs199533863	byFrequency	TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	CGAAGTTCCTGTTCCTGCG	CGAAGTTCCTGTTCCTGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr10:75283430_75283448delCGAAGTTCCTGTTCCTGCG	ENST00000339859.4	-	16	2355_2373	c.2255_2273delCGCAGGAACAGGAACTTCG	c.(2254-2274)gcgcaggaacaggaacttcgafs	p.AQEQELR752fs	USP54_ENST00000408019.1_Frame_Shift_Del_p.AQEQELR752fs|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000422491.2_5'UTR|USP54_ENST00000394811.2_5'UTR|USP54_ENST00000428547.1_Frame_Shift_Del_p.AQEQELR602fs			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	752					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					CCGTTTTCTTCGAAGTTCCTGTTCCTGCGCCCTCCTGGC	0.466																																					p.752_758del	Colon(195;880 2046 8854 25025 38456)	Atlas-INDEL	.											.	USP54	178	.	0			c.2256_2274del						.																																			SO:0001589	frameshift_variant	159195	exon15			.	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.2255_2273delCGCAGGAACAGGAACTTCG	chr10.hg19:g.75283430_75283448delCGAAGTTCCTGTTCCTGCG	ENSP00000345216:p.Ala752fs	99.0	0.0		85.0	17.0	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Frame_Shift_Del	DEL	ENST00000339859.4	hg19	CCDS7329.2																																																																																			.	.		0.466	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
ZNF800	168850	hgsc.bcm.edu	37	7	127031567	127031569	+	In_Frame_Del	DEL	GTG	GTG	-	rs138285367|rs559631790		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr7:127031567_127031569delGTG	ENST00000393313.1	-	2	634_636	c.43_45delCAC	c.(43-45)cacdel	p.H15del	ZNF800_ENST00000393312.1_In_Frame_Del_p.H15del|ZNF800_ENST00000265827.3_In_Frame_Del_p.H15del			Q2TB10	ZN800_HUMAN	zinc finger protein 800	15	Poly-His.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						CACAGCATCCGTGATGATGGTGG	0.488																																					p.15_16del		Atlas-INDEL	.											.	ZNF800	78	.	0			c.44_46del						.																																			SO:0001651	inframe_deletion	168850	exon2			.	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.43_45delCAC	chr7.hg19:g.127031567_127031569delGTG	ENSP00000376989:p.His15del	116.0	0.0		116.0	47.0	NM_176814	Q9HBN0	In_Frame_Del	DEL	ENST00000393313.1	hg19	CCDS5795.1																																																																																			.	.		0.488	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1	NM_176814	
GIGYF2	26058	hgsc.bcm.edu	37	2	233709080	233709080	+	Splice_Site	DEL	A	A	-			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:233709080delA	ENST00000409547.1	+	27	3412	c.3101delA	c.(3100-3102)cat>ct	p.H1034fs	GIGYF2_ENST00000409451.3_Splice_Site_p.H1055fs|GIGYF2_ENST00000409196.3_Splice_Site_p.H1028fs|GIGYF2_ENST00000373563.4_Splice_Site_p.H1034fs|GIGYF2_ENST00000452341.2_3'UTR|GIGYF2_ENST00000373566.3_Splice_Site_p.H1056fs|GIGYF2_ENST00000409480.1_Splice_Site_p.H1056fs	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1034					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CTTTAACAGCATTCCAACCTG	0.388																																					p.H1055fs		Atlas-INDEL	.											.	GIGYF2	288	.	0			c.3163delC						.						76.0	75.0	75.0					2																	233709080		2203	4300	6503	SO:0001630	splice_region_variant	26058	exon27			.	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3100-1A>-	chr2.hg19:g.233709080delA		107.0	0.0		108.0	50.0	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Frame_Shift_Del	DEL	ENST00000409547.1	hg19	CCDS33401.1																																																																																			.	.		0.388	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	Frame_Shift_Del
GP1BA	2811	hgsc.bcm.edu	37	17	4837225	4837226	+	Frame_Shift_Ins	INS	-	-	C	rs574786279		TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr17:4837225_4837226insC	ENST00000329125.5	+	2	1401_1402	c.1326_1327insC	c.(1327-1329)cccfs	p.P443fs		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	443	Pro/Thr-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						ccacctcagagcccgcccccag	0.713																																					p.E442fs		Atlas-INDEL	.											.	GP1BA	53	.	0			c.1326_1327insC						.																																			SO:0001589	frameshift_variant	2811	exon2			.		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1329dupC	chr17.hg19:g.4837228_4837228dupC	ENSP00000329380:p.Pro443fs	56.0	0.0		38.0	11.0	NM_000173	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Frame_Shift_Ins	INS	ENST00000329125.5	hg19	CCDS54068.1																																																																																			.	.		0.713	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1		
UNC13C	440279	hgsc.bcm.edu	37	15	54306719	54306720	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr15:54306719_54306720insT	ENST00000260323.11	+	1	1619_1620	c.1619_1620insT	c.(1618-1623)gattttfs	p.DF540fs	UNC13C_ENST00000537900.1_Frame_Shift_Ins_p.DF540fs|UNC13C_ENST00000545554.1_Frame_Shift_Ins_p.DF540fs	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	540					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCACAGAGTGATTTTTTCACTG	0.366																																					p.D540fs		Atlas-INDEL	.											.,2	UNC13C	674	.	0			c.1619_1620insT						.																																			SO:0001589	frameshift_variant	440279	exon1			.	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1625dupT	chr15.hg19:g.54306725_54306725dupT	ENSP00000260323:p.Asp540fs	167.0	0.0		146.0	62.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Frame_Shift_Ins	INS	ENST00000260323.11	hg19	CCDS45264.1																																																																																			.	.		0.366	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
KMT2A	4297	hgsc.bcm.edu	37	11	118343010	118343011	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr11:118343010_118343011insA	ENST00000389506.5	+	3	1136_1137	c.1136_1137insA	c.(1135-1140)gcaaaafs	p.AK379fs	KMT2A_ENST00000534358.1_Frame_Shift_Ins_p.AK379fs|KMT2A_ENST00000354520.4_Frame_Shift_Ins_p.AK379fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	379					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TTACAGAGGGCAAAAAAGGGGG	0.426																																					p.A379fs		Atlas-INDEL	.											.	MLL	548	.	0			c.1136_1137insA						.																																			SO:0001589	frameshift_variant	4297	exon3			.	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.1142dupA	chr11.hg19:g.118343016_118343016dupA	ENSP00000374157:p.Ala379fs	262.0	0.0		261.0	110.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Ins	INS	ENST00000389506.5	hg19	CCDS31686.1																																																																																			.	.		0.426	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
C2orf70	339778	hgsc.bcm.edu	37	2	26798930	26798930	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAW1-01A-11D-A40P-10	TCGA-DD-AAW1-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e922ce32-e6f6-497a-ae31-ae362055542d	7730846e-e3d4-44d3-a53c-47ab352eaf6e	g.chr2:26798930delA	ENST00000329615.3	+	2	266	c.235delA	c.(235-237)aacfs	p.N79fs	C2orf70_ENST00000409392.1_Frame_Shift_Del_p.Q66fs	NM_001105519.1	NP_001098989.1	A6NJV1	CB070_HUMAN	chromosome 2 open reading frame 70	79						nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	13						CACCAACCCCAACCTCCTGCT	0.612																																					p.P78fs		Atlas-INDEL	.											.	C2orf70	26	.	0			c.234delC						.						114.0	125.0	121.0					2																	26798930		2079	4207	6286	SO:0001589	frameshift_variant	339778	exon2			.		CCDS42661.1	2p23.3	2011-05-09			ENSG00000173557	ENSG00000173557			27938	protein-coding gene	gene with protein product	"""hypothetical protein LOC339778"""						Standard	NM_001105519		Approved	LOC339778	uc010eyn.3	A6NJV1	OTTHUMG00000151994	ENST00000329615.3:c.235delA	chr2.hg19:g.26798930delA	ENSP00000332875:p.Asn79fs	121.0	0.0		123.0	45.0	NM_001105519		Frame_Shift_Del	DEL	ENST00000329615.3	hg19	CCDS42661.1																																																																																			.	.		0.612	C2orf70-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353258.1	NM_001105519	
