#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA0040	9674	hgsc.bcm.edu	37	1	175129922	175129922	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr1:175129922A>C	ENST00000423313.1	-	4	764	c.228T>G	c.(226-228)gaT>gaG	p.D76E	KIAA0040_ENST00000444639.1_Missense_Mutation_p.D76E|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000545251.2_Missense_Mutation_p.D76E	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	GGtcttcttcatccttcttct	0.498																																					p.D76E		Atlas-SNP	.											.	KIAA0040	2	.	0			c.T228G						.						123.0	102.0	108.0					1																	175129922		692	1591	2283	SO:0001583	missense	9674	exon3			TTCTTCATCCTTC	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.228T>G	chr1.hg19:g.175129922A>C	ENSP00000462172:p.Asp76Glu	71.0	0.0		75.0	4.0	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	hg19																																																																																				.	.		0.498	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
KIAA0040	9674	hgsc.bcm.edu	37	1	175129924	175129924	+	Missense_Mutation	SNP	C	C	T	rs150137790		TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr1:175129924C>T	ENST00000423313.1	-	4	762	c.226G>A	c.(226-228)Gat>Aat	p.D76N	KIAA0040_ENST00000444639.1_Missense_Mutation_p.D76N|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000545251.2_Missense_Mutation_p.D76N	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tcttcttcatccttcttcttc	0.502																																					p.D76N		Atlas-SNP	.											.	KIAA0040	2	.	0			c.G226A						.						120.0	100.0	106.0					1																	175129924		692	1591	2283	SO:0001583	missense	9674	exon3			CTTCATCCTTCTT	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.226G>A	chr1.hg19:g.175129924C>T	ENSP00000462172:p.Asp76Asn	71.0	0.0		76.0	6.0	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	hg19																																																																																				.	.		0.502	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
SP110	3431	hgsc.bcm.edu	37	2	231067440	231067440	+	Silent	SNP	T	T	G			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr2:231067440T>G	ENST00000358662.4	-	9	981	c.903A>C	c.(901-903)acA>acC	p.T301T	SP110_ENST00000392048.3_Splice_Site|SP110_ENST00000338556.3_Intron|SP110_ENST00000258381.6_Silent_p.T301T|SP110_ENST00000258382.5_Silent_p.T301T|SP110_ENST00000486146.2_5'Flank|SP110_ENST00000540870.1_Silent_p.T307T	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	301					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TAGATGAGGCTGTCCCTGGAC	0.453																																					p.T307T		Atlas-SNP	.											.	SP110	105	.	0			c.A921C						.						166.0	159.0	161.0					2																	231067440		2203	4300	6503	SO:0001819	synonymous_variant	3431	exon10			TGAGGCTGTCCCT	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.903A>C	chr2.hg19:g.231067440T>G		142.0	0.0		157.0	20.0	NM_001185015	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Silent	SNP	ENST00000358662.4	hg19	CCDS2474.1	.	.	.	.	.	.	.	.	.	.	T	4.191	0.034178	0.08101	.	.	ENSG00000135899	ENST00000392048	.	.	.	3.72	1.29	0.21616	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.501	0.07673	0.0:0.1279:0.2335:0.6387	.	.	.	.	.	-1	.	.	.	-	.	.	SP110	230775684	0.000000	0.05858	0.005000	0.12908	0.007000	0.05969	-0.292000	0.08332	0.275000	0.22094	0.460000	0.39030	.	.	.		0.453	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424	
HTRA3	94031	hgsc.bcm.edu	37	4	8304197	8304197	+	Silent	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr4:8304197G>A	ENST00000307358.2	+	7	1263	c.1059G>A	c.(1057-1059)aaG>aaA	p.K353K		NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	353					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CAGACTGGAAGAAGCGCTTCA	0.582																																					p.K353K		Atlas-SNP	.											.	HTRA3	39	.	0			c.G1059A						.						163.0	143.0	150.0					4																	8304197		2203	4300	6503	SO:0001819	synonymous_variant	94031	exon7			CTGGAAGAAGCGC	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.1059G>A	chr4.hg19:g.8304197G>A		46.0	0.0		76.0	28.0	NM_053044	Q7Z7A2	Silent	SNP	ENST00000307358.2	hg19	CCDS3400.1																																																																																			.	.		0.582	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
TBC1D9	23158	hgsc.bcm.edu	37	4	141543809	141543809	+	Missense_Mutation	SNP	G	G	A	rs199802386		TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr4:141543809G>A	ENST00000442267.2	-	21	3415	c.3341C>T	c.(3340-3342)cCg>cTg	p.P1114L		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1114							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CAGGCTGGCCGGCAGGGGCTC	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		17744	0.0		0.0	False		,,,				2504	0.001				p.P1114L		Atlas-SNP	.											TBC1D9_ENST00000442267,NS,carcinoma,0,2	TBC1D9	198	.	0			c.C3341T						.						32.0	39.0	37.0					4																	141543809		1983	4152	6135	SO:0001583	missense	23158	exon21			CTGGCCGGCAGGG	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3341C>T	chr4.hg19:g.141543809G>A	ENSP00000411197:p.Pro1114Leu	34.0	0.0		49.0	21.0	NM_015130	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	hg19	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	G	8.488	0.861436	0.17178	.	.	ENSG00000109436	ENST00000442267	T	0.45276	0.9	4.94	4.94	0.65067	.	.	.	.	.	T	0.32496	0.0831	L	0.36672	1.1	0.09310	N	0.999996	B	0.20780	0.048	B	0.17433	0.018	T	0.10917	-1.0609	9	0.28530	T	0.3	.	9.9724	0.41763	0.0:0.1291:0.6568:0.2141	.	1114	Q6ZT07	TBCD9_HUMAN	L	1114	ENSP00000411197:P1114L	ENSP00000411197:P1114L	P	-	2	0	TBC1D9	141763259	0.258000	0.24033	0.035000	0.18076	0.518000	0.34316	2.855000	0.48333	2.273000	0.75805	0.655000	0.94253	CCG	.	G|0.998;A|0.002		0.672	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
FNIP2	57600	hgsc.bcm.edu	37	4	159790466	159790466	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr4:159790466C>T	ENST00000264433.6	+	13	2753	c.2678C>T	c.(2677-2679)tCa>tTa	p.S893L	FNIP2_ENST00000379346.3_Missense_Mutation_p.S916L	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	893	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		AATGAAAGCTCAGATAGCGCC	0.587																																					p.S893L		Atlas-SNP	.											.	FNIP2	90	.	0			c.C2678T						.						25.0	27.0	26.0					4																	159790466		2071	4219	6290	SO:0001583	missense	57600	exon13			AAAGCTCAGATAG	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2678C>T	chr4.hg19:g.159790466C>T	ENSP00000264433:p.Ser893Leu	35.0	0.0		51.0	22.0	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	hg19	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319261	0.23994	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.35048	1.34;1.33	5.57	2.89	0.33648	.	0.362778	0.29165	N	0.012956	T	0.25827	0.0629	L	0.42487	1.325	0.30400	N	0.780137	B	0.14012	0.009	B	0.13407	0.009	T	0.17715	-1.0360	9	.	.	.	.	6.2858	0.21033	0.0:0.6498:0.1322:0.2179	.	893	Q9P278	FNIP2_HUMAN	L	893;916	ENSP00000264433:S893L;ENSP00000368651:S916L	.	S	+	2	0	FNIP2	160009916	1.000000	0.71417	0.343000	0.25615	0.081000	0.17604	3.298000	0.51818	0.385000	0.24970	0.655000	0.94253	TCA	.	.		0.587	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
ZNF366	167465	hgsc.bcm.edu	37	5	71757293	71757293	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr5:71757293C>T	ENST00000318442.5	-	2	521	c.31G>A	c.(31-33)Gag>Aag	p.E11K		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	11					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TGCACATCCTCGTCTTTGATC	0.453																																					p.E11K		Atlas-SNP	.											.	ZNF366	108	.	0			c.G31A						.						75.0	71.0	72.0					5																	71757293		2200	4298	6498	SO:0001583	missense	167465	exon2			CATCCTCGTCTTT	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.31G>A	chr5.hg19:g.71757293C>T	ENSP00000313158:p.Glu11Lys	58.0	0.0		75.0	27.0	NM_152625	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	hg19	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502522	0.85176	.	.	ENSG00000178175	ENST00000318442;ENST00000414109	T;T	0.36699	1.24;1.24	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000002	T	0.51719	0.1691	L	0.36672	1.1	0.48830	D	0.999715	D	0.89917	1.0	D	0.63793	0.918	T	0.50474	-0.8824	10	0.87932	D	0	-52.8482	20.1775	0.98187	0.0:1.0:0.0:0.0	.	11	Q8N895	ZN366_HUMAN	K	11	ENSP00000313158:E11K;ENSP00000391333:E11K	ENSP00000313158:E11K	E	-	1	0	ZNF366	71793049	1.000000	0.71417	0.426000	0.26672	0.921000	0.55340	5.766000	0.68843	2.771000	0.95319	0.561000	0.74099	GAG	.	.		0.453	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
PCDHB16	57717	hgsc.bcm.edu	37	5	140563725	140563725	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr5:140563725G>A	ENST00000361016.2	+	1	2746	c.1591G>A	c.(1591-1593)Gtg>Atg	p.V531M		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	531	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGTTCCGCGTGAGCGCCAC	0.682																																					p.V531M		Atlas-SNP	.											.	PCDHB16	159	.	0			c.G1591A						.						36.0	39.0	38.0					5																	140563725		1853	3453	5306	SO:0001583	missense	57717	exon1			TTCCGCGTGAGCG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1591G>A	chr5.hg19:g.140563725G>A	ENSP00000354293:p.Val531Met	27.0	0.0		35.0	5.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	21.8	4.198465	0.79015	.	.	ENSG00000196963	ENST00000361016	T	0.71698	-0.59	4.26	4.26	0.50523	Cadherin (5);Cadherin-like (1);	0.000000	0.31404	N	0.007710	D	0.87732	0.6251	H	0.96889	3.9	0.46521	D	0.999081	D	0.65815	0.995	P	0.59012	0.85	D	0.92460	0.5977	10	0.72032	D	0.01	.	16.3541	0.83228	0.0:0.0:1.0:0.0	.	531	Q9NRJ7	PCDBG_HUMAN	M	531	ENSP00000354293:V531M	ENSP00000354293:V531M	V	+	1	0	PCDHB16	140543909	1.000000	0.71417	0.998000	0.56505	0.376000	0.30014	6.189000	0.72051	1.931000	0.55961	0.580000	0.79431	GTG	.	.		0.682	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
RNF14	9604	hgsc.bcm.edu	37	5	141358344	141358344	+	Silent	SNP	A	A	G			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr5:141358344A>G	ENST00000394520.2	+	5	1092	c.783A>G	c.(781-783)caA>caG	p.Q261Q	RNF14_ENST00000394515.3_Intron|RNF14_ENST00000540015.1_Intron|RNF14_ENST00000394519.1_Silent_p.Q261Q|RNF14_ENST00000347642.3_Silent_p.Q261Q|AC005740.5_ENST00000520882.1_RNA|RNF14_ENST00000394514.2_Silent_p.Q135Q|RNF14_ENST00000356143.1_Silent_p.Q261Q	NM_001201365.1|NM_004290.4	NP_001188294.1|NP_004281.1	Q9UBS8	RNF14_HUMAN	ring finger protein 14	261					androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription, DNA-templated (GO:0045893)|protein ubiquitination (GO:0016567)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|small conjugating protein ligase activity (GO:0019787)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GCCAGGTTCAATGCCTCAACT	0.488																																					p.Q261Q		Atlas-SNP	.											.	RNF14	30	.	0			c.A783G						.						124.0	127.0	126.0					5																	141358344		2203	4300	6503	SO:0001819	synonymous_variant	9604	exon5			GGTTCAATGCCTC	AF060544	CCDS4270.1, CCDS4271.1	5q23.3-q31.1	2008-02-05			ENSG00000013561	ENSG00000013561		"""RING-type (C3HC4) zinc fingers"""	10058	protein-coding gene	gene with protein product		605675				10085091, 10320776	Standard	NM_183399		Approved	ARA54, HFB30, TRIAD2	uc003lmc.3	Q9UBS8	OTTHUMG00000129660	ENST00000394520.2:c.783A>G	chr5.hg19:g.141358344A>G		33.0	0.0		49.0	8.0	NM_001201365	A0AV26|A6NMR2|A8MTW5|B3KN72|B7ZLV2|D3DQE4|O94793|Q6IBV0	Silent	SNP	ENST00000394520.2	hg19	CCDS4270.1																																																																																			.	.		0.488	RNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251860.2	NM_004290	
GRIA1	2890	hgsc.bcm.edu	37	5	153149816	153149816	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr5:153149816T>C	ENST00000285900.5	+	13	2454	c.2111T>C	c.(2110-2112)aTg>aCg	p.M704T	GRIA1_ENST00000340592.5_Missense_Mutation_p.M704T|GRIA1_ENST00000518142.1_Missense_Mutation_p.M624T|GRIA1_ENST00000521843.2_Missense_Mutation_p.M635T|GRIA1_ENST00000448073.4_Missense_Mutation_p.M714T|GRIA1_ENST00000518783.1_Missense_Mutation_p.M714T	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	704					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GAGGAGGGGATGATTCGAGTG	0.483																																					p.M714T		Atlas-SNP	.											.	GRIA1	321	.	0			c.T2141C						.						141.0	127.0	132.0					5																	153149816		2203	4300	6503	SO:0001583	missense	2890	exon13			AGGGGATGATTCG		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2111T>C	chr5.hg19:g.153149816T>C	ENSP00000285900:p.Met704Thr	68.0	0.0		104.0	39.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	hg19	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.731460	0.48939	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.38401	1.67;1.67;1.14;1.67;1.67;1.67;1.14	5.41	5.41	0.78517	Ionotropic glutamate receptor (2);	0.039962	0.85682	D	0.000000	T	0.27832	0.0685	N	0.17474	0.49	0.58432	D	0.999991	P;P;B;B;B	0.35124	0.485;0.485;0.002;0.43;0.122	B;B;B;B;B	0.36922	0.236;0.236;0.029;0.152;0.138	T	0.17198	-1.0377	10	0.87932	D	0	.	14.6134	0.68531	0.0:0.0:0.0:1.0	.	714;714;624;704;704	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	T	704;704;624;658;704;637;635;714;714	ENSP00000285900:M704T;ENSP00000427920:M624T;ENSP00000339343:M704T;ENSP00000427864:M637T;ENSP00000442108:M635T;ENSP00000428994:M714T;ENSP00000415569:M714T	ENSP00000285900:M704T	M	+	2	0	GRIA1	153130009	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.859000	0.86982	2.042000	0.60477	0.533000	0.62120	ATG	.	.		0.483	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
CUL9	23113	hgsc.bcm.edu	37	6	43172740	43172740	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr6:43172740C>G	ENST00000252050.4	+	23	4603	c.4519C>G	c.(4519-4521)Cac>Gac	p.H1507D	CUL9_ENST00000372647.2_Missense_Mutation_p.H1507D|CUL9_ENST00000354495.3_Missense_Mutation_p.H1397D	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1507					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ACTCTATGAGCACTTGCAGAG	0.562																																					p.H1507D		Atlas-SNP	.											.	CUL9	248	.	0			c.C4519G						.						95.0	100.0	98.0					6																	43172740		2203	4300	6503	SO:0001583	missense	23113	exon23			TATGAGCACTTGC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.4519C>G	chr6.hg19:g.43172740C>G	ENSP00000252050:p.His1507Asp	36.0	0.0		51.0	19.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	hg19	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869784	0.51588	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.73363	-0.74;-0.74;-0.74	5.07	4.2	0.49525	Cullin, N-terminal (1);	0.764287	0.12753	N	0.442018	T	0.40145	0.1105	N	0.08118	0	0.27551	N	0.950508	B;B;B	0.24920	0.114;0.042;0.042	B;B;B	0.34346	0.122;0.18;0.18	T	0.42616	-0.9441	10	0.62326	D	0.03	-5.5672	8.3214	0.32132	0.1546:0.7667:0.0:0.0787	.	1397;1507;1507	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	D	1507;1397;1507	ENSP00000252050:H1507D;ENSP00000346490:H1397D;ENSP00000361730:H1507D	ENSP00000252050:H1507D	H	+	1	0	CUL9	43280718	0.046000	0.20272	0.545000	0.28153	0.988000	0.76386	2.129000	0.42055	1.141000	0.42275	0.462000	0.41574	CAC	.	.		0.562	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
RADIL	55698	hgsc.bcm.edu	37	7	4917455	4917455	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr7:4917455G>T	ENST00000399583.3	-	2	503	c.316C>A	c.(316-318)Cag>Aag	p.Q106K	RADIL_ENST00000536091.1_Missense_Mutation_p.Q106K	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	106	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		TGGCCGGCCTGCCTGGGGTCC	0.682																																					p.Q106K		Atlas-SNP	.											.	RADIL	110	.	0			c.C316A						.						32.0	38.0	36.0					7																	4917455		2039	4159	6198	SO:0001583	missense	55698	exon2			CGGCCTGCCTGGG	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.316C>A	chr7.hg19:g.4917455G>T	ENSP00000382492:p.Gln106Lys	23.0	0.0		37.0	9.0	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	hg19	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.300779	0.01364	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000457174	T;T;T	0.16597	2.33;2.33;2.33	5.84	-6.1	0.02138	Ras-association (3);	0.987507	0.08283	N	0.969709	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.38972	-0.9636	10	0.10902	T	0.67	-0.2306	2.2366	0.04010	0.1814:0.1949:0.3937:0.23	.	106	Q96JH8	RADIL_HUMAN	K	106;80;106;106	ENSP00000382492:Q106K;ENSP00000442533:Q106K;ENSP00000398057:Q106K	ENSP00000320946:Q80K	Q	-	1	0	RADIL	4883981	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-0.496000	0.06436	-1.453000	0.01928	0.561000	0.74099	CAG	.	.		0.682	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
KCNS2	3788	hgsc.bcm.edu	37	8	99440423	99440423	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr8:99440423C>A	ENST00000287042.4	+	2	566	c.216C>A	c.(214-216)gaC>gaA	p.D72E	KCNS2_ENST00000521839.1_Missense_Mutation_p.D72E	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	72					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TCTACTTCGACCGCAACCCTG	0.602																																					p.D72E	Pancreas(138;844 2489 9202 24627)	Atlas-SNP	.											.	KCNS2	93	.	0			c.C216A						.						131.0	101.0	111.0					8																	99440423		2203	4300	6503	SO:0001583	missense	3788	exon2			CTTCGACCGCAAC	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.216C>A	chr8.hg19:g.99440423C>A	ENSP00000287042:p.Asp72Glu	38.0	0.0		48.0	15.0	NM_020697	A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	hg19	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	c	20.2	3.949719	0.73787	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	T;T	0.64085	-0.08;-0.08	5.4	4.33	0.51752	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.80417	0.4619	M	0.85373	2.75	0.42774	D	0.993847	D	0.76494	0.999	D	0.81914	0.995	D	0.84243	0.0473	10	0.87932	D	0	.	15.0064	0.71516	0.0:0.9196:0.0:0.0804	.	72	Q9ULS6	KCNS2_HUMAN	E	72	ENSP00000287042:D72E;ENSP00000430712:D72E	ENSP00000287042:D72E	D	+	3	2	KCNS2	99509599	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.362000	0.52314	2.523000	0.85059	0.558000	0.71614	GAC	.	.		0.602	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
APBA1	320	hgsc.bcm.edu	37	9	72071267	72071267	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr9:72071267G>A	ENST00000265381.4	-	8	1906	c.1684C>T	c.(1684-1686)Cgg>Tgg	p.R562W	APBA1_ENST00000470082.1_5'UTR	NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	562	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CGAGGCATCCGCCGGCGGGCC	0.572																																					p.R562W		Atlas-SNP	.											.	APBA1	96	.	0			c.C1684T						.						241.0	229.0	233.0					9																	72071267		2203	4300	6503	SO:0001583	missense	320	exon8			GCATCCGCCGGCG	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1684C>T	chr9.hg19:g.72071267G>A	ENSP00000265381:p.Arg562Trp	47.0	0.0		63.0	21.0	NM_001163	O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	hg19	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149517	0.78001	.	.	ENSG00000107282	ENST00000265381	T	0.21031	2.03	6.06	-0.61	0.11604	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.052490	0.64402	D	0.000001	T	0.45716	0.1356	M	0.75615	2.305	0.58432	D	0.999998	D	0.89917	1.0	D	0.70935	0.971	T	0.55848	-0.8076	10	0.87932	D	0	-15.6655	19.3569	0.94418	0.0:0.0:0.3196:0.6804	.	562	Q02410	APBA1_HUMAN	W	562	ENSP00000265381:R562W	ENSP00000265381:R562W	R	-	1	2	APBA1	71261087	1.000000	0.71417	0.976000	0.42696	0.976000	0.68499	2.556000	0.45862	-0.381000	0.07882	-0.169000	0.13324	CGG	.	.		0.572	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
TSC1	7248	hgsc.bcm.edu	37	9	135797282	135797282	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr9:135797282G>A	ENST00000298552.3	-	7	808	c.587C>T	c.(586-588)cCt>cTt	p.P196L	TSC1_ENST00000545250.1_Missense_Mutation_p.P145L|TSC1_ENST00000403810.1_Missense_Mutation_p.P196L|TSC1_ENST00000475903.1_5'UTR|TSC1_ENST00000440111.2_Missense_Mutation_p.P196L	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	196					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GAAGTTGCAAGGGTACATTCC	0.443			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.P196L		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	167	.	1	Unknown(1)	bone(1)	c.C587T						.						138.0	132.0	134.0					9																	135797282		2203	4300	6503	SO:0001583	missense	7248	exon7	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TTGCAAGGGTACA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.587C>T	chr9.hg19:g.135797282G>A	ENSP00000298552:p.Pro196Leu	60.0	0.0		46.0	30.0	NM_000368	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	hg19	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	G	36	5.673373	0.96754	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000537172;ENST00000424271;ENST00000403810	D;D;D;D;D	0.96459	-4.02;-4.02;-4.02;-4.02;-4.02	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.98432	0.9478	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.98844	1.0756	10	0.87932	D	0	-16.8015	19.6603	0.95864	0.0:0.0:1.0:0.0	.	75;145;196;196;196;196	B7Z604;B7Z897;Q86WV8;Q59IT9;Q32NF0;Q92574	.;.;.;.;.;TSC1_HUMAN	L	196;196;145;75;75;196	ENSP00000298552:P196L;ENSP00000394524:P196L;ENSP00000444017:P145L;ENSP00000438099:P75L;ENSP00000386093:P196L	ENSP00000298552:P196L	P	-	2	0	TSC1	134787103	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	CCT	.	.		0.443	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
OR51V1	283111	hgsc.bcm.edu	37	11	5221116	5221116	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr11:5221116C>T	ENST00000321255.1	-	1	814	c.815G>A	c.(814-816)cGt>cAt	p.R272H		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	272					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTGCCAAAACGGTGCACCAT	0.473																																					p.R272H		Atlas-SNP	.											.	OR51V1	77	.	0			c.G815A						.						129.0	113.0	118.0					11																	5221116		2201	4298	6499	SO:0001583	missense	283111	exon1			CCAAAACGGTGCA	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.815G>A	chr11.hg19:g.5221116C>T	ENSP00000321729:p.Arg272His	34.0	0.0		76.0	31.0	NM_001004760		Missense_Mutation	SNP	ENST00000321255.1	hg19	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466749	0.26335	.	.	ENSG00000176742	ENST00000321255	T	0.37235	1.21	5.27	4.35	0.52113	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000096	T	0.46502	0.1396	M	0.85542	2.76	0.27457	N	0.953251	P	0.39940	0.696	B	0.40940	0.344	T	0.53500	-0.8430	10	0.72032	D	0.01	.	13.0188	0.58773	0.0:0.9208:0.0:0.0792	.	272	Q9H2C8	O51V1_HUMAN	H	272	ENSP00000321729:R272H	ENSP00000321729:R272H	R	-	2	0	OR51V1	5177692	0.008000	0.16893	0.707000	0.30419	0.090000	0.18270	0.602000	0.24134	1.431000	0.47355	0.655000	0.94253	CGT	.	.		0.473	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760	
DRAP1	10589	hgsc.bcm.edu	37	11	65687843	65687843	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr11:65687843T>G	ENST00000312515.2	+	4	484	c.239T>G	c.(238-240)tTt>tGt	p.F80C	C11orf68_ENST00000438576.2_5'Flank|DRAP1_ENST00000532933.1_Missense_Mutation_p.F60C|C11orf68_ENST00000530188.1_5'Flank|DRAP1_ENST00000376991.2_Missense_Mutation_p.F80C|C11orf68_ENST00000449692.3_5'Flank|DRAP1_ENST00000527119.1_Missense_Mutation_p.F36C	NM_006442.3	NP_006433.2	Q14919	NC2A_HUMAN	DR1-associated protein 1 (negative cofactor 2 alpha)	80					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(1)	5				READ - Rectum adenocarcinoma(159;0.166)		GAGCAGCAGTTTGACTTCTTG	0.627																																					p.F80C		Atlas-SNP	.											.	DRAP1	18	.	0			c.T239G						.						76.0	78.0	77.0					11																	65687843		2201	4296	6497	SO:0001583	missense	10589	exon4			AGCAGTTTGACTT	U41843	CCDS8123.1	11q13	2010-09-29			ENSG00000175550	ENSG00000175550			3019	protein-coding gene	gene with protein product	"""negative cofactor 2 alpha"", ""DR1-associated corepressor"""	602289				8608938	Standard	NM_006442		Approved	NC2-alpha	uc001ogj.2	Q14919	OTTHUMG00000166723	ENST00000312515.2:c.239T>G	chr11.hg19:g.65687843T>G	ENSP00000307850:p.Phe80Cys	35.0	0.0		42.0	9.0	NM_006442	Q13448	Missense_Mutation	SNP	ENST00000312515.2	hg19	CCDS8123.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.575947	0.86645	.	.	ENSG00000175550	ENST00000312515;ENST00000376991;ENST00000527119;ENST00000532933	T;T	0.50813	0.73;0.73	4.33	4.33	0.51752	Histone-fold (1);	0.000000	0.85682	D	0.000000	T	0.61527	0.2354	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.65261	-0.6211	10	0.87932	D	0	-7.0965	11.7748	0.51979	0.0:0.0:0.0:1.0	.	80	Q14919	NC2A_HUMAN	C	80;80;36;60	ENSP00000437287:F36C;ENSP00000432445:F60C	ENSP00000307850:F80C	F	+	2	0	DRAP1	65444419	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.132000	0.77251	1.744000	0.51775	0.533000	0.62120	TTT	.	.		0.627	DRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391197.2	NM_006442	
ERBB3	2065	hgsc.bcm.edu	37	12	56495713	56495713	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr12:56495713G>T	ENST00000267101.3	+	28	4343	c.3903G>T	c.(3901-3903)caG>caT	p.Q1301H	ERBB3_ENST00000549832.1_Missense_Mutation_p.Q421H|ERBB3_ENST00000553131.1_Missense_Mutation_p.Q542H|ERBB3_ENST00000415288.2_Missense_Mutation_p.Q1242H|PA2G4_ENST00000552766.1_5'Flank|ERBB3_ENST00000450146.2_Missense_Mutation_p.Q658H|RP11-603J24.9_ENST00000548861.1_Intron|PA2G4_ENST00000303305.6_5'Flank|RP11-603J24.17_ENST00000548595.1_RNA	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1301					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CTGGACATCAGGCCCCCCATG	0.537																																					p.Q1301H		Atlas-SNP	.											.	ERBB3	350	.	0			c.G3903T						.						107.0	117.0	114.0					12																	56495713		2203	4300	6503	SO:0001583	missense	2065	exon28			ACATCAGGCCCCC	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3903G>T	chr12.hg19:g.56495713G>T	ENSP00000267101:p.Gln1301His	39.0	0.0		55.0	25.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	hg19	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	3.395	-0.123576	0.06795	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.78707	-1.06;-0.97;-1.05;-1.2;-0.93	5.39	-2.98	0.05513	.	0.563354	0.17890	N	0.158548	T	0.44138	0.1279	N	0.04508	-0.205	0.29846	N	0.828808	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.25152	-1.0140	10	0.19147	T	0.46	.	1.1483	0.01780	0.3152:0.1409:0.3421:0.2018	.	1242;421;1301	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	H	1301;658;1242;424;542;421	ENSP00000267101:Q1301H;ENSP00000399178:Q658H;ENSP00000408340:Q1242H;ENSP00000449129:Q542H;ENSP00000448729:Q421H	ENSP00000267101:Q1301H	Q	+	3	2	ERBB3	54781980	0.002000	0.14202	0.773000	0.31616	0.337000	0.28794	-0.178000	0.09782	-0.700000	0.05070	-0.262000	0.10625	CAG	.	.		0.537	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
SRGAP1	57522	hgsc.bcm.edu	37	12	64437335	64437335	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr12:64437335G>A	ENST00000355086.3	+	6	1305	c.781G>A	c.(781-783)Gat>Aat	p.D261N	RP11-196H14.2_ENST00000535594.1_RNA|SRGAP1_ENST00000357825.3_Missense_Mutation_p.D261N|SRGAP1_ENST00000543397.1_Missense_Mutation_p.D221N	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	261	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTATATTCATGATCTTTCTGA	0.294																																					p.D261N		Atlas-SNP	.											.	SRGAP1	146	.	0			c.G781A						.						91.0	76.0	81.0					12																	64437335		2203	4300	6503	SO:0001583	missense	57522	exon6			ATTCATGATCTTT	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.781G>A	chr12.hg19:g.64437335G>A	ENSP00000347198:p.Asp261Asn	106.0	0.0		223.0	44.0	NM_020762	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	hg19	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	G	35	5.510171	0.96386	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.49139	0.79;0.79;2.36	5.56	5.56	0.83823	.	0.000000	0.35739	U	0.003007	T	0.70535	0.3235	M	0.89601	3.045	0.80722	D	1	P;P;P	0.49185	0.884;0.847;0.92	P;P;P	0.53593	0.636;0.73;0.73	T	0.75091	-0.3440	9	.	.	.	.	19.9239	0.97097	0.0:0.0:1.0:0.0	.	261;221;261	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	N	261;261;221	ENSP00000347198:D261N;ENSP00000350480:D261N;ENSP00000437948:D221N	.	D	+	1	0	SRGAP1	62723602	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.787000	0.99055	2.797000	0.96272	0.563000	0.77884	GAT	.	.		0.294	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
SUPT20H	55578	hgsc.bcm.edu	37	13	37583904	37583904	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr13:37583904C>T	ENST00000350612.6	-	26	2465	c.2245G>A	c.(2245-2247)Gca>Aca	p.A749T	SUPT20H_ENST00000464744.1_Missense_Mutation_p.S715N|SUPT20H_ENST00000356185.3_Missense_Mutation_p.S715N|SUPT20H_ENST00000360252.4_Missense_Mutation_p.S715N|SUPT20H_ENST00000475892.1_Missense_Mutation_p.S793N	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	749	Gln-rich.				autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										GTTTGTGCTGCTGCTGCTGCC	0.453																																					p.A749T		Atlas-SNP	.											.	.	.	.	0			c.G2245A						.						116.0	106.0	110.0					13																	37583904		2203	4300	6503	SO:0001583	missense	55578	exon26			GTGCTGCTGCTGC	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.2245G>A	chr13.hg19:g.37583904C>T	ENSP00000218894:p.Ala749Thr	201.0	0.0		233.0	10.0	NM_001014286	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	ENST00000350612.6	hg19	CCDS31959.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.87|10.87	1.472182|1.472182	0.26423|0.26423	.|.	.|.	ENSG00000102710|ENSG00000102710	ENST00000350612|ENST00000360252;ENST00000475892;ENST00000356185;ENST00000536874;ENST00000464744	T|T;T;T;T	0.35236|0.50548	1.32|0.74;0.75;0.74;0.74	5.52|5.52	4.68|4.68	0.58851|0.58851	.|.	0.256846|.	0.27936|.	N|.	0.017255|.	T|T	0.39759|0.39759	0.1090|0.1090	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	B|B;B;B	0.06786|0.02656	0.001|0.0;0.0;0.0	B|B;B;B	0.06405|0.04013	0.002|0.0;0.0;0.001	T|T	0.22034|0.22034	-1.0228|-1.0228	10|9	0.48119|0.39692	T|T	0.1|0.17	-11.2654|-11.2654	9.8977|9.8977	0.41329|0.41329	0.0:0.844:0.0:0.156|0.0:0.844:0.0:0.156	.|.	749|793;715;715	Q8NEM7|E7ER46;A8K8L1;Q8NEM7-2	FA48A_HUMAN|.;.;.	T|N	749|715;793;715;714;715	ENSP00000218894:A749T|ENSP00000353388:S715N;ENSP00000417510:S793N;ENSP00000348512:S715N;ENSP00000419754:S715N	ENSP00000218894:A749T|ENSP00000348512:S715N	A|S	-|-	1|2	0|0	FAM48A|FAM48A	36481904|36481904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.697000|2.697000	0.47060|0.47060	1.350000|1.350000	0.45770|0.45770	0.467000|0.467000	0.42956|0.42956	GCA|AGC	.	.		0.453	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1	NM_017569	
NIN	51199	hgsc.bcm.edu	37	14	51196346	51196346	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr14:51196346C>A	ENST00000382041.3	-	29	6163	c.5973G>T	c.(5971-5973)agG>agT	p.R1991S	NIN_ENST00000245441.5_Missense_Mutation_p.R1991S|NIN_ENST00000382043.4_Missense_Mutation_p.R1278S|NIN_ENST00000453196.1_Missense_Mutation_p.R1991S|NIN_ENST00000324330.9_3'UTR|NIN_ENST00000389868.3_3'UTR|NIN_ENST00000530997.2_Missense_Mutation_p.R1991S	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1991					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					GAAACTGCTCCCTGGGCACCA	0.577			T	PDGFRB	MPD																																p.R1991S		Atlas-SNP	.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	NIN	475	.	0			c.G5973T						.						116.0	105.0	108.0					14																	51196346		2203	4300	6503	SO:0001583	missense	51199	exon29			CTGCTCCCTGGGC	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.5973G>T	chr14.hg19:g.51196346C>A	ENSP00000371472:p.Arg1991Ser	115.0	0.0		105.0	56.0	NM_020921	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	hg19	CCDS32079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.224096|4.224096	0.79576|0.79576	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853|ENST00000245441;ENST00000311149;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000453196	.|T;T;T;T	.|0.12255	.|3.38;2.7;3.19;3.14	5.23|5.23	4.32|4.32	0.51571|0.51571	.|.	.|0.476626	.|0.22821	.|N	.|0.055235	.|T	.|0.33030	.|0.0849	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D	.|0.89917	.|0.993;1.0;0.996;0.94;0.996	.|D;D;D;P;D	.|0.87578	.|0.963;0.998;0.99;0.678;0.99	.|T	.|0.00855	.|-1.1539	.|10	.|0.40728	.|T	.|0.16	-15.8915|-15.8915	13.9493|13.9493	0.64106|0.64106	0.0:0.9224:0.0:0.0776|0.0:0.9224:0.0:0.0776	.|.	.|1997;1991;1991;1278;1991	.|Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.|.;.;NIN_HUMAN;.;.	X|S	1482|1991;1974;1278;1997;1991;1991	.|ENSP00000245441:R1991S;ENSP00000371474:R1278S;ENSP00000371472:R1991S;ENSP00000412391:R1991S	.|ENSP00000245441:R1991S	G|R	-|-	1|3	0|2	NIN|NIN	50266096|50266096	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.895000|0.895000	0.52256|0.52256	1.921000|1.921000	0.40035|0.40035	2.624000|2.624000	0.88883|0.88883	0.650000|0.650000	0.86243|0.86243	GGA|AGG	.	.		0.577	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
PRIMA1	145270	hgsc.bcm.edu	37	14	94245606	94245606	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr14:94245606G>A	ENST00000393140.1	-	3	247	c.145C>T	c.(145-147)Cga>Tga	p.R49*	PRIMA1_ENST00000316227.3_Nonsense_Mutation_p.R49*|PRIMA1_ENST00000393143.1_Nonsense_Mutation_p.R49*	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	49					establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		CAGACGTGTCGGCAGCTGTCA	0.647																																					p.R49X		Atlas-SNP	.											.	PRIMA1	21	.	0			c.C145T						.						33.0	28.0	29.0					14																	94245606		2201	4299	6500	SO:0001587	stop_gained	145270	exon3			CGTGTCGGCAGCT		CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.145C>T	chr14.hg19:g.94245606G>A	ENSP00000376848:p.Arg49*	22.0	0.0		28.0	16.0	NM_178013	Q86XR6	Nonsense_Mutation	SNP	ENST00000393140.1	hg19	CCDS9912.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039999	0.97226	.	.	ENSG00000175785	ENST00000393140;ENST00000393143;ENST00000316227	.	.	.	4.86	4.86	0.63082	.	0.163970	0.40554	N	0.001072	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-0.6267	13.5121	0.61519	0.0:0.0:1.0:0.0	.	.	.	.	X	49	.	ENSP00000320948:R49X	R	-	1	2	PRIMA1	93315359	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.650000	0.61440	2.254000	0.74563	0.549000	0.68633	CGA	.	.		0.647	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280658.1	NM_178013	
JAG2	3714	hgsc.bcm.edu	37	14	105612177	105612177	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr14:105612177T>C	ENST00000331782.3	-	23	3246	c.2843A>G	c.(2842-2844)gAg>gGg	p.E948G	JAG2_ENST00000347004.2_Missense_Mutation_p.E910G	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	948					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TGCGCCGCACTCCCCCCAGGC	0.687																																					p.E948G		Atlas-SNP	.											.	JAG2	69	.	0			c.A2843G						.						27.0	21.0	23.0					14																	105612177		2144	4260	6404	SO:0001583	missense	3714	exon23			CCGCACTCCCCCC	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.2843A>G	chr14.hg19:g.105612177T>C	ENSP00000328169:p.Glu948Gly	115.0	0.0		119.0	5.0	NM_002226	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	hg19	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294824	0.40594	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.87334	-2.23;-2.24	3.6	2.39	0.29439	.	0.356734	0.25762	U	0.028466	D	0.82724	0.5099	L	0.52573	1.65	0.38453	D	0.947009	B;B	0.29646	0.253;0.164	B;B	0.32980	0.156;0.075	T	0.78130	-0.2324	10	0.56958	D	0.05	.	8.9426	0.35740	0.0:0.0:0.1887:0.8113	.	910;948	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	G	948;910	ENSP00000328169:E948G;ENSP00000328566:E910G	ENSP00000328169:E948G	E	-	2	0	JAG2	104683222	0.885000	0.30320	0.990000	0.47175	0.797000	0.45037	1.450000	0.35134	0.254000	0.21573	0.358000	0.22013	GAG	.	.		0.687	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
AKAP13	11214	hgsc.bcm.edu	37	15	86124170	86124171	+	Nonsense_Mutation	DNP	AC	AC	TT			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr15:86124170_86124171AC>TT	ENST00000394518.2	+	7	2966_2967	c.2871_2872AC>TT	c.(2869-2874)ggACaa>ggTTaa	p.Q958*	AKAP13_ENST00000361243.2_Nonsense_Mutation_p.Q958*|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	958					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CACCTCCTGGACAAGATACTCA	0.441																																					p.G957G|p.Q958X	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.A2871T|c.C2872T						.																																			SO:0001587	stop_gained	11214	exon7			TCCTGGACAAGAT|CCTGGACAAGATA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		Exception_encountered	chr15.hg19:g.86124170_86124171delinsTT	ENSP00000378026:p.Gln958*	59.0|61.0	0.0		56.0	17.0|16.0	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent|Nonsense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1																																																																																			.	.		0.441	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
FAM92B	339145	hgsc.bcm.edu	37	16	85133752	85133752	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr16:85133752G>A	ENST00000539556.1	-	8	901	c.746C>T	c.(745-747)gCc>gTc	p.A249V		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	249										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						CACCTGGCTGGCGAGAGACTG	0.572																																					p.A249V		Atlas-SNP	.											.	FAM92B	29	.	0			c.C746T						.						68.0	55.0	59.0					16																	85133752		2198	4300	6498	SO:0001583	missense	339145	exon7			TGGCTGGCGAGAG		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.746C>T	chr16.hg19:g.85133752G>A	ENSP00000443411:p.Ala249Val	28.0	0.0		37.0	11.0	NM_198491		Missense_Mutation	SNP	ENST00000539556.1	hg19	CCDS32500.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101252	0.37048	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.34667	1.35	4.82	1.75	0.24633	.	1.048890	0.07502	N	0.907383	T	0.30166	0.0756	L	0.43923	1.385	0.09310	N	1	B	0.14012	0.009	B	0.19148	0.024	T	0.29427	-1.0012	10	0.40728	T	0.16	-2.212	6.2424	0.20797	0.3156:0.0:0.6844:0.0	.	249	Q6ZTR7	FA92B_HUMAN	V	249	ENSP00000443411:A249V	ENSP00000376937:A249V	A	-	2	0	FAM92B	83691253	0.000000	0.05858	0.007000	0.13788	0.083000	0.17756	-0.212000	0.09319	0.446000	0.26666	0.462000	0.41574	GCC	.	.		0.572	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198491	
P2RX1	5023	hgsc.bcm.edu	37	17	3806509	3806509	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr17:3806509G>T	ENST00000225538.3	-	7	1008	c.734C>A	c.(733-735)aCc>aAc	p.T245N		NM_002558.2	NP_002549.1	P51575	P2RX1_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 1	245					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ceramide biosynthetic process (GO:0046513)|insemination (GO:0007320)|ion transport (GO:0006811)|neuronal action potential (GO:0019228)|platelet activation (GO:0030168)|positive regulation of ion transport (GO:0043270)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of vascular smooth muscle contraction (GO:0003056)|response to ATP (GO:0033198)|serotonin secretion by platelet (GO:0002554)|signal transduction (GO:0007165)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|vasoconstriction (GO:0042310)	external side of cell outer membrane (GO:0031240)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	13				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		CTCAGCCAGGGTGCTGAAGTT	0.582																																					p.T245N		Atlas-SNP	.											.	P2RX1	38	.	0			c.C734A						.						80.0	74.0	76.0					17																	3806509		2203	4300	6503	SO:0001583	missense	5023	exon7			GCCAGGGTGCTGA	X83688	CCDS11040.1	17p13.3	2012-01-17				ENSG00000108405		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8533	protein-coding gene	gene with protein product		600845				8834001	Standard	NM_002558		Approved	P2X1	uc002fww.3	P51575		ENST00000225538.3:c.734C>A	chr17.hg19:g.3806509G>T	ENSP00000225538:p.Thr245Asn	36.0	0.0		25.0	12.0	NM_002558	Q9UK84	Missense_Mutation	SNP	ENST00000225538.3	hg19	CCDS11040.1	.	.	.	.	.	.	.	.	.	.	G	8.596	0.885606	0.17540	.	.	ENSG00000108405	ENST00000225538	T	0.04083	3.71	5.43	2.12	0.27331	.	0.609805	0.18718	N	0.133118	T	0.04724	0.0128	L	0.28115	0.83	0.09310	N	1	B	0.25169	0.119	B	0.36418	0.224	T	0.40001	-0.9586	10	0.49607	T	0.09	-14.7021	5.6267	0.17487	0.0825:0.4055:0.3961:0.1158	.	245	P51575	P2RX1_HUMAN	N	245	ENSP00000225538:T245N	ENSP00000225538:T245N	T	-	2	0	P2RX1	3753258	0.001000	0.12720	0.318000	0.25279	0.287000	0.27160	0.357000	0.20199	0.174000	0.19809	-0.217000	0.12591	ACC	.	.		0.582	P2RX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438391.1	NM_002558	
CTIF	9811	hgsc.bcm.edu	37	18	46163025	46163026	+	Nonsense_Mutation	DNP	CC	CC	GA	rs141933283		TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr18:46163025_46163026CC>GA	ENST00000256413.3	+	3	516_517	c.221_222CC>GA	c.(220-222)tCC>tGA	p.S74*	CTIF_ENST00000382998.4_Nonsense_Mutation_p.S74*	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	74	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						AGCAGCTGTTCCTTCTCCCGAG	0.644																																					p.S74C|p.S74S		Atlas-SNP	.											.	CTIF	102	.	0			c.C221G|c.C222A						.																																			SO:0001587	stop_gained	9811	exon3			GCTGTTCCTTCTC|CTGTTCCTTCTCC	AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	Exception_encountered	chr18.hg19:g.46163025_46163026delinsGA	ENSP00000256413:p.Ser74*	88.0|86.0	0.0		85.0	35.0	NM_014772	B3KTR8|Q8IVD5	Missense_Mutation|Silent	SNP	ENST00000256413.3	hg19	CCDS11935.1																																																																																			.	C|1.000;T|0.000|.		0.644	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1	NM_014772	
MCM8	84515	hgsc.bcm.edu	37	20	5935894	5935894	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr20:5935894T>A	ENST00000378896.3	+	5	860	c.483T>A	c.(481-483)caT>caA	p.H161Q	MCM8_ENST00000378883.1_Missense_Mutation_p.H161Q|MCM8_ENST00000378886.2_Missense_Mutation_p.H161Q|MCM8_ENST00000265187.4_Missense_Mutation_p.H161Q	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	161					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						TGGCAATACATCAGGTAACTA	0.368																																					p.H161Q		Atlas-SNP	.											.	MCM8	125	.	0			c.T483A						.						173.0	161.0	165.0					20																	5935894		2203	4300	6503	SO:0001583	missense	84515	exon5			AATACATCAGGTA	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.483T>A	chr20.hg19:g.5935894T>A	ENSP00000368174:p.His161Gln	77.0	0.0		50.0	39.0	NM_032485	B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Missense_Mutation	SNP	ENST00000378896.3	hg19	CCDS13094.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.789269	0.90367	.	.	ENSG00000125885	ENST00000378896;ENST00000378883;ENST00000399350;ENST00000378886;ENST00000265187	T;T;T;T	0.10668	2.85;2.85;2.85;2.85	5.76	5.76	0.90799	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.32675	0.0837	M	0.77616	2.38	0.80722	D	1	D;D;P;P	0.69078	0.991;0.997;0.937;0.949	P;D;P;P	0.66847	0.885;0.947;0.661;0.642	T	0.03025	-1.1081	10	0.27785	T	0.31	-18.5568	16.3786	0.83431	0.0:0.0:0.0:1.0	.	161;161;161;161	Q9UJA3-2;E7EQU7;Q9UJA3-3;Q9UJA3	.;.;.;MCM8_HUMAN	Q	161	ENSP00000368174:H161Q;ENSP00000368161:H161Q;ENSP00000368164:H161Q;ENSP00000265187:H161Q	ENSP00000265187:H161Q	H	+	3	2	MCM8	5883894	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.521000	0.45563	2.323000	0.78572	0.528000	0.53228	CAT	.	.		0.368	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077900.1	NM_032485	
MT-ND5	4540	hgsc.bcm.edu	37	M	13543	13543	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chrM:13543T>C	ENST00000361567.2	+	1	1207	c.1207T>C	c.(1207-1209)Tac>Cac	p.Y403H	MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	403					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CAAACATATCATACACAAACG	0.473																																					p.Y403H		Atlas-SNP	.											.	.	.	.	0			c.T1207C						.																																			SO:0001583	missense	0	exon1			ATATCATACACAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1207T>C	chrM.hg19:g.13543T>C	ENSP00000354813:p.Tyr403His	17.0	0.0		15.0	15.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.473	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
BAP1	8314	hgsc.bcm.edu	37	3	52436639	52436640	+	Frame_Shift_Ins	INS	-	-	A			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr3:52436639_52436640insA	ENST00000460680.1	-	16	2505_2506	c.2034_2035insT	c.(2032-2037)tttatcfs	p.I679fs	BAP1_ENST00000296288.5_Frame_Shift_Ins_p.I661fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C676fs*10(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGCATGGAGATAAAGGTGCAGA	0.554			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.I679fs	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.,1	BAP1	371	.	1	Deletion - Frameshift(1)	kidney(1)	c.2035_2036insT						.																																			SO:0001589	frameshift_variant	8314	exon16			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.2035dupT	chr3.hg19:g.52436642_52436642dupA	ENSP00000417132:p.Ile679fs	84.0	0.0		67.0	35.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Ins	INS	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.		0.554	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CREG2	200407	hgsc.bcm.edu	37	2	101971822	101971823	+	Frame_Shift_Ins	INS	-	-	T			TCGA-ED-A7PX-01A-51D-A34Z-10	TCGA-ED-A7PX-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	282d9c17-9d34-43d9-952e-bf14edf7bc65	4fd69f63-3ae5-4678-8647-a7e5eabd7486	g.chr2:101971822_101971823insT	ENST00000324768.5	-	3	754_755	c.617_618insA	c.(616-618)aacfs	p.N206fs		NM_153836.3	NP_722578.1	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	206						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						GATCAACGATGTTTTTTCTGCA	0.396																																					p.N206fs		Atlas-Indel,Pindel	.											.	CREG2	21	.	0			c.618_619insA						.																																			SO:0001589	frameshift_variant	200407	exon3			.	AB046109	CCDS2052.1	2q12.1	2007-08-01			ENSG00000175874	ENSG00000175874			14272	protein-coding gene	gene with protein product						12408961	Standard	NM_153836		Approved		uc002tba.2	Q8IUH2	OTTHUMG00000130692	ENST00000324768.5:c.618dupA	chr2.hg19:g.101971828_101971828dupT	ENSP00000315203:p.Asn206fs	117.0	0.0		186.0	64.0	NM_153836	Q86X03|Q8N540|Q8N9E3	Frame_Shift_Ins	INS	ENST00000324768.5	hg19	CCDS2052.1																																																																																			.	.		0.396	CREG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253188.2	NM_153836	
