#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTC34	100287898	hgsc.bcm.edu	37	1	2704267	2704267	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:2704267C>T	ENST00000401095.3	-	2	173	c.94G>A	c.(94-96)Gcc>Acc	p.A32T	TTC34_ENST00000401094.6_Intron	NM_001242672.1	NP_001229601.1	A8MYJ7	TTC34_HUMAN	tetratricopeptide repeat domain 34	32																	ACGCCGCAGGCGACCCTGTGT	0.652																																					p.A32T		Atlas-SNP	.											.	TTC34	2	.	0			c.G94A						.																																			SO:0001583	missense	100287898	exon2			CGCAGGCGACCCT		CCDS55565.1	1p36.32	2013-01-11			ENSG00000215912	ENSG00000215912		"""Tetratricopeptide (TTC) repeat domain containing"""	34297	protein-coding gene	gene with protein product							Standard	NM_001242672		Approved		uc021oey.1	A8MYJ7	OTTHUMG00000000539	ENST00000401095.3:c.94G>A	chr1.hg19:g.2704267C>T	ENSP00000383873:p.Ala32Thr	144.0	0.0		146.0	70.0	NM_001242672	A8MXL8	Missense_Mutation	SNP	ENST00000401095.3	hg19	CCDS55565.1	.	.	.	.	.	.	.	.	.	.	c	9.905	1.208043	0.22205	.	.	ENSG00000215912	ENST00000401094;ENST00000401095	.	.	.	4.21	2.29	0.28610	.	0.491076	0.12897	U	0.430094	T	0.51024	0.1650	M	0.65975	2.015	0.28931	N	0.891566	.	.	.	.	.	.	T	0.45673	-0.9245	7	0.33940	T	0.23	.	8.8423	0.35148	0.0:0.7659:0.1502:0.084	.	.	.	.	T	32	.	ENSP00000387700:A32T	A	-	1	0	TTC34	2694127	0.896000	0.30565	0.334000	0.25495	0.008000	0.06430	1.568000	0.36418	0.505000	0.28104	-0.226000	0.12346	GCC	.	.		0.652	TTC34-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		XM_002342015	
PIK3CD	5293	hgsc.bcm.edu	37	1	9778944	9778944	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:9778944C>T	ENST00000377346.4	+	9	1408	c.1213C>T	c.(1213-1215)Cgc>Tgc	p.R405C	PIK3CD_ENST00000536656.1_Missense_Mutation_p.R370C|PIK3CD_ENST00000361110.2_Missense_Mutation_p.R370C|PIK3CD_ENST00000543390.1_Missense_Mutation_p.R72C	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	405	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	CAAGAAGGCTCGCTCCACCAA	0.637																																					p.R405C		Atlas-SNP	.											.	PIK3CD	86	.	0			c.C1213T						.						58.0	56.0	57.0					1																	9778944		2203	4300	6503	SO:0001583	missense	5293	exon9			AAGGCTCGCTCCA		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.1213C>T	chr1.hg19:g.9778944C>T	ENSP00000366563:p.Arg405Cys	65.0	0.0		57.0	20.0	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	hg19	CCDS104.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368120	0.82463	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563;ENST00000543390	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	5.35	5.35	0.76521	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.113763	0.64402	D	0.000014	T	0.75206	0.3818	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.973;0.993;0.987	T	0.76471	-0.2947	10	0.54805	T	0.06	-34.6236	13.1212	0.59327	0.1597:0.8402:0.0:0.0	.	405;370;405	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	C	370;405;370;370;72	ENSP00000446444:R370C;ENSP00000366563:R405C;ENSP00000354410:R370C;ENSP00000443811:R72C	ENSP00000353766:R370C	R	+	1	0	PIK3CD	9701531	0.871000	0.30034	0.954000	0.39281	0.947000	0.59692	1.712000	0.37940	2.499000	0.84300	0.563000	0.77884	CGC	.	.		0.637	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
MROH7	374977	hgsc.bcm.edu	37	1	55158176	55158177	+	Missense_Mutation	DNP	GG	GG	AC	rs537957753	byFrequency	TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:55158176_55158177GG>AC	ENST00000421030.2	+	16	3076_3077	c.2791_2792GG>AC	c.(2791-2793)GGc>ACc	p.G931T	MROH7_ENST00000545244.1_Missense_Mutation_p.G499T|MROH7_ENST00000339553.5_Missense_Mutation_p.G931T|MROH7_ENST00000409996.1_Missense_Mutation_p.G499T|MROH7_ENST00000395690.2_Missense_Mutation_p.G931T|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.G931T|MROH7_ENST00000454855.2_Missense_Mutation_p.G449T	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	931						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GGACCAGGGTGGCTGGGAGCTC	0.594																																					p.G931S|p.G931A		Atlas-SNP	.											.	.	.	.	0			c.G2791A|c.G2792C						.																																			SO:0001583	missense	374977	exon16			CAGGGTGGCTGGG|AGGGTGGCTGGGA	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	Exception_encountered	chr1.hg19:g.55158176_55158177delinsAC	ENSP00000396622:p.Gly931Thr	45.0|46.0	0.0		72.0|73.0	30.0	NM_001039464	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	ENST00000421030.2	hg19	CCDS41342.2																																																																																			.	.		0.594	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
PTBP2	58155	hgsc.bcm.edu	37	1	97250726	97250726	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:97250726C>T	ENST00000426398.2	+	8	863	c.820C>T	c.(820-822)Cga>Tga	p.R274*	PTBP2_ENST00000541987.1_Nonsense_Mutation_p.R243*|PTBP2_ENST00000370198.1_Nonsense_Mutation_p.R274*|PTBP2_ENST00000370197.1_Nonsense_Mutation_p.R274*|PTBP2_ENST00000609116.1_Nonsense_Mutation_p.R274*|PTBP2_ENST00000394184.3_Nonsense_Mutation_p.R285*|PTBP2_ENST00000482253.1_3'UTR	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	274					mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GGATTATACTCGACCTGATCT	0.383																																					p.R274X		Atlas-SNP	.											.	PTBP2	62	.	0			c.C820T						.						127.0	122.0	123.0					1																	97250726		2203	4300	6503	SO:0001587	stop_gained	58155	exon8			TATACTCGACCTG	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.820C>T	chr1.hg19:g.97250726C>T	ENSP00000412788:p.Arg274*	90.0	0.0		83.0	30.0	NM_021190	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Nonsense_Mutation	SNP	ENST00000426398.2	hg19	CCDS754.1	.	.	.	.	.	.	.	.	.	.	C	39	7.749179	0.98468	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184;ENST00000541987;ENST00000394176	.	.	.	5.57	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1846	0.65598	0.0:0.928:0.0:0.072	.	.	.	.	X	274;274;274;274;285;243;264	.	ENSP00000236228:R274X	R	+	1	2	PTBP2	97023314	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	3.524000	0.53495	1.362000	0.46000	0.591000	0.81541	CGA	.	.		0.383	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		
SYT6	148281	hgsc.bcm.edu	37	1	114680598	114680598	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:114680598G>A	ENST00000610222.1	-	3	736	c.590C>T	c.(589-591)gCa>gTa	p.A197V	SYT6_ENST00000393296.1_Missense_Mutation_p.A197V|SYT6_ENST00000609117.1_Missense_Mutation_p.A112V|SYT6_ENST00000369547.1_Missense_Mutation_p.A112V|SYT6_ENST00000607941.1_Missense_Mutation_p.A112V			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	197					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCTCTGCTGCTGGTGGAAG	0.597																																					p.A112V		Atlas-SNP	.											.	SYT6	66	.	0			c.C335T						.						80.0	69.0	73.0					1																	114680598		2203	4300	6503	SO:0001583	missense	148281	exon3			TCTGCTGCTGGTG		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.590C>T	chr1.hg19:g.114680598G>A	ENSP00000476396:p.Ala197Val	45.0	0.0		56.0	27.0	NM_205848	B1AMB8|B3KPK1	Missense_Mutation	SNP	ENST00000610222.1	hg19		.	.	.	.	.	.	.	.	.	.	G	5.713	0.316132	0.10789	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.58358	0.34;0.35;0.34;0.35	5.38	2.41	0.29592	.	0.350509	0.29093	N	0.013173	T	0.12135	0.0295	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.15464	-1.0436	10	0.33141	T	0.24	.	1.8167	0.03102	0.2673:0.1358:0.4576:0.1393	.	197	Q5T7P8	SYT6_HUMAN	V	112;197;112;197	ENSP00000358560:A112V;ENSP00000376974:A197V;ENSP00000358559:A112V;ENSP00000358558:A197V	ENSP00000358558:A197V	A	-	2	0	SYT6	114482121	0.274000	0.24191	0.008000	0.14137	0.420000	0.31355	1.326000	0.33735	0.609000	0.30018	0.655000	0.94253	GCA	.	.		0.597	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	
AMPD1	270	hgsc.bcm.edu	37	1	115222318	115222318	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:115222318G>A	ENST00000520113.2	-	7	893	c.878C>T	c.(877-879)aCc>aTc	p.T293I	AMPD1_ENST00000353928.6_Missense_Mutation_p.T260I|AMPD1_ENST00000369538.3_Missense_Mutation_p.T289I			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	293					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GCGCCGGTGGGTATAGGTCTT	0.413																																					p.T293I		Atlas-SNP	.											.	AMPD1	223	.	0			c.C878T						.						90.0	98.0	95.0					1																	115222318		2203	4300	6503	SO:0001583	missense	270	exon7			CGGTGGGTATAGG	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.878C>T	chr1.hg19:g.115222318G>A	ENSP00000430075:p.Thr293Ile	114.0	0.0		114.0	52.0	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	hg19	CCDS876.2	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995677	0.54147	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.86097	-2.07;-2.07;-2.07	5.63	5.63	0.86233	.	0.334724	0.38381	N	0.001701	T	0.78502	0.4293	M	0.62723	1.935	0.34864	D	0.742917	P;B	0.35383	0.498;0.042	B;B	0.33620	0.167;0.04	T	0.83320	-0.0018	10	0.87932	D	0	-2.9922	15.465	0.75394	0.0:0.2525:0.7475:0.0	.	289;260	Q5TF02;P23109	.;AMPD1_HUMAN	I	293;289;260	ENSP00000430075:T293I;ENSP00000358551:T289I;ENSP00000316520:T260I	ENSP00000316520:T260I	T	-	2	0	AMPD1	115023841	1.000000	0.71417	0.934000	0.37439	0.982000	0.71751	3.907000	0.56348	2.826000	0.97356	0.655000	0.94253	ACC	.	.		0.413	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
FLG	2312	hgsc.bcm.edu	37	1	152283840	152283840	+	Silent	SNP	T	T	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:152283840T>A	ENST00000368799.1	-	3	3557	c.3522A>T	c.(3520-3522)ggA>ggT	p.G1174G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1174	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCCTTCCTCCTCTCCTTG	0.602									Ichthyosis																												p.G1174G		Atlas-SNP	.											.	FLG	900	.	0			c.A3522T						.						323.0	363.0	349.0					1																	152283840		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCTTCCTCCTCTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3522A>T	chr1.hg19:g.152283840T>A		76.0	0.0		119.0	65.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	hg19	CCDS30860.1																																																																																			.	.		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CCT3	7203	hgsc.bcm.edu	37	1	156303356	156303356	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:156303356T>A	ENST00000295688.3	-	5	566	c.286A>T	c.(286-288)Aca>Tca	p.T96S	CCT3_ENST00000368256.3_5'UTR|CCT3_ENST00000472765.2_Missense_Mutation_p.T51S|CCT3_ENST00000368259.2_Missense_Mutation_p.T58S|CCT3_ENST00000368261.3_Missense_Mutation_p.T51S	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	96					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					ATTACTGATGTGGTCCCATCT	0.403																																					p.T96S		Atlas-SNP	.											.	CCT3	61	.	0			c.A286T						.						133.0	135.0	135.0					1																	156303356		2203	4300	6503	SO:0001583	missense	7203	exon5			CTGATGTGGTCCC	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.286A>T	chr1.hg19:g.156303356T>A	ENSP00000295688:p.Thr96Ser	36.0	0.0		60.0	38.0	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	hg19	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	T	31	5.077699	0.94000	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765;ENST00000413555;ENST00000496684;ENST00000533194;ENST00000446905;ENST00000478640;ENST00000415548	D;D;D;D;D;D;D;D;D;D	0.92858	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-3.12	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.97324	0.9125	H	0.98178	4.165	0.58432	D	0.99999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.997;0.998;0.99	D	0.98444	1.0588	10	0.87932	D	0	-10.3319	12.6112	0.56552	0.0:0.0:0.0:1.0	.	58;96;96	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	S	96;58;51;51;120;96;17;82;75;96	ENSP00000295688:T96S;ENSP00000357242:T58S;ENSP00000357244:T51S;ENSP00000431543:T51S;ENSP00000413308:T120S;ENSP00000434232:T96S;ENSP00000434481:T17S;ENSP00000388799:T82S;ENSP00000435026:T75S;ENSP00000413431:T96S	ENSP00000295688:T96S	T	-	1	0	CCT3	154569980	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.394000	0.79862	2.234000	0.73211	0.528000	0.53228	ACA	.	.		0.403	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
PRCC	5546	hgsc.bcm.edu	37	1	156737670	156737670	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:156737670G>C	ENST00000271526.4	+	1	379	c.107G>C	c.(106-108)gGg>gCg	p.G36A	PRCC_ENST00000353233.3_Missense_Mutation_p.G36A|HDGF_ENST00000465180.1_5'Flank|PRCC_ENST00000491853.1_Intron	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	36	Mediates interaction with MAD2L2.				mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCGCTTTAGGGGGCTTGTTC	0.677			T	TFE3	papillary renal																																p.G36A		Atlas-SNP	.		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	.	PRCC	39	.	0			c.G107C						.						17.0	15.0	16.0					1																	156737670		2200	4298	6498	SO:0001583	missense	5546	exon1			CTTTAGGGGGCTT	X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.107G>C	chr1.hg19:g.156737670G>C	ENSP00000271526:p.Gly36Ala	181.0	0.0		226.0	58.0	NM_005973	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	ENST00000271526.4	hg19	CCDS1157.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.839359	0.51057	.	.	ENSG00000143294	ENST00000271526;ENST00000353233	T;T	0.42513	0.97;0.97	5.55	5.55	0.83447	.	0.054551	0.64402	D	0.000001	T	0.26521	0.0648	L	0.53249	1.67	0.41931	D	0.99056	P;P	0.46784	0.884;0.884	B;B	0.43838	0.433;0.337	T	0.06516	-1.0822	10	0.07813	T	0.8	-10.7178	16.3527	0.83220	0.0:0.0:1.0:0.0	.	36;36	A6NG79;Q92733	.;PRCC_HUMAN	A	36	ENSP00000271526:G36A;ENSP00000339300:G36A	ENSP00000271526:G36A	G	+	2	0	PRCC	155004294	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.795000	0.62489	2.885000	0.99019	0.655000	0.94253	GGG	.	.		0.677	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2	NM_005973	
SLC9C2	284525	hgsc.bcm.edu	37	1	173556888	173556888	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:173556888A>T	ENST00000367714.3	-	5	861	c.439T>A	c.(439-441)Tgg>Agg	p.W147R	SLC9C2_ENST00000536496.1_Missense_Mutation_p.W45R|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	147					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										TGCAAATCCCATGAATCTTTA	0.333																																					p.W147R		Atlas-SNP	.											.	.	.	.	0			c.T439A						.						117.0	118.0	117.0					1																	173556888		2203	4299	6502	SO:0001583	missense	284525	exon5			AATCCCATGAATC	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.439T>A	chr1.hg19:g.173556888A>T	ENSP00000356687:p.Trp147Arg	102.0	0.0		128.0	61.0	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	hg19	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	A	16.20	3.054827	0.55325	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.06142	3.34;3.34	5.59	5.59	0.84812	Cation/H+ exchanger (1);	0.000000	0.53938	D	0.000046	T	0.11495	0.0280	L	0.54323	1.7	0.31595	N	0.653435	D	0.89917	1.0	D	0.97110	1.0	T	0.01464	-1.1348	10	0.66056	D	0.02	-9.1585	12.153	0.54059	1.0:0.0:0.0:0.0	.	147	Q5TAH2	S9A11_HUMAN	R	147;45	ENSP00000356687:W147R;ENSP00000445437:W45R	ENSP00000356687:W147R	W	-	1	0	SLC9A11	171823511	0.996000	0.38824	0.917000	0.36280	0.379000	0.30106	4.446000	0.60014	2.137000	0.66172	0.482000	0.46254	TGG	.	.		0.333	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
KCNT2	343450	hgsc.bcm.edu	37	1	196398776	196398776	+	Silent	SNP	A	A	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:196398776A>T	ENST00000294725.9	-	9	1665	c.750T>A	c.(748-750)ccT>ccA	p.P250P	KCNT2_ENST00000367433.5_Silent_p.P250P|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000609185.1_Silent_p.P250P|KCNT2_ENST00000367431.4_Silent_p.P250P|KCNT2_ENST00000498426.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	250					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						ACCATGTTTCAGGAGTGACAT	0.408																																					p.P250P		Atlas-SNP	.											.	KCNT2	243	.	0			c.T750A						.						118.0	103.0	108.0					1																	196398776		2203	4300	6503	SO:0001819	synonymous_variant	343450	exon9			TGTTTCAGGAGTG	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.750T>A	chr1.hg19:g.196398776A>T		418.0	0.0		595.0	360.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	hg19	CCDS1384.1																																																																																			.	.		0.408	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
RYR2	6262	hgsc.bcm.edu	37	1	237804207	237804207	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:237804207G>T	ENST00000366574.2	+	47	7443	c.7126G>T	c.(7126-7128)Gag>Tag	p.E2376*	RYR2_ENST00000360064.6_Nonsense_Mutation_p.E2374*|RYR2_ENST00000542537.1_Nonsense_Mutation_p.E2360*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2376	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGACACAGAGGAGGAGGAAGA	0.433																																					p.E2376X		Atlas-SNP	.											.	RYR2	1273	.	0			c.G7126T						.						143.0	136.0	138.0					1																	237804207		2041	4212	6253	SO:0001587	stop_gained	6262	exon47			ACAGAGGAGGAGG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7126G>T	chr1.hg19:g.237804207G>T	ENSP00000355533:p.Glu2376*	54.0	0.0		80.0	54.0	NM_001035	Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	48	14.281882	0.99788	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	5.84	4.92	0.64577	.	0.079351	0.47093	D	0.000249	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-10.7054	15.3501	0.74376	0.0678:0.0:0.9322:0.0	.	.	.	.	X	2376;2374;2360	.	ENSP00000353174:E2374X	E	+	1	0	RYR2	235870830	1.000000	0.71417	0.969000	0.41365	0.562000	0.35680	7.635000	0.83286	2.779000	0.95612	0.591000	0.81541	GAG	.	.		0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OR14C36	127066	hgsc.bcm.edu	37	1	248512967	248512967	+	Silent	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr1:248512967G>A	ENST00000317861.1	+	1	891	c.891G>A	c.(889-891)gtG>gtA	p.V297V		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						AAATAAAGGTGGCCATCAAGA	0.383																																					p.V297V		Atlas-SNP	.											.	OR14C36	113	.	0			c.G891A						.						64.0	79.0	74.0					1																	248512967		2148	4170	6318	SO:0001819	synonymous_variant	127066	exon1			AAAGGTGGCCATC	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.891G>A	chr1.hg19:g.248512967G>A		94.0	0.0		119.0	24.0	NM_001001918	Q6IEZ6	Silent	SNP	ENST00000317861.1	hg19	CCDS31112.1																																																																																			.	.		0.383	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
DDX1	1653	hgsc.bcm.edu	37	2	15758310	15758310	+	Silent	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:15758310G>T	ENST00000381341.2	+	17	1511	c.1122G>T	c.(1120-1122)ggG>ggT	p.G374G	DDX1_ENST00000233084.3_Silent_p.G374G			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	374	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TGCAGGATGGGCTTCTTTCTC	0.289																																					p.G374G		Atlas-SNP	.											.	DDX1	70	.	0			c.G1122T						.						125.0	143.0	137.0					2																	15758310		2203	4299	6502	SO:0001819	synonymous_variant	1653	exon16			GGATGGGCTTCTT	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1122G>T	chr2.hg19:g.15758310G>T		212.0	0.0		186.0	73.0	NM_004939	B4DME8|B4DPN6	Silent	SNP	ENST00000381341.2	hg19	CCDS1686.1																																																																																			.	.		0.289	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939	
OTOF	9381	hgsc.bcm.edu	37	2	26702479	26702479	+	Missense_Mutation	SNP	C	C	T	rs142370721		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:26702479C>T	ENST00000272371.2	-	17	2081	c.1955G>A	c.(1954-1956)cGg>cAg	p.R652Q	OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000403946.3_Missense_Mutation_p.R652Q|OTOF_ENST00000339598.3_5'Flank	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	652					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGCCGAGGCCGCTGGGGCCG	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		18849	0.0		0.0	False		,,,				2504	0.001				p.R652Q	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											.	OTOF	524	.	0			c.G1955A						.	C	GLN/ARG	1,4397	2.1+/-5.4	0,1,2198	31.0	35.0	34.0		1955	3.8	0.8	2	dbSNP_134	34	0,8598		0,0,4299	no	missense	OTOF	NM_194248.2	43	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	benign	652/1998	26702479	1,12995	2199	4299	6498	SO:0001583	missense	9381	exon17			CGAGGCCGCTGGG	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1955G>A	chr2.hg19:g.26702479C>T	ENSP00000272371:p.Arg652Gln	102.0	0.0		90.0	33.0	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	hg19	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	8.707	0.911027	0.17833	2.27E-4	0.0	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.79845	-1.31;-1.31	4.63	3.75	0.43078	.	0.000000	0.22692	U	0.056801	T	0.58409	0.2120	N	0.12182	0.205	0.09310	N	1	B	0.32620	0.378	B	0.19148	0.024	T	0.43782	-0.9370	10	0.17832	T	0.49	-13.8053	10.2866	0.43570	0.0:0.9014:0.0:0.0986	.	652	Q9HC10	OTOF_HUMAN	Q	652	ENSP00000272371:R652Q;ENSP00000385255:R652Q	ENSP00000272371:R652Q	R	-	2	0	OTOF	26555983	0.925000	0.31364	0.822000	0.32727	0.015000	0.08874	2.440000	0.44855	0.914000	0.36822	0.561000	0.74099	CGG	.	C|1.000;T|0.000		0.642	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
TTC7A	57217	hgsc.bcm.edu	37	2	47278963	47278963	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:47278963T>A	ENST00000319190.5	+	18	2464	c.2096T>A	c.(2095-2097)cTg>cAg	p.L699Q	TTC7A_ENST00000409245.1_Missense_Mutation_p.L665Q|TTC7A_ENST00000394850.2_Missense_Mutation_p.L723Q|TTC7A_ENST00000263737.6_Missense_Mutation_p.L345Q	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	699					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			TCTTCGGTCCTGAAGCAGGGC	0.657																																					p.L699Q		Atlas-SNP	.											.	TTC7A	80	.	0			c.T2096A						.						38.0	37.0	37.0					2																	47278963		2203	4300	6503	SO:0001583	missense	57217	exon18			CGGTCCTGAAGCA	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.2096T>A	chr2.hg19:g.47278963T>A	ENSP00000316699:p.Leu699Gln	95.0	0.0		106.0	39.0	NM_020458	Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	ENST00000319190.5	hg19	CCDS33193.1	.	.	.	.	.	.	.	.	.	.	T	11.68	1.709502	0.30322	.	.	ENSG00000068724	ENST00000409245;ENST00000319190;ENST00000394850;ENST00000263737;ENST00000434093	T;T;T;T	0.32515	1.87;1.88;1.49;1.45	5.18	5.18	0.71444	.	0.434081	0.25619	N	0.029426	T	0.12902	0.0313	N	0.03608	-0.345	0.80722	D	1	B;B;B;B	0.26195	0.144;0.013;0.087;0.022	B;B;B;B	0.20955	0.032;0.01;0.02;0.022	T	0.13872	-1.0493	10	0.29301	T	0.29	-8.4471	8.7474	0.34594	0.0:0.0851:0.0:0.9149	.	723;665;699;665	Q2T9J9;B3KPK7;Q9ULT0;G5E9G4	.;.;TTC7A_HUMAN;.	Q	665;699;723;345;526	ENSP00000386307:L665Q;ENSP00000316699:L699Q;ENSP00000378320:L723Q;ENSP00000263737:L345Q	ENSP00000263737:L345Q	L	+	2	0	TTC7A	47132467	0.994000	0.37717	0.953000	0.39169	0.984000	0.73092	1.574000	0.36482	2.172000	0.68678	0.533000	0.62120	CTG	.	.		0.657	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
KANSL3	55683	hgsc.bcm.edu	37	2	97274685	97274685	+	Silent	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:97274685T>C	ENST00000431828.1	-	13	1576	c.1500A>G	c.(1498-1500)agA>agG	p.R500R	KANSL3_ENST00000599854.1_Silent_p.R413R|KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000440133.1_Silent_p.R294R|KANSL3_ENST00000441706.2_Silent_p.R413R			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	500					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AGGCCAAGTCTCTGCGGGCCA	0.617																																					p.R500R		Atlas-SNP	.											.	.	.	.	0			c.A1500G						.						14.0	17.0	16.0					2																	97274685		1897	4122	6019	SO:0001819	synonymous_variant	55683	exon13			CAAGTCTCTGCGG	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1500A>G	chr2.hg19:g.97274685T>C		109.0	0.0		103.0	7.0	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Silent	SNP	ENST00000431828.1	hg19	CCDS46361.1																																																																																			.	.		0.617	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
KANSL3	55683	hgsc.bcm.edu	37	2	97274687	97274687	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:97274687T>C	ENST00000431828.1	-	13	1574	c.1498A>G	c.(1498-1500)Aga>Gga	p.R500G	KANSL3_ENST00000599854.1_Missense_Mutation_p.R413G|KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000440133.1_Missense_Mutation_p.R294G|KANSL3_ENST00000441706.2_Missense_Mutation_p.R413G			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	500					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GCCAAGTCTCTGCGGGCCACA	0.617																																					p.R500G		Atlas-SNP	.											.	.	.	.	0			c.A1498G						.						14.0	17.0	16.0					2																	97274687		1899	4122	6021	SO:0001583	missense	55683	exon13			AGTCTCTGCGGGC	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1498A>G	chr2.hg19:g.97274687T>C	ENSP00000396749:p.Arg500Gly	110.0	0.0		102.0	6.0	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	ENST00000431828.1	hg19	CCDS46361.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.857290	0.71834	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000441706;ENST00000440133;ENST00000444759	T;T	0.69175	0.43;-0.38	5.44	1.78	0.24846	.	0.000000	0.85682	D	0.000000	T	0.71358	0.3330	L	0.38175	1.15	0.80722	D	1	D;D;D;D	0.89917	0.999;0.989;1.0;0.999	D;D;D;D	0.83275	0.991;0.978;0.996;0.994	T	0.68488	-0.5395	10	0.42905	T	0.14	.	12.3585	0.55188	0.0:0.0:0.5105:0.4895	.	294;500;413;388	B4E1W4;Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;.;.;.	G	413;388;500;413;294;294	ENSP00000396749:R500G;ENSP00000406207:R294G	ENSP00000346144:R413G	R	-	1	2	KIAA1310	96638414	1.000000	0.71417	0.973000	0.42090	0.915000	0.54546	1.925000	0.40074	0.344000	0.23847	0.460000	0.39030	AGA	.	.		0.617	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
LRP1B	53353	hgsc.bcm.edu	37	2	141459290	141459290	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:141459290C>T	ENST00000389484.3	-	40	7398	c.6427G>A	c.(6427-6429)Ggg>Agg	p.G2143R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2143	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAGTGCTGACCTTTCTCTCTT	0.348										TSP Lung(27;0.18)																											p.G2143R	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.G6427A						.						87.0	83.0	84.0					2																	141459290		2203	4299	6502	SO:0001630	splice_region_variant	53353	exon40			GCTGACCTTTCTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6427+1G>A	chr2.hg19:g.141459290C>T		63.0	0.0		54.0	21.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423085	0.83559	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90385	-2.66	4.58	4.58	0.56647	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	U	0.000000	D	0.95815	0.8638	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96133	0.9094	9	.	.	.	.	17.5696	0.87931	0.0:1.0:0.0:0.0	.	2143	Q9NZR2	LRP1B_HUMAN	R	2143;2081	ENSP00000374135:G2143R	.	G	-	1	0	LRP1B	141175760	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.539000	0.82063	2.360000	0.80028	0.467000	0.42956	GGG	.	.		0.348	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Missense_Mutation
BAZ2B	29994	hgsc.bcm.edu	37	2	160231234	160231234	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:160231234C>A	ENST00000392783.2	-	26	4531	c.4036G>T	c.(4036-4038)Gag>Tag	p.E1346*	BAZ2B_ENST00000343439.5_Nonsense_Mutation_p.E1246*|BAZ2B_ENST00000355831.2_Nonsense_Mutation_p.E1312*|BAZ2B_ENST00000392782.1_Nonsense_Mutation_p.E1310*	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1346					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TTTTCCAGCTCTTCAACACTT	0.294																																					p.E1346X		Atlas-SNP	.											.	BAZ2B	196	.	0			c.G4036T						.						123.0	114.0	117.0					2																	160231234		1832	4085	5917	SO:0001587	stop_gained	29994	exon26			CCAGCTCTTCAAC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4036G>T	chr2.hg19:g.160231234C>A	ENSP00000376534:p.Glu1346*	36.0	0.0		39.0	11.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Nonsense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	46	12.453254	0.99669	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	.	.	.	5.07	5.07	0.68467	.	0.000000	0.37348	U	0.002124	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-12.788	18.4517	0.90705	0.0:1.0:0.0:0.0	.	.	.	.	X	1310;1346;1312;1246	.	ENSP00000339670:E1246X	E	-	1	0	BAZ2B	159939480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.087000	0.76893	2.345000	0.79718	0.591000	0.81541	GAG	.	.		0.294	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
LRP2	4036	hgsc.bcm.edu	37	2	170101205	170101205	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:170101205C>A	ENST00000263816.3	-	22	3713	c.3428G>T	c.(3427-3429)tGc>tTc	p.C1143F	LRP2_ENST00000443831.1_Missense_Mutation_p.C1006F	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1143	LDL-receptor class A 10. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAACTTACTGCAGTTCTTTTC	0.433																																					p.C1143F		Atlas-SNP	.											.	LRP2	751	.	0			c.G3428T						.						136.0	131.0	133.0					2																	170101205		2203	4300	6503	SO:0001583	missense	4036	exon22			TTACTGCAGTTCT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3428G>T	chr2.hg19:g.170101205C>A	ENSP00000263816:p.Cys1143Phe	48.0	0.0		39.0	14.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659432	0.47467	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.99919	-8.0;-8.0	5.93	5.93	0.95920	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99953	0.9980	H	0.99435	4.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99939	1.1392	10	0.14252	T	0.57	.	20.3368	0.98748	0.0:1.0:0.0:0.0	.	1006;1143	E9PC35;P98164	.;LRP2_HUMAN	F	1143;1006	ENSP00000263816:C1143F;ENSP00000409813:C1006F	ENSP00000263816:C1143F	C	-	2	0	LRP2	169809451	1.000000	0.71417	0.871000	0.34182	0.952000	0.60782	7.760000	0.85248	2.805000	0.96524	0.655000	0.94253	TGC	.	.		0.433	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	hgsc.bcm.edu	37	2	179427083	179427083	+	Silent	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:179427083A>G	ENST00000591111.1	-	276	79077	c.78853T>C	c.(78853-78855)Tta>Cta	p.L26285L	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.L27926L|TTN_ENST00000342992.6_Silent_p.L25358L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.L19053L|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.L18986L|TTN_ENST00000460472.2_Silent_p.L18861L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26285	Fibronectin type-III 91. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGCAGTTAAGCCAGATATA	0.428																																					p.L27926L		Atlas-SNP	.											.	TTN	18412	.	0			c.T83776C						.						134.0	129.0	131.0					2																	179427083		1926	4136	6062	SO:0001819	synonymous_variant	7273	exon326			CAGTTAAGCCAGA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78853T>C	chr2.hg19:g.179427083A>G		67.0	0.0		62.0	29.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CDK15	65061	hgsc.bcm.edu	37	2	202698631	202698631	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:202698631A>G	ENST00000374598.4	+	7	667	c.667A>G	c.(667-669)Agg>Ggg	p.R223G	CDK15_ENST00000434439.1_Missense_Mutation_p.R223G|CDK15_ENST00000410091.3_Missense_Mutation_p.R172G|CDK15_ENST00000260967.2_Missense_Mutation_p.R172G|CDK15_ENST00000488419.1_3'UTR|CDK15_ENST00000450471.2_Missense_Mutation_p.R223G			Q96Q40	CDK15_HUMAN	cyclin-dependent kinase 15	223	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|kidney(5)|large_intestine(1)|lung(14)|ovary(1)	26					Adenosine triphosphate(DB00171)	CGTTCTTCACAGGGACCTGAA	0.498																																					p.R223G		Atlas-SNP	.											.	CDK15	66	.	0			c.A667G						.						171.0	148.0	155.0					2																	202698631		2203	4300	6503	SO:0001583	missense	65061	exon7			CTTCACAGGGACC	AB053308	CCDS2350.1, CCDS58746.1, CCDS58747.1	2q33.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000138395	ENSG00000138395		"""Cyclin-dependent kinases"""	14434	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7"", ""PFTAIRE protein kinase 2"""	ALS2CR7, PFTK2		11586298, 16236519, 19884882	Standard	NM_139158		Approved	PFTAIRE2	uc002uyt.3	Q96Q40	OTTHUMG00000132838	ENST00000374598.4:c.667A>G	chr2.hg19:g.202698631A>G	ENSP00000363726:p.Arg223Gly	95.0	0.0		73.0	29.0	NM_001261435	A8K8R9|B8ZZX0|C9J1N8|C9K003|F8W6H8|Q4ZG86|Q53TV1|Q6ZMR9|Q8IUP1	Missense_Mutation	SNP	ENST00000374598.4	hg19		.	.	.	.	.	.	.	.	.	.	A	21.1	4.099900	0.76983	.	.	ENSG00000138395	ENST00000410091;ENST00000260967;ENST00000450471;ENST00000434439;ENST00000374598	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.47	4.36	0.52297	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82337	0.5015	M	0.93978	3.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.85906	0.1437	10	0.87932	D	0	-15.225	10.6141	0.45441	0.5839:0.4161:0.0:0.0	.	202;223;223	Q96Q40-2;Q96Q40;F8W6H8	.;CDK15_HUMAN;.	G	172;172;223;223;223	ENSP00000386901:R172G;ENSP00000260967:R172G;ENSP00000406472:R223G;ENSP00000412775:R223G;ENSP00000363726:R223G	ENSP00000260967:R172G	R	+	1	2	CDK15	202406876	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.295000	0.59049	2.068000	0.61886	0.454000	0.30748	AGG	.	.		0.498	CDK15-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000336053.2		
SUSD5	26032	hgsc.bcm.edu	37	3	33195306	33195306	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:33195306G>A	ENST00000309558.3	-	5	1235	c.818C>T	c.(817-819)cCt>cTt	p.P273L		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	273					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CCCAGCACCAGGCAAGCCTGT	0.557																																					p.P273L		Atlas-SNP	.											.	SUSD5	53	.	0			c.C818T						.						48.0	48.0	48.0					3																	33195306		1903	4120	6023	SO:0001583	missense	26032	exon5			GCACCAGGCAAGC	AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.818C>T	chr3.hg19:g.33195306G>A	ENSP00000308727:p.Pro273Leu	49.0	0.0		54.0	42.0	NM_015551		Missense_Mutation	SNP	ENST00000309558.3	hg19	CCDS46787.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709800	0.30322	.	.	ENSG00000173705	ENST00000309558	T	0.07327	3.2	6.02	4.24	0.50183	.	0.484707	0.23035	N	0.052684	T	0.06917	0.0176	L	0.29908	0.895	0.09310	N	0.999997	B	0.29508	0.246	B	0.26094	0.066	T	0.28839	-1.0031	10	0.39692	T	0.17	-6.0917	10.7109	0.45982	0.1472:0.0:0.8528:0.0	.	273	O60279	SUSD5_HUMAN	L	273	ENSP00000308727:P273L	ENSP00000308727:P273L	P	-	2	0	SUSD5	33170310	0.697000	0.27767	0.019000	0.16419	0.091000	0.18340	3.539000	0.53604	0.888000	0.36160	0.655000	0.94253	CCT	.	.		0.557	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	107.0	1.0		108.0	90.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
GNL3	26354	hgsc.bcm.edu	37	3	52720072	52720072	+	5'UTR	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:52720072G>A	ENST00000418458.1	+	0	137				SNORD19B_ENST00000516978.1_RNA|GNL3_ENST00000394799.2_5'UTR|PBRM1_ENST00000394830.3_5'Flank	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)						cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		GCCAGCGGAGGCAGGTTGATG	0.612																																					.		Atlas-SNP	.											.	GNL3	37	.	0			.						.						74.0	64.0	67.0					3																	52720072		2203	4299	6502	SO:0001623	5_prime_UTR_variant	26354	.			GCGGAGGCAGGTT	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.-37G>A	chr3.hg19:g.52720072G>A		69.0	0.0		50.0	37.0	.	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Splice_Site	SNP	ENST00000418458.1	hg19	CCDS2861.1																																																																																			.	.		0.612	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	NM_014366	
TMEM110	375346	hgsc.bcm.edu	37	3	52877737	52877737	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:52877737G>A	ENST00000355083.5	-	6	763	c.618C>T	c.(616-618)aaC>aaT	p.N206N	TMEM110-MUSTN1_ENST00000504329.1_Splice_Site_p.N206N|TMEM110_ENST00000464769.1_5'Flank	NM_198563.2	NP_940965.1	Q86TL2	TM110_HUMAN	transmembrane protein 110	206						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)	4				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)		TGGCACTGACGTTGACAAAGA	0.502																																					p.N206N		Atlas-SNP	.											.	.	.	.	0			c.C618T						.						183.0	160.0	168.0					3																	52877737		2203	4300	6503	SO:0001630	splice_region_variant	100526772	exon6			ACTGACGTTGACA	BC047015	CCDS2866.1	3p21.1	2010-08-13			ENSG00000213533	ENSG00000213533			30526	protein-coding gene	gene with protein product						12477932	Standard	NM_198563		Approved	MGC52022		Q86TL2	OTTHUMG00000150346	ENST00000355083.5:c.618+1C>T	chr3.hg19:g.52877737G>A		51.0	0.0		47.0	39.0	NM_001198974		Silent	SNP	ENST00000355083.5	hg19	CCDS2866.1																																																																																			.	.		0.502	TMEM110-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352949.2	NM_198563	Silent
CBLB	868	hgsc.bcm.edu	37	3	105404274	105404274	+	Silent	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:105404274T>C	ENST00000264122.4	-	14	2412	c.2091A>G	c.(2089-2091)aaA>aaG	p.K697K	CBLB_ENST00000405772.1_Silent_p.K697K|CBLB_ENST00000394027.3_Silent_p.K719K|CBLB_ENST00000403724.1_Silent_p.K697K	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	697	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GGTCTCTTGTTTTCTCTGAAA	0.383			Mis S		AML																																p.K697K	GBM(93;588 1337 9788 29341 43499)	Atlas-SNP	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	CBLB	118	.	0			c.A2091G						.						139.0	134.0	136.0					3																	105404274		2203	4300	6503	SO:0001819	synonymous_variant	868	exon14			TCTTGTTTTCTCT	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.2091A>G	chr3.hg19:g.105404274T>C		99.0	0.0		65.0	30.0	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Silent	SNP	ENST00000264122.4	hg19	CCDS2948.1																																																																																			.	.		0.383	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
MORC1	27136	hgsc.bcm.edu	37	3	108819341	108819341	+	Silent	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:108819341G>A	ENST00000483760.1	-	5	280	c.237C>T	c.(235-237)gaC>gaT	p.D79D	MORC1_ENST00000232603.5_Silent_p.D79D|MORC1-AS1_ENST00000480826.1_RNA					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						AGTAAATGATGTCTGAAGCTT	0.438																																					p.D79D		Atlas-SNP	.											.	MORC1	211	.	0			c.C237T						.						160.0	160.0	160.0					3																	108819341		2203	4300	6503	SO:0001819	synonymous_variant	27136	exon5			AATGATGTCTGAA	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.237C>T	chr3.hg19:g.108819341G>A		90.0	0.0		102.0	44.0	NM_014429		Silent	SNP	ENST00000483760.1	hg19																																																																																				.	.		0.438	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
TRH	7200	hgsc.bcm.edu	37	3	129696007	129696007	+	Missense_Mutation	SNP	G	G	A	rs149654673		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:129696007G>A	ENST00000302649.3	+	3	1204	c.677G>A	c.(676-678)cGg>cAg	p.R226Q	TRH_ENST00000507066.1_Missense_Mutation_p.R222Q	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	226					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						GAGGAAAAGCGGCAGCACCCT	0.632																																					p.R226Q	Esophageal Squamous(60;321 1330 17401 41911)	Atlas-SNP	.											.	TRH	30	.	0			c.G677A						.	G	GLN/ARG	3,4399		0,3,2198	24.0	26.0	25.0		677	3.5	1.0	3	dbSNP_134	25	2,8574		0,2,4286	yes	missense	TRH	NM_007117.3	43	0,5,6484	AA,AG,GG		0.0233,0.0682,0.0385	benign	226/243	129696007	5,12973	2201	4288	6489	SO:0001583	missense	7200	exon3			AAAAGCGGCAGCA		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.677G>A	chr3.hg19:g.129696007G>A	ENSP00000303452:p.Arg226Gln	39.0	0.0		36.0	12.0	NM_007117	B2R8R1|Q2TB83	Missense_Mutation	SNP	ENST00000302649.3	hg19	CCDS3066.1	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016595	0.19355	6.82E-4	2.33E-4	ENSG00000170893	ENST00000302649;ENST00000507066	T;T	0.57107	0.42;0.44	4.34	3.47	0.39725	.	0.139469	0.46442	D	0.000286	T	0.37073	0.0990	L	0.27053	0.805	0.34790	D	0.735581	B	0.18863	0.031	B	0.10450	0.005	T	0.43782	-0.9370	10	0.56958	D	0.05	-7.6057	8.7081	0.34367	0.1093:0.0:0.8907:0.0	.	226	P20396	TRH_HUMAN	Q	226;222	ENSP00000303452:R226Q;ENSP00000426522:R222Q	ENSP00000303452:R226Q	R	+	2	0	TRH	131178697	0.994000	0.37717	0.983000	0.44433	0.003000	0.03518	1.287000	0.33284	0.948000	0.37687	-0.244000	0.11960	CGG	.	G|1.000;A|0.000		0.632	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356592.1	NM_007117	
TP63	8626	hgsc.bcm.edu	37	3	189584586	189584586	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr3:189584586G>A	ENST00000264731.3	+	6	971	c.882G>A	c.(880-882)caG>caA	p.Q294Q	TP63_ENST00000437221.1_Splice_Site_p.Q200Q|TP63_ENST00000449992.1_Splice_Site_p.Q115Q|TP63_ENST00000320472.5_Splice_Site_p.Q294Q|TP63_ENST00000354600.5_Splice_Site_p.Q200Q|TP63_ENST00000392460.3_Splice_Site_p.Q294Q|TP63_ENST00000382063.4_Splice_Site_p.Q209Q|TP63_ENST00000392461.3_Splice_Site_p.Q200Q|TP63_ENST00000456148.1_Splice_Site_p.Q200Q|TP63_ENST00000440651.2_Splice_Site_p.Q294Q|TP63_ENST00000418709.2_Splice_Site_p.Q294Q|TP63_ENST00000392463.2_Splice_Site_p.Q200Q	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	294					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		AGCCACCCCAGGTAAAAAGCA	0.443										HNSCC(45;0.13)																											p.Q294Q		Atlas-SNP	.											.	TP63	187	.	0			c.G882A						.						74.0	65.0	68.0					3																	189584586		2203	4300	6503	SO:0001630	splice_region_variant	8626	exon6			ACCCCAGGTAAAA	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.882+1G>A	chr3.hg19:g.189584586G>A		185.0	0.0		172.0	63.0	NM_001114979	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Silent	SNP	ENST00000264731.3	hg19	CCDS3293.1																																																																																			.	.		0.443	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	Silent
TRAM1L1	133022	hgsc.bcm.edu	37	4	118005493	118005493	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr4:118005493C>A	ENST00000310754.4	-	1	1243	c.1057G>T	c.(1057-1059)Gaa>Taa	p.E353*		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	353					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						TTTGAAGTTTCCACTCCCACT	0.398																																					p.E353X		Atlas-SNP	.											.	TRAM1L1	55	.	0			c.G1057T						.						155.0	160.0	158.0					4																	118005493		2203	4300	6503	SO:0001587	stop_gained	133022	exon1			AAGTTTCCACTCC	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.1057G>T	chr4.hg19:g.118005493C>A	ENSP00000309402:p.Glu353*	97.0	0.0		84.0	31.0	NM_152402	Q8N2L7	Nonsense_Mutation	SNP	ENST00000310754.4	hg19	CCDS3707.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628645	0.67015	.	.	ENSG00000174599	ENST00000310754	.	.	.	0.225	0.225	0.15325	.	0.394016	0.24217	U	0.040464	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-13.609	6.2336	0.20750	0.0:0.9997:0.0:3.0E-4	.	.	.	.	X	353	.	ENSP00000309402:E353X	E	-	1	0	TRAM1L1	118224941	0.048000	0.20356	0.174000	0.22961	0.651000	0.38670	0.765000	0.26546	0.300000	0.22699	0.305000	0.20034	GAA	.	.		0.398	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
PCDH18	54510	hgsc.bcm.edu	37	4	138451631	138451631	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr4:138451631C>A	ENST00000344876.4	-	1	1998	c.1612G>T	c.(1612-1614)Gtg>Ttg	p.V538L	PCDH18_ENST00000412923.2_Missense_Mutation_p.V538L|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.V318L	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					ATCTGACTCACTTCTTCATGA	0.418																																					p.V538L		Atlas-SNP	.											.	PCDH18	229	.	0			c.G1612T						.						123.0	123.0	123.0					4																	138451631		2203	4300	6503	SO:0001583	missense	54510	exon1			GACTCACTTCTTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1612G>T	chr4.hg19:g.138451631C>A	ENSP00000355082:p.Val538Leu	77.0	0.0		76.0	30.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	hg19	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808482	0.31961	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.51071	0.72;0.72;0.72	5.93	5.93	0.95920	Cadherin (5);Cadherin-like (1);	0.000000	0.39020	N	0.001492	T	0.43389	0.1245	N	0.02865	-0.47	0.80722	D	1	D;B;D	0.89917	1.0;0.067;1.0	D;B;D	0.87578	0.998;0.108;0.998	T	0.36016	-0.9765	10	0.02654	T	1	.	20.3437	0.98782	0.0:1.0:0.0:0.0	.	318;538;538	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	L	538;538;318	ENSP00000355082:V538L;ENSP00000390688:V538L;ENSP00000425903:V318L	ENSP00000355082:V538L	V	-	1	0	PCDH18	138671081	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.196000	0.58407	2.802000	0.96397	0.563000	0.77884	GTG	.	.		0.418	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
CFAP97	57587	hgsc.bcm.edu	37	4	186111951	186111951	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr4:186111951C>A	ENST00000458385.2	-	2	519	c.400G>T	c.(400-402)Gat>Tat	p.D134Y	KIAA1430_ENST00000514798.1_Missense_Mutation_p.D134Y|KIAA1430_ENST00000296775.6_Missense_Mutation_p.D134Y	NM_020827.1	NP_065878.1	Q9P2B7	K1430_HUMAN		134										endometrium(3)|kidney(2)|large_intestine(5)|upper_aerodigestive_tract(1)	11		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		TCCTCTCCATCTGTGTAGTAA	0.348																																					p.D134Y		Atlas-SNP	.											.	KIAA1430	55	.	0			c.G400T						.						74.0	70.0	71.0					4																	186111951		1905	4113	6018	SO:0001583	missense	57587	exon2			CTCCATCTGTGTA																												ENST00000458385.2:c.400G>T	chr4.hg19:g.186111951C>A	ENSP00000409964:p.Asp134Tyr	81.0	0.0		90.0	43.0	NM_020827	B3KRP7|D3DP60|Q05CU1|Q4W5M4|Q8N6E7|Q9UF45	Missense_Mutation	SNP	ENST00000458385.2	hg19	CCDS47168.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008982	0.75046	.	.	ENSG00000164323	ENST00000458385;ENST00000514798;ENST00000296775;ENST00000503223	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.37	5.37	0.77165	.	0.417324	0.25089	N	0.033226	T	0.67655	0.2916	M	0.61703	1.905	0.45676	D	0.998592	D;D	0.89917	1.0;0.998	D;P	0.71870	0.975;0.879	T	0.68938	-0.5277	10	0.66056	D	0.02	-23.3418	19.469	0.94954	0.0:1.0:0.0:0.0	.	134;134	Q9P2B7-2;Q9P2B7	.;K1430_HUMAN	Y	134	ENSP00000409964:D134Y;ENSP00000423312:D134Y;ENSP00000296775:D134Y;ENSP00000420832:D134Y	ENSP00000296775:D134Y	D	-	1	0	KIAA1430	186348945	1.000000	0.71417	0.994000	0.49952	0.865000	0.49528	5.721000	0.68477	2.649000	0.89929	0.655000	0.94253	GAT	.	.		0.348	KIAA1430-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360717.2		
DHX29	54505	hgsc.bcm.edu	37	5	54581616	54581616	+	Silent	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr5:54581616T>C	ENST00000251636.5	-	9	1288	c.1140A>G	c.(1138-1140)aaA>aaG	p.K380K	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	380						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TCAGAAATTGTTTGGGAGATT	0.353																																					p.K380K		Atlas-SNP	.											.	DHX29	116	.	0			c.A1140G						.						67.0	70.0	69.0					5																	54581616		2203	4300	6503	SO:0001819	synonymous_variant	54505	exon9			AAATTGTTTGGGA	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1140A>G	chr5.hg19:g.54581616T>C		144.0	0.0		136.0	48.0	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Silent	SNP	ENST00000251636.5	hg19	CCDS34158.1																																																																																			.	.		0.353	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
IQGAP2	10788	hgsc.bcm.edu	37	5	75886316	75886316	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr5:75886316G>A	ENST00000274364.6	+	8	1021	c.724G>A	c.(724-726)Gcg>Acg	p.A242T	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	242					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAACCCAAATGCGGTTTTAAC	0.383																																					p.A242T		Atlas-SNP	.											.	IQGAP2	186	.	0			c.G724A						.						92.0	92.0	92.0					5																	75886316		2203	4300	6503	SO:0001583	missense	10788	exon8			CCAAATGCGGTTT	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.724G>A	chr5.hg19:g.75886316G>A	ENSP00000274364:p.Ala242Thr	131.0	0.0		130.0	51.0	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	hg19	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	35	5.457558	0.96240	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.51574	3.28;0.7;3.28	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.69682	0.3138	M	0.82716	2.605	0.80722	D	1	D	0.56035	0.974	P	0.58210	0.835	T	0.73522	-0.3956	10	0.72032	D	0.01	-23.1046	19.8594	0.96778	0.0:0.0:1.0:0.0	.	242	Q13576	IQGA2_HUMAN	T	242;215;192	ENSP00000274364:A242T;ENSP00000423672:A215T;ENSP00000421097:A192T	ENSP00000274364:A242T	A	+	1	0	IQGAP2	75922072	1.000000	0.71417	0.952000	0.39060	0.879000	0.50718	9.592000	0.98245	2.691000	0.91804	0.650000	0.86243	GCG	.	.		0.383	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
UNC5CL	222643	hgsc.bcm.edu	37	6	40998166	40998166	+	Missense_Mutation	SNP	C	C	T	rs533058060		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr6:40998166C>T	ENST00000373164.1	-	7	1355	c.1295G>A	c.(1294-1296)aGa>aAa	p.R432K	UNC5CL_ENST00000470102.1_5'UTR|UNC5CL_ENST00000244565.3_Missense_Mutation_p.R432K			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	432	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.		R -> G (in dbSNP:rs742493). {ECO:0000269|PubMed:14769797, ECO:0000269|PubMed:15489334}.		positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGAGGCCAGTCTGCGCCAGTC	0.587																																					p.R432K		Atlas-SNP	.											.	UNC5CL	52	.	0			c.G1295A						.						87.0	80.0	82.0					6																	40998166		2203	4300	6503	SO:0001583	missense	222643	exon8			GCCAGTCTGCGCC	BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.1295G>A	chr6.hg19:g.40998166C>T	ENSP00000362258:p.Arg432Lys	87.0	0.0		194.0	22.0	NM_173561	Q5TGU1	Missense_Mutation	SNP	ENST00000373164.1	hg19	CCDS4847.1	.	.	.	.	.	.	.	.	.	.	C	3.741	-0.053527	0.07362	.	.	ENSG00000124602	ENST00000244565;ENST00000373164	D;D	0.85013	-1.93;-1.93	4.64	2.78	0.32641	Death (3);DEATH-like (2);	0.000000	0.42420	D	0.000719	T	0.41834	0.1176	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.42481	-0.9449	10	0.06099	T	0.92	-13.9955	7.6946	0.28587	0.0:0.7978:0.0:0.2022	.	432	Q8IV45	UN5CL_HUMAN	K	432	ENSP00000244565:R432K;ENSP00000362258:R432K	ENSP00000244565:R432K	R	-	2	0	UNC5CL	41106144	0.050000	0.20438	0.018000	0.16275	0.961000	0.63080	1.027000	0.30115	1.140000	0.42260	0.655000	0.94253	AGA	.	.		0.587	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561	
GCLC	2729	hgsc.bcm.edu	37	6	53364926	53364926	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr6:53364926G>T	ENST00000229416.6	-	15	2102	c.1619C>A	c.(1618-1620)tCt>tAt	p.S540Y		NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	540					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	TTCAAGGTAAGAGTTCAGAAT	0.433																																					p.S540Y		Atlas-SNP	.											.	GCLC	58	.	0			c.C1619A						.						133.0	125.0	127.0					6																	53364926		2203	4300	6503	SO:0001583	missense	2729	exon15			AGGTAAGAGTTCA	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.1619C>A	chr6.hg19:g.53364926G>T	ENSP00000229416:p.Ser540Tyr	93.0	0.0		214.0	49.0	NM_001498	Q14399	Missense_Mutation	SNP	ENST00000229416.6	hg19	CCDS4952.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710712	0.68730	.	.	ENSG00000001084	ENST00000229416	T	0.74526	-0.85	5.77	2.95	0.34219	.	0.306839	0.41396	D	0.000885	T	0.80444	0.4624	M	0.84683	2.71	0.80722	D	1	P	0.42620	0.785	P	0.53224	0.721	D	0.83985	0.0334	10	0.72032	D	0.01	.	17.2211	0.86957	0.0:0.3539:0.6461:0.0	.	540	P48506	GSH1_HUMAN	Y	540	ENSP00000229416:S540Y	ENSP00000229416:S540Y	S	-	2	0	GCLC	53472885	1.000000	0.71417	0.717000	0.30585	0.942000	0.58702	3.334000	0.52097	0.412000	0.25729	-0.150000	0.13652	TCT	.	.		0.433	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2		
DST	667	hgsc.bcm.edu	37	6	56481993	56481993	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr6:56481993C>T	ENST00000370765.6	-	24	6379	c.6272G>A	c.(6271-6273)gGg>gAg	p.G2091E	DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	0					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTGCCTAAGCCCTTGGAATTT	0.458																																					p.G2091E		Atlas-SNP	.											.	DST	1427	.	0			c.G6272A						.						130.0	128.0	129.0					6																	56481993		2203	4300	6503	SO:0001583	missense	667	exon24			CTAAGCCCTTGGA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.6272G>A	chr6.hg19:g.56481993C>T	ENSP00000359801:p.Gly2091Glu	50.0	0.0		119.0	23.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	hg19	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489319	0.64074	.	.	ENSG00000151914	ENST00000370765	T	0.70045	-0.45	5.77	5.77	0.91146	.	.	.	.	.	T	0.77765	0.4179	.	.	.	0.18873	N	0.999984	D	0.89917	1.0	D	0.83275	0.996	T	0.70350	-0.4896	7	0.25106	T	0.35	.	20.3472	0.98799	0.0:1.0:0.0:0.0	.	2091	Q03001-3	.	E	2091	ENSP00000359801:G2091E	ENSP00000359801:G2091E	G	-	2	0	DST	56589952	0.999000	0.42202	0.999000	0.59377	0.979000	0.70002	3.033000	0.49743	2.890000	0.99128	0.650000	0.86243	GGG	.	.		0.458	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
OPRM1	4988	hgsc.bcm.edu	37	6	154360440	154360440	+	5'Flank	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr6:154360440G>T	ENST00000330432.7	+	0	0				OPRM1_ENST00000524163.1_5'Flank|OPRM1_ENST00000452687.2_5'Flank|OPRM1_ENST00000419506.2_5'Flank|OPRM1_ENST00000428397.2_5'Flank|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000229768.5_5'Flank|OPRM1_ENST00000434900.2_Splice_Site_p.A49S|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000435918.2_5'Flank|OPRM1_ENST00000414028.2_5'Flank|OPRM1_ENST00000337049.4_5'Flank|OPRM1_ENST00000360422.4_5'Flank	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GTGCGGGGCAGGTGATGAGCC	0.622																																					p.A49S		Atlas-SNP	.											.	OPRM1	241	.	0			c.G145T						.						71.0	68.0	69.0					6																	154360440		692	1591	2283	SO:0001631	upstream_gene_variant	4988	exon2			GGGGCAGGTGATG	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870		chr6.hg19:g.154360440G>T	Exception_encountered	80.0	0.0		52.0	40.0	NM_001145279	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	hg19	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.267847	0.23136	.	.	ENSG00000112038	ENST00000434900	T	0.72505	-0.66	5.48	0.339	0.15979	.	.	.	.	.	T	0.23649	0.0572	N	0.08118	0	0.22001	N	0.999426	B	0.12013	0.005	B	0.12156	0.007	T	0.20009	-1.0288	9	0.56958	D	0.05	.	3.4842	0.07614	0.0784:0.2559:0.3686:0.2971	.	49	P35372-10	.	S	49	ENSP00000394624:A49S	ENSP00000394624:A49S	A	+	1	0	OPRM1	154402133	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.166000	0.31834	-0.243000	0.09653	-0.885000	0.02943	GCC	.	.		0.622	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
ASZ1	136991	hgsc.bcm.edu	37	7	117003700	117003700	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr7:117003700C>T	ENST00000284629.2	-	13	1440	c.1378G>A	c.(1378-1380)Gga>Aga	p.G460R		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			AAACCGAATCCGCATATGGTA	0.323																																					p.G460R		Atlas-SNP	.											.	ASZ1	56	.	0			c.G1378A						.						114.0	113.0	113.0					7																	117003700		2203	4299	6502	SO:0001583	missense	136991	exon13			CGAATCCGCATAT	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.1378G>A	chr7.hg19:g.117003700C>T	ENSP00000284629:p.Gly460Arg	83.0	0.0		93.0	16.0	NM_130768		Missense_Mutation	SNP	ENST00000284629.2	hg19	CCDS5772.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.254029	0.59212	.	.	ENSG00000154438	ENST00000284629	T	0.74947	-0.89	5.23	5.23	0.72850	.	0.056344	0.64402	D	0.000001	D	0.83261	0.5216	L	0.59436	1.845	0.52501	D	0.999957	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.84862	0.0820	10	0.87932	D	0	2.3198	14.2861	0.66247	0.0:1.0:0.0:0.0	.	451;460	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	R	460	ENSP00000284629:G460R	ENSP00000284629:G460R	G	-	1	0	ASZ1	116790936	0.997000	0.39634	0.998000	0.56505	0.435000	0.31806	4.401000	0.59716	2.440000	0.82611	0.591000	0.81541	GGA	.	.		0.323	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	NM_130768	
STRIP2	57464	hgsc.bcm.edu	37	7	129102863	129102863	+	Silent	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr7:129102863C>T	ENST00000249344.2	+	14	1573	c.1533C>T	c.(1531-1533)taC>taT	p.Y511Y	STRIP2_ENST00000435494.2_Silent_p.Y511Y	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	511					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											GAATGCTGTACAGCCTTCCGC	0.507																																					p.Y511Y		Atlas-SNP	.											.	.	.	.	0			c.C1533T						.						97.0	86.0	90.0					7																	129102863		2203	4300	6503	SO:0001819	synonymous_variant	57464	exon14			GCTGTACAGCCTT	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.1533C>T	chr7.hg19:g.129102863C>T		65.0	0.0		64.0	14.0	NM_020704	Q8WUZ4	Silent	SNP	ENST00000249344.2	hg19	CCDS34752.1																																																																																			.	.		0.507	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
MKLN1	4289	hgsc.bcm.edu	37	7	131122635	131122635	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr7:131122635T>C	ENST00000352689.6	+	10	1092	c.1052T>C	c.(1051-1053)gTg>gCg	p.V351A	MKLN1_ENST00000421797.2_Missense_Mutation_p.V259A	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	351					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					GATTCCTCTGTGAGGAACAGC	0.433																																					p.V351A		Atlas-SNP	.											.	MKLN1	67	.	0			c.T1052C						.						237.0	225.0	229.0					7																	131122635		2203	4300	6503	SO:0001583	missense	4289	exon10			CCTCTGTGAGGAA	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.1052T>C	chr7.hg19:g.131122635T>C	ENSP00000323527:p.Val351Ala	112.0	0.0		149.0	31.0	NM_013255	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Missense_Mutation	SNP	ENST00000352689.6	hg19	CCDS34754.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.622137	0.46840	.	.	ENSG00000128585	ENST00000421797;ENST00000352689	T;T	0.44482	1.93;0.92	5.83	5.83	0.93111	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.27419	0.0673	N	0.14661	0.345	0.80722	D	1	B;B;B	0.15473	0.007;0.013;0.013	B;B;B	0.12156	0.007;0.003;0.003	T	0.10154	-1.0642	10	0.16896	T	0.51	-14.1727	15.3799	0.74648	0.0:0.0:0.0:1.0	.	351;328;259	Q9UL63;B4DG30;C9J7E8	MKLN1_HUMAN;.;.	A	259;351	ENSP00000398094:V259A;ENSP00000323527:V351A	ENSP00000323527:V351A	V	+	2	0	MKLN1	130773175	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.230000	0.72887	0.454000	0.30748	GTG	.	.		0.433	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255	
RUNX1T1	862	hgsc.bcm.edu	37	8	92982954	92982954	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr8:92982954C>T	ENST00000523629.1	-	11	1925	c.1471G>A	c.(1471-1473)Gcc>Acc	p.A491T	RUNX1T1_ENST00000436581.2_Missense_Mutation_p.A502T|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.A491T|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.A464T|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.A454T|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.A454T|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.A454T|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.A464T	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	491					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A491T(2)|p.A454T(2)|p.A502T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TTGGCCTCGGCGACCGTGCGC	0.602																																					p.A550T		Atlas-SNP	.											RUNX1T1_ENST00000436581,NS,carcinoma,0,5	RUNX1T1	516	.	5	Substitution - Missense(5)	lung(3)|large_intestine(2)	c.G1648A						.						71.0	61.0	64.0					8																	92982954		2203	4300	6503	SO:0001583	missense	862	exon11			CCTCGGCGACCGT	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1471G>A	chr8.hg19:g.92982954C>T	ENSP00000428543:p.Ala491Thr	67.0	0.0		124.0	26.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	hg19	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	32	5.157358	0.94686	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.67154	0.2863	M	0.83603	2.65	0.58432	D	0.999996	D;D;D;D	0.67145	0.994;0.996;0.995;0.984	P;P;P;P	0.62184	0.82;0.899;0.838;0.773	T	0.68062	-0.5508	10	0.48119	T	0.1	-15.9301	19.9981	0.97395	0.0:1.0:0.0:0.0	.	502;454;491;464	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	T	491;464;491;454;454;454;502;464	ENSP00000428543:A491T;ENSP00000379520:A464T;ENSP00000265814:A491T;ENSP00000353504:A454T;ENSP00000390137:A454T;ENSP00000428742:A454T;ENSP00000402257:A502T;ENSP00000430728:A464T	ENSP00000265814:A491T	A	-	1	0	RUNX1T1	93052130	1.000000	0.71417	0.954000	0.39281	0.838000	0.47535	5.999000	0.70665	2.729000	0.93468	0.655000	0.94253	GCC	.	.		0.602	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	SNP	G	G	C	rs398009582|rs71302978		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr8:120220776G>C	ENST00000276681.6	+	1	167	c.65G>C	c.(64-66)cGg>cCg	p.R22P	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771																																					.		Atlas-SNP	.											.	.	.	.	0			c.64+1G>C						.						1.0	1.0	1.0					8																	120220776		184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>C	chr8.hg19:g.120220776G>C		34.0	0.0		81.0	13.0	NM_052886	B2R520|Q6ZMD9	Splice_Site	SNP	ENST00000276681.6	hg19																																																																																				.	.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Missense_Mutation
HSF1	3297	hgsc.bcm.edu	37	8	145533250	145533250	+	Silent	SNP	T	T	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr8:145533250T>A	ENST00000528838.1	+	3	496	c.336T>A	c.(334-336)ctT>ctA	p.L112L	HSF1_ENST00000400780.4_Silent_p.L47L	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1	112					cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			AGCAGCTCCTTGAGAACATCA	0.642																																					p.L112L		Atlas-SNP	.											.	HSF1	29	.	0			c.T336A						.						121.0	118.0	119.0					8																	145533250		2203	4296	6499	SO:0001819	synonymous_variant	3297	exon3			GCTCCTTGAGAAC	M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.336T>A	chr8.hg19:g.145533250T>A		172.0	0.0		353.0	250.0	NM_005526	A8K4L0|A8MW26|Q53XT4	Silent	SNP	ENST00000528838.1	hg19	CCDS6419.1																																																																																			.	.		0.642	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382053.1	NM_005526	
CDKN2A	1029	hgsc.bcm.edu	37	9	21971190	21971190	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:21971190G>T	ENST00000304494.5	-	2	438	c.168C>A	c.(166-168)agC>agA	p.S56R	CDKN2A_ENST00000498124.1_Missense_Mutation_p.S56R|CDKN2A_ENST00000578845.2_Missense_Mutation_p.S5R|CDKN2A_ENST00000479692.2_Missense_Mutation_p.S5R|CDKN2A_ENST00000530628.2_Missense_Mutation_p.R71S|CDKN2A_ENST00000579755.1_Missense_Mutation_p.R71S|CDKN2A_ENST00000446177.1_Missense_Mutation_p.S56R|CDKN2A_ENST00000497750.1_Missense_Mutation_p.S5R|CDKN2A_ENST00000579122.1_Missense_Mutation_p.S56R|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Missense_Mutation_p.S5R|CDKN2A_ENST00000361570.3_Missense_Mutation_p.R112S|CDKN2A_ENST00000498628.2_Missense_Mutation_p.S5R	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	56			S -> I (possible polymorphism).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(45)|p.M53_R58del(3)|p.M54fs*61(2)|p.A57fs*63(2)|p.0(1)|p.V28_V51del(1)|p.A57fs*62(1)|p.G55fs*86(1)|p.S56fs*90(1)|p.S114fs*>61(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCACTCGGGCGCTGCCCATCA	0.687		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.R71S		Atlas-SNP	.											CDKN2A_ENST00000361570,NS,carcinoma,+1,1	CDKN2A	4810	.	1373	Whole gene deletion(1316)|Unknown(45)|Deletion - Frameshift(5)|Deletion - In frame(4)|Insertion - Frameshift(3)	haematopoietic_and_lymphoid_tissue(283)|skin(177)|central_nervous_system(167)|lung(146)|urinary_tract(92)|bone(74)|soft_tissue(57)|upper_aerodigestive_tract(56)|pleura(51)|oesophagus(50)|ovary(37)|kidney(32)|breast(32)|pancreas(30)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.C211A						.						7.0	9.0	8.0					9																	21971190		2052	4098	6150	SO:0001583	missense	1029	exon2			TCGGGCGCTGCCC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.168C>A	chr9.hg19:g.21971190G>T	ENSP00000307101:p.Ser56Arg	42.0	0.0		39.0	17.0	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	hg19	CCDS6510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.997|8.997	0.979147|0.979147	0.18812|0.18812	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|T;T	0.78816|0.64991	-1.21;-1.15|-0.13;-0.13	5.79|5.79	3.64|3.64	0.41730|0.41730	.|Ankyrin repeat-containing domain (4);	0.577489|.	0.14579|.	N|.	0.310962|.	T|T	0.64080|0.64080	0.2566|0.2566	N|N	0.24115|0.24115	0.695|0.695	0.21950|0.21950	N|N	0.999459|0.999459	B|D	0.16802|0.89917	0.019|1.0	B|D	0.12156|0.68039	0.007|0.955	T|T	0.53151|0.53151	-0.8479|-0.8479	10|9	0.44086|0.49607	T|T	0.13|0.09	-13.3999|-13.3999	10.119|10.119	0.42609|0.42609	0.2392:0.0:0.7608:0.0|0.2392:0.0:0.7608:0.0	.|.	112|56	Q8N726|P42771	CD2A2_HUMAN|CD2A1_HUMAN	S|R	112;71|56	ENSP00000355153:R112S;ENSP00000432664:R71S|ENSP00000307101:S56R;ENSP00000394932:S56R	ENSP00000355153:R112S|ENSP00000307101:S56R	R|S	-|-	1|3	0|2	CDKN2A|CDKN2A	21961190|21961190	0.983000|0.983000	0.35010|0.35010	0.488000|0.488000	0.27440|0.27440	0.368000|0.368000	0.29767|0.29767	3.981000|3.981000	0.56902|0.56902	1.454000|1.454000	0.47793|0.47793	-0.263000|-0.263000	0.10527|0.10527	CGC|AGC	.	.		0.687	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
CCDC180	100499483	hgsc.bcm.edu	37	9	100105806	100105806	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:100105806T>C	ENST00000357054.1	+	33	3943	c.3008T>C	c.(3007-3009)gTg>gCg	p.V1003A	CCDC180_ENST00000529487.1_Missense_Mutation_p.V864A|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000375202.2_Missense_Mutation_p.V864A|CCDC180_ENST00000411667.2_Missense_Mutation_p.V861A|CCDC180_ENST00000460482.2_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1003						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ATAGAACAAGTGACAATTCCA	0.378																																					p.V864A		Atlas-SNP	.											.	.	.	.	0			c.T2591C						.						82.0	78.0	79.0					9																	100105806		2203	4300	6503	SO:0001583	missense	0	exon19			AACAAGTGACAAT	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3008T>C	chr9.hg19:g.100105806T>C	ENSP00000349562:p.Val1003Ala	57.0	0.0		59.0	20.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.21	1.570755	0.28003	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.19250	2.81;2.82;2.16;2.82	5.39	3.05	0.35203	.	0.249082	0.33127	N	0.005243	T	0.12860	0.0312	L	0.32530	0.975	0.09310	N	1	B;B;P	0.36144	0.087;0.42;0.539	B;B;B	0.37650	0.063;0.255;0.17	T	0.21348	-1.0248	10	0.06757	T	0.87	-13.5431	7.2665	0.26232	0.0:0.1774:0.0:0.8226	.	887;1003;1003	Q86Y65;B7ZMG3;Q9P1Z9	.;.;CI174_HUMAN	A	1003;864;861;887;864	ENSP00000349562:V1003A;ENSP00000364348:V864A;ENSP00000414000:V861A;ENSP00000434727:V864A	ENSP00000349562:V1003A	V	+	2	0	C9orf174	99145627	0.669000	0.27502	0.135000	0.22099	0.038000	0.13279	0.812000	0.27211	0.441000	0.26529	-0.256000	0.11100	GTG	.	.		0.378	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
ACTL7B	10880	hgsc.bcm.edu	37	9	111617761	111617761	+	Silent	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:111617761G>A	ENST00000374667.3	-	1	1478	c.450C>T	c.(448-450)tcC>tcT	p.S150S		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	150						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GCGGAGGGTCGGAGACCAGCA	0.627																																					p.S150S		Atlas-SNP	.											.	ACTL7B	57	.	0			c.C450T						.						59.0	44.0	49.0					9																	111617761		2203	4300	6503	SO:0001819	synonymous_variant	10880	exon1			AGGGTCGGAGACC	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.450C>T	chr9.hg19:g.111617761G>A		64.0	0.0		53.0	16.0	NM_006686	B2R9Q2|Q5JSV1	Silent	SNP	ENST00000374667.3	hg19	CCDS6771.1																																																																																			.	.		0.627	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053571.1	NM_006686	
GPSM1	26086	hgsc.bcm.edu	37	9	139234263	139234263	+	Silent	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:139234263C>T	ENST00000440944.1	+	8	1294	c.1074C>T	c.(1072-1074)atC>atT	p.I358I	GPSM1_ENST00000392945.3_Silent_p.I358I	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	358	Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		ACCTGCAGATCTCCCAGGAGG	0.711																																					p.I358I		Atlas-SNP	.											.	GPSM1	50	.	0			c.C1074T						.						28.0	29.0	29.0					9																	139234263		1822	3480	5302	SO:0001819	synonymous_variant	26086	exon8			GCAGATCTCCCAG	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1074C>T	chr9.hg19:g.139234263C>T		63.0	0.0		55.0	27.0	NM_015597	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Silent	SNP	ENST00000440944.1	hg19	CCDS48055.1																																																																																			.	.		0.711	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
ABCA2	20	hgsc.bcm.edu	37	9	139902954	139902954	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:139902954G>T	ENST00000371605.3	-	47	7333	c.7186C>A	c.(7186-7188)Ccc>Acc	p.P2396T	ABCA2_ENST00000341511.6_Missense_Mutation_p.P2397T|ABCA2_ENST00000265662.5_Missense_Mutation_p.P2397T			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	2396					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGCTCCGTGGGGGCAGACCGG	0.682																																					p.P2427T		Atlas-SNP	.											.	ABCA2	113	.	0			c.C7279A						.						13.0	16.0	15.0					9																	139902954		1972	4151	6123	SO:0001583	missense	20	exon48			CCGTGGGGGCAGA	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.7186C>A	chr9.hg19:g.139902954G>T	ENSP00000360666:p.Pro2396Thr	60.0	0.0		61.0	23.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	hg19		.	.	.	.	.	.	.	.	.	.	G	11.41	1.629176	0.28978	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511;ENST00000490486;ENST00000448336	D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-1.75;-1.72	4.06	3.13	0.36017	.	0.583672	0.15862	U	0.240980	T	0.79167	0.4400	N	0.24115	0.695	0.40152	D	0.976961	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.73329	-0.4017	10	0.48119	T	0.1	.	12.8377	0.57782	0.0:0.0:0.8353:0.1647	.	2396;2427	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	T	2397;2396;2427;2397;156;146	ENSP00000265662:P2397T;ENSP00000360666:P2396T;ENSP00000344155:P2397T;ENSP00000420360:P156T;ENSP00000406741:P146T	ENSP00000265662:P2397T	P	-	1	0	ABCA2	139022775	0.979000	0.34478	0.489000	0.27452	0.448000	0.32197	1.156000	0.31712	0.877000	0.35895	0.313000	0.20887	CCC	.	.		0.682	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
FUT7	2529	hgsc.bcm.edu	37	9	139925353	139925353	+	Missense_Mutation	SNP	C	C	T	rs547445437		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:139925353C>T	ENST00000314412.6	-	2	1856	c.838G>A	c.(838-840)Gcc>Acc	p.A280T	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_5'Flank|ABCA2_ENST00000371605.3_5'Flank|ABCA2_ENST00000265662.5_5'Flank|C9orf139_ENST00000314330.2_Intron	NM_004479.3	NP_004470.1	Q11130	FUT7_HUMAN	fucosyltransferase 7 (alpha (1,3) fucosyltransferase)	280					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|leukocyte migration involved in immune response (GO:0002522)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|lung(4)|ovary(1)|skin(1)	8	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		AGCTCTCGGGCTGAGCCAAAG	0.637																																					p.A280T		Atlas-SNP	.											.	FUT7	24	.	0			c.G838A						.						49.0	52.0	51.0					9																	139925353		2201	4295	6496	SO:0001583	missense	2529	exon2			CTCGGGCTGAGCC	X78031, AB012668	CCDS7022.1	9q34.3	2013-02-26			ENSG00000180549	ENSG00000180549		"""Fucosyltransferases"""	4018	protein-coding gene	gene with protein product		602030				8207002, 8182079	Standard	NM_004479		Approved		uc004ckq.2	Q11130	OTTHUMG00000020964	ENST00000314412.6:c.838G>A	chr9.hg19:g.139925353C>T	ENSP00000318142:p.Ala280Thr	43.0	0.0		65.0	26.0	NM_004479	B2R7U7|Q6DK54	Missense_Mutation	SNP	ENST00000314412.6	hg19	CCDS7022.1	.	.	.	.	.	.	.	.	.	.	c	9.723	1.160111	0.21454	.	.	ENSG00000180549	ENST00000314412	T	0.26223	1.75	4.37	4.37	0.52481	.	0.354005	0.24143	U	0.041148	T	0.20820	0.0501	L	0.31752	0.955	0.27989	N	0.935726	B	0.29766	0.256	B	0.32393	0.145	T	0.11275	-1.0594	10	0.31617	T	0.26	-18.2707	14.499	0.67709	0.0:1.0:0.0:0.0	.	280	Q11130	FUT7_HUMAN	T	280	ENSP00000318142:A280T	ENSP00000318142:A280T	A	-	1	0	FUT7	139045174	0.000000	0.05858	0.745000	0.31077	0.023000	0.10783	-0.310000	0.08135	2.252000	0.74401	0.552000	0.68991	GCC	.	.		0.637	FUT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055220.1	NM_004479	
RASGEF1A	221002	hgsc.bcm.edu	37	10	43691966	43691966	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:43691966C>T	ENST00000395809.1	-	12	3885	c.1379G>A	c.(1378-1380)gGt>gAt	p.G460D	RASGEF1A_ENST00000395810.1_Missense_Mutation_p.G460D|RASGEF1A_ENST00000374459.1_Missense_Mutation_p.G468D			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	460	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						GTTCTCGGGACCCTCACTTTC	0.572																																					p.G460D		Atlas-SNP	.											.	RASGEF1A	66	.	0			c.G1379A						.						156.0	142.0	147.0					10																	43691966		2203	4300	6503	SO:0001583	missense	221002	exon12			TCGGGACCCTCAC	AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.1379G>A	chr10.hg19:g.43691966C>T	ENSP00000379154:p.Gly460Asp	50.0	0.0		59.0	21.0	NM_145313	Q8TBF1	Missense_Mutation	SNP	ENST00000395809.1	hg19	CCDS7202.2	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995664	0.93167	.	.	ENSG00000198915	ENST00000374459;ENST00000395810;ENST00000395809	T;T;T	0.29655	1.56;1.56;1.56	5.14	5.14	0.70334	Guanine-nucleotide dissociation stimulator CDC25 (2);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000001	T	0.40595	0.1123	L	0.51422	1.61	0.80722	D	1	P;P	0.45672	0.645;0.864	B;P	0.47981	0.231;0.563	T	0.25152	-1.0140	10	0.56958	D	0.05	.	18.9656	0.92695	0.0:1.0:0.0:0.0	.	460;468	Q8N9B8;Q8N9B8-2	RGF1A_HUMAN;.	D	468;460;460	ENSP00000363583:G468D;ENSP00000379155:G460D;ENSP00000379154:G460D	ENSP00000363583:G468D	G	-	2	0	RASGEF1A	43011972	1.000000	0.71417	0.992000	0.48379	0.949000	0.60115	7.403000	0.79983	2.550000	0.86006	0.462000	0.41574	GGT	.	.		0.572	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313	
JMJD1C	221037	hgsc.bcm.edu	37	10	64952883	64952883	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:64952883T>C	ENST00000399262.2	-	16	6109	c.5891A>G	c.(5890-5892)aAt>aGt	p.N1964S	JMJD1C_ENST00000542921.1_Missense_Mutation_p.N1782S|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Intron	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1964					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					AGAAATTTTATTACTGTGATT	0.353																																					p.N1964S		Atlas-SNP	.											.	JMJD1C	347	.	0			c.A5891G						.						75.0	67.0	69.0					10																	64952883		1855	4101	5956	SO:0001583	missense	221037	exon16			ATTTTATTACTGT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5891A>G	chr10.hg19:g.64952883T>C	ENSP00000382204:p.Asn1964Ser	20.0	0.0		17.0	6.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	hg19	CCDS41532.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.75|12.75	2.030144|2.030144	0.35797|0.35797	.|.	.|.	ENSG00000171988|ENSG00000171988	ENST00000327520|ENST00000399262;ENST00000542921	.|T;T	.|0.50001	.|0.76;0.77	5.67|5.67	3.31|3.31	0.37934|0.37934	.|.	.|0.048027	.|0.85682	.|D	.|0.000000	T|T	0.39009|0.39009	0.1062|0.1062	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|B;B	.|0.30793	.|0.052;0.295	.|B;B	.|0.23852	.|0.031;0.049	T|T	0.18335|0.18335	-1.0340|-1.0340	5|10	.|0.27082	.|T	.|0.32	-10.3947|-10.3947	10.073|10.073	0.42345|0.42345	0.0:0.1406:0.0:0.8594|0.0:0.1406:0.0:0.8594	.|.	.|1505;1964	.|A6PW35;Q15652	.|.;JHD2C_HUMAN	V|S	511|1964;1782	.|ENSP00000382204:N1964S;ENSP00000444682:N1782S	.|ENSP00000382204:N1964S	I|N	-|-	1|2	0|0	JMJD1C|JMJD1C	64622889|64622889	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.878000|0.878000	0.50629|0.50629	3.212000|3.212000	0.51145|0.51145	0.982000|0.982000	0.38575|0.38575	0.528000|0.528000	0.53228|0.53228	ATA|AAT	.	.		0.353	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
TBATA	219793	hgsc.bcm.edu	37	10	72536989	72536989	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:72536989A>G	ENST00000299290.1	-	7	999	c.610T>C	c.(610-612)Tct>Cct	p.S204P	TBATA_ENST00000456372.2_Missense_Mutation_p.S204P	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	204					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											CCCTGGTGAGATCTGCGGCGG	0.632																																					p.S204P		Atlas-SNP	.											.	.	.	.	0			c.T610C						.						61.0	64.0	63.0					10																	72536989		2203	4300	6503	SO:0001583	missense	219793	exon7			GGTGAGATCTGCG	AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.610T>C	chr10.hg19:g.72536989A>G	ENSP00000299290:p.Ser204Pro	40.0	0.0		38.0	12.0	NM_152710	A4QPA8|B2RPQ2|Q5T4G2	Missense_Mutation	SNP	ENST00000299290.1	hg19	CCDS7308.1	.	.	.	.	.	.	.	.	.	.	A	9.941	1.217434	0.22373	.	.	ENSG00000166220	ENST00000299290;ENST00000536955;ENST00000456372	T;T	0.19394	2.15;2.15	4.66	0.438	0.16560	.	0.536654	0.14140	N	0.338743	T	0.30978	0.0782	M	0.75264	2.295	0.09310	N	1	D;B;B;B	0.64830	0.994;0.004;0.004;0.019	P;B;B;B	0.52957	0.714;0.007;0.011;0.011	T	0.11641	-1.0579	10	0.66056	D	0.02	-11.2433	5.6987	0.17871	0.5189:0.3238:0.0:0.1573	.	224;203;205;204	B7Z8G0;B7ZMN4;B7ZMN5;Q96M53	.;.;.;SPATL_HUMAN	P	204;222;204	ENSP00000299290:S204P;ENSP00000400224:S204P	ENSP00000299290:S204P	S	-	1	0	C10orf27	72206995	0.216000	0.23585	0.003000	0.11579	0.001000	0.01503	0.811000	0.27198	0.208000	0.20626	-0.501000	0.04562	TCT	.	.		0.632	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1	NM_152710	
PTEN	5728	hgsc.bcm.edu	37	10	89685287	89685287	+	Missense_Mutation	SNP	A	A	T	rs398123316		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:89685287A>T	ENST00000371953.3	+	3	1539	c.182A>T	c.(181-183)cAt>cTt	p.H61L		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	61	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		H -> D (in VATER). {ECO:0000269|PubMed:11748304}.|H -> R (loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.H61R(8)|p.?(6)|p.R55fs*1(5)|p.Y27fs*1(2)|p.H61L(1)|p.V54fs*29(1)|p.R55_L70>S(1)|p.F56fs*2(1)|p.H61P(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GATTCAAAGCATAAAAACCAT	0.259		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.H61L		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,carcinoma,0,10	PTEN	3652	.	63	Whole gene deletion(37)|Substitution - Missense(10)|Deletion - Frameshift(9)|Unknown(6)|Complex - deletion inframe(1)	central_nervous_system(18)|prostate(16)|lung(8)|skin(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(3)|urinary_tract(2)|breast(2)|soft_tissue(1)|endometrium(1)	c.A182T	GRCh37	CI022298	PTEN	I		.						35.0	36.0	36.0					10																	89685287		2184	4274	6458	SO:0001583	missense	5728	exon3	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	CAAAGCATAAAAA	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.182A>T	chr10.hg19:g.89685287A>T	ENSP00000361021:p.His61Leu	1343.0	1.0		1334.0	544.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.546993	0.86022	.	.	ENSG00000171862	ENST00000371953	D	0.98602	-5.02	5.46	5.46	0.80206	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.99202	0.9723	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99170	1.0864	9	.	.	.	-10.6657	15.5246	0.75894	1.0:0.0:0.0:0.0	.	61	P60484	PTEN_HUMAN	L	61	ENSP00000361021:H61L	.	H	+	2	0	PTEN	89675267	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.668000	0.91158	2.072000	0.62099	0.533000	0.62120	CAT	.	.		0.259	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
CHUK	1147	hgsc.bcm.edu	37	10	101967049	101967049	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:101967049C>T	ENST00000370397.7	-	11	1255	c.1169G>A	c.(1168-1170)aGt>aAt	p.S390N		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	390					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TACAGTTTTACTTTTATCAAA	0.333																																					p.S390N	Ovarian(159;52 1904 10536 35305 37148)	Atlas-SNP	.											.	CHUK	71	.	0			c.G1169A						.						65.0	65.0	65.0					10																	101967049		2202	4295	6497	SO:0001583	missense	1147	exon11			GTTTTACTTTTAT	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1169G>A	chr10.hg19:g.101967049C>T	ENSP00000359424:p.Ser390Asn	75.0	0.0		59.0	13.0	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	hg19	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800210	0.70567	.	.	ENSG00000213341	ENST00000370397	T	0.56103	0.48	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.69780	0.3149	L	0.58810	1.83	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.69921	-0.5014	10	0.56958	D	0.05	-11.411	17.2953	0.87169	0.0:1.0:0.0:0.0	.	390	O15111	IKKA_HUMAN	N	390	ENSP00000359424:S390N	ENSP00000359424:S390N	S	-	2	0	CHUK	101957039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.678000	0.91216	0.650000	0.86243	AGT	.	.		0.333	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
SORCS3	22986	hgsc.bcm.edu	37	10	107022244	107022244	+	Missense_Mutation	SNP	T	T	C	rs367891062		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:107022244T>C	ENST00000369701.3	+	26	3826	c.3599T>C	c.(3598-3600)gTc>gCc	p.V1200A		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1200					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GACACGCGGGTCATAGGTACA	0.532																																					p.V1200A	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.T3599C						.	T	ALA/VAL	0,4406		0,0,2203	60.0	47.0	51.0		3599	5.8	1.0	10		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	SORCS3	NM_014978.1	64	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	1200/1223	107022244	1,13005	2203	4300	6503	SO:0001583	missense	22986	exon26			CGCGGGTCATAGG	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3599T>C	chr10.hg19:g.107022244T>C	ENSP00000358715:p.Val1200Ala	62.0	0.0		59.0	28.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	T	13.15	2.150713	0.37923	0.0	1.16E-4	ENSG00000156395	ENST00000369701	T	0.14144	2.53	5.84	5.84	0.93424	.	0.334249	0.31909	N	0.006878	T	0.13114	0.0318	L	0.36672	1.1	0.35142	D	0.768993	B	0.14805	0.011	B	0.12156	0.007	T	0.14980	-1.0453	9	.	.	.	.	16.2322	0.82352	0.0:0.0:0.0:1.0	.	1200	Q9UPU3	SORC3_HUMAN	A	1200	ENSP00000358715:V1200A	.	V	+	2	0	SORCS3	107012234	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	1.978000	0.40598	2.233000	0.73108	0.454000	0.30748	GTC	.	.		0.532	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
COPB1	1315	hgsc.bcm.edu	37	11	14512195	14512195	+	Silent	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr11:14512195A>G	ENST00000249923.3	-	5	822	c.522T>C	c.(520-522)ccT>ccC	p.P174P	COPB1_ENST00000439561.2_Silent_p.P174P	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	174					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						GTATCAGTTCAGGAGCATCAG	0.323																																					p.P174P		Atlas-SNP	.											.	COPB1	81	.	0			c.T522C						.						88.0	76.0	80.0					11																	14512195		2200	4292	6492	SO:0001819	synonymous_variant	1315	exon5			CAGTTCAGGAGCA	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.522T>C	chr11.hg19:g.14512195A>G		170.0	0.0		153.0	53.0	NM_001144062	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Silent	SNP	ENST00000249923.3	hg19	CCDS7815.1																																																																																			.	.		0.323	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
OR8H2	390151	hgsc.bcm.edu	37	11	55872580	55872580	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr11:55872580C>T	ENST00000313503.1	+	1	62	c.62C>T	c.(61-63)tCt>tTt	p.S21F		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTGACACTTTCTGAAGAGATC	0.423										HNSCC(53;0.14)																											p.S21F		Atlas-SNP	.											.	OR8H2	117	.	0			c.C62T						.						238.0	230.0	232.0					11																	55872580		2201	4296	6497	SO:0001583	missense	390151	exon1			CACTTTCTGAAGA	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.62C>T	chr11.hg19:g.55872580C>T	ENSP00000323982:p.Ser21Phe	88.0	0.0		76.0	32.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	hg19	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	c	3.756	-0.050546	0.07407	.	.	ENSG00000181767	ENST00000313503	T	0.01099	5.34	3.74	1.81	0.25067	.	0.135646	0.34700	N	0.003756	T	0.01189	0.0039	L	0.43598	1.365	0.09310	N	1	B	0.24043	0.096	B	0.23018	0.043	T	0.45556	-0.9253	10	0.46703	T	0.11	.	5.6885	0.17817	0.1589:0.6551:0.0:0.186	.	21	Q8N162	OR8H2_HUMAN	F	21	ENSP00000323982:S21F	ENSP00000323982:S21F	S	+	2	0	OR8H2	55629156	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.275000	0.08525	0.866000	0.35629	0.440000	0.28878	TCT	.	.		0.423	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
OR5T3	390154	hgsc.bcm.edu	37	11	56019703	56019703	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr11:56019703C>T	ENST00000303059.3	+	1	28	c.28C>T	c.(28-30)Ctt>Ttt	p.L10F		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					AGGCTATAACCTTTATAACCT	0.353																																					p.L10F		Atlas-SNP	.											.	OR5T3	98	.	0			c.C28T						.						60.0	57.0	58.0					11																	56019703		2199	4295	6494	SO:0001583	missense	390154	exon1			TATAACCTTTATA	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.28C>T	chr11.hg19:g.56019703C>T	ENSP00000305403:p.Leu10Phe	64.0	0.0		55.0	19.0	NM_001004747	Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	hg19	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	C	9.450	1.090394	0.20471	.	.	ENSG00000172489	ENST00000303059	T	0.00007	9.66	4.7	-7.43	0.01383	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.11665	-1.0578	9	0.66056	D	0.02	.	5.8558	0.18718	0.3431:0.4707:0.0:0.1862	.	10	Q8NGG3	OR5T3_HUMAN	F	10	ENSP00000305403:L10F	ENSP00000305403:L10F	L	+	1	0	OR5T3	55776279	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.271000	0.00532	-1.389000	0.02090	-1.020000	0.02445	CTT	.	.		0.353	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747	
AHNAK	79026	hgsc.bcm.edu	37	11	62293842	62293842	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr11:62293842T>C	ENST00000378024.4	-	5	8321	c.8047A>G	c.(8047-8049)Att>Gtt	p.I2683V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2683					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGTCCTTCAATGTTAACATCA	0.483																																					p.I2683V		Atlas-SNP	.											.	AHNAK	532	.	0			c.A8047G						.						163.0	164.0	164.0					11																	62293842		2202	4299	6501	SO:0001583	missense	79026	exon5			CTTCAATGTTAAC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8047A>G	chr11.hg19:g.62293842T>C	ENSP00000367263:p.Ile2683Val	85.0	0.0		101.0	42.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	t	5.912	0.352398	0.11182	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.01347	4.99	4.65	-0.928	0.10448	.	.	.	.	.	T	0.01254	0.0041	L	0.28400	0.85	0.09310	N	1	B	0.25955	0.138	B	0.29785	0.107	T	0.47749	-0.9093	9	0.32370	T	0.25	-5.9575	3.7706	0.08640	0.1239:0.0737:0.3838:0.4186	.	2683	Q09666	AHNK_HUMAN	V	772;2683	ENSP00000367263:I2683V	ENSP00000244934:I772V	I	-	1	0	AHNAK	62050418	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-0.480000	0.06803	0.392000	0.25879	ATT	.	.		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PIH1D2	120379	hgsc.bcm.edu	37	11	111941928	111941928	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr11:111941928C>A	ENST00000280350.4	-	4	603	c.381G>T	c.(379-381)caG>caT	p.Q127H	PIH1D2_ENST00000530641.1_Missense_Mutation_p.Q127H|C11orf57_ENST00000420986.2_5'Flank|PIH1D2_ENST00000532211.1_Missense_Mutation_p.Q127H|PIH1D2_ENST00000431456.1_Missense_Mutation_p.Q127H|PIH1D2_ENST00000521853.2_5'UTR|PIH1D2_ENST00000528775.1_Missense_Mutation_p.Q127H	NM_138789.3	NP_620144.1	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2	127										endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		TCTGAATTAACTGATTTTTTT	0.373																																					p.Q127H		Atlas-SNP	.											.	PIH1D2	24	.	0			c.G381T						.						175.0	168.0	171.0					11																	111941928		2201	4297	6498	SO:0001583	missense	120379	exon4			AATTAACTGATTT	BC019238	CCDS8355.1, CCDS44730.1	11q23.1	2007-01-31			ENSG00000150773	ENSG00000150773			25210	protein-coding gene	gene with protein product						12477932	Standard	NM_138789		Approved		uc001pmp.4	Q8WWB5	OTTHUMG00000166925	ENST00000280350.4:c.381G>T	chr11.hg19:g.111941928C>A	ENSP00000280350:p.Gln127His	52.0	0.0		57.0	29.0	NM_001082619	B4DU48|E9PD82	Missense_Mutation	SNP	ENST00000280350.4	hg19	CCDS8355.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.037|1.037	-0.680063|-0.680063	0.03353|0.03353	.|.	.|.	ENSG00000150773|ENSG00000150773	ENST00000528775;ENST00000431456;ENST00000532211;ENST00000280350;ENST00000530641;ENST00000525744|ENST00000525072	T;T;T;T;T;T|.	0.17854|.	2.25;2.25;2.25;2.25;2.25;2.25|.	5.9|5.9	-4.06|-4.06	0.03986|0.03986	.|.	0.706089|.	0.14818|.	N|.	0.296636|.	T|T	0.42988|0.42988	0.1227|0.1227	L|L	0.54323|0.54323	1.7|1.7	0.29794|0.29794	N|N	0.832949|0.832949	B;P;B|.	0.35684|.	0.164;0.515;0.16|.	B;B;B|.	0.34138|.	0.126;0.176;0.119|.	T|T	0.51942|0.51942	-0.8641|-0.8641	10|5	0.14252|.	T|.	0.57|.	-0.7436|-0.7436	7.4158|7.4158	0.27044|0.27044	0.1853:0.6243:0.0925:0.0978|0.1853:0.6243:0.0925:0.0978	.|.	127;127;127|.	B4DU48;E9PD82;Q8WWB5|.	.;.;PIHD2_HUMAN|.	H|F	127;127;127;127;127;92|83	ENSP00000434275:Q127H;ENSP00000388209:Q127H;ENSP00000431841:Q127H;ENSP00000280350:Q127H;ENSP00000431147:Q127H;ENSP00000433297:Q92H|.	ENSP00000280350:Q127H|.	Q|V	-|-	3|1	2|0	PIH1D2|PIH1D2	111447138|111447138	0.677000|0.677000	0.27577|0.27577	0.166000|0.166000	0.22797|0.22797	0.301000|0.301000	0.27625|0.27625	-0.422000|-0.422000	0.07043|0.07043	-0.318000|-0.318000	0.08665|0.08665	-0.282000|-0.282000	0.10007|0.10007	CAG|GTT	.	.		0.373	PIH1D2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391916.1	NM_138789	
KCNJ1	3758	hgsc.bcm.edu	37	11	128709552	128709552	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr11:128709552T>C	ENST00000392664.2	-	2	760	c.644A>G	c.(643-645)aAt>aGt	p.N215S	KCNJ1_ENST00000392666.1_Missense_Mutation_p.N196S|KCNJ1_ENST00000440599.2_Missense_Mutation_p.N196S|KCNJ1_ENST00000324036.3_Missense_Mutation_p.N196S|KCNJ1_ENST00000392665.2_Missense_Mutation_p.N196S	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	215					cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	CTTCCTGAGATTAGCCACTCG	0.473																																					p.N215S		Atlas-SNP	.											.	KCNJ1	68	.	0			c.A644G						.						86.0	88.0	87.0					11																	128709552		2199	4290	6489	SO:0001583	missense	3758	exon2			CTGAGATTAGCCA	BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.644A>G	chr11.hg19:g.128709552T>C	ENSP00000376432:p.Asn215Ser	71.0	0.0		72.0	32.0	NM_000220	B2RMR4|Q6LD67	Missense_Mutation	SNP	ENST00000392664.2	hg19	CCDS8476.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.209756	0.79240	.	.	ENSG00000151704	ENST00000392665;ENST00000392666;ENST00000440599;ENST00000324036;ENST00000392664	D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51	5.71	5.71	0.89125	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97885	0.9305	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98962	1.0798	10	0.87932	D	0	.	15.992	0.80214	0.0:0.0:0.0:1.0	.	215	P48048	IRK1_HUMAN	S	196;196;196;196;215	ENSP00000376433:N196S;ENSP00000376434:N196S;ENSP00000406320:N196S;ENSP00000316233:N196S;ENSP00000376432:N215S	ENSP00000316233:N196S	N	-	2	0	KCNJ1	128214762	1.000000	0.71417	0.971000	0.41717	0.968000	0.65278	8.026000	0.88783	2.173000	0.68751	0.421000	0.28195	AAT	.	.		0.473	KCNJ1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386233.1	NM_000220	
VWF	7450	hgsc.bcm.edu	37	12	6128399	6128399	+	Silent	SNP	C	C	A	rs63749069		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:6128399C>A	ENST00000261405.5	-	28	4439	c.4185G>T	c.(4183-4185)cgG>cgT	p.R1395R		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1395	VWFA 1; binding site for platelet glycoprotein Ib. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGACAAAGTTCCGGGACATCC	0.582																																					p.R1395R		Atlas-SNP	.											.	VWF	338	.	0			c.G4185T						.						45.0	51.0	49.0					12																	6128399		2203	4297	6500	SO:0001819	synonymous_variant	7450	exon28			AAAGTTCCGGGAC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4185G>T	chr12.hg19:g.6128399C>A		40.0	0.0		42.0	15.0	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
CLSTN3	9746	hgsc.bcm.edu	37	12	7288407	7288407	+	Silent	SNP	T	T	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:7288407T>A	ENST00000266546.6	+	5	1050	c.600T>A	c.(598-600)atT>atA	p.I200I	CLSTN3_ENST00000537408.1_Silent_p.I212I	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	200	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CAGGGAACATTGAGAACACAG	0.547																																					p.I200I		Atlas-SNP	.											.	CLSTN3	84	.	0			c.T600A						.						108.0	98.0	101.0					12																	7288407		2203	4300	6503	SO:0001819	synonymous_variant	9746	exon5			GAACATTGAGAAC	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.600T>A	chr12.hg19:g.7288407T>A		64.0	0.0		53.0	26.0	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	hg19	CCDS8575.1																																																																																			.	.		0.547	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
FAM186A	121006	hgsc.bcm.edu	37	12	50746094	50746094	+	Silent	SNP	G	G	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:50746094G>C	ENST00000327337.5	-	4	4520	c.4521C>G	c.(4519-4521)ctC>ctG	p.L1507L	FAM186A_ENST00000543111.1_Silent_p.L1507L|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1507								p.L1507L(9)									GCGGAGGGATGAGAAGGATCC	0.662																																					p.L1507L	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,NS,carcinoma,0,8	FAM186A	181	.	9	Substitution - coding silent(9)	endometrium(8)|lung(1)	c.C4521G						.																																			SO:0001819	synonymous_variant	121006	exon4			AGGGATGAGAAGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4521C>G	chr12.hg19:g.50746094G>C		107.0	0.0		117.0	5.0	NM_001145475		Silent	SNP	ENST00000327337.5	hg19	CCDS44878.1																																																																																			.	.		0.662	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
KRT86	3892	hgsc.bcm.edu	37	12	52699514	52699514	+	Missense_Mutation	SNP	A	A	T	rs373358594		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:52699514A>T	ENST00000423955.2	+	8	1146	c.968A>T	c.(967-969)aAc>aTc	p.N323I	RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000544024.1_Missense_Mutation_p.N323I|KRT86_ENST00000293525.5_Missense_Mutation_p.N323I			O43790	KRT86_HUMAN	keratin 86	323	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GAGGAGATCAACGAGCTGAAC	0.597																																					p.N323I		Atlas-SNP	.											.	KRT86	33	.	0			c.A968T						.						128.0	113.0	118.0					12																	52699514		2203	4300	6503	SO:0001583	missense	3892	exon6			AGATCAACGAGCT	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.968A>T	chr12.hg19:g.52699514A>T	ENSP00000444533:p.Asn323Ile	111.0	0.0		105.0	40.0	NM_002284	P78387	Missense_Mutation	SNP	ENST00000423955.2	hg19	CCDS41785.1	.	.	.	.	.	.	.	.	.	.	A	18.21	3.573534	0.65765	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	T;T;T	0.78126	-1.15;-1.15;-1.15	4.73	4.73	0.59995	Filament (1);	0.000000	0.47455	U	0.000230	T	0.81659	0.4869	M	0.64170	1.965	0.24475	N	0.994378	P	0.40211	0.707	P	0.52598	0.703	T	0.75345	-0.3350	10	0.72032	D	0.01	.	9.4167	0.38525	0.7567:0.2433:0.0:0.0	.	323	O43790	KRT86_HUMAN	I	323	ENSP00000443169:N323I;ENSP00000444533:N323I;ENSP00000293525:N323I	ENSP00000293525:N323I	N	+	2	0	AC021066.1;KRT86	50985781	0.085000	0.21516	0.994000	0.49952	0.961000	0.63080	1.035000	0.30216	1.781000	0.52344	0.413000	0.27773	AAC	.	.		0.597	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	NM_002284	
MFSD5	84975	hgsc.bcm.edu	37	12	53646678	53646678	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:53646678A>G	ENST00000329548.4	+	2	250	c.59A>G	c.(58-60)gAa>gGa	p.E20G	MFSD5_ENST00000534842.1_Missense_Mutation_p.E127G	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	20					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CTGGGGCTGGAACTGTCAAGA	0.602																																					p.E127G		Atlas-SNP	.											.	MFSD5	40	.	0			c.A380G						.						77.0	84.0	81.0					12																	53646678		2203	4300	6503	SO:0001583	missense	84975	exon2			GGCTGGAACTGTC	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.59A>G	chr12.hg19:g.53646678A>G	ENSP00000332624:p.Glu20Gly	65.0	0.0		65.0	31.0	NM_001170790	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	hg19	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	A	15.25	2.778806	0.49891	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	.	.	.	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	M	0.76170	2.325	0.58432	D	0.999991	B;B	0.32350	0.2;0.366	B;B	0.39094	0.29;0.157	T	0.70128	-0.4957	9	0.59425	D	0.04	-5.2353	12.5639	0.56297	1.0:0.0:0.0:0.0	.	20;127	Q6N075;G3V1N7	MFSD5_HUMAN;.	G	127;127;127;20	.	ENSP00000331231:E127G	E	+	2	0	MFSD5	51932945	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.147000	0.89628	1.817000	0.53016	0.459000	0.35465	GAA	.	.		0.602	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
IKZF4	64375	hgsc.bcm.edu	37	12	56429110	56429110	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:56429110G>A	ENST00000262032.5	+	12	2120	c.1753G>A	c.(1753-1755)Ggc>Agc	p.G585S	IKZF4_ENST00000547791.1_Missense_Mutation_p.G540S|IKZF4_ENST00000547167.1_Missense_Mutation_p.G585S|RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000431367.2_Missense_Mutation_p.G483S			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	585					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			GCATAAGGTGGGCTAGCAACC	0.537																																					p.G585S		Atlas-SNP	.											.	IKZF4	71	.	0			c.G1753A						.						137.0	138.0	137.0					12																	56429110		2128	4235	6363	SO:0001583	missense	64375	exon8			AAGGTGGGCTAGC	AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.1753G>A	chr12.hg19:g.56429110G>A	ENSP00000262032:p.Gly585Ser	37.0	0.0		49.0	16.0	NM_022465	Q96JP3	Missense_Mutation	SNP	ENST00000262032.5	hg19	CCDS44917.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027025	0.75390	.	.	ENSG00000123411	ENST00000262032;ENST00000431367;ENST00000547167;ENST00000547791	T;T;T;T	0.15718	2.4;2.66;2.4;2.54	4.74	4.74	0.60224	.	0.282883	0.25347	N	0.031330	T	0.29458	0.0734	L	0.27053	0.805	0.44006	D	0.996716	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	T	0.04522	-1.0945	10	0.87932	D	0	-5.1608	14.7469	0.69494	0.0:0.0:1.0:0.0	.	483;540;544;585	G5E9S4;F8VPL6;Q9H2S9-2;Q9H2S9	.;.;.;IKZF4_HUMAN	S	585;483;585;540	ENSP00000262032:G585S;ENSP00000412101:G483S;ENSP00000448419:G585S;ENSP00000450020:G540S	ENSP00000262032:G585S	G	+	1	0	IKZF4	54715377	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	3.234000	0.51320	2.453000	0.82957	0.313000	0.20887	GGC	.	.		0.537	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407590.1	NM_022465	
SLC26A10	65012	hgsc.bcm.edu	37	12	58015473	58015473	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:58015473A>G	ENST00000320442.4	+	4	867	c.556A>G	c.(556-558)Acg>Gcg	p.T186A	SLC26A10_ENST00000379218.2_Splice_Site_p.T186A|AC025165.8_ENST00000593846.1_RNA	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	186						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CTGCCCTCAGACGCTGGCCTC	0.701											OREG0021948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T186A		Atlas-SNP	.											.	SLC26A10	89	.	0			c.A556G						.						10.0	11.0	11.0					12																	58015473		2193	4291	6484	SO:0001630	splice_region_variant	65012	exon4			CCTCAGACGCTGG		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.556-1A>G	chr12.hg19:g.58015473A>G		67.0	0.0	1027	46.0	20.0	NM_133489	A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	hg19	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	20.2	3.942556	0.73672	.	.	ENSG00000135502	ENST00000320442;ENST00000379218	D;D	0.92199	-2.99;-2.99	3.89	3.89	0.44902	Sulphate transporter (1);	.	.	.	.	D	0.93406	0.7897	M	0.71871	2.18	0.43242	D	0.995152	D	0.53885	0.963	P	0.57204	0.815	D	0.92534	0.6036	8	.	.	.	.	9.3146	0.37926	1.0:0.0:0.0:0.0	.	186	Q8NG04	S2610_HUMAN	A	186	ENSP00000320217:T186A;ENSP00000368520:T186A	.	T	+	1	0	SLC26A10	56301740	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	4.464000	0.60134	1.785000	0.52413	0.454000	0.30748	ACG	.	.		0.701	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2		Missense_Mutation
GIT2	9815	hgsc.bcm.edu	37	12	110370863	110370863	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:110370863G>C	ENST00000355312.3	-	20	2199	c.2200C>G	c.(2200-2202)Cag>Gag	p.Q734E	GIT2_ENST00000360185.4_Missense_Mutation_p.Q684E|GIT2_ENST00000551209.1_Missense_Mutation_p.Q683E|GIT2_ENST00000354574.4_Missense_Mutation_p.Q656E|GIT2_ENST00000553118.1_Missense_Mutation_p.Q606E|GIT2_ENST00000361006.5_Missense_Mutation_p.Q704E|GIT2_ENST00000548655.1_5'Flank|GIT2_ENST00000457474.2_Missense_Mutation_p.Q656E|GIT2_ENST00000343646.5_Missense_Mutation_p.Q624E|GIT2_ENST00000356259.4_Missense_Mutation_p.Q621E|TCHP_ENST00000550780.1_3'UTR|GIT2_ENST00000338373.5_Missense_Mutation_p.Q636E	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	734					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						TGGATGACCTGCTGCGTGACC	0.592																																					p.Q734E		Atlas-SNP	.											.	GIT2	81	.	0			c.C2200G						.						155.0	124.0	135.0					12																	110370863		2203	4300	6503	SO:0001583	missense	9815	exon20			TGACCTGCTGCGT	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.2200C>G	chr12.hg19:g.110370863G>C	ENSP00000347464:p.Gln734Glu	66.0	0.0		53.0	23.0	NM_057169	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Missense_Mutation	SNP	ENST00000355312.3	hg19	CCDS9138.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021747	0.75275	.	.	ENSG00000139436	ENST00000355312;ENST00000360185;ENST00000354574;ENST00000338373;ENST00000343646;ENST00000356259;ENST00000457474;ENST00000361006;ENST00000553118;ENST00000551209;ENST00000552978	T;T;T;T;T;T;T;T;T;T	0.75938	-0.8;-0.95;-0.77;-0.69;-0.9;-0.67;-0.74;-0.78;-0.8;-0.98	5.53	5.53	0.82687	G protein-coupled receptor kinase-interacting protein 1 C term (1);	0.000000	0.85682	D	0.000000	D	0.83243	0.5212	L	0.56199	1.76	0.42362	D	0.992419	D;D;P;D;P	0.76494	0.997;0.997;0.943;0.999;0.514	D;D;P;D;B	0.85130	0.926;0.926;0.546;0.997;0.276	T	0.79727	-0.1682	10	0.25106	T	0.35	.	18.4469	0.90688	0.0:0.0:1.0:0.0	.	656;656;606;734;704	Q14161-10;F8WAK2;Q14161-11;Q14161;Q14161-5	.;.;.;GIT2_HUMAN;.	E	734;684;656;636;624;621;656;704;606;683;120	ENSP00000347464:Q734E;ENSP00000353312:Q684E;ENSP00000346585:Q656E;ENSP00000340342:Q636E;ENSP00000340938:Q624E;ENSP00000348595:Q621E;ENSP00000391813:Q656E;ENSP00000354282:Q704E;ENSP00000447465:Q606E;ENSP00000448832:Q683E	ENSP00000340342:Q636E	Q	-	1	0	GIT2	108855246	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	9.869000	0.99810	2.593000	0.87608	0.455000	0.32223	CAG	.	.		0.592	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
PIWIL1	9271	hgsc.bcm.edu	37	12	130832690	130832690	+	Silent	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr12:130832690T>C	ENST00000245255.3	+	7	968	c.696T>C	c.(694-696)taT>taC	p.Y232Y		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	232					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GACGAAATTATTATAACCCAA	0.328																																					p.Y232Y		Atlas-SNP	.											.	PIWIL1	157	.	0			c.T696C						.						87.0	84.0	85.0					12																	130832690		2203	4300	6503	SO:0001819	synonymous_variant	9271	exon7			AAATTATTATAAC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.696T>C	chr12.hg19:g.130832690T>C		103.0	0.0		65.0	28.0	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	hg19	CCDS9268.1																																																																																			.	.		0.328	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
RNF17	56163	hgsc.bcm.edu	37	13	25367348	25367348	+	Silent	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr13:25367348T>C	ENST00000255324.5	+	10	1156	c.1104T>C	c.(1102-1104)gaT>gaC	p.D368D	RNF17_ENST00000381921.1_Silent_p.D368D|RNF17_ENST00000255325.6_Silent_p.D368D|RNF17_ENST00000255326.4_3'UTR	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	368					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AGACAAATGATGTACATTTAG	0.448																																					p.D368D		Atlas-SNP	.											.	RNF17	259	.	0			c.T1104C						.						169.0	158.0	162.0					13																	25367348		2203	4300	6503	SO:0001819	synonymous_variant	56163	exon10			AAATGATGTACAT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1104T>C	chr13.hg19:g.25367348T>C		115.0	0.0		101.0	42.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	hg19	CCDS9308.2																																																																																			.	.		0.448	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
HMGB1	3146	hgsc.bcm.edu	37	13	31035522	31035522	+	Missense_Mutation	SNP	T	T	A	rs55678359		TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr13:31035522T>A	ENST00000405805.1	-	5	1560	c.620A>T	c.(619-621)gAt>gTt	p.D207V	HMGB1_ENST00000399489.1_3'UTR|HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000339872.4_Missense_Mutation_p.D207V|HMGB1_ENST00000341423.5_Missense_Mutation_p.D207V|HMGB1_ENST00000399494.1_Missense_Mutation_p.D207V			P09429	HMGB1_HUMAN	high mobility group box 1	207	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		ttcttcttcatcttcatcttc	0.398																																					p.D207V		Atlas-SNP	.											.	HMGB1	21	.	0			c.A620T						.						17.0	20.0	19.0					13																	31035522		1871	4092	5963	SO:0001583	missense	3146	exon5			TCTTCATCTTCAT	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.620A>T	chr13.hg19:g.31035522T>A	ENSP00000384678:p.Asp207Val	58.0	0.0		66.0	29.0	NM_002128	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	ENST00000405805.1	hg19	CCDS9335.1	.	.	.	.	.	.	.	.	.	.	T	9.476	1.096774	0.20552	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399494	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	5.72	5.72	0.89469	Armadillo-like helical (1);	0.870387	0.09605	N	0.779737	T	0.55609	0.1931	N	0.08118	0	0.80722	D	1	P;P	0.41313	0.745;0.535	B;B	0.36608	0.229;0.151	T	0.60068	-0.7335	10	0.87932	D	0	.	15.9816	0.80114	0.0:0.0:0.0:1.0	.	168;207	B3KQ05;P09429	.;HMGB1_HUMAN	V	207	ENSP00000384678:D207V;ENSP00000343040:D207V;ENSP00000345347:D207V;ENSP00000382417:D207V	ENSP00000343040:D207V	D	-	2	0	HMGB1	29933522	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.386000	0.79775	2.180000	0.69256	0.519000	0.50382	GAT	.	.		0.398	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
ITM2B	9445	hgsc.bcm.edu	37	13	48807572	48807572	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr13:48807572G>T	ENST00000378565.5	+	1	279	c.76G>T	c.(76-78)Gcg>Tcg	p.A26S	ITM2B_ENST00000378549.5_Missense_Mutation_p.A26S	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	26					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		CGGCGAGGAGGCGCTCATCAT	0.721																																					p.A26S		Atlas-SNP	.											.	ITM2B	24	.	0			c.G76T						.						10.0	9.0	9.0					13																	48807572		2141	4219	6360	SO:0001583	missense	9445	exon1			GAGGAGGCGCTCA	AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.76G>T	chr13.hg19:g.48807572G>T	ENSP00000367828:p.Ala26Ser	113.0	0.0		150.0	63.0	NM_021999	Q5W0A3|Q96B24|Q9NYH1	Missense_Mutation	SNP	ENST00000378565.5	hg19	CCDS9409.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188503	0.78789	.	.	ENSG00000136156	ENST00000378565;ENST00000378549	T;T	0.30981	1.54;1.51	5.04	5.04	0.67666	.	0.169236	0.37906	N	0.001896	T	0.25680	0.0625	L	0.39898	1.24	0.35016	D	0.757332	B	0.22346	0.068	B	0.13407	0.009	T	0.23190	-1.0195	10	0.29301	T	0.29	-3.3056	13.8841	0.63698	0.0:0.0:1.0:0.0	.	26	Q9Y287	ITM2B_HUMAN	S	26	ENSP00000367828:A26S;ENSP00000367811:A26S	ENSP00000367811:A26S	A	+	1	0	ITM2B	47705573	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.966000	0.63715	2.333000	0.79357	0.561000	0.74099	GCG	.	.		0.721	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044870.3	NM_021999	
ING1	3621	hgsc.bcm.edu	37	13	111368119	111368119	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr13:111368119G>T	ENST00000375774.3	+	1	791	c.329G>T	c.(328-330)cGc>cTc	p.R110L	ING1_ENST00000338450.7_Intron|ING1_ENST00000333219.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron|CARS2_ENST00000535398.1_5'Flank	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	110					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CGAGTCTCCCGCTGGCCTCCT	0.692																																					p.R110L		Atlas-SNP	.											.	ING1	106	.	0			c.G329T						.						11.0	13.0	12.0					13																	111368119		2161	4213	6374	SO:0001583	missense	3621	exon1			TCTCCCGCTGGCC		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.329G>T	chr13.hg19:g.111368119G>T	ENSP00000364929:p.Arg110Leu	26.0	0.0		25.0	9.0	NM_005537	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	hg19	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.544859	0.27563	.	.	ENSG00000153487	ENST00000375774	T	0.55052	0.54	2.6	0.696	0.18075	.	.	.	.	.	T	0.31420	0.0796	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.21621	-1.0240	9	0.59425	D	0.04	-0.2528	4.9415	0.13967	0.0:0.2385:0.5168:0.2448	.	110	Q9UK53	ING1_HUMAN	L	110	ENSP00000364929:R110L	ENSP00000364929:R110L	R	+	2	0	ING1	110166120	0.000000	0.05858	0.003000	0.11579	0.045000	0.14185	-0.883000	0.04170	0.004000	0.14682	-0.310000	0.09108	CGC	.	.		0.692	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
PCK2	5106	hgsc.bcm.edu	37	14	24572747	24572747	+	Silent	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr14:24572747C>T	ENST00000216780.4	+	10	1765	c.1497C>T	c.(1495-1497)gcC>gcT	p.A499A	NRL_ENST00000561028.1_Intron|PCK2_ENST00000558096.1_Silent_p.A333A|PCK2_ENST00000545054.2_Silent_p.A365A|PCK2_ENST00000559250.1_Intron|PCK2_ENST00000561286.1_Silent_p.A365A	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	499					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		ACCCATTTGCCATGCGGCCCT	0.572																																					p.A499A		Atlas-SNP	.											.	PCK2	66	.	0			c.C1497T						.						74.0	75.0	75.0					14																	24572747		2203	4300	6503	SO:0001819	synonymous_variant	5106	exon10			ATTTGCCATGCGG	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.1497C>T	chr14.hg19:g.24572747C>T		102.0	0.0		90.0	43.0	NM_004563	O43253|Q86U01|Q9BV62	Silent	SNP	ENST00000216780.4	hg19	CCDS9609.1																																																																																			.	.		0.572	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3	NM_001018073	
ATP10A	57194	hgsc.bcm.edu	37	15	25928550	25928550	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr15:25928550G>T	ENST00000356865.6	-	17	3486	c.3375C>A	c.(3373-3375)ttC>ttA	p.F1125L		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1125					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCAGATTAAAGAAGATTAGAT	0.502																																					p.F1125L		Atlas-SNP	.											.	ATP10A	270	.	0			c.C3375A						.						85.0	82.0	83.0					15																	25928550		2203	4300	6503	SO:0001583	missense	57194	exon17			ATTAAAGAAGATT	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3375C>A	chr15.hg19:g.25928550G>T	ENSP00000349325:p.Phe1125Leu	178.0	0.0		175.0	79.0	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	hg19	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777985	0.49786	.	.	ENSG00000206190	ENST00000356865	D	0.87887	-2.31	4.81	4.81	0.61882	.	0.046306	0.85682	N	0.000000	T	0.79185	0.4403	N	0.25890	0.77	0.52501	D	0.999954	B	0.11235	0.004	B	0.14578	0.011	T	0.73694	-0.3902	10	0.07644	T	0.81	-23.3633	17.8828	0.88845	0.0:0.0:1.0:0.0	.	1125	O60312	AT10A_HUMAN	L	1125	ENSP00000349325:F1125L	ENSP00000349325:F1125L	F	-	3	2	ATP10A	23479643	1.000000	0.71417	0.999000	0.59377	0.816000	0.46133	7.493000	0.81493	2.205000	0.71048	0.655000	0.94253	TTC	.	.		0.502	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
NOP10	55505	hgsc.bcm.edu	37	15	34635263	34635263	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr15:34635263C>A	ENST00000328848.4	-	1	115	c.12G>T	c.(10-12)caG>caT	p.Q4H	NUTM1_ENST00000333756.4_5'Flank|NUTM1_ENST00000438749.3_5'Flank|NUTM1_ENST00000537011.1_5'Flank|NOP10_ENST00000557912.1_Missense_Mutation_p.Q4H	NM_018648.3	NP_061118.1	Q9NPE3	NOP10_HUMAN	NOP10 ribonucleoprotein	4					pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA RNP complex (GO:0072588)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	snoRNA binding (GO:0030515)			lung(1)|ovary(1)	2						TGAGGTAATACTGGAGAAACA	0.522											OREG0023034	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q4H		Atlas-SNP	.											.	NOP10	8	.	0			c.G12T						.						226.0	176.0	193.0					15																	34635263		2201	4298	6499	SO:0001583	missense	55505	exon1			GTAATACTGGAGA	AB043103	CCDS10037.1	15q14-q15	2014-09-17	2012-12-10	2008-10-13	ENSG00000182117	ENSG00000182117			14378	protein-coding gene	gene with protein product	"""homolog of yeast Nop10p"""	606471	"""nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs)"", ""NOP10 ribonucleoprotein homolog (yeast)"""	NOLA3		11074001, 9843512	Standard	NM_018648		Approved	NOP10P, MGC70651	uc001zie.1	Q9NPE3	OTTHUMG00000129440	ENST00000328848.4:c.12G>T	chr15.hg19:g.34635263C>A	ENSP00000332198:p.Gln4His	87.0	0.0	849	81.0	36.0	NM_018648		Missense_Mutation	SNP	ENST00000328848.4	hg19	CCDS10037.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814900	0.50527	.	.	ENSG00000182117	ENST00000328848	T	0.77489	-1.1	5.04	3.13	0.36017	.	0.208582	0.45361	D	0.000362	T	0.68650	0.3024	.	.	.	0.49483	D	0.999799	B	0.02656	0.0	B	0.06405	0.002	T	0.64287	-0.6443	9	0.59425	D	0.04	.	10.0238	0.42059	0.0:0.8317:0.0:0.1683	.	4	Q9NPE3	NOP10_HUMAN	H	4	ENSP00000332198:Q4H	ENSP00000332198:Q4H	Q	-	3	2	NOP10	32422555	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.646000	0.37249	0.684000	0.31448	0.655000	0.94253	CAG	.	.		0.522	NOP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251602.2	NM_018648	
SPG11	80208	hgsc.bcm.edu	37	15	44859685	44859685	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr15:44859685T>C	ENST00000261866.7	-	36	6707	c.6691A>G	c.(6691-6693)Att>Gtt	p.I2231V	SPG11_ENST00000535302.2_Missense_Mutation_p.I2118V|SPG11_ENST00000427534.2_Missense_Mutation_p.I2231V	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	2231					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TTCTCGCCAATCTCCCGGCAC	0.542																																					p.I2231V		Atlas-SNP	.											.	SPG11	207	.	0			c.A6691G						.						82.0	71.0	75.0					15																	44859685		2198	4298	6496	SO:0001583	missense	80208	exon36			CGCCAATCTCCCG		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.6691A>G	chr15.hg19:g.44859685T>C	ENSP00000261866:p.Ile2231Val	57.0	0.0		51.0	25.0	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	hg19	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.287000	0.80803	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.80994	-1.44;-1.06;-1.31	6.14	6.14	0.99180	.	0.044927	0.85682	D	0.000000	D	0.89739	0.6802	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.85130	0.997;0.994;0.997;0.997	D	0.89546	0.3796	10	0.46703	T	0.11	.	16.7723	0.85541	0.0:0.0:0.0:1.0	.	2231;2118;2231;2231	C4B7M2;F5H3N6;C4B7M4;Q96JI7	.;.;.;SPTCS_HUMAN	V	2231;2118;2231	ENSP00000261866:I2231V;ENSP00000445278:I2118V;ENSP00000396110:I2231V	ENSP00000261866:I2231V	I	-	1	0	SPG11	42646977	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.988000	0.88194	2.360000	0.80028	0.519000	0.50382	ATT	.	.		0.542	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
SEMA4B	10509	hgsc.bcm.edu	37	15	90764627	90764627	+	Silent	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr15:90764627C>T	ENST00000411539.2	+	6	884	c.624C>T	c.(622-624)agC>agT	p.S208S	SEMA4B_ENST00000332496.6_Silent_p.S208S|SEMA4B_ENST00000379122.3_Silent_p.S203S	NM_198925.2	NP_945119.1	Q9NPR2	SEM4B_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B	203	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)	receptor activity (GO:0004872)			NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)	12	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			GAACAGTCAGCAGCTTCCAAG	0.602											OREG0023469	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S208S		Atlas-SNP	.											.	SEMA4B	51	.	0			c.C624T						.						26.0	28.0	27.0					15																	90764627		1978	4158	6136	SO:0001819	synonymous_variant	10509	exon7			AGTCAGCAGCTTC	AB051532	CCDS45347.1	15q25	2008-07-18						"""Semaphorins"""	10730	protein-coding gene	gene with protein product				SEMAC		7748561	Standard	NM_020210		Approved	SemC, KIAA1745, MGC131831	uc002boz.3	Q9NPR2		ENST00000411539.2:c.624C>T	chr15.hg19:g.90764627C>T		62.0	0.0	1277	69.0	26.0	NM_020210	Q6UXE3|Q8WVP9|Q96FK5|Q9C0B8|Q9H691|Q9NPM8|Q9NPN0	Silent	SNP	ENST00000411539.2	hg19	CCDS45347.1																																																																																			.	.		0.602	SEMA4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416810.1	NM_198925	
MAPK8IP3	23162	hgsc.bcm.edu	37	16	1816360	1816360	+	Silent	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr16:1816360C>T	ENST00000250894.4	+	22	2923	c.2766C>T	c.(2764-2766)caC>caT	p.H922H	MAPK8IP3_ENST00000356010.5_Silent_p.H916H	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	922					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						TCACAGAGCACGTCTTCACTG	0.692																																					p.H922H		Atlas-SNP	.											.	MAPK8IP3	164	.	0			c.C2766T						.						26.0	37.0	33.0					16																	1816360		2049	4180	6229	SO:0001819	synonymous_variant	23162	exon22			AGAGCACGTCTTC	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2766C>T	chr16.hg19:g.1816360C>T		104.0	0.0		112.0	11.0	NM_015133	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	ENST00000250894.4	hg19	CCDS10442.2																																																																																			.	.		0.692	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	
FAM92B	339145	hgsc.bcm.edu	37	16	85132897	85132897	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr16:85132897G>A	ENST00000539556.1	-	9	964	c.809C>T	c.(808-810)gCc>gTc	p.A270V		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	270										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						gccatgattggcatgaggatg	0.547																																					p.A270V		Atlas-SNP	.											.	FAM92B	29	.	0			c.C809T						.						136.0	106.0	116.0					16																	85132897		2198	4300	6498	SO:0001583	missense	339145	exon8			TGATTGGCATGAG		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.809C>T	chr16.hg19:g.85132897G>A	ENSP00000443411:p.Ala270Val	87.0	0.0		61.0	28.0	NM_198491		Missense_Mutation	SNP	ENST00000539556.1	hg19	CCDS32500.1	.	.	.	.	.	.	.	.	.	.	G	8.286	0.816552	0.16607	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.35605	1.3	1.33	0.342	0.15996	.	16.395400	0.01771	N	0.031201	T	0.20455	0.0492	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.26744	-1.0094	10	0.87932	D	0	-1.9737	3.6117	0.08062	0.2602:0.0:0.7398:0.0	.	270	Q6ZTR7	FA92B_HUMAN	V	270	ENSP00000443411:A270V	ENSP00000376937:A270V	A	-	2	0	FAM92B	83690398	0.001000	0.12720	0.006000	0.13384	0.038000	0.13279	0.082000	0.14847	0.147000	0.19030	0.491000	0.48974	GCC	.	.		0.547	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198491	
GLP2R	9340	hgsc.bcm.edu	37	17	9729508	9729508	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr17:9729508G>A	ENST00000262441.5	+	1	641	c.128G>A	c.(127-129)tGc>tAc	p.C43Y	GLP2R_ENST00000574745.1_Intron	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	43					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	CACAGGAAGTGCTCTCTCTGG	0.572																																					p.C43Y		Atlas-SNP	.											.	GLP2R	90	.	0			c.G128A						.						41.0	41.0	41.0					17																	9729508		2203	4300	6503	SO:0001583	missense	9340	exon1			GGAAGTGCTCTCT	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.128G>A	chr17.hg19:g.9729508G>A	ENSP00000262441:p.Cys43Tyr	44.0	0.0		35.0	9.0	NM_004246	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	hg19	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	G	5.696	0.312991	0.10789	.	.	ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441	T	0.55413	0.52	4.06	-4.54	0.03452	.	1.382700	0.05238	N	0.511683	T	0.26412	0.0645	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.12156	0.007	T	0.13710	-1.0499	10	0.44086	T	0.13	.	2.9793	0.05948	0.096:0.3993:0.2079:0.2968	.	43	O95838	GLP2R_HUMAN	Y	43;18;43	ENSP00000262441:C43Y	ENSP00000262441:C43Y	C	+	2	0	GLP2R	9670233	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.381000	0.07417	-0.511000	0.06514	-0.878000	0.02970	TGC	.	.		0.572	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
TPGS1	91978	hgsc.bcm.edu	37	19	519025	519025	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:519025G>A	ENST00000359315.5	+	2	683	c.475G>A	c.(475-477)Gag>Aag	p.E159K		NM_033513.2	NP_277048.2	Q6ZTW0	TPGS1_HUMAN	tubulin polyglutamylase complex subunit 1	159					adult behavior (GO:0030534)|multicellular organismal development (GO:0007275)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|synaptic transmission (GO:0007268)|vesicle localization (GO:0051648)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)	tubulin-glutamic acid ligase activity (GO:0070740)										AGCCCCCGAGGAGGTGGTGGC	0.731																																					p.E159K		Atlas-SNP	.											.	.	.	.	0			c.G475A						.						5.0	8.0	7.0					19																	519025		2004	4048	6052	SO:0001583	missense	91978	exon2			CCCGAGGAGGTGG	BC009520	CCDS42454.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000141933	ENSG00000141933			25058	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 20"""	C19orf20		11441184, 12972506	Standard	NM_033513		Approved	GTRGEO22, PGs1	uc002lou.3	Q6ZTW0		ENST00000359315.5:c.475G>A	chr19.hg19:g.519025G>A	ENSP00000352265:p.Glu159Lys	38.0	0.0		46.0	23.0	NM_033513	Q96GE2	Missense_Mutation	SNP	ENST00000359315.5	hg19	CCDS42454.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293582	0.80914	.	.	ENSG00000141933	ENST00000359315;ENST00000388800	T	0.16743	2.32	4.24	3.11	0.35812	.	0.469643	0.17205	U	0.182972	T	0.13500	0.0327	L	0.29908	0.895	0.32558	N	0.531466	P	0.40731	0.728	B	0.40285	0.325	T	0.11767	-1.0574	10	0.33940	T	0.23	-18.4087	11.4992	0.50426	0.0:0.0:0.8197:0.1803	.	159	Q6ZTW0	TPGS1_HUMAN	K	159	ENSP00000352265:E159K	ENSP00000352265:E159K	E	+	1	0	C19orf20	470025	1.000000	0.71417	0.999000	0.59377	0.768000	0.43524	3.040000	0.49799	1.929000	0.55896	0.450000	0.29827	GAG	.	.		0.731	TPGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451887.2	NM_033513	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8661267	8661267	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:8661267G>A	ENST00000597188.1	-	10	1384	c.1114C>T	c.(1114-1116)Cgc>Tgc	p.R372C	ADAMTS10_ENST00000596709.1_5'Flank|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.R372C	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	372	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						CTTCTCTCGCGCTCACACATT	0.662																																					p.R372C		Atlas-SNP	.											.	ADAMTS10	132	.	0			c.C1114T						.						40.0	35.0	36.0					19																	8661267		2203	4300	6503	SO:0001583	missense	81794	exon10			TCTCGCGCTCACA	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.1114C>T	chr19.hg19:g.8661267G>A	ENSP00000471851:p.Arg372Cys	44.0	0.0		43.0	6.0	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	hg19	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028095	0.35797	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	D	0.86956	-2.19	4.76	2.53	0.30540	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.159568	0.40908	D	0.000995	D	0.89860	0.6837	L	0.49126	1.545	0.58432	D	0.999992	D;D	0.76494	0.998;0.999	P;D	0.64877	0.892;0.93	D	0.89664	0.3879	10	0.87932	D	0	.	12.8281	0.57731	0.0:0.0:0.5787:0.4213	.	126;372	Q59FE5;Q9H324	.;ATS10_HUMAN	C	372;126	ENSP00000270328:R372C	ENSP00000270328:R372C	R	-	1	0	ADAMTS10	8567267	1.000000	0.71417	0.910000	0.35882	0.036000	0.12997	5.917000	0.69989	0.570000	0.29347	-0.538000	0.04264	CGC	.	.		0.662	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
ZNF878	729747	hgsc.bcm.edu	37	19	12154963	12154963	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:12154963G>A	ENST00000547628.1	-	4	1390	c.1253C>T	c.(1252-1254)aCa>aTa	p.T418I	CTD-2006C1.2_ENST00000591898.1_RNA|CTD-2006C1.2_ENST00000591838.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|ZNF878_ENST00000602107.1_Missense_Mutation_p.T465I	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						TTTCTCTCCTGTGTGAGTTCG	0.438																																					p.T418I		Atlas-SNP	.											.	ZNF878	172	.	0			c.C1253T						.						70.0	74.0	73.0					19																	12154963		2201	4300	6501	SO:0001583	missense	729747	exon4			TCTCCTGTGTGAG		CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.1253C>T	chr19.hg19:g.12154963G>A	ENSP00000447931:p.Thr418Ile	57.0	0.0		47.0	22.0	NM_001080404		Missense_Mutation	SNP	ENST00000547628.1	hg19	CCDS45984.2	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668635	0.67814	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.25749	1.78	1.3	0.0242	0.14140	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41650	0.1168	L	0.61036	1.89	0.30315	N	0.788124	D	0.76494	0.999	D	0.68621	0.959	T	0.39683	-0.9602	9	0.72032	D	0.01	.	7.9262	0.29876	0.0:0.259:0.7409:0.0	.	418	C9JN71	ZN878_HUMAN	I	418;465	ENSP00000447931:T418I	ENSP00000447931:T418I	T	-	2	0	AC022415.4;ZNF878	12015963	0.854000	0.29725	0.002000	0.10522	0.918000	0.54935	2.253000	0.43205	-0.149000	0.11215	0.313000	0.20887	ACA	.	.		0.438	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403723.1	NM_001080404	
POP4	10775	hgsc.bcm.edu	37	19	30099579	30099579	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:30099579C>T	ENST00000585603.1	+	2	2325	c.23C>T	c.(22-24)gCa>gTa	p.A8V	POP4_ENST00000591824.1_3'UTR|POP4_ENST00000392279.3_Missense_Mutation_p.H2Y|POP4_ENST00000221770.3_5'UTR			O95707	RPP29_HUMAN	processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)	8					mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)|ribonuclease P complex (GO:0030677)	ribonuclease P activity (GO:0004526)|ribonuclease P RNA binding (GO:0033204)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|lung(4)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			ATCTACCATGCATTGTCTCAG	0.443																																					p.A8V	Melanoma(89;1165 1449 14085 34436 43672)	Atlas-SNP	.											.	POP4	20	.	0			c.C23T						.						158.0	157.0	157.0					19																	30099579		2203	4300	6503	SO:0001583	missense	10775	exon2			ACCATGCATTGTC	BC006098	CCDS12416.1	19q13.11	2012-05-21				ENSG00000105171			30081	protein-coding gene	gene with protein product		606114				10352175, 10024167	Standard	NM_006627		Approved	RPP29	uc002nsf.2	O95707		ENST00000585603.1:c.23C>T	chr19.hg19:g.30099579C>T	ENSP00000465213:p.Ala8Val	59.0	0.0		42.0	18.0	NM_006627	Q5XKL7|Q6FHW9|Q9UQQ3	Missense_Mutation	SNP	ENST00000585603.1	hg19	CCDS12416.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.52|11.52	1.662680|1.662680	0.29515|0.29515	.|.	.|.	ENSG00000105171|ENSG00000105171	ENST00000221770|ENST00000392279	.|.	.|.	.|.	4.93|4.93	3.87|3.87	0.44632|0.44632	.|.	0.495975|.	0.21944|.	N|.	0.066828|.	T|T	0.41259|0.41259	0.1151|0.1151	M|M	0.68952|0.68952	2.095|2.095	0.09310|0.09310	N|N	0.999998|0.999998	B|B	0.24258|0.14012	0.1|0.009	B|B	0.21708|0.14578	0.036|0.011	T|T	0.44498|0.44498	-0.9324|-0.9324	9|8	0.52906|0.02654	T|T	0.07|1	-6.8732|-6.8732	11.2339|11.2339	0.48929|0.48929	0.0:0.815:0.185:0.0|0.0:0.815:0.185:0.0	.|.	8|2	O95707|A8MYC1	RPP29_HUMAN|.	V|Y	8|2	.|.	ENSP00000221770:A8V|ENSP00000376104:H2Y	A|H	+|+	2|1	0|0	POP4|POP4	34791419|34791419	0.394000|0.394000	0.25246|0.25246	0.560000|0.560000	0.28344|0.28344	0.352000|0.352000	0.29268|0.29268	0.660000|0.660000	0.25009|0.25009	1.399000|1.399000	0.46721|0.46721	0.655000|0.655000	0.94253|0.94253	GCA|CAT	.	.		0.443	POP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458710.1	NM_006627	
CEBPA	1050	hgsc.bcm.edu	37	19	33792753	33792753	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:33792753A>G	ENST00000498907.2	-	1	717	c.568T>C	c.(568-570)Tcg>Ccg	p.S190P	CTD-2540B15.11_ENST00000589932.1_RNA|CTD-2540B15.7_ENST00000587312.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	190					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S190fs*131(1)|p.P185_P197del(1)|p.S190_P198del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					TGCGGGTGCGAGggcggcggc	0.751			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.S190P		Atlas-SNP	.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA	986	.	3	Deletion - In frame(2)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(3)	c.T568C						.						1.0	1.0	1.0					19																	33792753		457	1100	1557	SO:0001583	missense	1050	exon1	Familial Cancer Database	Familial AML	GGTGCGAGGGCGG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.568T>C	chr19.hg19:g.33792753A>G	ENSP00000427514:p.Ser190Pro	71.0	0.0		129.0	12.0	NM_004364	A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	ENST00000498907.2	hg19	CCDS54243.1	.	.	.	.	.	.	.	.	.	.	A	1.858	-0.463433	0.04476	.	.	ENSG00000245848	ENST00000498907	T	0.18174	2.23	2.47	1.39	0.22231	.	.	.	.	.	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38134	-0.9675	9	0.29301	T	0.29	.	5.1081	0.14794	0.1886:0.0:0.8114:0.0	.	190	P49715	CEBPA_HUMAN	P	190	ENSP00000427514:S190P	ENSP00000427514:S190P	S	-	1	0	CEBPA	38484593	0.969000	0.33509	0.085000	0.20634	0.154000	0.21943	-0.452000	0.06787	0.068000	0.16574	0.055000	0.15244	TCG	.	.		0.751	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
FGF21	26291	hgsc.bcm.edu	37	19	49259647	49259647	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:49259647G>A	ENST00000593756.1	+	2	726	c.154G>A	c.(154-156)Gat>Aat	p.D52N	FUT1_ENST00000310160.3_5'Flank|FGF21_ENST00000222157.3_Missense_Mutation_p.D52N|FUT1_ENST00000601931.1_5'Flank			Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21	52					cell-cell signaling (GO:0007267)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|regulation of low-density lipoprotein particle clearance (GO:0010988)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCTCTACACAGATGATGCCCA	0.647																																					p.D52N		Atlas-SNP	.											.	FGF21	21	.	0			c.G154A						.						43.0	40.0	41.0					19																	49259647		2203	4300	6503	SO:0001583	missense	26291	exon1			TACACAGATGATG	AB021975	CCDS12734.1	19q13.33	2012-09-20			ENSG00000105550	ENSG00000105550			3678	protein-coding gene	gene with protein product		609436				10858549	Standard	XM_005258731		Approved		uc002pko.1	Q9NSA1		ENST00000593756.1:c.154G>A	chr19.hg19:g.49259647G>A	ENSP00000471477:p.Asp52Asn	44.0	0.0		46.0	18.0	NM_019113	Q8N683	Missense_Mutation	SNP	ENST00000593756.1	hg19	CCDS12734.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857445	0.71834	.	.	ENSG00000105550	ENST00000222157	D	0.85773	-2.03	4.77	4.77	0.60923	.	0.143969	0.42964	D	0.000623	T	0.80934	0.4719	N	0.17800	0.525	0.47862	D	0.999533	P	0.52577	0.954	P	0.57057	0.812	T	0.75690	-0.3230	10	0.05620	T	0.96	-26.9537	13.5102	0.61508	0.0:0.0:1.0:0.0	.	52	Q9NSA1	FGF21_HUMAN	N	52	ENSP00000222157:D52N	ENSP00000222157:D52N	D	+	1	0	FGF21	53951459	0.986000	0.35501	0.726000	0.30738	0.954000	0.61252	4.701000	0.61810	2.664000	0.90586	0.561000	0.74099	GAT	.	.		0.647	FGF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466200.1		
RUVBL2	10856	hgsc.bcm.edu	37	19	49506571	49506571	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:49506571G>A	ENST00000595090.1	+	3	567	c.103G>A	c.(103-105)Gat>Aat	p.D35N	RUVBL2_ENST00000413176.2_De_novo_Start_OutOfFrame|RUVBL2_ENST00000601968.1_De_novo_Start_OutOfFrame	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	35					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		GGGGCTGGACGATGCCTTGGA	0.607																																					p.D35N		Atlas-SNP	.											.	RUVBL2	31	.	0			c.G103A						.						75.0	80.0	79.0					19																	49506571		1975	4142	6117	SO:0001583	missense	10856	exon3			CTGGACGATGCCT	AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.103G>A	chr19.hg19:g.49506571G>A	ENSP00000473172:p.Asp35Asn	93.0	0.0		83.0	39.0	NM_006666	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Missense_Mutation	SNP	ENST00000595090.1	hg19	CCDS42588.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590485	0.86851	.	.	ENSG00000183207	ENST00000221413	T	0.47869	0.83	4.96	4.96	0.65561	TIP49, C-terminal (1);	0.000000	0.85682	U	0.000000	T	0.65196	0.2668	M	0.84683	2.71	0.80722	D	1	D;D	0.56968	0.977;0.978	P;P	0.53146	0.659;0.719	T	0.72377	-0.4312	10	0.62326	D	0.03	-21.2525	16.0913	0.81091	0.0:0.0:1.0:0.0	.	35;35	B4DW30;Q9Y230	.;RUVB2_HUMAN	N	35	ENSP00000221413:D35N	ENSP00000221413:D35N	D	+	1	0	RUVBL2	54198383	1.000000	0.71417	0.984000	0.44739	0.706000	0.40770	8.274000	0.89889	2.480000	0.83734	0.561000	0.74099	GAT	.	.		0.607	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466235.1		
SIGLEC5	8778	hgsc.bcm.edu	37	19	52130954	52130954	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr19:52130954C>T	ENST00000534261.2	-	7	1442	c.1043G>A	c.(1042-1044)gGt>gAt	p.G348D	SIGLEC5_ENST00000429354.3_Missense_Mutation_p.G348D|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.G348D|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.G348D|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.G348D			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	348					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GCAGTGCAGACCCTCAGCCTC	0.647																																					p.G348D		Atlas-SNP	.											.	SIGLEC5	67	.	0			c.G1043A						.						11.0	13.0	12.0					19																	52130954		2182	4283	6465	SO:0001583	missense	8778	exon6			TGCAGACCCTCAG	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1043G>A	chr19.hg19:g.52130954C>T	ENSP00000473238:p.Gly348Asp	30.0	0.0		44.0	19.0	NM_003830		Missense_Mutation	SNP	ENST00000534261.2	hg19	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	C	4.700	0.130223	0.08981	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	D;D	0.85629	-2.01;-2.01	3.86	0.0684	0.14369	.	45.634200	0.00465	U	0.000118	D	0.84388	0.5461	M	0.65975	2.015	0.09310	N	1	B	0.23442	0.085	B	0.29598	0.104	T	0.64193	-0.6465	10	0.49607	T	0.09	.	6.1484	0.20298	0.38:0.4349:0.1851:0.0	.	348	O15389	SIGL5_HUMAN	D	348	ENSP00000222107:G348D;ENSP00000415200:G348D	ENSP00000222107:G348D	G	-	2	0	SIGLEC5	56822766	0.000000	0.05858	0.001000	0.08648	0.145000	0.21501	-0.674000	0.05233	0.015000	0.14971	0.551000	0.68910	GGT	.	.		0.647	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
SIGLEC1	6614	hgsc.bcm.edu	37	20	3674951	3674951	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr20:3674951A>T	ENST00000344754.4	-	12	3172	c.3173T>A	c.(3172-3174)aTg>aAg	p.M1058K	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.M1058K	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1058	Ig-like C2-type 10.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						ATCCTCCAGCATAGCCCCGTG	0.627																																					p.M1058K		Atlas-SNP	.											.	SIGLEC1	210	.	0			c.T3173A						.						95.0	82.0	87.0					20																	3674951		2200	4297	6497	SO:0001583	missense	6614	exon12			TCCAGCATAGCCC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3173T>A	chr20.hg19:g.3674951A>T	ENSP00000341141:p.Met1058Lys	102.0	0.0		92.0	44.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	hg19	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	A	5.896	0.349345	0.11182	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.63913	-0.07;-0.07	5.15	-7.42	0.01388	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.119980	0.06933	N	0.811492	T	0.25717	0.0626	N	0.04508	-0.205	0.09310	N	1	B;B	0.23735	0.02;0.09	B;B	0.21360	0.034;0.033	T	0.26916	-1.0089	10	0.06365	T	0.9	.	3.2747	0.06894	0.2953:0.4247:0.1763:0.1036	.	1058;1058	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	K	1058	ENSP00000341141:M1058K;ENSP00000202578:M1058K	ENSP00000202578:M1058K	M	-	2	0	SIGLEC1	3622951	0.000000	0.05858	0.001000	0.08648	0.288000	0.27193	-0.575000	0.05861	-1.092000	0.03062	0.459000	0.35465	ATG	.	.		0.627	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
CST11	140880	hgsc.bcm.edu	37	20	23432513	23432513	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr20:23432513C>A	ENST00000377009.3	-	2	306	c.273G>T	c.(271-273)tgG>tgT	p.W91C	CST11_ENST00000377007.3_Intron	NM_130794.1	NP_570612.1	Q9H112	CST11_HUMAN	cystatin 11	91					defense response to bacterium (GO:0042742)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(2)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	14	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GGCAGGTGGTCCACTGCATTT	0.557																																					p.W91C		Atlas-SNP	.											.	CST11	27	.	0			c.G273T						.						125.0	106.0	113.0					20																	23432513		2203	4300	6503	SO:0001583	missense	140880	exon2			GGTGGTCCACTGC	AL096677	CCDS13154.1, CCDS13155.1	20p11.21	2012-08-14			ENSG00000125831	ENSG00000125831			15959	protein-coding gene	gene with protein product		609731		CST8L		20565543	Standard	NM_080830		Approved	dJ322G13.6, CTES2	uc002wtf.1	Q9H112	OTTHUMG00000032060	ENST00000377009.3:c.273G>T	chr20.hg19:g.23432513C>A	ENSP00000366208:p.Trp91Cys	61.0	0.0		62.0	32.0	NM_130794	Q0VAF2|Q0VAF3|Q8WXU5|Q8WXU6|Q9H113	Missense_Mutation	SNP	ENST00000377009.3	hg19	CCDS13155.1	.	.	.	.	.	.	.	.	.	.	C	6.518	0.463782	0.12402	.	.	ENSG00000125831	ENST00000377009	T	0.12361	2.69	4.1	-1.38	0.09027	Proteinase inhibitor I25, cystatin (2);	0.124783	0.51477	D	0.000089	T	0.05593	0.0147	N	0.08118	0	0.20638	N	0.99988	B	0.09022	0.002	B	0.06405	0.002	T	0.24977	-1.0145	10	0.87932	D	0	-10.8155	5.9538	0.19261	0.0:0.5011:0.2594:0.2395	.	91	Q9H112	CST11_HUMAN	C	91	ENSP00000366208:W91C	ENSP00000366208:W91C	W	-	3	0	CST11	23380513	0.232000	0.23762	0.027000	0.17364	0.008000	0.06430	-0.114000	0.10757	-0.474000	0.06862	-1.128000	0.01989	TGG	.	.		0.557	CST11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078314.1	NM_130794	
SDC4	6385	hgsc.bcm.edu	37	20	43964503	43964503	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr20:43964503C>T	ENST00000372733.3	-	2	157	c.118G>A	c.(118-120)Gga>Aga	p.G40R	SDC4_ENST00000537976.1_Intron	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	40					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)		SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				GGTAGGGCTCCGGAGAAGTAT	0.562			T	ROS1	NSCLC																																p.G40R		Atlas-SNP	.		Dom	yes		20	20q12	6385	syndecan 4		E	.	SDC4	16	.	0			c.G118A						.						69.0	65.0	67.0					20																	43964503		2203	4300	6503	SO:0001583	missense	6385	exon2			GGGCTCCGGAGAA	X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.118G>A	chr20.hg19:g.43964503C>T	ENSP00000361818:p.Gly40Arg	44.0	0.0		37.0	14.0	NM_002999	O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	ENST00000372733.3	hg19	CCDS13350.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977135	0.74360	.	.	ENSG00000124145	ENST00000372733	T	0.41758	0.99	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.62527	0.2435	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64943	-0.6288	10	0.56958	D	0.05	-16.4399	13.6844	0.62506	0.0:1.0:0.0:0.0	.	40	P31431	SDC4_HUMAN	R	40	ENSP00000361818:G40R	ENSP00000361818:G40R	G	-	1	0	SDC4	43397917	0.992000	0.36948	0.998000	0.56505	0.746000	0.42486	4.003000	0.57061	2.376000	0.81061	0.561000	0.74099	GGA	.	.		0.562	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999	
DMD	1756	hgsc.bcm.edu	37	X	32235165	32235165	+	Silent	SNP	A	A	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chrX:32235165A>T	ENST00000357033.4	-	44	6512	c.6306T>A	c.(6304-6306)tcT>tcA	p.S2102S	DMD_ENST00000378677.2_Silent_p.S2098S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2102					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATTTCTCAACAGATCTGTCAA	0.328																																					p.S2102S		Atlas-SNP	.											.	DMD	2127	.	0			c.T6306A						.						45.0	41.0	42.0					X																	32235165		2202	4297	6499	SO:0001819	synonymous_variant	1756	exon44			CTCAACAGATCTG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6306T>A	chrX.hg19:g.32235165A>T		174.0	0.0		202.0	176.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	hg19	CCDS14233.1																																																																																			.	.		0.328	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
MAGEC3	139081	hgsc.bcm.edu	37	X	140926121	140926121	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chrX:140926121G>C	ENST00000298296.1	+	1	20	c.20G>C	c.(19-21)tGg>tCg	p.W7S		NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	7										NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGCCACTGGGTGTTGGAT	0.522																																					p.W7S		Atlas-SNP	.											.	MAGEC3	228	.	0			c.G20C						.						83.0	57.0	66.0					X																	140926121		2203	4300	6503	SO:0001583	missense	139081	exon1			GCCACTGGGTGTT	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.20G>C	chrX.hg19:g.140926121G>C	ENSP00000298296:p.Trp7Ser	89.0	0.0		86.0	76.0	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	hg19	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	G	6.044	0.376436	0.11466	.	.	ENSG00000165509	ENST00000298296	T	0.08634	3.07	0.427	0.427	0.16489	.	.	.	.	.	T	0.08223	0.0205	N	0.08118	0	0.09310	N	1	D	0.55605	0.972	P	0.56700	0.804	T	0.34800	-0.9814	8	0.87932	D	0	.	.	.	.	.	7	Q8TD91	MAGC3_HUMAN	S	7	ENSP00000298296:W7S	ENSP00000298296:W7S	W	+	2	0	MAGEC3	140753787	0.348000	0.24861	0.027000	0.17364	0.028000	0.11728	0.364000	0.20325	0.417000	0.25871	0.422000	0.28245	TGG	.	.		0.522	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16942170	16942170	+	3'UTR	SNP	G	G	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chrY:16942170G>T	ENST00000476359.1	+	0	1917							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						GGCCACCGCCGACCTGCACGC	0.617																																					p.D458Y		Atlas-SNP	.											.	NLGN4Y	44	.	0			c.G1372T						.																																			SO:0001624	3_prime_UTR_variant	22829	exon5			ACCGCCGACCTGC		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*1914G>T	chrY.hg19:g.16942170G>T		157.0	0.0		149.0	119.0	NM_014893	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	ENST00000476359.1	hg19																																																																																				.	.		0.617	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
MT-CO3	4514	hgsc.bcm.edu	37	M	9591	9591	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chrM:9591G>A	ENST00000362079.2	+	1	385	c.385G>A	c.(385-387)Gtc>Atc	p.V129I	MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	129					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						ATCCCCTAGAAGTCCCACTCC	0.493																																					p.V129I		Atlas-SNP	.											.	.	.	.	0			c.G385A						.																																			SO:0001583	missense	5742	exon1			CTAGAAGTCCCAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.385G>A	chrM.hg19:g.9591G>A	ENSP00000354982:p.Val129Ile	23.0	0.0		44.0	40.0	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.493	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
FAM45A	404636	hgsc.bcm.edu	37	10	120879889	120879890	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr10:120879889_120879890insA	ENST00000361432.2	+	5	544_545	c.518_519insA	c.(517-522)ttacacfs	p.H174fs	FAM45A_ENST00000535029.1_Intron|FAM45A_ENST00000544016.1_Frame_Shift_Ins_p.H23fs|FAM45A_ENST00000489988.1_3'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	174										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		ACTGTTATCTTACACACAGCAC	0.347																																					p.L173fs		Atlas-INDEL	.											.	FAM45A	30	.	0			c.518_519insA						.																																			SO:0001589	frameshift_variant	404636	exon5			.	AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.519dupA	chr10.hg19:g.120879890_120879890dupA	ENSP00000354688:p.His174fs	289.0	0.0		240.0	100.0	NM_207009	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Frame_Shift_Ins	INS	ENST00000361432.2	hg19	CCDS7609.1																																																																																			.	.		0.347	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20222202	20222203	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chrX:20222202_20222203insT	ENST00000379565.3	-	4	469_470	c.262_263insA	c.(262-264)atcfs	p.I88fs	RPS6KA3_ENST00000540702.1_Frame_Shift_Ins_p.I60fs|RPS6KA3_ENST00000544447.1_Frame_Shift_Ins_p.I60fs|RPS6KA3_ENST00000379548.4_Frame_Shift_Ins_p.I59fs	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	88	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	AGAGCCTGAGATTTTTTTAACT	0.332																																					p.I88fs		Atlas-INDEL	.											.	RPS6KA3	110	.	0			c.263_264insA	GRCh37	CD982930|CI021234	RPS6KA3	D|I		.																																			SO:0001589	frameshift_variant	6197	exon4			.	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.263dupA	chrX.hg19:g.20222209_20222209dupT	ENSP00000368884:p.Ile88fs	107.0	0.0		112.0	32.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Frame_Shift_Ins	INS	ENST00000379565.3	hg19	CCDS14197.1																																																																																			.	.		0.332	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
C9orf131	138724	hgsc.bcm.edu	37	9	35044496	35044497	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr9:35044496_35044497delCA	ENST00000312292.5	+	2	1917_1918	c.1870_1871delCA	c.(1870-1872)cagfs	p.Q624fs	C9orf131_ENST00000421362.2_Frame_Shift_Del_p.Q576fs|C9orf131_ENST00000354479.5_Frame_Shift_Del_p.Q551fs|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	624										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GTCTGATTCTCAGTCTATTGTA	0.49																																					p.623_624del		Atlas-INDEL	.											.	C9orf131	71	.	0			c.1869_1870del						.																																			SO:0001589	frameshift_variant	138724	exon2			.	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1870_1871delCA	chr9.hg19:g.35044496_35044497delCA	ENSP00000308279:p.Gln624fs	98.0	0.0		59.0	25.0	NM_203299	A6NLE6|E9PB26|Q86XC6|Q9UF74	Frame_Shift_Del	DEL	ENST00000312292.5	hg19	CCDS6572.2																																																																																			.	.		0.490	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299	
PCLO	27445	hgsc.bcm.edu	37	7	82585150	82585157	+	Frame_Shift_Del	DEL	AGTCTGTC	AGTCTGTC	-			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	AGTCTGTC	AGTCTGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr7:82585150_82585157delAGTCTGTC	ENST00000333891.9	-	5	5449_5456	c.5112_5119delGACAGACT	c.(5110-5121)ctgacagactcafs	p.TDS1705fs	PCLO_ENST00000423517.2_Frame_Shift_Del_p.TDS1705fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCTTCAGGTGAGTCTGTCAGGCTTTCCA	0.433																																					p.1705_1707del		Atlas-INDEL	.											.	PCLO	1506	.	0			c.5113_5120del						.																																			SO:0001589	frameshift_variant	27445	exon5			.	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5112_5119delGACAGACT	chr7.hg19:g.82585150_82585157delAGTCTGTC	ENSP00000334319:p.Thr1705fs	97.0	0.0		130.0	23.0	NM_014510		Frame_Shift_Del	DEL	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
CENPH	64946	hgsc.bcm.edu	37	5	68492921	68492921	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr5:68492921delT	ENST00000283006.2	+	5	443	c.356delT	c.(355-357)attfs	p.I119fs	CENPH_ENST00000515001.1_Intron	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		CTGGAGAAAATTAGCAGACAG	0.318																																					p.I119fs		Atlas-INDEL	.											.	CENPH	28	.	0			c.355delA						.						48.0	51.0	50.0					5																	68492921		2203	4299	6502	SO:0001589	frameshift_variant	64946	exon5			.	AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.356delT	chr5.hg19:g.68492921delT	ENSP00000283006:p.Ile119fs	260.0	0.0		247.0	110.0	NM_022909		Frame_Shift_Del	DEL	ENST00000283006.2	hg19	CCDS3998.1																																																																																			.	.		0.318	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215083.1		
FZD2	2535	hgsc.bcm.edu	37	17	42635670	42635675	+	In_Frame_Del	DEL	TCAAGG	TCAAGG	-	rs566397443	byFrequency	TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	TCAAGG	TCAAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr17:42635670_42635675delTCAAGG	ENST00000315323.3	+	1	746_751	c.614_619delTCAAGG	c.(613-621)ctcaaggtg>ctg	p.KV206del		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	206					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCGCGCGTCCTCAAGGTGCCATCCTA	0.699																																					p.205_206del		Atlas-INDEL	.											.	FZD2	81	.	0			c.613_618del						.																																			SO:0001651	inframe_deletion	2535	exon1			.	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.614_619delTCAAGG	chr17.hg19:g.42635670_42635675delTCAAGG	ENSP00000323901:p.Lys206_Val207del	49.0	0.0		35.0	11.0	NM_001466	Q0VG82	In_Frame_Del	DEL	ENST00000315323.3	hg19	CCDS11484.1																																																																																			.	.		0.699	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466	
TTC19	54902	hgsc.bcm.edu	37	17	15930009	15930023	+	Splice_Site	DEL	GCACAGAGGTAGGTA	GCACAGAGGTAGGTA	-	rs189614332	byFrequency	TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	GCACAGAGGTAGGTA	GCACAGAGGTAGGTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr17:15930009_15930023delGCACAGAGGTAGGTA	ENST00000261647.5	+	9	1456_1463	c.987_994delGCACAGAGGTAGGTA	c.(985-996)atgcacagaggt>atgt	p.HRG330del	TTC19_ENST00000486880.2_Splice_Site_p.HRG451del|TTC19_ENST00000497842.2_3'UTR	NM_001271420.1|NM_017775.3	NP_001258349.1|NP_060245.3	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	330					cytokinesis (GO:0000910)|mitochondrial respiratory chain complex III assembly (GO:0034551)	centrosome (GO:0005813)|midbody (GO:0030496)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(2)|skin(1)|stomach(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CAGTTTTGATGCACAGAGGTAGGTAGCAATGTAAA	0.423																																					p.329_332del		Atlas-INDEL	.											.	TTC19	10	.	0			c.986_994del						.																																			SO:0001630	splice_region_variant	54902	exon9			.	AK094819	CCDS11174.1, CCDS11174.2	17p11.2	2013-01-11			ENSG00000011295	ENSG00000011295		"""Tetratricopeptide (TTC) repeat domain containing"""	26006	protein-coding gene	gene with protein product		613814					Standard	NM_017775		Approved	FLJ20343, MGC19520	uc002gph.3	Q6DKK2	OTTHUMG00000059306	ENST00000261647.5:c.994+1GCACAGAGGTAGGTA>-	chr17.hg19:g.15930009_15930023delGCACAGAGGTAGGTA		94.0	0.0		79.0	15.0	NM_017775	A8MZ52|B3KP62|B4DN65|Q2M248|Q7L3U8|Q9H6G3|Q9NXB2	In_Frame_Del	DEL	ENST00000261647.5	hg19	CCDS11174.2																																																																																			.	.		0.423	TTC19-001	NOVEL	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000131725.6	NM_017775	In_Frame_Del
FAM117B	150864	hgsc.bcm.edu	37	2	203630340	203630341	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAW3-01A-11D-A40P-10	TCGA-DD-AAW3-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07d529e0-2ba2-49d7-b348-2ef3d52cc0ce	e3ae1920-aeb7-4aa2-b8c2-f83450414f08	g.chr2:203630340_203630341insA	ENST00000392238.2	+	8	1623_1624	c.1623_1624insA	c.(1624-1626)atgfs	p.M542fs	FAM117B_ENST00000303116.6_Frame_Shift_Ins_p.M298fs			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	542										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						TCACCACTGGCATGACAACCAC	0.554																																					p.G541fs		Atlas-INDEL	.											.	FAM117B	73	.	0			c.1623_1624insA						.																																			SO:0001589	frameshift_variant	150864	exon8			.	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.1624dupA	chr2.hg19:g.203630341_203630341dupA	ENSP00000376071:p.Met542fs	83.0	0.0		62.0	29.0	NM_173511	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Frame_Shift_Ins	INS	ENST00000392238.2	hg19	CCDS33362.2																																																																																			.	.		0.554	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
