#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MIB2	142678	hgsc.bcm.edu	37	1	1561031	1561031	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:1561031A>T	ENST00000357210.4	+	8	1360	c.1144A>T	c.(1144-1146)Aag>Tag	p.K382*	MIB2_ENST00000520777.1_Nonsense_Mutation_p.K435*|MIB2_ENST00000355826.5_Nonsense_Mutation_p.K425*|MIB2_ENST00000505820.2_Nonsense_Mutation_p.K439*|MIB2_ENST00000378712.1_Nonsense_Mutation_p.K259*|MIB2_ENST00000504599.1_Nonsense_Mutation_p.K338*|MIB2_ENST00000360522.4_Nonsense_Mutation_p.K382*|MIB2_ENST00000378710.3_Intron|MIB2_ENST00000518681.1_Nonsense_Mutation_p.K374*|MIB2_ENST00000378708.1_Intron	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	382					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGCGCTCACCAAGGTGCCGGG	0.682																																					p.K439X		Atlas-SNP	.											.	MIB2	62	.	0			c.A1315T						.						10.0	12.0	11.0					1																	1561031		1913	4062	5975	SO:0001587	stop_gained	142678	exon8			CTCACCAAGGTGC	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.1144A>T	chr1.hg19:g.1561031A>T	ENSP00000349741:p.Lys382*	71.0	0.0		76.0	41.0	NM_080875	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Nonsense_Mutation	SNP	ENST00000357210.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.1|27.1	4.799871|4.799871	0.90538|0.90538	.|.	.|.	ENSG00000197530|ENSG00000197530	ENST00000520777;ENST00000357210;ENST00000360522;ENST00000355826;ENST00000518681;ENST00000505820;ENST00000378712;ENST00000504599|ENST00000514234	.|.	.|.	.|.	4.41|4.41	3.17|3.17	0.36434|0.36434	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.59115	.|0.2170	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.56559	.|-0.7959	.|4	0.02654|.	T|.	1|.	-15.7819|-15.7819	9.3025|9.3025	0.37853|0.37853	0.8394:0.0:0.0:0.1606|0.8394:0.0:0.0:0.1606	.|.	.|.	.|.	.|.	X|L	435;382;382;425;374;439;259;338|232	.|.	ENSP00000348081:K425X|.	K|Q	+|+	1|2	0|0	MIB2|MIB2	1550894|1550894	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	6.626000|6.626000	0.74253|0.74253	1.764000|1.764000	0.52075|0.52075	0.379000|0.379000	0.24179|0.24179	AAG|CAA	.	.		0.682	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_080875	
USP48	84196	hgsc.bcm.edu	37	1	22083087	22083087	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:22083087T>A	ENST00000308271.9	-	3	1012	c.364A>T	c.(364-366)Agc>Tgc	p.S122C	USP48_ENST00000421625.2_Missense_Mutation_p.S122C|USP48_ENST00000400301.1_Missense_Mutation_p.S122C|USP48_ENST00000529637.1_Missense_Mutation_p.S122C	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	122	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CTACAAGTGCTTGGACATAAG	0.473																																					p.S122C		Atlas-SNP	.											.	USP48	91	.	0			c.A364T						.						141.0	141.0	141.0					1																	22083087		2203	4300	6503	SO:0001583	missense	84196	exon3			AAGTGCTTGGACA	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.364A>T	chr1.hg19:g.22083087T>A	ENSP00000309262:p.Ser122Cys	299.0	0.0		314.0	153.0	NM_001032730	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	hg19	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.590189	0.66105	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	T;T;T;T	0.05649	3.41;3.41;3.41;3.41	5.55	5.55	0.83447	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.090377	0.85682	D	0.000000	T	0.14056	0.0340	L	0.28400	0.85	0.50171	D	0.999855	D;D;P;D;D;D	0.71674	0.997;0.993;0.804;0.969;0.969;0.998	D;P;P;P;P;P	0.63113	0.911;0.87;0.694;0.517;0.613;0.855	T	0.01834	-1.1264	10	0.56958	D	0.05	.	14.8709	0.70456	0.0:0.0:0.0:1.0	.	122;122;122;122;122;122	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	C	122	ENSP00000383157:S122C;ENSP00000309262:S122C;ENSP00000431949:S122C;ENSP00000406256:S122C	ENSP00000309262:S122C	S	-	1	0	USP48	21955674	1.000000	0.71417	1.000000	0.80357	0.166000	0.22503	4.869000	0.63028	2.099000	0.63709	0.533000	0.62120	AGC	.	.		0.473	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
RSRP1	57035	hgsc.bcm.edu	37	1	25571745	25571745	+	Silent	SNP	G	G	A	rs147790749		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:25571745G>A	ENST00000243189.7	-	3	844	c.568C>T	c.(568-570)Cta>Tta	p.L190L	RP3-465N24.6_ENST00000607698.1_lincRNA|C1orf63_ENST00000431849.2_Silent_p.L190L|C1orf63_ENST00000417642.2_Silent_p.L183L	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		190										breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GTTGTTCCTAGAGCTTTCGCT	0.383																																					p.L190L		Atlas-SNP	.											.	C1orf63	17	.	0			c.C568T						.	A		1,4405	825.8+/-416.5	0,1,2202	153.0	136.0	142.0		568	3.3	0.1	1	dbSNP_134	142	0,8600		0,0,4300	no	coding-synonymous	C1orf63	NM_020317.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		190/291	25571745	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57035	exon3			TTCCTAGAGCTTT																												ENST00000243189.7:c.568C>T	chr1.hg19:g.25571745G>A		75.0	0.0		65.0	20.0	NM_020317	A8K917|Q49AA4|Q5TH71|Q9GZP6	Silent	SNP	ENST00000243189.7	hg19	CCDS260.1																																																																																			.	G|1.000;A|0.000		0.383	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101966.2		
TMEM57	55219	hgsc.bcm.edu	37	1	25810611	25810611	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:25810611G>A	ENST00000374343.4	+	7	1338	c.1159G>A	c.(1159-1161)Gaa>Aaa	p.E387K	TMEM57_ENST00000399763.3_Missense_Mutation_p.E29K|TMEM57_ENST00000399766.3_Missense_Mutation_p.E160K	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	387					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTAGGCTGGAACAAGACAT	0.547																																					p.E387K		Atlas-SNP	.											.	TMEM57	72	.	0			c.G1159A						.						58.0	62.0	60.0					1																	25810611		2203	4300	6503	SO:0001583	missense	55219	exon7			AGGCTGGAACAAG	AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.1159G>A	chr1.hg19:g.25810611G>A	ENSP00000363463:p.Glu387Lys	265.0	1.0		267.0	110.0	NM_018202	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	ENST00000374343.4	hg19	CCDS30638.1	.	.	.	.	.	.	.	.	.	.	G	36	5.684625	0.96784	.	.	ENSG00000204178	ENST00000399766;ENST00000399763;ENST00000374343	T;D;T	0.86627	1.62;-2.15;2.6	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.94414	0.8203	M	0.84683	2.71	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.998	D	0.93903	0.7190	10	0.54805	T	0.06	-18.9469	19.5093	0.95135	0.0:0.0:1.0:0.0	.	29;160;387	Q8N5G2-2;Q8N5G2-3;Q8N5G2	.;.;MACOI_HUMAN	K	160;29;387	ENSP00000382668:E160K;ENSP00000382666:E29K;ENSP00000363463:E387K	ENSP00000363463:E387K	E	+	1	0	TMEM57	25683198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.447000	0.97595	2.861000	0.98227	0.650000	0.86243	GAA	.	.		0.547	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009659.2	NM_018202	
SLC30A2	7780	hgsc.bcm.edu	37	1	26365755	26365755	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:26365755T>A	ENST00000374278.3	-	7	1084	c.868A>T	c.(868-870)Agc>Tgc	p.S290C	SLC30A2_ENST00000374276.3_Missense_Mutation_p.S339C	NM_032513.3	NP_115902.1	Q9BRI3	ZNT2_HUMAN	solute carrier family 30 (zinc transporter), member 2	290					positive regulation of sequestering of zinc ion (GO:0061090)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)	cation transmembrane transporter activity (GO:0008324)			cervix(1)|endometrium(2)|kidney(1)|lung(8)|stomach(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAGGCGGCTGCTGGCTGTC	0.597																																					p.S339C		Atlas-SNP	.											.	SLC30A2	29	.	0			c.A1015T						.						68.0	62.0	64.0					1																	26365755		2203	4300	6503	SO:0001583	missense	7780	exon8			GGCGGCTGCTGGC	AK023491	CCDS272.1, CCDS30644.1	1p35.3	2013-05-22			ENSG00000158014	ENSG00000158014		"""Solute carriers"""	11013	protein-coding gene	gene with protein product		609617		ZNT2			Standard	NM_001004434		Approved		uc001blg.1	Q9BRI3	OTTHUMG00000007508	ENST00000374278.3:c.868A>T	chr1.hg19:g.26365755T>A	ENSP00000363396:p.Ser290Cys	74.0	0.0		78.0	41.0	NM_001004434	Q71RC8	Missense_Mutation	SNP	ENST00000374278.3	hg19	CCDS272.1	.	.	.	.	.	.	.	.	.	.	T	13.18	2.159612	0.38119	.	.	ENSG00000158014	ENST00000374278;ENST00000374276	T;T	0.64991	-0.13;-0.13	5.63	-11.1	0.00147	.	1.156630	0.06172	N	0.677951	T	0.48295	0.1492	L	0.42744	1.35	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.18263	0.021;0.012	T	0.48293	-0.9048	10	0.56958	D	0.05	-0.4516	11.5943	0.50964	0.2604:0.6304:0.0:0.1092	.	290;339	Q9BRI3;Q9BRI3-2	ZNT2_HUMAN;.	C	290;339	ENSP00000363396:S290C;ENSP00000363394:S339C	ENSP00000363394:S339C	S	-	1	0	SLC30A2	26238342	0.000000	0.05858	0.000000	0.03702	0.317000	0.28152	-2.347000	0.01095	-1.583000	0.01638	0.379000	0.24179	AGC	.	.		0.597	SLC30A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019742.1	NM_032513	
COL16A1	1307	hgsc.bcm.edu	37	1	32157244	32157244	+	Splice_Site	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:32157244C>A	ENST00000373672.3	-	18	1774		c.e18-1		COL16A1_ENST00000373668.3_Splice_Site|COL16A1_ENST00000271069.6_Splice_Site	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1						cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTGGCCGGCCCTGTGGGGGGA	0.652																																					.	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.1258-1G>T						.						105.0	112.0	109.0					1																	32157244		1921	4121	6042	SO:0001630	splice_region_variant	1307	exon19			CCGGCCCTGTGGG	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1258-1G>T	chr1.hg19:g.32157244C>A		227.0	1.0		193.0	87.0	NM_001856	Q16593|Q59F89|Q71RG9	Splice_Site	SNP	ENST00000373672.3	hg19	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833443	0.50951	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668;ENST00000373667	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1384	0.72590	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL16A1	31929831	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	6.052000	0.71080	2.391000	0.81399	0.462000	0.41574	.	.	.		0.652	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	Intron
OSCP1	127700	hgsc.bcm.edu	37	1	36904373	36904373	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:36904373T>A	ENST00000356637.5	-	3	344	c.281A>T	c.(280-282)cAg>cTg	p.Q94L	OSCP1_ENST00000315643.9_Missense_Mutation_p.Q94L|OSCP1_ENST00000235532.5_Missense_Mutation_p.Q84L|OSCP1_ENST00000433045.2_Missense_Mutation_p.Q39L|OSCP1_ENST00000354267.3_Missense_Mutation_p.Q84L			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	94					transport (GO:0006810)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						CATGCTGGCCTGGTTCAGTTT	0.468																																					p.Q84L		Atlas-SNP	.											.	OSCP1	48	.	0			c.A251T						.						101.0	90.0	94.0					1																	36904373		2203	4300	6503	SO:0001583	missense	127700	exon2			CTGGCCTGGTTCA		CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.281A>T	chr1.hg19:g.36904373T>A	ENSP00000349052:p.Gln94Leu	39.0	0.0		40.0	12.0	NM_145047	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	ENST00000356637.5	hg19		.	.	.	.	.	.	.	.	.	.	T	16.64	3.179923	0.57800	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000433045;ENST00000445843;ENST00000315643;ENST00000354267	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.32194	0.0821	L	0.56769	1.78	0.80722	D	1	P;B;B	0.37352	0.591;0.228;0.27	B;B;B	0.36186	0.219;0.138;0.216	T	0.05784	-1.0864	10	0.28530	T	0.3	.	15.4635	0.75381	0.0:0.0:0.0:1.0	.	84;84;94	Q8WVF1-4;Q8WVF1-3;Q8WVF1	.;.;OSCP1_HUMAN	L	84;94;39;54;94;84	ENSP00000235532:Q84L;ENSP00000349052:Q94L;ENSP00000390820:Q39L;ENSP00000396417:Q54L;ENSP00000314541:Q94L;ENSP00000346216:Q84L	ENSP00000235532:Q84L	Q	-	2	0	OSCP1	36676960	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.927000	0.56499	2.250000	0.74265	0.533000	0.62120	CAG	.	.		0.468	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000389759.1	NM_145047	
EPHA10	284656	hgsc.bcm.edu	37	1	38230698	38230698	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:38230698A>T	ENST00000373048.4	-	1	40	c.41T>A	c.(40-42)cTc>cAc	p.L14H	EPHA10_ENST00000319637.6_Missense_Mutation_p.L14H|EPHA10_ENST00000427468.2_Missense_Mutation_p.L14H	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	14					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CATCCGGCAGAGGAAGAGGCG	0.692																																					p.L14H		Atlas-SNP	.											.	EPHA10	120	.	0			c.T41A						.						12.0	15.0	14.0					1																	38230698		2200	4295	6495	SO:0001583	missense	284656	exon1			CGGCAGAGGAAGA	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.41T>A	chr1.hg19:g.38230698A>T	ENSP00000362139:p.Leu14His	47.0	0.0		40.0	24.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	hg19	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	A	12.36	1.915646	0.33815	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.78003	-1.14;-1.13;4.31	5.19	-1.18	0.09617	.	1.399080	0.05203	N	0.505331	T	0.63189	0.2490	N	0.14661	0.345	0.38080	D	0.936641	B;B	0.30542	0.187;0.284	B;B	0.36244	0.156;0.22	T	0.48811	-0.9002	10	0.44086	T	0.13	.	4.98	0.14160	0.4937:0.1605:0.3458:0.0	.	14;14	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	H	14	ENSP00000397746:L14H;ENSP00000362139:L14H;ENSP00000316395:L14H	ENSP00000316395:L14H	L	-	2	0	EPHA10	38003285	0.033000	0.19621	0.030000	0.17652	0.802000	0.45316	0.081000	0.14823	-0.382000	0.07870	0.519000	0.50382	CTC	.	.		0.692	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
YBX1	4904	hgsc.bcm.edu	37	1	43162928	43162928	+	Silent	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:43162928C>T	ENST00000321358.7	+	6	874	c.735C>T	c.(733-735)ttC>ttT	p.F245F		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	245					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GACCACGATTCCGCAGGTATG	0.438																																					p.F245F		Atlas-SNP	.											.	YBX1	49	.	0			c.C735T						.						104.0	86.0	92.0					1																	43162928		2203	4300	6503	SO:0001819	synonymous_variant	4904	exon6			ACGATTCCGCAGG	BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.735C>T	chr1.hg19:g.43162928C>T		220.0	0.0		179.0	57.0	NM_004559	P16990|P16991|Q14972|Q15325|Q5FVF0	Silent	SNP	ENST00000321358.7	hg19	CCDS470.1	.	.	.	.	.	.	.	.	.	.	C	9.695	1.152938	0.21371	.	.	ENSG00000065978	ENST00000318612;ENST00000436427	.	.	.	5.6	3.68	0.42216	.	.	.	.	.	T	0.51466	0.1676	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37197	-0.9716	5	0.24483	T	0.36	-2.5623	6.7295	0.23375	0.0:0.6894:0.0:0.3106	.	.	.	.	F	236;295	.	ENSP00000361621:S236F	S	+	2	0	YBX1	42935515	0.978000	0.34361	1.000000	0.80357	0.975000	0.68041	0.034000	0.13776	0.643000	0.30638	0.563000	0.77884	TCC	.	.		0.438	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	
FAM73A	374986	hgsc.bcm.edu	37	1	78325806	78325806	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:78325806C>T	ENST00000370791.3	+	11	1302	c.1270C>T	c.(1270-1272)Cga>Tga	p.R424*	FAM73A_ENST00000443751.2_Nonsense_Mutation_p.R386*	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	424						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TGTGAAAGCACGAAAGGTAAA	0.323																																					p.R424X		Atlas-SNP	.											.	FAM73A	56	.	0			c.C1270T						.						45.0	46.0	46.0					1																	78325806		2203	4300	6503	SO:0001587	stop_gained	374986	exon11			AAAGCACGAAAGG		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1270C>T	chr1.hg19:g.78325806C>T	ENSP00000359827:p.Arg424*	120.0	0.0		99.0	35.0	NM_198549	Q6MZG0	Nonsense_Mutation	SNP	ENST00000370791.3	hg19	CCDS681.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750257	0.89753	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	.	.	.	5.48	3.41	0.39046	.	0.069985	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-9.9574	8.484	0.33061	0.2587:0.6544:0.0:0.0869	.	.	.	.	X	424;386	.	ENSP00000359827:R424X	R	+	1	2	FAM73A	78098394	0.987000	0.35691	1.000000	0.80357	0.909000	0.53808	1.308000	0.33528	1.313000	0.45069	0.563000	0.77884	CGA	.	.		0.323	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
MCOLN2	255231	hgsc.bcm.edu	37	1	85403666	85403666	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:85403666T>A	ENST00000370608.3	-	10	1277	c.1210A>T	c.(1210-1212)Aat>Tat	p.N404Y	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Missense_Mutation_p.N376Y	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	404					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		ATCCTTACATTATATGCCTGG	0.418																																					p.N404Y		Atlas-SNP	.											.	MCOLN2	60	.	0			c.A1210T						.						69.0	71.0	70.0					1																	85403666		2203	4300	6503	SO:0001583	missense	255231	exon10			TTACATTATATGC	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1210A>T	chr1.hg19:g.85403666T>A	ENSP00000359640:p.Asn404Tyr	377.0	0.0		369.0	152.0	NM_153259	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	hg19	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.276951	0.59758	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.69685	-0.42;-0.42	6.07	6.07	0.98685	Polycystin cation channel, PKD1/PKD2 (1);	0.040162	0.85682	D	0.000000	T	0.67850	0.2937	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64245	-0.6453	10	0.13108	T	0.6	-35.197	16.6277	0.84984	0.0:0.0:0.0:1.0	.	404	Q8IZK6	MCLN2_HUMAN	Y	404;376	ENSP00000359640:N404Y;ENSP00000284027:N376Y	ENSP00000284027:N376Y	N	-	1	0	MCOLN2	85176254	1.000000	0.71417	0.820000	0.32676	0.083000	0.17756	7.698000	0.84413	2.330000	0.79161	0.528000	0.53228	AAT	.	.		0.418	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259	
ABCA4	24	hgsc.bcm.edu	37	1	94548999	94548999	+	Splice_Site	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:94548999T>A	ENST00000370225.3	-	7	855		c.e7-2		ABCA4_ENST00000535735.1_Splice_Site	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4						phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGTGGGAAGCTGTAATTGACA	0.383																																					.		Atlas-SNP	.											.	ABCA4	275	.	0			c.769-2A>T						.						139.0	153.0	149.0					1																	94548999		2203	4300	6503	SO:0001630	splice_region_variant	24	exon8			GGAAGCTGTAATT	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.769-2A>T	chr1.hg19:g.94548999T>A		35.0	0.0		55.0	6.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Splice_Site	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925846	0.73213	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0668	0.80887	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA4	94321587	1.000000	0.71417	0.999000	0.59377	0.794000	0.44872	6.891000	0.75639	2.246000	0.74042	0.533000	0.62120	.	.	.		0.383	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	Intron
PLPPR5	163404	hgsc.bcm.edu	37	1	99418684	99418684	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:99418684C>A	ENST00000263177.4	-	3	784	c.563G>T	c.(562-564)cGa>cTa	p.R188L	LPPR5_ENST00000370188.3_Missense_Mutation_p.R188L	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		188						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										AAAGGTTTTTCGGGCTCTCAT	0.418																																					p.R188L		Atlas-SNP	.											.	.	.	.	0			c.G563T						.						126.0	113.0	117.0					1																	99418684		2203	4300	6503	SO:0001583	missense	0	exon3			GTTTTTCGGGCTC																												ENST00000263177.4:c.563G>T	chr1.hg19:g.99418684C>A	ENSP00000263177:p.Arg188Leu	90.0	0.0		90.0	40.0	NM_001010861	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	ENST00000263177.4	hg19	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975196	0.74360	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.75477	-0.94;-0.94	5.16	5.16	0.70880	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85261	0.5656	M	0.79693	2.465	0.53688	D	0.999972	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.87028	0.2133	10	0.87932	D	0	.	17.9943	0.89178	0.0:1.0:0.0:0.0	.	188;188	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	L	188	ENSP00000359207:R188L;ENSP00000263177:R188L	ENSP00000263177:R188L	R	-	2	0	AL161744.1	99191272	1.000000	0.71417	0.721000	0.30653	0.314000	0.28054	7.445000	0.80570	2.563000	0.86464	0.655000	0.94253	CGA	.	.		0.418	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
OLFM3	118427	hgsc.bcm.edu	37	1	102270187	102270187	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:102270187G>T	ENST00000338858.5	-	6	1043	c.1044C>A	c.(1042-1044)gaC>gaA	p.D348E	OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.D328E			Q96PB7	NOE3_HUMAN	olfactomedin 3	348	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CAGCCATTAGGTCGATGTCAG	0.473																																					p.D328E		Atlas-SNP	.											.	OLFM3	178	.	0			c.C984A						.						88.0	75.0	80.0					1																	102270187		2203	4300	6503	SO:0001583	missense	118427	exon6			CATTAGGTCGATG	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1044C>A	chr1.hg19:g.102270187G>T	ENSP00000345192:p.Asp348Glu	133.0	0.0		178.0	89.0	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.64|16.64	3.180330|3.180330	0.57800|0.57800	.|.	.|.	ENSG00000118733|ENSG00000118733	ENST00000370103;ENST00000338858|ENST00000424771	D;D|.	0.94000|.	-3.33;-3.33|.	5.77|5.77	2.56|2.56	0.30785|0.30785	Olfactomedin-like (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67439|0.67439	0.2893|0.2893	M|M	0.86953|0.86953	2.85|2.85	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.992|.	D;D|.	0.97110|.	1.0;0.987|.	T|T	0.71781|0.71781	-0.4489|-0.4489	10|6	0.87932|0.87932	D|D	0|0	.|.	8.7937|8.7937	0.34866|0.34866	0.3525:0.0:0.6475:0.0|0.3525:0.0:0.6475:0.0	.|.	328;348|.	Q5T3V6;Q96PB7|.	.;NOE3_HUMAN|.	E|N	328;348|199	ENSP00000359121:D328E;ENSP00000345192:D348E|.	ENSP00000345192:D348E|ENSP00000407686:T199N	D|T	-|-	3|2	2|0	OLFM3|OLFM3	102042775|102042775	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	2.438000|2.438000	0.44837|0.44837	0.799000|0.799000	0.34018|0.34018	0.650000|0.650000	0.86243|0.86243	GAC|ACC	.	.		0.473	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
NOTCH2	4853	hgsc.bcm.edu	37	1	120462971	120462971	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:120462971C>T	ENST00000256646.2	-	30	5579	c.5360G>A	c.(5359-5361)cGg>cAg	p.R1787Q	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1787					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTCCATGGCCGTCGATCAAT	0.532			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.R1787Q		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.G5360A						.						177.0	137.0	151.0					1																	120462971		2203	4300	6503	SO:0001583	missense	4853	exon30	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CATGGCCGTCGAT	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5360G>A	chr1.hg19:g.120462971C>T	ENSP00000256646:p.Arg1787Gln	130.0	0.0		114.0	7.0	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	hg19	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	36	5.739306	0.96873	.	.	ENSG00000134250	ENST00000256646	D	0.85702	-2.02	5.82	5.82	0.92795	.	0.000000	0.36815	U	0.002381	D	0.90497	0.7023	M	0.62088	1.915	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90405	0.4405	10	0.66056	D	0.02	.	19.0775	0.93168	0.0:1.0:0.0:0.0	.	1787	Q04721	NOTC2_HUMAN	Q	1787	ENSP00000256646:R1787Q	ENSP00000256646:R1787Q	R	-	2	0	NOTCH2	120264494	1.000000	0.71417	0.967000	0.41034	0.867000	0.49689	7.755000	0.85180	2.761000	0.94854	0.655000	0.94253	CGG	.	.		0.532	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
GJA5	2702	hgsc.bcm.edu	37	1	147230478	147230478	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:147230478T>C	ENST00000271348.2	-	2	1030	c.869A>G	c.(868-870)cAa>cGa	p.Q290R	GJA5_ENST00000369237.1_Missense_Mutation_p.Q290R|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	290					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			TGTGTTTTGTTGGGAGGCCAT	0.527																																					p.Q290R		Atlas-SNP	.											.	GJA5	64	.	0			c.A869G						.						152.0	148.0	150.0					1																	147230478		2203	4300	6503	SO:0001583	missense	2702	exon2			TTTTGTTGGGAGG		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.869A>G	chr1.hg19:g.147230478T>C	ENSP00000271348:p.Gln290Arg	110.0	0.0		192.0	27.0	NM_005266	Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	hg19	CCDS929.1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.299225	0.23650	.	.	ENSG00000143140	ENST00000271348;ENST00000369237	D;D	0.81739	-1.53;-1.53	5.07	0.79	0.18613	.	0.559513	0.18427	N	0.141554	T	0.45175	0.1329	N	0.16903	0.455	0.41508	D	0.988324	B	0.13145	0.007	B	0.09377	0.004	T	0.33189	-0.9878	10	0.46703	T	0.11	.	6.0386	0.19722	0.0:0.2054:0.1364:0.6582	.	290	P36382	CXA5_HUMAN	R	290	ENSP00000271348:Q290R;ENSP00000358240:Q290R	ENSP00000271348:Q290R	Q	-	2	0	GJA5	145697102	1.000000	0.71417	0.991000	0.47740	0.536000	0.34869	4.770000	0.62309	0.243000	0.21327	0.460000	0.39030	CAA	.	.		0.527	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703	
VPS45	11311	hgsc.bcm.edu	37	1	150054960	150054960	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:150054960C>T	ENST00000369130.3	+	10	1643	c.1097C>T	c.(1096-1098)gCt>gTt	p.A366V	VPS45_ENST00000535106.1_Missense_Mutation_p.A297V|VPS45_ENST00000369128.5_Missense_Mutation_p.A261V	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	366					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATTCTAGTGCTCTCCAGGTC	0.463																																					p.A366V		Atlas-SNP	.											.	VPS45	47	.	0			c.C1097T						.						78.0	76.0	77.0					1																	150054960		2203	4300	6503	SO:0001583	missense	11311	exon10			CTAGTGCTCTCCA	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.1097C>T	chr1.hg19:g.150054960C>T	ENSP00000358126:p.Ala366Val	115.0	0.0		178.0	121.0	NM_007259	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Missense_Mutation	SNP	ENST00000369130.3	hg19	CCDS944.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893249	0.72524	.	.	ENSG00000136631	ENST00000369130;ENST00000369128;ENST00000543996;ENST00000535106;ENST00000419023	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	L	0.45470	1.425	0.80722	D	1	B;B;B;B	0.28971	0.229;0.041;0.08;0.089	B;B;B;B	0.32090	0.112;0.091;0.063;0.14	T	0.62770	-0.6784	10	0.05525	T	0.97	.	19.2671	0.93993	0.0:1.0:0.0:0.0	.	261;366;186;366	F5H8K1;Q53FR8;A0AR27;Q9NRW7	.;.;.;VPS45_HUMAN	V	366;261;241;297;297	ENSP00000358126:A366V;ENSP00000358124:A261V;ENSP00000440690:A297V;ENSP00000400143:A297V	ENSP00000358124:A261V	A	+	2	0	VPS45	148321584	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.622000	0.83099	2.788000	0.95919	0.650000	0.86243	GCT	.	.		0.463	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034964.1	NM_007259	
DENND4B	9909	hgsc.bcm.edu	37	1	153907303	153907303	+	Silent	SNP	C	C	T	rs557071025	byFrequency	TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:153907303C>T	ENST00000361217.4	-	18	3124	c.2706G>A	c.(2704-2706)caG>caA	p.Q902Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	902	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgttgctgct	0.642																																					p.Q902Q		Atlas-SNP	.											DENND4B_ENST00000361217,bladder,carcinoma,0,2	DENND4B	210	.	0			c.G2706A						.						30.0	39.0	36.0					1																	153907303		2184	4281	6465	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGTTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2706G>A	chr1.hg19:g.153907303C>T		40.0	0.0		69.0	5.0	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	hg19	CCDS44228.1																																																																																			.	.		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
CRTC2	200186	hgsc.bcm.edu	37	1	153924016	153924016	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:153924016G>T	ENST00000368633.1	-	11	1251	c.1124C>A	c.(1123-1125)tCc>tAc	p.S375Y	CRTC2_ENST00000476883.1_5'Flank|CRTC2_ENST00000368630.3_Missense_Mutation_p.S55Y	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	375	Ser-rich.				gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.S375F(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCCAAGGAGGAGGCAGGCAG	0.642																																					p.S375Y		Atlas-SNP	.											CRTC2,extremity,malignant_melanoma,0,1	CRTC2	58	.	1	Substitution - Missense(1)	skin(1)	c.C1124A						.						54.0	59.0	58.0					1																	153924016		2202	4300	6502	SO:0001583	missense	200186	exon11			AAGGAGGAGGCAG	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1124C>A	chr1.hg19:g.153924016G>T	ENSP00000357622:p.Ser375Tyr	27.0	0.0		55.0	37.0	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	hg19	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.454705	0.63290	.	.	ENSG00000160741	ENST00000368630;ENST00000368633	T;T	0.48201	0.82;2.59	4.63	4.63	0.57726	.	0.538685	0.19321	N	0.117131	T	0.55226	0.1907	L	0.57536	1.79	0.41428	D	0.987841	D	0.69078	0.997	D	0.65573	0.936	T	0.56577	-0.7956	10	0.52906	T	0.07	-14.715	15.0183	0.71605	0.0:0.0:1.0:0.0	.	375	Q53ET0	CRTC2_HUMAN	Y	55;375	ENSP00000357619:S55Y;ENSP00000357622:S375Y	ENSP00000357619:S55Y	S	-	2	0	CRTC2	152190640	1.000000	0.71417	0.998000	0.56505	0.722000	0.41435	5.617000	0.67716	2.396000	0.81511	0.557000	0.71058	TCC	.	.		0.642	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
UBE2Q1	55585	hgsc.bcm.edu	37	1	154527989	154527989	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:154527989C>T	ENST00000292211.4	-	3	531	c.452G>A	c.(451-453)aGg>aAg	p.R151K	UBE2Q1-AS1_ENST00000441613.1_RNA|UBE2Q1_ENST00000497453.1_5'UTR	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	151					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGAGATGATCCTCTTCAGATG	0.512																																					p.R151K		Atlas-SNP	.											.	UBE2Q1	35	.	0			c.G452A						.						135.0	127.0	130.0					1																	154527989		2203	4300	6503	SO:0001583	missense	55585	exon3			ATGATCCTCTTCA	AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.452G>A	chr1.hg19:g.154527989C>T	ENSP00000292211:p.Arg151Lys	70.0	0.0		99.0	21.0	NM_017582	B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Missense_Mutation	SNP	ENST00000292211.4	hg19	CCDS1069.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.526163	0.44969	.	.	ENSG00000160714	ENST00000292211	T	0.42513	0.97	4.52	3.6	0.41247	.	0.060403	0.64402	D	0.000003	T	0.15435	0.0372	L	0.32530	0.975	0.33822	D	0.629146	B	0.14438	0.01	B	0.10450	0.005	T	0.06391	-1.0829	10	0.29301	T	0.29	-16.7599	11.8151	0.52204	0.0:0.913:0.0:0.087	.	151	Q7Z7E8	UB2Q1_HUMAN	K	151	ENSP00000292211:R151K	ENSP00000292211:R151K	R	-	2	0	UBE2Q1	152794613	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.407000	0.59754	1.265000	0.44215	0.455000	0.32223	AGG	.	.		0.512	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090704.1	NM_017582	
DCST1	149095	hgsc.bcm.edu	37	1	155023119	155023119	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:155023119C>A	ENST00000295542.1	+	17	1992	c.1896C>A	c.(1894-1896)caC>caA	p.H632Q	ADAM15_ENST00000447332.3_5'Flank|ADAM15_ENST00000355956.2_5'Flank|ADAM15_ENST00000368412.3_5'Flank|DCST1_ENST00000423025.2_Missense_Mutation_p.H607Q|ADAM15_ENST00000356955.2_5'Flank|ADAM15_ENST00000449910.2_5'Flank|ADAM15_ENST00000271836.6_5'Flank|ADAM15_ENST00000368410.2_5'Flank|ADAM15_ENST00000360674.4_5'Flank|ADAM15_ENST00000531455.1_5'Flank|ADAM15_ENST00000368413.1_5'Flank|ADAM15_ENST00000359280.4_5'Flank	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	632						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			ATATCCTGCACCGCGGCTGCC	0.711											OREG0013846	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H632Q		Atlas-SNP	.											.	DCST1	69	.	0			c.C1896A						.						7.0	9.0	8.0					1																	155023119		2062	4078	6140	SO:0001583	missense	149095	exon17			CCTGCACCGCGGC	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1896C>A	chr1.hg19:g.155023119C>A	ENSP00000295542:p.His632Gln	19.0	0.0	1767	27.0	10.0	NM_152494	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	ENST00000295542.1	hg19	CCDS1083.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457415	0.43634	.	.	ENSG00000163357	ENST00000295542;ENST00000423025	T;T	0.21734	1.99;2.0	5.02	1.98	0.26296	.	1.256760	0.06619	U	0.757118	T	0.05364	0.0142	L	0.29908	0.895	0.80722	D	1	B;B	0.20459	0.045;0.045	B;B	0.16722	0.016;0.016	T	0.34079	-0.9843	10	0.29301	T	0.29	-17.4989	4.6556	0.12615	0.0:0.5704:0.1606:0.269	.	607;632	E9PHV3;Q5T197	.;DCST1_HUMAN	Q	632;607	ENSP00000295542:H632Q;ENSP00000387369:H607Q	ENSP00000295542:H632Q	H	+	3	2	DCST1	153289743	0.995000	0.38212	0.998000	0.56505	0.609000	0.37215	0.326000	0.19646	0.122000	0.18314	0.655000	0.94253	CAC	.	.		0.711	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	NM_152494	
AIM2	9447	hgsc.bcm.edu	37	1	159043068	159043068	+	Silent	SNP	A	A	G	rs145394745		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:159043068A>G	ENST00000368130.4	-	2	510	c.222T>C	c.(220-222)taT>taC	p.Y74Y	AIM2_ENST00000411768.1_5'UTR	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	74	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					CCAAAAGCATATAATTCAACT	0.453																																					p.Y74Y		Atlas-SNP	.											.	AIM2	70	.	0			c.T222C						.	A		0,4406		0,0,2203	83.0	85.0	84.0		222	-3.9	0.0	1	dbSNP_134	84	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AIM2	NM_004833.1		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		74/344	159043068	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9447	exon2			AAGCATATAATTC	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.222T>C	chr1.hg19:g.159043068A>G		168.0	0.0		228.0	82.0	NM_004833	A8K7M7|Q5T3V9|Q96FG9	Silent	SNP	ENST00000368130.4	hg19	CCDS1181.1																																																																																			.	A|1.000;G|0.000		0.453	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833	
NCSTN	23385	hgsc.bcm.edu	37	1	160323960	160323960	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:160323960T>G	ENST00000294785.5	+	11	1357	c.1232T>G	c.(1231-1233)gTc>gGc	p.V411G	NCSTN_ENST00000535857.1_Missense_Mutation_p.V273G|NCSTN_ENST00000368063.1_Missense_Mutation_p.V391G|NCSTN_ENST00000368065.4_Missense_Mutation_p.V153G|NCSTN_ENST00000392212.4_Missense_Mutation_p.V391G|NCSTN_ENST00000459963.1_3'UTR	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	411					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTCCCTGCTGTCATCCTCAGG	0.577																																					p.V411G		Atlas-SNP	.											.	NCSTN	64	.	0			c.T1232G						.						155.0	122.0	133.0					1																	160323960		2203	4300	6503	SO:0001583	missense	23385	exon11			CTGCTGTCATCCT	AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.1232T>G	chr1.hg19:g.160323960T>G	ENSP00000294785:p.Val411Gly	131.0	0.0		145.0	39.0	NM_015331	Q5T207|Q5T208|Q86VV5	Missense_Mutation	SNP	ENST00000294785.5	hg19	CCDS1203.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.244750|4.244750	0.79912|0.79912	.|.	.|.	ENSG00000162736|ENSG00000162736	ENST00000424645;ENST00000435149|ENST00000294785;ENST00000368063;ENST00000535857;ENST00000368067;ENST00000392212;ENST00000368065;ENST00000424754	.|T;T;T;T;T;T	.|0.71579	.|-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.122362	.|0.56097	.|D	.|0.000035	T|T	0.74465|0.74465	0.3720|0.3720	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.998;0.998	.|D;D;D	.|0.69824	.|0.933;0.929;0.966	T|T	0.72616|0.72616	-0.4239|-0.4239	5|10	.|0.20519	.|T	.|0.43	-21.6824|-21.6824	14.0769|14.0769	0.64895|0.64895	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|273;391;411	.|F6Y097;Q92542-2;Q92542	.|.;.;NICA_HUMAN	A|G	247;88|411;391;273;118;391;153;155	.|ENSP00000294785:V411G;ENSP00000357042:V391G;ENSP00000442605:V273G;ENSP00000376047:V391G;ENSP00000357044:V153G;ENSP00000410124:V155G	.|ENSP00000294785:V411G	S|V	+|+	1|2	0|0	NCSTN|NCSTN	158590584|158590584	0.982000|0.982000	0.34865|0.34865	0.045000|0.045000	0.18777|0.18777	0.996000|0.996000	0.88848|0.88848	4.813000|4.813000	0.62620|0.62620	2.022000|2.022000	0.59522|0.59522	0.533000|0.533000	0.62120|0.62120	TCA|GTC	.	.		0.577	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080622.1	NM_015331	
ATF6	22926	hgsc.bcm.edu	37	1	161832997	161832997	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:161832997A>T	ENST00000367942.3	+	14	1681	c.1614A>T	c.(1612-1614)tcA>tcT	p.S538S		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	538	Interaction with THBS4.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	GCAGGAACTCAGGGAGTGAGC	0.358																																					p.S538S		Atlas-SNP	.											.	ATF6	84	.	0			c.A1614T						.						103.0	100.0	101.0					1																	161832997		2203	4300	6503	SO:0001819	synonymous_variant	22926	exon14			GAACTCAGGGAGT	AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1614A>T	chr1.hg19:g.161832997A>T		172.0	0.0		225.0	65.0	NM_007348	O15139|Q5VW62|Q6IPB5|Q9UEC9	Silent	SNP	ENST00000367942.3	hg19	CCDS1235.1																																																																																			.	.		0.358	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	
ASTN1	460	hgsc.bcm.edu	37	1	176915125	176915125	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:176915125A>G	ENST00000367654.3	-	13	2421	c.2210T>C	c.(2209-2211)tTc>tCc	p.F737S	ASTN1_ENST00000367657.3_Missense_Mutation_p.F729S|ASTN1_ENST00000361833.2_Missense_Mutation_p.F729S|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.F729S	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	737					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GTAACCAAAGAACATCTCCCC	0.498																																					p.F729S		Atlas-SNP	.											.	ASTN1	314	.	0			c.T2186C						.						122.0	122.0	122.0					1																	176915125		2203	4300	6503	SO:0001583	missense	460	exon13			CCAAAGAACATCT	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2210T>C	chr1.hg19:g.176915125A>G	ENSP00000356626:p.Phe737Ser	116.0	0.0		144.0	39.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	hg19		.	.	.	.	.	.	.	.	.	.	A	24.9	4.579551	0.86645	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.15718	2.4;2.82;2.82;2.41	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	N	0.19112	0.55	0.80722	D	1	D;D;D	0.69078	0.997;0.981;0.981	D;D;D	0.78314	0.991;0.972;0.972	T	0.08868	-1.0701	10	0.72032	D	0.01	-33.8887	14.8389	0.70209	1.0:0.0:0.0:0.0	.	737;729;729	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	S	729;729;737;729;729	ENSP00000356629:F729S;ENSP00000354536:F729S;ENSP00000356626:F737S;ENSP00000395041:F729S	ENSP00000354536:F729S	F	-	2	0	ASTN1	175181748	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.647000	0.91057	1.997000	0.58415	0.533000	0.62120	TTC	.	.		0.498	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
RGS16	6004	hgsc.bcm.edu	37	1	182569551	182569551	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:182569551A>T	ENST00000367558.5	-	5	633	c.485T>A	c.(484-486)cTg>cAg	p.L162Q		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	162	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						CTTCTCCATCAGGGTACGTGT	0.602																																					p.L162Q		Atlas-SNP	.											.	RGS16	25	.	0			c.T485A						.						163.0	130.0	141.0					1																	182569551		2203	4300	6503	SO:0001583	missense	6004	exon5			TCCATCAGGGTAC	U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.485T>A	chr1.hg19:g.182569551A>T	ENSP00000356529:p.Leu162Gln	75.0	0.0		73.0	21.0	NM_002928	B2R4M4|Q5VYN9|Q99701	Missense_Mutation	SNP	ENST00000367558.5	hg19	CCDS1348.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.542476	0.85917	.	.	ENSG00000143333	ENST00000367558	T	0.38722	1.12	5.38	5.38	0.77491	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76870	0.4048	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85663	0.1290	10	0.87932	D	0	.	15.0472	0.71835	1.0:0.0:0.0:0.0	.	162	O15492	RGS16_HUMAN	Q	162	ENSP00000356529:L162Q	ENSP00000356529:L162Q	L	-	2	0	RGS16	180836174	1.000000	0.71417	0.893000	0.35052	0.663000	0.39108	9.004000	0.93583	2.042000	0.60477	0.454000	0.30748	CTG	.	.		0.602	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	NM_002928	
KCNK2	3776	hgsc.bcm.edu	37	1	215345508	215345508	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:215345508T>A	ENST00000444842.2	+	5	955	c.805T>A	c.(805-807)Ttt>Att	p.F269I	KCNK2_ENST00000391895.2_Missense_Mutation_p.F265I|KCNK2_ENST00000391894.2_Missense_Mutation_p.F254I	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	269					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	AACTATTGGATTTGGTGACTA	0.408																																					p.F269I		Atlas-SNP	.											.	KCNK2	135	.	0			c.T805A						.						152.0	127.0	136.0					1																	215345508		2203	4300	6503	SO:0001583	missense	3776	exon5			ATTGGATTTGGTG	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.805T>A	chr1.hg19:g.215345508T>A	ENSP00000394033:p.Phe269Ile	107.0	0.0		158.0	22.0	NM_001017425	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	hg19	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.743789	0.89663	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.29655	1.56;1.56;1.56	5.5	5.5	0.81552	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.57184	0.2036	M	0.82132	2.575	0.80722	D	1	D;D;P	0.63880	0.957;0.993;0.46	P;D;B	0.67382	0.781;0.951;0.327	T	0.61987	-0.6949	10	0.56958	D	0.05	.	15.6222	0.76816	0.0:0.0:0.0:1.0	.	254;269;265	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	I	265;254;269	ENSP00000375765:F265I;ENSP00000375764:F254I;ENSP00000394033:F269I	ENSP00000375764:F254I	F	+	1	0	KCNK2	213412131	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.040000	0.89188	2.087000	0.62958	0.460000	0.39030	TTT	.	.		0.408	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
C1orf35	79169	hgsc.bcm.edu	37	1	228290668	228290668	+	Silent	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:228290668C>A	ENST00000272139.4	-	2	411	c.177G>T	c.(175-177)gcG>gcT	p.A59A	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	59							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				GGCTCGGGCCCGCGCATGGCG	0.751																																					p.A59A		Atlas-SNP	.											.	C1orf35	17	.	0			c.G177T						.						2.0	3.0	2.0					1																	228290668		1419	3164	4583	SO:0001819	synonymous_variant	79169	exon2			CGGGCCCGCGCAT	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.177G>T	chr1.hg19:g.228290668C>A		14.0	0.0		27.0	18.0	NM_024319	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Silent	SNP	ENST00000272139.4	hg19	CCDS1566.1																																																																																			.	.		0.751	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319	
DISC1	27185	hgsc.bcm.edu	37	1	232144628	232144628	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:232144628C>A	ENST00000439617.2	+	11	2193	c.2140C>A	c.(2140-2142)Ctg>Atg	p.L714M	DISC1_ENST00000537876.1_3'UTR|DISC1_ENST00000366637.3_Missense_Mutation_p.L46M|DISC1_ENST00000427560.1_3'UTR|DISC1_ENST00000535983.1_Silent_p.A693A	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	714	Interaction with ATF4 and ATF5.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				CAGGGGAAGCCTGTCTGTAGA	0.537																																					p.L746M		Atlas-SNP	.											.	DISC1	207	.	0			c.C2236A						.						63.0	65.0	64.0					1																	232144628		1963	4150	6113	SO:0001583	missense	27185	exon12			GGAAGCCTGTCTG	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.2140C>A	chr1.hg19:g.232144628C>A	ENSP00000403888:p.Leu714Met	102.0	0.0		145.0	22.0	NM_001164537	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000439617.2	hg19		.	.	.	.	.	.	.	.	.	.	C	17.73	3.461168	0.63513	.	.	ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000366638;ENST00000532576;ENST00000427560	T	0.09163	3.01	4.5	1.23	0.21249	.	0.821609	0.10223	N	0.700707	T	0.21718	0.0523	.	.	.	0.09310	N	1	D;D;D;D;D;D;D	0.71674	0.994;0.997;0.998;0.994;0.994;0.994;0.994	P;D;P;P;P;P;P	0.65010	0.864;0.931;0.904;0.864;0.878;0.878;0.878	T	0.12400	-1.0549	9	0.46703	T	0.11	-0.3675	4.5187	0.11949	0.0:0.5046:0.2565:0.239	.	746;592;746;714;592;714;714	C4P096;C4P094;E2QRA4;C4P098;F5H1F1;Q9NRI5-2;Q9NRI5	.;.;.;.;.;.;DISC1_HUMAN	M	714;714;746;592;46	ENSP00000403888:L714M	ENSP00000355597:L714M	L	+	1	2	DISC1	230211251	0.003000	0.15002	0.004000	0.12327	0.683000	0.39861	0.433000	0.21477	0.456000	0.26937	0.650000	0.86243	CTG	.	.		0.537	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000092351.2	NM_018662	
MTR	4548	hgsc.bcm.edu	37	1	237025590	237025590	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:237025590A>T	ENST00000366577.5	+	21	2645	c.2251A>T	c.(2251-2253)Atg>Ttg	p.M751L	MTR_ENST00000535889.1_Missense_Mutation_p.M700L	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	751	B12-binding N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00666}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TATCCCTTTCATGGAAAAAGA	0.448																																					p.M751L		Atlas-SNP	.											.	MTR	127	.	0			c.A2251T						.						156.0	158.0	158.0					1																	237025590		2203	4300	6503	SO:0001583	missense	4548	exon21			CCTTTCATGGAAA	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2251A>T	chr1.hg19:g.237025590A>T	ENSP00000355536:p.Met751Leu	87.0	0.0		98.0	25.0	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	hg19	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.492167	0.64074	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	T;T;D	0.81996	-0.21;-0.35;-1.56	5.23	5.23	0.72850	Methionine synthase, cobalamin (vitamin B12)-binding module, cap (4);	0.000000	0.85682	D	0.000000	T	0.77068	0.4076	L	0.35341	1.055	0.48696	D	0.999692	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.24006	0.05;0.05;0.05	T	0.74019	-0.3799	10	0.51188	T	0.08	-30.9363	15.2972	0.73919	1.0:0.0:0.0:0.0	.	751;700;751	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	L	605;751;700;305	ENSP00000355536:M751L;ENSP00000441845:M700L;ENSP00000355535:M305L	ENSP00000355535:M305L	M	+	1	0	MTR	235092213	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.722000	0.91452	2.195000	0.70347	0.528000	0.53228	ATG	.	.		0.448	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
KIF26B	55083	hgsc.bcm.edu	37	1	245851297	245851297	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:245851297G>T	ENST00000407071.2	+	12	5452	c.5012G>T	c.(5011-5013)aGg>aTg	p.R1671M	KIF26B_ENST00000366518.4_Missense_Mutation_p.R1290M	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1671	Ser-rich.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCGCTGGGCAGGGCGACAGTC	0.667																																					p.R1671M		Atlas-SNP	.											.	KIF26B	343	.	0			c.G5012T						.						6.0	9.0	8.0					1																	245851297		1994	4075	6069	SO:0001583	missense	55083	exon12			TGGGCAGGGCGAC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5012G>T	chr1.hg19:g.245851297G>T	ENSP00000385545:p.Arg1671Met	64.0	0.0		73.0	38.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184440	0.38609	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.80033	-1.33;-1.33	5.28	5.28	0.74379	.	.	.	.	.	D	0.89466	0.6723	M	0.75447	2.3	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.90593	0.4538	9	0.87932	D	0	.	17.0795	0.86594	0.0:0.0:1.0:0.0	.	1290;1671	B7WPD9;Q2KJY2	.;KI26B_HUMAN	M	1671;1290;1287	ENSP00000385545:R1671M;ENSP00000355475:R1290M	ENSP00000355475:R1290M	R	+	2	0	KIF26B	243917920	1.000000	0.71417	0.853000	0.33588	0.135000	0.20990	7.833000	0.86765	2.478000	0.83669	0.561000	0.74099	AGG	.	.		0.667	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
AHCTF1	25909	hgsc.bcm.edu	37	1	247013752	247013752	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:247013752T>A	ENST00000391829.2	-	33	5679	c.5556A>T	c.(5554-5556)ccA>ccT	p.P1852P	AHCTF1_ENST00000366508.1_Silent_p.P1887P|AHCTF1_ENST00000326225.3_Silent_p.P1861P|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1852	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTTCAACTGCTGGTTCCAACA	0.348																																					p.P1861P	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.A5583T						.						16.0	17.0	17.0					1																	247013752		2088	4227	6315	SO:0001819	synonymous_variant	25909	exon33			AACTGCTGGTTCC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.5556A>T	chr1.hg19:g.247013752T>A		214.0	0.0		317.0	175.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	ENST00000391829.2	hg19																																																																																				.	.		0.348	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2L3	391192	hgsc.bcm.edu	37	1	248224411	248224411	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr1:248224411T>C	ENST00000359959.3	+	1	428	c.428T>C	c.(427-429)aTg>aCg	p.M143T	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TGTGTGCTGATGATAACAGGG	0.428																																					p.M143T		Atlas-SNP	.											.	OR2L3	97	.	0			c.T428C						.						230.0	245.0	240.0					1																	248224411		2203	4300	6503	SO:0001583	missense	391192	exon1			TGCTGATGATAAC	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.428T>C	chr1.hg19:g.248224411T>C	ENSP00000353044:p.Met143Thr	67.0	0.0		117.0	29.0	NM_001004687	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	hg19	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	8.564	0.878541	0.17395	.	.	ENSG00000198128	ENST00000359959	T	0.38240	1.15	1.91	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	U	0.001749	T	0.48484	0.1502	M	0.79693	2.465	0.09310	N	1	P	0.38148	0.62	P	0.50378	0.639	T	0.41251	-0.9519	10	0.72032	D	0.01	.	6.0993	0.20039	0.0:0.1477:0.0:0.8523	.	143	Q8NG85	OR2L3_HUMAN	T	143	ENSP00000353044:M143T	ENSP00000353044:M143T	M	+	2	0	OR2L3	246291034	0.061000	0.20836	0.857000	0.33713	0.130000	0.20726	2.938000	0.48987	0.853000	0.35312	0.379000	0.24179	ATG	.	.		0.428	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
SNTG2	54221	hgsc.bcm.edu	37	2	1094065	1094065	+	Silent	SNP	C	C	T	rs369324271		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:1094065C>T	ENST00000308624.5	+	4	423	c.294C>T	c.(292-294)gtC>gtT	p.V98V	SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	98	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		ACGTCCCTGTCGTCATATCAA	0.383																																					p.V98V		Atlas-SNP	.											.	SNTG2	125	.	0			c.C294T						.	C		0,3768		0,0,1884	117.0	111.0	113.0		294	1.6	1.0	2		113	2,8210		0,2,4104	no	coding-synonymous	SNTG2	NM_018968.3		0,2,5988	TT,TC,CC		0.0244,0.0,0.0167		98/540	1094065	2,11978	1884	4106	5990	SO:0001819	synonymous_variant	54221	exon4			CCCTGTCGTCATA	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.294C>T	chr2.hg19:g.1094065C>T		180.0	0.0		156.0	36.0	NM_018968	Q05AH5	Silent	SNP	ENST00000308624.5	hg19	CCDS46220.1																																																																																			.	.		0.383	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
MYT1L	23040	hgsc.bcm.edu	37	2	1926446	1926446	+	Silent	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:1926446C>T	ENST00000399161.2	-	10	1842	c.1095G>A	c.(1093-1095)gaG>gaA	p.E365E	MYT1L_ENST00000428368.2_Silent_p.E365E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	365					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CGGGGAAGTCCTCTTCTGGCC	0.592																																					p.E365E		Atlas-SNP	.											.	MYT1L	241	.	0			c.G1095A						.						38.0	41.0	40.0					2																	1926446		2080	4214	6294	SO:0001819	synonymous_variant	23040	exon10			GAAGTCCTCTTCT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1095G>A	chr2.hg19:g.1926446C>T		96.0	0.0		69.0	17.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	hg19																																																																																				.	.		0.592	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
SMC6	79677	hgsc.bcm.edu	37	2	17896176	17896176	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:17896176G>A	ENST00000448223.2	-	16	1951	c.1682C>T	c.(1681-1683)cCg>cTg	p.P561L	SMC6_ENST00000351948.4_Missense_Mutation_p.P561L|SMC6_ENST00000402989.1_Missense_Mutation_p.P561L|SMC6_ENST00000381272.4_Missense_Mutation_p.P587L	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	561	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AACTATTATCGGTGGCCGTGA	0.408																																					p.P561L		Atlas-SNP	.											.	SMC6	102	.	0			c.C1682T						.						109.0	106.0	107.0					2																	17896176		2203	4300	6503	SO:0001583	missense	79677	exon16			ATTATCGGTGGCC	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1682C>T	chr2.hg19:g.17896176G>A	ENSP00000404092:p.Pro561Leu	100.0	0.0		106.0	9.0	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	ENST00000448223.2	hg19	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688544	0.48097	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.33438	2.62;2.62;2.13;2.62;1.41	6.16	5.01	0.66863	RecF/RecN/SMC (1);	0.490255	0.24776	N	0.035700	T	0.15609	0.0376	N	0.08118	0	0.33300	D	0.564735	B;B;B	0.19817	0.039;0.005;0.014	B;B;B	0.20955	0.013;0.002;0.032	T	0.15665	-1.0429	10	0.08179	T	0.78	.	13.4742	0.61299	0.0:0.0:0.2466:0.7534	.	587;587;561	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	L	561;561;587;561;587	ENSP00000404092:P561L;ENSP00000323439:P561L;ENSP00000370672:P587L;ENSP00000384539:P561L;ENSP00000408644:P587L	ENSP00000323439:P561L	P	-	2	0	SMC6	17759657	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.559000	0.45888	1.152000	0.42452	-0.265000	0.10407	CCG	.	.		0.408	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
SLC30A3	7781	hgsc.bcm.edu	37	2	27480785	27480785	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:27480785C>A	ENST00000233535.4	-	4	918	c.566G>T	c.(565-567)tGt>tTt	p.C189F	SLC30A3_ENST00000447008.2_Missense_Mutation_p.C184F	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	189					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGTTGGCACAGACTGCGAT	0.642																																					p.C189F		Atlas-SNP	.											.	SLC30A3	39	.	0			c.G566T						.						47.0	46.0	46.0					2																	27480785		2203	4300	6503	SO:0001583	missense	7781	exon4			TTGGCACAGACTG	U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.566G>T	chr2.hg19:g.27480785C>A	ENSP00000233535:p.Cys189Phe	137.0	0.0		127.0	33.0	NM_003459	Q8TC03	Missense_Mutation	SNP	ENST00000233535.4	hg19	CCDS1743.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107511	0.37145	.	.	ENSG00000115194	ENST00000233535;ENST00000447008;ENST00000432351;ENST00000426924;ENST00000424577	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	5.34	5.34	0.76211	.	0.226724	0.45606	D	0.000359	T	0.43100	0.1232	N	0.04132	-0.27	0.38463	D	0.947264	B;B	0.15141	0.003;0.012	B;B	0.20577	0.018;0.03	T	0.39121	-0.9629	10	0.37606	T	0.19	-10.1632	16.9199	0.86161	0.0:1.0:0.0:0.0	.	184;189	F5H3B7;Q99726	.;ZNT3_HUMAN	F	189;184;140;176;167	ENSP00000233535:C189F;ENSP00000415226:C184F;ENSP00000414320:C140F;ENSP00000393545:C176F;ENSP00000403959:C167F	ENSP00000233535:C189F	C	-	2	0	SLC30A3	27334289	0.859000	0.29813	1.000000	0.80357	0.996000	0.88848	1.252000	0.32874	2.666000	0.90696	0.561000	0.74099	TGT	.	.		0.642	SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250189.2		
SPAST	6683	hgsc.bcm.edu	37	2	32341205	32341205	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:32341205T>A	ENST00000315285.3	+	7	1147	c.1022T>A	c.(1021-1023)tTt>tAt	p.F341Y	SPAST_ENST00000345662.1_Missense_Mutation_p.F309Y	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GCTGTTAAATTTGATGATATA	0.368																																					p.F341Y		Atlas-SNP	.											.	SPAST	61	.	0			c.T1022A						.						136.0	135.0	135.0					2																	32341205		2203	4300	6503	SO:0001583	missense	6683	exon7			TTAAATTTGATGA	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.1022T>A	chr2.hg19:g.32341205T>A	ENSP00000320885:p.Phe341Tyr	95.0	0.0		80.0	29.0	NM_014946		Missense_Mutation	SNP	ENST00000315285.3	hg19	CCDS1778.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.845844	0.91277	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	D;D	0.95307	-3.67;-3.67	5.58	5.58	0.84498	.	0.048853	0.85682	D	0.000000	D	0.94434	0.8209	L	0.33710	1.025	0.80722	D	1	D;P	0.59357	0.985;0.952	P;P	0.58172	0.834;0.761	D	0.95167	0.8286	10	0.72032	D	0.01	-44.0228	15.4125	0.74937	0.0:0.0:0.0:1.0	.	309;341	E5KRP6;Q9UBP0	.;SPAST_HUMAN	Y	309;341	ENSP00000340817:F309Y;ENSP00000320885:F341Y	ENSP00000320885:F341Y	F	+	2	0	SPAST	32194709	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.307000	0.72815	2.120000	0.65058	0.377000	0.23210	TTT	.	.		0.368	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436	
GTF2A1L	11036	hgsc.bcm.edu	37	2	48848041	48848041	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:48848041C>G	ENST00000403751.3	+	2	110	c.73C>G	c.(73-75)Cta>Gta	p.L25V	GTF2A1L_ENST00000430487.2_Intron|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.L729V|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.L729V|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.L729V|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.L729V|GTF2A1L_ENST00000468326.1_3'UTR|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.L729V	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	25					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AGTTCGGAATCTATTTGCTGA	0.299																																					p.L729V		Atlas-SNP	.											.	STON1-GTF2A1L	180	.	0			c.C2185G						.						60.0	60.0	60.0					2																	48848041		2203	4298	6501	SO:0001583	missense	286749	exon3			CGGAATCTATTTG	AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.73C>G	chr2.hg19:g.48848041C>G	ENSP00000384597:p.Leu25Val	85.0	0.0		52.0	22.0	NM_001198594	B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	hg19	CCDS46281.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754370	0.49362	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000437125;ENST00000403751	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	4.7	3.81	0.43845	Transcription factor IIA, alpha subunit, N-terminal (1);Transcription factor IIA, helical (1);	0.000000	0.64402	D	0.000005	T	0.58623	0.2135	L	0.58969	1.84	0.80722	D	1	B;D;D;D	0.76494	0.264;0.999;0.992;0.999	B;D;P;D	0.87578	0.03;0.998;0.883;0.997	T	0.61879	-0.6972	10	0.72032	D	0.01	.	12.2031	0.54337	0.0:0.9167:0.0:0.0833	.	729;729;25;729	A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;TF2AY_HUMAN;.	V	729;729;729;729;729;24;25;25	ENSP00000385499:L729V;ENSP00000385701:L729V;ENSP00000378236:L729V;ENSP00000311493:L729V;ENSP00000378234:L729V;ENSP00000396702:L25V;ENSP00000384597:L25V	ENSP00000384597:L25V	L	+	1	2	STON1-GTF2A1L;GTF2A1L	48701545	0.987000	0.35691	0.667000	0.29798	0.597000	0.36814	2.797000	0.47877	1.334000	0.45468	0.561000	0.74099	CTA	.	.		0.299	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872	
CNRIP1	25927	hgsc.bcm.edu	37	2	68544310	68544310	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:68544310T>A	ENST00000263655.3	-	2	914	c.309A>T	c.(307-309)caA>caT	p.Q103H	CNRIP1_ENST00000409559.3_Missense_Mutation_p.Q103H|CNRIP1_ENST00000409862.1_Missense_Mutation_p.Q103H|CNRIP1_ENST00000481714.1_5'UTR	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	103										kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						TCTGGATGGGTTGCCGTTCTC	0.478																																					p.Q103H		Atlas-SNP	.											.	CNRIP1	45	.	0			c.A309T						.						189.0	163.0	172.0					2																	68544310		2203	4300	6503	SO:0001583	missense	25927	exon2			GATGGGTTGCCGT	AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.309A>T	chr2.hg19:g.68544310T>A	ENSP00000263655:p.Gln103His	188.0	0.0		111.0	66.0	NM_001111101	B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	ENST00000263655.3	hg19	CCDS1886.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.006418	0.74932	.	.	ENSG00000119865	ENST00000409559;ENST00000263655;ENST00000409862	.	.	.	5.16	-1.52	0.08637	.	0.000000	0.85682	D	0.000000	T	0.67202	0.2868	L	0.55990	1.75	0.53005	D	0.999962	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.87578	0.998;0.958;0.997	T	0.67114	-0.5752	9	0.87932	D	0	-0.8663	12.7446	0.57273	0.0:0.6951:0.0:0.3049	.	103;103;103	B8ZZB8;Q96F85;Q96F85-2	.;CNRP1_HUMAN;.	H	103	.	ENSP00000263655:Q103H	Q	-	3	2	CNRIP1	68397814	0.999000	0.42202	0.992000	0.48379	0.998000	0.95712	0.466000	0.22019	-0.364000	0.08088	0.454000	0.30748	CAA	.	.		0.478	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251758.1	NM_015463	
ZC3H6	376940	hgsc.bcm.edu	37	2	113067546	113067546	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:113067546A>T	ENST00000409871.1	+	4	822	c.421A>T	c.(421-423)Agc>Tgc	p.S141C	ZC3H6_ENST00000343936.4_Missense_Mutation_p.S141C	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	141							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						TGATGAGTACAGCACCTACAG	0.368																																					p.S141C		Atlas-SNP	.											.	ZC3H6	93	.	0			c.A421T						.						63.0	57.0	59.0					2																	113067546		1867	4098	5965	SO:0001583	missense	376940	exon4			GAGTACAGCACCT	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.421A>T	chr2.hg19:g.113067546A>T	ENSP00000386764:p.Ser141Cys	278.0	0.0		252.0	83.0	NM_198581	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	hg19	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703558	0.88924	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.18338	2.22;2.22	5.86	5.86	0.93980	.	0.101889	0.64402	D	0.000005	T	0.43722	0.1260	M	0.75264	2.295	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	T	0.39742	-0.9599	10	0.87932	D	0	-16.894	15.4305	0.75092	1.0:0.0:0.0:0.0	.	141	P61129	ZC3H6_HUMAN	C	141;141;118	ENSP00000386764:S141C;ENSP00000340298:S141C	ENSP00000340298:S141C	S	+	1	0	ZC3H6	112784017	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	4.494000	0.60347	2.233000	0.73108	0.459000	0.35465	AGC	.	.		0.368	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
CSRNP3	80034	hgsc.bcm.edu	37	2	166535809	166535809	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:166535809T>A	ENST00000342316.4	+	5	1576	c.1304T>A	c.(1303-1305)cTg>cAg	p.L435Q	CSRNP3_ENST00000409420.1_Missense_Mutation_p.L467Q|CSRNP3_ENST00000314499.7_Missense_Mutation_p.L435Q	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	435					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						TCTTCAACTCTGTATTACCAA	0.423																																					p.L435Q		Atlas-SNP	.											.	CSRNP3	73	.	0			c.T1304A						.						117.0	121.0	120.0					2																	166535809		2203	4300	6503	SO:0001583	missense	80034	exon7			CAACTCTGTATTA	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.1304T>A	chr2.hg19:g.166535809T>A	ENSP00000344042:p.Leu435Gln	103.0	0.0		56.0	32.0	NM_001172173	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	hg19	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.569117	0.45798	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000342316;ENST00000409420	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.88	5.88	0.94601	.	0.217184	0.40908	D	0.000991	T	0.48519	0.1504	L	0.29908	0.895	0.39894	D	0.973807	P	0.46512	0.879	P	0.45377	0.478	T	0.52457	-0.8573	10	0.49607	T	0.09	-11.0577	16.3009	0.82811	0.0:0.0:0.0:1.0	.	435	Q8WYN3	CSRN3_HUMAN	Q	435;442;435;435;467	ENSP00000412081:L435Q;ENSP00000318258:L435Q;ENSP00000344042:L435Q;ENSP00000387195:L467Q	ENSP00000318258:L435Q	L	+	2	0	CSRNP3	166244055	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.574000	0.60900	2.246000	0.74042	0.533000	0.62120	CTG	.	.		0.423	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969	
SLC25A12	8604	hgsc.bcm.edu	37	2	172666177	172666177	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:172666177T>A	ENST00000422440.2	-	13	1281	c.1244A>T	c.(1243-1245)gAc>gTc	p.D415V	SLC25A12_ENST00000392592.4_Missense_Mutation_p.D308V	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	415					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GGTAAATTTGTCCCGAACAAA	0.398																																					p.D415V		Atlas-SNP	.											.	SLC25A12	59	.	0			c.A1244T						.						107.0	110.0	109.0					2																	172666177		2203	4300	6503	SO:0001583	missense	8604	exon13			AATTTGTCCCGAA	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1244A>T	chr2.hg19:g.172666177T>A	ENSP00000388658:p.Asp415Val	213.0	0.0		165.0	33.0	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	hg19	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	t	27.2	4.811540	0.90707	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;T	0.79454	-1.27;-1.27	5.47	5.47	0.80525	Mitochondrial carrier domain (2);	0.085034	0.85682	D	0.000000	D	0.83737	0.5319	L	0.43701	1.375	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.74674	0.984;0.984	D	0.84899	0.0841	10	0.56958	D	0.05	-17.6289	15.5355	0.75998	0.0:0.0:0.0:1.0	.	308;415	B3KR64;O75746	.;CMC1_HUMAN	V	415;308	ENSP00000388658:D415V;ENSP00000376371:D308V	ENSP00000376371:D308V	D	-	2	0	SLC25A12	172374423	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.838000	0.86804	2.065000	0.61736	0.528000	0.53228	GAC	.	.		0.398	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
TTN	7273	hgsc.bcm.edu	37	2	179407911	179407911	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:179407911A>T	ENST00000591111.1	-	297	92090	c.91866T>A	c.(91864-91866)acT>acA	p.T30622T	TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Silent_p.T29695T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Silent_p.T23390T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Silent_p.T32263T|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.T23323T|TTN_ENST00000460472.2_Silent_p.T23198T|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590040.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30622	Fibronectin type-III 123. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGAAGTAACAGTGTGCTCTA	0.458																																					p.T32263T		Atlas-SNP	.											.	TTN	18412	.	0			c.T96789A						.						231.0	221.0	225.0					2																	179407911		1927	4146	6073	SO:0001819	synonymous_variant	7273	exon347			AGTAACAGTGTGC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.91866T>A	chr2.hg19:g.179407911A>T		76.0	0.0		73.0	41.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179594820	179594820	+	Splice_Site	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:179594820C>T	ENST00000591111.1	-	60	17580	c.17356G>A	c.(17356-17358)Gaa>Aaa	p.E5786K	TTN_ENST00000342992.6_Splice_Site_p.E4859K|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Splice_Site_p.E6103K|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12587					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGACCAGACCTTTTACAAAG	0.502																																					p.E6103K		Atlas-SNP	.											.	TTN	18412	.	0			c.G18307A						.						51.0	47.0	48.0					2																	179594820		1910	4121	6031	SO:0001630	splice_region_variant	7273	exon62			CCAGACCTTTTAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17356+1G>A	chr2.hg19:g.179594820C>T		50.0	0.0		34.0	12.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.99	2.994324	0.54041	.	.	ENSG00000155657	ENST00000342992	T	0.46819	0.86	5.69	5.69	0.88448	Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62011	0.2393	L	0.41710	1.295	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.55270	-0.8167	8	.	.	.	.	20.181	0.98201	0.0:1.0:0.0:0.0	.	5786	Q8WZ42	TITIN_HUMAN	K	4859	ENSP00000343764:E4859K	.	E	-	1	0	TTN	179303065	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.776000	0.85560	2.840000	0.97914	0.655000	0.94253	GAA	.	.		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Missense_Mutation
TTN	7273	hgsc.bcm.edu	37	2	179611653	179611653	+	Intron	SNP	A	A	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:179611653A>C	ENST00000591111.1	-	46	10585				TTN_ENST00000360870.5_Silent_p.A5158A|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATTTCATAAGCTGAACCCC	0.403																																					p.A5158A		Atlas-SNP	.											.	TTN	18412	.	0			c.T15474G						.						126.0	124.0	125.0					2																	179611653		2203	4299	6502	SO:0001627	intron_variant	7273	exon46			TTCATAAGCTGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5005T>G	chr2.hg19:g.179611653A>C		80.0	0.0		78.0	26.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC141	285025	hgsc.bcm.edu	37	2	179825979	179825979	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:179825979T>A	ENST00000409284.1	-	5	875	c.758A>T	c.(757-759)cAg>cTg	p.Q253L	CCDC141_ENST00000420890.2_Missense_Mutation_p.Q253L			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	253										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTGGTCCCACTGACATATCTG	0.453																																					p.Q253L		Atlas-SNP	.											.	CCDC141	362	.	0			c.A758T						.																																			SO:0001583	missense	285025	exon5			TCCCACTGACATA	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.758A>T	chr2.hg19:g.179825979T>A	ENSP00000386503:p.Gln253Leu	122.0	0.0		100.0	60.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000409284.1	hg19		.	.	.	.	.	.	.	.	.	.	T	4.276	0.050294	0.08243	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	5.85	4.69	0.59074	.	.	.	.	.	T	0.24198	0.0586	N	0.25426	0.745	0.80722	D	1	B	0.15141	0.012	B	0.11329	0.006	T	0.05053	-1.0909	8	.	.	.	.	10.3716	0.44058	0.3277:0.0:0.0:0.6723	.	253	B8ZZB3	.	L	253	ENSP00000395995:Q253L;ENSP00000390190:Q253L;ENSP00000388745:Q253L;ENSP00000386503:Q253L	.	Q	-	2	0	CCDC141	179534224	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.879000	0.48522	1.026000	0.39733	0.533000	0.62120	CAG	.	.		0.453	CCDC141-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000335873.1	NM_173648	
COL3A1	1281	hgsc.bcm.edu	37	2	189861938	189861938	+	Silent	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:189861938C>A	ENST00000304636.3	+	25	1979	c.1809C>A	c.(1807-1809)ggC>ggA	p.G603G	COL3A1_ENST00000317840.5_Silent_p.G603G	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	603	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GAGGACCTGGCCCTCAGGTAC	0.433																																					p.G603G		Atlas-SNP	.											.	COL3A1	292	.	0			c.C1809A						.						144.0	146.0	146.0					2																	189861938		2203	4300	6503	SO:0001819	synonymous_variant	1281	exon25			ACCTGGCCCTCAG	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.1809C>A	chr2.hg19:g.189861938C>A		121.0	0.0		84.0	39.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Silent	SNP	ENST00000304636.3	hg19	CCDS2297.1																																																																																			.	.		0.433	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
BMPR2	659	hgsc.bcm.edu	37	2	203379609	203379609	+	Splice_Site	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:203379609A>T	ENST00000374580.4	+	5	1068		c.e5-1		BMPR2_ENST00000374574.2_Splice_Site	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)						activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						CTGTTCTTATAGGAGACCGTA	0.348																																					.		Atlas-SNP	.											.	BMPR2	142	.	0			c.530-2A>T						.						107.0	99.0	102.0					2																	203379609		2203	4300	6503	SO:0001630	splice_region_variant	659	exon5			TCTTATAGGAGAC	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.530-1A>T	chr2.hg19:g.203379609A>T		59.0	0.0		60.0	19.0	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Splice_Site	SNP	ENST00000374580.4	hg19	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801825	0.70682	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3678	0.83341	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BMPR2	203087854	1.000000	0.71417	0.934000	0.37439	0.597000	0.36814	8.630000	0.90987	2.254000	0.74563	0.528000	0.53228	.	.	.		0.348	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	Intron
ADAM23	8745	hgsc.bcm.edu	37	2	207429764	207429764	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:207429764T>A	ENST00000264377.3	+	14	1694	c.1366T>A	c.(1366-1368)Tgg>Agg	p.W456R	ADAM23_ENST00000374415.3_Missense_Mutation_p.W456R|ADAM23_ENST00000374416.1_Missense_Mutation_p.W456R	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	456	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CACAGAATCCTGGGGTGGCTG	0.363																																					p.W456R	Melanoma(194;1127 2130 19620 24042 27855)	Atlas-SNP	.											.	ADAM23	239	.	0			c.T1366A						.						182.0	179.0	180.0					2																	207429764		2203	4300	6503	SO:0001583	missense	8745	exon14			GAATCCTGGGGTG	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1366T>A	chr2.hg19:g.207429764T>A	ENSP00000264377:p.Trp456Arg	73.0	0.0		49.0	23.0	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	hg19	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566111	0.65651	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.08282	3.11;3.11;3.11	5.28	4.11	0.48088	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.52532	D	0.000077	T	0.16171	0.0389	L	0.55213	1.73	0.58432	D	0.999998	D	0.56521	0.976	P	0.58013	0.831	T	0.07693	-1.0759	10	0.16420	T	0.52	.	10.8285	0.46647	0.0:0.0747:0.0:0.9253	.	456	O75077	ADA23_HUMAN	R	456;456;350;456	ENSP00000264377:W456R;ENSP00000363537:W456R;ENSP00000363536:W456R	ENSP00000264377:W456R	W	+	1	0	ADAM23	207138009	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	6.005000	0.70716	0.825000	0.34637	0.460000	0.39030	TGG	.	.		0.363	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
STK36	27148	hgsc.bcm.edu	37	2	219553490	219553490	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:219553490C>T	ENST00000295709.3	+	12	1730	c.1451C>T	c.(1450-1452)tCc>tTc	p.S484F	STK36_ENST00000440309.1_Missense_Mutation_p.S484F|STK36_ENST00000392105.3_Missense_Mutation_p.S484F|STK36_ENST00000392106.2_Missense_Mutation_p.S484F	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		AGTCTTCTCTCCAGCTGCAGT	0.567																																					p.S484F		Atlas-SNP	.											.	STK36	111	.	0			c.C1451T						.						177.0	159.0	165.0					2																	219553490		2203	4300	6503	SO:0001583	missense	27148	exon12			TTCTCTCCAGCTG	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1451C>T	chr2.hg19:g.219553490C>T	ENSP00000295709:p.Ser484Phe	134.0	0.0		126.0	40.0	NM_015690		Missense_Mutation	SNP	ENST00000295709.3	hg19	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710289	0.48517	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.69435	-0.4;-0.4;0.72;-0.4	5.38	4.5	0.54988	Armadillo-like helical (1);	0.516425	0.16439	N	0.214399	T	0.51244	0.1663	N	0.19112	0.55	0.30533	N	0.767276	P;P	0.37636	0.603;0.468	B;B	0.33042	0.157;0.075	T	0.58999	-0.7536	10	0.87932	D	0	-5.8795	13.6629	0.62378	0.0:0.6794:0.3206:0.0	.	484;484	Q9NRP7-2;Q9NRP7	.;STK36_HUMAN	F	484	ENSP00000295709:S484F;ENSP00000375955:S484F;ENSP00000375954:S484F;ENSP00000394095:S484F	ENSP00000295709:S484F	S	+	2	0	STK36	219261734	0.207000	0.23482	1.000000	0.80357	0.988000	0.76386	1.110000	0.31147	1.480000	0.48289	-0.211000	0.12701	TCC	.	.		0.567	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
SPEG	10290	hgsc.bcm.edu	37	2	220341676	220341676	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:220341676A>T	ENST00000312358.7	+	19	4664	c.4532A>T	c.(4531-4533)aAa>aTa	p.K1511I	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1511	Ig-like 8.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GTCGAGGGAAAACCACTGCCG	0.632																																					p.K1511I		Atlas-SNP	.											.	SPEG	272	.	0			c.A4532T						.						69.0	75.0	73.0					2																	220341676		2079	4210	6289	SO:0001583	missense	10290	exon19			AGGGAAAACCACT	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4532A>T	chr2.hg19:g.220341676A>T	ENSP00000311684:p.Lys1511Ile	70.0	0.0		38.0	10.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	a	19.66	3.869107	0.72065	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.68331	-0.32	5.19	4.05	0.47172	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37348	U	0.002129	T	0.63792	0.2541	L	0.35593	1.075	0.80722	D	1	P	0.47253	0.892	P	0.51487	0.671	T	0.67252	-0.5717	10	0.72032	D	0.01	.	10.3472	0.43913	0.9225:0.0:0.0775:0.0	.	1511	Q15772	SPEG_HUMAN	I	1511	ENSP00000311684:K1511I	ENSP00000265327:K1511I	K	+	2	0	SPEG	220049920	1.000000	0.71417	0.903000	0.35520	0.924000	0.55760	4.281000	0.58965	1.954000	0.56735	0.478000	0.44815	AAA	.	.		0.632	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
INHA	3623	hgsc.bcm.edu	37	2	220439764	220439764	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:220439764C>A	ENST00000243786.2	+	2	797	c.617C>A	c.(616-618)tCa>tAa	p.S206*	INHA_ENST00000489456.1_3'UTR	NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	206					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		TGTACCTGCTCAGCCCGGCCT	0.687																																					p.S206X		Atlas-SNP	.											.	INHA	30	.	0			c.C617A						.						59.0	58.0	58.0					2																	220439764		2203	4300	6503	SO:0001587	stop_gained	3623	exon2			CCTGCTCAGCCCG		CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.617C>A	chr2.hg19:g.220439764C>A	ENSP00000243786:p.Ser206*	66.0	0.0		38.0	14.0	NM_002191	A8K8H5	Nonsense_Mutation	SNP	ENST00000243786.2	hg19	CCDS2444.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211943	0.79240	.	.	ENSG00000123999	ENST00000243786	.	.	.	5.48	4.41	0.53225	.	0.629214	0.15987	N	0.235029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-10.6525	8.3908	0.32526	0.0:0.7167:0.1635:0.1198	.	.	.	.	X	206	.	ENSP00000243786:S206X	S	+	2	0	INHA	220148008	0.091000	0.21658	0.962000	0.40283	0.888000	0.51559	1.067000	0.30616	2.564000	0.86499	0.561000	0.74099	TCA	.	.		0.687	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131425.1		
DOCK10	55619	hgsc.bcm.edu	37	2	225702538	225702538	+	Missense_Mutation	SNP	C	C	G	rs369073678		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:225702538C>G	ENST00000258390.7	-	25	2858	c.2791G>C	c.(2791-2793)Gac>Cac	p.D931H	DOCK10_ENST00000409592.3_Missense_Mutation_p.D925H	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	931					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GCCACAATGTCGGTCAGAACC	0.458																																					p.D931H		Atlas-SNP	.											.	DOCK10	308	.	0			c.G2791C						.						74.0	72.0	73.0					2																	225702538		1939	4142	6081	SO:0001583	missense	55619	exon25			CAATGTCGGTCAG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.2791G>C	chr2.hg19:g.225702538C>G	ENSP00000258390:p.Asp931His	57.0	0.0		58.0	22.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	C	0.107	-1.144478	0.01728	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.67345	3.78;-0.26	5.82	4.9	0.64082	.	0.204155	0.51477	D	0.000084	T	0.33030	0.0849	N	0.02158	-0.66	0.41256	D	0.986748	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.005	T	0.41088	-0.9528	10	0.02654	T	1	.	9.586	0.39517	0.1444:0.777:0.0:0.0786	.	931;925	Q96BY6;B3FL70	DOC10_HUMAN;.	H	925;931	ENSP00000386694:D925H;ENSP00000258390:D931H	ENSP00000258390:D931H	D	-	1	0	DOCK10	225410782	0.994000	0.37717	0.975000	0.42487	0.256000	0.26092	2.684000	0.46951	2.756000	0.94617	0.563000	0.77884	GAC	.	.		0.458	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
B3GNT7	93010	hgsc.bcm.edu	37	2	232263636	232263636	+	Nonstop_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr2:232263636A>T	ENST00000287590.5	+	2	1467	c.1206A>T	c.(1204-1206)tgA>tgT	p.*402C		NM_145236.2	NP_660279.1	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7	0					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)	17		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		AGGTGCTCTGACCCCAGCCGG	0.652																																					p.X402C		Atlas-SNP	.											.	B3GNT7	38	.	0			c.A1206T						.						8.0	9.0	8.0					2																	232263636		2017	4180	6197	SO:0001578	stop_lost	93010	exon2			GCTCTGACCCCAG	AK000770	CCDS46540.1	2q36.1	2013-02-21			ENSG00000156966	ENSG00000156966		"""Beta 3-glycosyltransferases"""	18811	protein-coding gene	gene with protein product		615313				12061784	Standard	NM_145236		Approved	beta3GnT7	uc002vrs.3	Q8NFL0	OTTHUMG00000153880	ENST00000287590.5:c.1206A>T	chr2.hg19:g.232263636A>T	ENSP00000287590:p.*402Cysext*6	11.0	0.0		8.0	6.0	NM_145236	B3KWY4|B7WNP0	Missense_Mutation	SNP	ENST00000287590.5	hg19	CCDS46540.1	.	.	.	.	.	.	.	.	.	.	a	12.52	1.963017	0.34659	.	.	ENSG00000156966	ENST00000287590	.	.	.	5.05	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.5012	0.07673	0.7611:0.0:0.2389:0.0	.	.	.	.	C	402	.	.	X	+	3	0	B3GNT7	231971880	.	.	0.916000	0.36221	0.905000	0.53344	.	.	1.905000	0.55150	0.454000	0.30748	TGA	.	.		0.652	B3GNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332827.1	NM_145236	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	G	rs121913396|rs121913416		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:41266098A>G	ENST00000349496.5	+	3	375	c.95A>G	c.(94-96)gAc>gGc	p.D32G	CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25G|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32G	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,128	CTNNB1	4904	.	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95G						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>G	chr3.hg19:g.41266098A>G	ENSP00000344456:p.Asp32Gly	182.0	0.0		114.0	106.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308122	0.81247	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.74137	-0.3762	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	G	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25G;ENSP00000385604:D32G;ENSP00000412219:D32G;ENSP00000379486:D32G;ENSP00000344456:D32G;ENSP00000411226:D25G;ENSP00000379488:D32G;ENSP00000409302:D32G;ENSP00000401599:D32G	ENSP00000344456:D32G	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CACNA2D2	9254	hgsc.bcm.edu	37	3	50418547	50418547	+	Silent	SNP	G	G	A	rs56287038	byFrequency	TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:50418547G>A	ENST00000479441.1	-	7	662	c.663C>T	c.(661-663)atC>atT	p.I221I	CACNA2D2_ENST00000424201.2_Silent_p.I221I|CACNA2D2_ENST00000360963.3_Silent_p.I152I|CACNA2D2_ENST00000395083.1_Silent_p.I221I|CACNA2D2_ENST00000423994.2_Silent_p.I221I|CACNA2D2_ENST00000435965.1_Silent_p.I221I|CACNA2D2_ENST00000429770.1_Silent_p.I221I|CACNA2D2_ENST00000266039.3_Silent_p.I221I			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	221					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GCTCATTGAGGATGACAGTGG	0.612																																					p.I221I		Atlas-SNP	.											.	CACNA2D2	82	.	0			c.C663T						.						123.0	128.0	126.0					3																	50418547		2203	4300	6503	SO:0001819	synonymous_variant	9254	exon7			ATTGAGGATGACA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.663C>T	chr3.hg19:g.50418547G>A		81.0	0.0		56.0	18.0	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Silent	SNP	ENST00000479441.1	hg19	CCDS54588.1																																																																																			.	G|0.887;T|0.113		0.612	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
OR5H14	403273	hgsc.bcm.edu	37	3	97868527	97868527	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:97868527C>A	ENST00000437310.1	+	1	358	c.298C>A	c.(298-300)Cag>Aag	p.Q100K	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q100K(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATGCAAGATACAGTTGTTTTC	0.393																																					p.Q100K		Atlas-SNP	.											OR5H14,NS,carcinoma,0,1	OR5H14	56	.	1	Substitution - Missense(1)	lung(1)	c.C298A						.						202.0	209.0	207.0					3																	97868527		2203	4299	6502	SO:0001583	missense	403273	exon1			AAGATACAGTTGT		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.298C>A	chr3.hg19:g.97868527C>A	ENSP00000401706:p.Gln100Lys	165.0	0.0		182.0	26.0	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	hg19	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237609	0.58886	.	.	ENSG00000236032	ENST00000437310	T	0.00462	7.26	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000379	T	0.01421	0.0046	H	0.97491	4.015	0.19300	N	0.999972	P	0.48089	0.905	P	0.49451	0.611	T	0.13926	-1.0491	10	0.72032	D	0.01	.	10.6214	0.45483	0.0:1.0:0.0:0.0	.	100	A6NHG9	O5H14_HUMAN	K	100	ENSP00000401706:Q100K	ENSP00000401706:Q100K	Q	+	1	0	OR5H14	99351217	1.000000	0.71417	0.006000	0.13384	0.041000	0.13682	6.590000	0.74085	1.380000	0.46344	0.195000	0.17529	CAG	.	.		0.393	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
MORC1	27136	hgsc.bcm.edu	37	3	108698446	108698446	+	Missense_Mutation	SNP	C	C	A	rs201675482		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:108698446C>A	ENST00000483760.1	-	23	2373	c.2330G>T	c.(2329-2331)gGc>gTc	p.G777V	MORC1_ENST00000232603.5_Missense_Mutation_p.G798V					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTTACAACTGCCACTCACAGA	0.413																																					p.G798V		Atlas-SNP	.											.	MORC1	211	.	0			c.G2393T						.						118.0	112.0	114.0					3																	108698446		2203	4300	6503	SO:0001583	missense	27136	exon24			CAACTGCCACTCA	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2330G>T	chr3.hg19:g.108698446C>A	ENSP00000417282:p.Gly777Val	124.0	0.0		102.0	24.0	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.11	2.437450	0.43224	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06449	3.33;3.3	5.25	-0.433	0.12287	.	1.786500	0.02702	N	0.111811	T	0.05593	0.0147	L	0.32530	0.975	0.09310	N	1	B;B	0.21381	0.055;0.055	B;B	0.17433	0.018;0.018	T	0.38067	-0.9678	10	0.27785	T	0.31	0.026	3.5674	0.07905	0.1775:0.3688:0.0:0.4537	.	777;798	E7ERX1;Q86VD1	.;MORC1_HUMAN	V	798;777	ENSP00000232603:G798V;ENSP00000417282:G777V	ENSP00000232603:G798V	G	-	2	0	MORC1	110181136	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.058000	0.11750	0.016000	0.14998	0.655000	0.94253	GGC	.	C|1.000;T|0.000		0.413	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
CD96	10225	hgsc.bcm.edu	37	3	111342600	111342600	+	Splice_Site	SNP	G	G	T	rs77738677	byFrequency	TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:111342600G>T	ENST00000283285.5	+	10	1359		c.e10-1		CD96_ENST00000352690.4_Splice_Site	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule						cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TTTCAAAATAGGATATCCAGC	0.368									Opitz Trigonocephaly syndrome																												.		Atlas-SNP	.											.	CD96	75	.	0			c.1181-1G>T						.						80.0	77.0	78.0					3																	111342600		2203	4299	6502	SO:0001630	splice_region_variant	10225	exon9	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	AAAATAGGATATC	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1229-1G>T	chr3.hg19:g.111342600G>T		284.0	0.0		304.0	108.0	NM_005816	Q5JPB3	Splice_Site	SNP	ENST00000283285.5	hg19	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.719710	0.48728	.	.	ENSG00000153283	ENST00000352690;ENST00000283285	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9321	0.52853	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD96	112825290	0.980000	0.34600	0.885000	0.34714	0.295000	0.27426	2.142000	0.42177	2.537000	0.85549	0.655000	0.94253	.	.	G|0.995;A|0.005		0.368	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		Intron
KALRN	8997	hgsc.bcm.edu	37	3	124437851	124437851	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:124437851C>T	ENST00000291478.5	+	27	3567	c.3404C>T	c.(3403-3405)tCg>tTg	p.S1135L	KALRN_ENST00000360013.3_Missense_Mutation_p.S2832L|KALRN_ENST00000428018.2_Missense_Mutation_p.S1103L	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2831					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GTCCAGATCTCGGGTCACTTC	0.552																																					p.S2832L		Atlas-SNP	.											.	KALRN	556	.	0			c.C8495T						.						89.0	87.0	88.0					3																	124437851		2203	4300	6503	SO:0001583	missense	8997	exon60			AGATCTCGGGTCA	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3404C>T	chr3.hg19:g.124437851C>T	ENSP00000291478:p.Ser1135Leu	102.0	0.0		116.0	18.0	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	hg19	CCDS3028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.650666|4.650666	0.87958|0.87958	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000291478;ENST00000428018	.|T;T;T	.|0.65364	.|-0.15;-0.15;-0.15	5.41|5.41	5.41|5.41	0.78517|0.78517	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.079259	.|0.52532	.|D	.|0.000067	T|T	0.51958|0.51958	0.1705|0.1705	L|L	0.33093|0.33093	0.98|0.98	0.41765|0.41765	D|D	0.989733|0.989733	.|P;B	.|0.41159	.|0.74;0.344	.|B;B	.|0.34489	.|0.184;0.06	T|T	0.56098|0.56098	-0.8035|-0.8035	5|10	.|0.44086	.|T	.|0.13	.|.	19.3942|19.3942	0.94598|0.94598	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1135;2831	.|C9JQ37;O60229	.|.;KALRN_HUMAN	W|L	2801|2832;1135;1103	.|ENSP00000353109:S2832L;ENSP00000291478:S1135L;ENSP00000402419:S1103L	.|ENSP00000291478:S1135L	R|S	+|+	1|2	2|0	KALRN|KALRN	125920541|125920541	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	3.901000|3.901000	0.56303|0.56303	2.816000|2.816000	0.96949|0.96949	0.563000|0.563000	0.77884|0.77884	CGG|TCG	.	.		0.552	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
KALRN	8997	hgsc.bcm.edu	37	3	124437876	124437876	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:124437876G>A	ENST00000291478.5	+	27	3592	c.3429G>A	c.(3427-3429)ctG>ctA	p.L1143L	KALRN_ENST00000360013.3_Silent_p.L2840L|KALRN_ENST00000428018.2_Silent_p.L1111L	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2839					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TTCACCACCTGCTGGGGAACC	0.542																																					p.L2840L		Atlas-SNP	.											.	KALRN	556	.	0			c.G8520A						.						82.0	79.0	80.0					3																	124437876		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon60			CCACCTGCTGGGG	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3429G>A	chr3.hg19:g.124437876G>A		97.0	0.0		119.0	20.0	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000291478.5	hg19	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	G	5.073	0.199194	0.09652	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.41	1.58	0.23477	.	.	.	.	.	T	0.51109	0.1655	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35076	-0.9803	4	.	.	.	.	4.6724	0.12696	0.0715:0.2775:0.4246:0.2265	.	.	.	.	Y	2809	.	.	C	+	2	0	KALRN	125920566	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	0.637000	0.24659	0.107000	0.17824	-0.253000	0.11424	TGC	.	.		0.542	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
SLC12A8	84561	hgsc.bcm.edu	37	3	124909320	124909320	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:124909320T>A	ENST00000393469.4	-	2	146	c.97A>T	c.(97-99)Atg>Ttg	p.M33L	SLC12A8_ENST00000314584.7_5'UTR|SLC12A8_ENST00000469902.1_Missense_Mutation_p.M33L|SLC12A8_ENST00000423114.2_Missense_Mutation_p.M62L	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	33					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.M33L(1)		endometrium(2)|kidney(2)|lung(12)	16						GGCTCCCACATGAACAGCTGG	0.582																																					p.M33L		Atlas-SNP	.											SLC12A8_ENST00000393469,NS,carcinoma,0,1	SLC12A8	81	.	1	Substitution - Missense(1)	ovary(1)	c.A97T						.						132.0	142.0	139.0					3																	124909320		2040	4197	6237	SO:0001583	missense	84561	exon3			CCCACATGAACAG		CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.97A>T	chr3.hg19:g.124909320T>A	ENSP00000377112:p.Met33Leu	304.0	0.0		334.0	60.0	NM_024628	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	hg19	CCDS43143.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148037	0.37923	.	.	ENSG00000221955	ENST00000393469;ENST00000423114;ENST00000469902;ENST00000462437	D;D;D;D	0.95272	-2.21;-2.21;-2.21;-3.66	5.03	1.25	0.21368	.	.	.	.	.	D	0.87341	0.6153	N	0.22421	0.69	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.74551	-0.3628	9	0.25106	T	0.35	.	8.5487	0.33438	0.0:0.6188:0.0:0.3812	.	62;33	A0AV02-2;A0AV02	.;S12A8_HUMAN	L	33;62;33;1	ENSP00000377112:M33L;ENSP00000404243:M62L;ENSP00000418783:M33L;ENSP00000418636:M1L	ENSP00000377112:M33L	M	-	1	0	SLC12A8	126392010	0.374000	0.25081	0.602000	0.28890	0.667000	0.39255	0.405000	0.21015	-0.160000	0.11002	-0.735000	0.03563	ATG	.	.		0.582	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628	
NEK11	79858	hgsc.bcm.edu	37	3	130884346	130884346	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:130884346A>T	ENST00000510769.1	+	8	1097	c.844A>T	c.(844-846)Agt>Tgt	p.S282C	NEK11_ENST00000508196.1_Missense_Mutation_p.S387C|NEK11_ENST00000429253.2_Missense_Mutation_p.S387C|NEK11_ENST00000383366.4_Missense_Mutation_p.S387C|NEK11_ENST00000356918.4_Missense_Mutation_p.S387C|NEK11_ENST00000511262.1_Missense_Mutation_p.S387C|NEK11_ENST00000507910.1_Missense_Mutation_p.S387C|NEK11_ENST00000510688.1_Missense_Mutation_p.S387C|NEK11_ENST00000412440.2_Missense_Mutation_p.S239C					NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						TCAGCAGCTGAGTGTTGATGT	0.328																																					p.S387C		Atlas-SNP	.											.	NEK11	76	.	0			c.A1159T						.						87.0	90.0	89.0					3																	130884346		2203	4300	6503	SO:0001583	missense	79858	exon12			CAGCTGAGTGTTG	AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.844A>T	chr3.hg19:g.130884346A>T	ENSP00000421549:p.Ser282Cys	171.0	0.0		186.0	98.0	NM_024800		Missense_Mutation	SNP	ENST00000510769.1	hg19		.	.	.	.	.	.	.	.	.	.	A	22.3	4.265998	0.80358	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000356918;ENST00000510688;ENST00000511262;ENST00000383366;ENST00000412440;ENST00000507910;ENST00000508196	T;T;T;T;T;T;T;T;T	0.72725	-0.62;-0.41;-0.55;-0.44;-0.54;-0.41;-0.68;-0.55;-0.41	5.65	3.24	0.37175	.	0.759465	0.11815	N	0.526839	T	0.70833	0.3269	L	0.43923	1.385	0.09310	N	1	D;D;D;D;D;P	0.60575	0.988;0.973;0.983;0.978;0.963;0.921	P;P;P;P;P;P	0.53593	0.73;0.639;0.613;0.711;0.518;0.518	T	0.58713	-0.7588	10	0.62326	D	0.03	.	8.0131	0.30365	0.7909:0.1367:0.0723:0.0	.	387;282;239;387;387;387	Q8NG66-3;E9PHI8;B4DDN2;Q8NG66-4;Q8NG66;Q8NG66-2	.;.;.;.;NEK11_HUMAN;.	C	282;387;387;387;387;387;239;387;387	ENSP00000421549:S282C;ENSP00000397180:S387C;ENSP00000349389:S387C;ENSP00000423458:S387C;ENSP00000425114:S387C;ENSP00000372857:S387C;ENSP00000411888:S239C;ENSP00000426662:S387C;ENSP00000421851:S387C	ENSP00000349389:S387C	S	+	1	0	NEK11	132367036	0.003000	0.15002	0.000000	0.03702	0.864000	0.49448	1.867000	0.39499	0.485000	0.27652	0.528000	0.53228	AGT	.	.		0.328	NEK11-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000356757.1	NM_024800	
PLSCR4	57088	hgsc.bcm.edu	37	3	145924525	145924525	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:145924525G>A	ENST00000354952.2	-	4	382	c.142C>T	c.(142-144)Cca>Tca	p.P48S	PLSCR4_ENST00000383083.2_Missense_Mutation_p.P48S|PLSCR4_ENST00000446574.2_Missense_Mutation_p.P48S|PLSCR4_ENST00000493382.1_Missense_Mutation_p.P48S|PLSCR4_ENST00000433593.2_Missense_Mutation_p.P33S	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	48	Proline-rich domain (PRD). {ECO:0000250}.				cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)			kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						CCAGTAGGTGGAGGGACAGCT	0.448																																					p.P48S		Atlas-SNP	.											.	PLSCR4	44	.	0			c.C142T						.						32.0	33.0	33.0					3																	145924525		2203	4300	6503	SO:0001583	missense	57088	exon4			TAGGTGGAGGGAC	AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.142C>T	chr3.hg19:g.145924525G>A	ENSP00000347038:p.Pro48Ser	108.0	0.0		124.0	17.0	NM_020353	A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Missense_Mutation	SNP	ENST00000354952.2	hg19	CCDS3133.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853010	0.51270	.	.	ENSG00000114698	ENST00000354952;ENST00000383083;ENST00000433593;ENST00000446574;ENST00000493382;ENST00000460350;ENST00000460885;ENST00000476202;ENST00000481701;ENST00000498625	T;T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	4.0	3.12	0.35913	.	0.524004	0.17648	N	0.166778	T	0.43612	0.1255	L	0.60845	1.875	0.09310	N	1	B;B	0.30793	0.295;0.099	B;B	0.31614	0.133;0.037	T	0.43734	-0.9373	10	0.72032	D	0.01	.	9.8013	0.40766	0.0:0.2095:0.7905:0.0	.	48;48	E9PHR9;Q9NRQ2	.;PLS4_HUMAN	S	48;48;33;48;48;48;48;48;48;48	ENSP00000347038:P48S;ENSP00000372561:P48S;ENSP00000415605:P33S;ENSP00000399315:P48S;ENSP00000419040:P48S;ENSP00000417896:P48S;ENSP00000420385:P48S;ENSP00000418173:P48S;ENSP00000418419:P48S;ENSP00000417248:P48S	ENSP00000347038:P48S	P	-	1	0	PLSCR4	147407215	0.002000	0.14202	0.273000	0.24645	0.962000	0.63368	0.705000	0.25675	1.012000	0.39366	0.650000	0.86243	CCA	.	.		0.448	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355172.1	NM_020353	
ARHGEF26	26084	hgsc.bcm.edu	37	3	153842229	153842229	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:153842229G>C	ENST00000356448.4	+	3	1398	c.1114G>C	c.(1114-1116)Gat>Cat	p.D372H	ARHGEF26_ENST00000465093.1_Missense_Mutation_p.D372H|ARHGEF26_ENST00000465817.1_Missense_Mutation_p.D372H	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	372					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						AGGAACATTTGATGGGGAAGG	0.289																																					p.D372H	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	Atlas-SNP	.											SGEF,colon,carcinoma,0,3	ARHGEF26	158	.	0			c.G1114C						.						78.0	77.0	77.0					3																	153842229		1798	4058	5856	SO:0001583	missense	26084	exon3			ACATTTGATGGGG	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1114G>C	chr3.hg19:g.153842229G>C	ENSP00000348828:p.Asp372His	48.0	0.0		50.0	28.0	NM_001251962	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	ENST00000356448.4	hg19	CCDS46938.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094882	0.76870	.	.	ENSG00000114790	ENST00000356448;ENST00000465093;ENST00000465817	T;T;T	0.60548	0.18;0.18;1.94	5.76	5.76	0.90799	.	0.048978	0.85682	D	0.000000	T	0.70613	0.3244	L	0.44542	1.39	0.53005	D	0.999967	D;D	0.89917	1.0;1.0	D;D	0.67231	0.95;0.915	T	0.70626	-0.4820	10	0.59425	D	0.04	-22.8259	19.9857	0.97347	0.0:0.0:1.0:0.0	.	372;372	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	H	372	ENSP00000348828:D372H;ENSP00000423418:D372H;ENSP00000423295:D372H	ENSP00000348828:D372H	D	+	1	0	ARHGEF26	155324919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.405000	0.80007	2.706000	0.92434	0.655000	0.94253	GAT	.	.		0.289	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	
TTC14	151613	hgsc.bcm.edu	37	3	180322340	180322340	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:180322340C>A	ENST00000296015.4	+	5	778	c.646C>A	c.(646-648)Cta>Ata	p.L216I	RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000382584.4_Missense_Mutation_p.L216I|TTC14_ENST00000412756.2_Missense_Mutation_p.L216I	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	216							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCCACCACACCTATCTGGTAT	0.333																																					p.L216I		Atlas-SNP	.											.	TTC14	112	.	0			c.C646A						.						66.0	65.0	65.0					3																	180322340		2203	4295	6498	SO:0001583	missense	151613	exon5			CCACACCTATCTG	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.646C>A	chr3.hg19:g.180322340C>A	ENSP00000296015:p.Leu216Ile	153.0	0.0		167.0	41.0	NM_001042601	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	hg19	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590530	0.46214	.	.	ENSG00000163728	ENST00000296015;ENST00000412756;ENST00000382584;ENST00000492617;ENST00000495660	T;T	0.50001	0.76;0.76	5.71	2.82	0.32997	.	0.284900	0.34386	N	0.004002	T	0.37652	0.1011	L	0.46157	1.445	0.80722	D	1	P;B;B	0.45283	0.855;0.063;0.376	B;B;B	0.40702	0.338;0.04;0.09	T	0.09509	-1.0671	10	0.35671	T	0.21	-4.525	8.4286	0.32744	0.1229:0.7405:0.0:0.1365	.	216;216;216	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	I	216;216;216;116;116	ENSP00000296015:L216I;ENSP00000372027:L216I	ENSP00000296015:L216I	L	+	1	2	TTC14	181805034	0.015000	0.18098	0.982000	0.44146	0.971000	0.66376	0.296000	0.19083	0.705000	0.31890	0.650000	0.86243	CTA	.	.		0.333	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
MUC4	4585	hgsc.bcm.edu	37	3	195507956	195507956	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:195507956T>A	ENST00000463781.3	-	2	10954	c.10495A>T	c.(10495-10497)Aca>Tca	p.T3499S	MUC4_ENST00000475231.1_Missense_Mutation_p.T3499S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGTCACCTGTGGATGCTGAG	0.592																																					p.T3499S		Atlas-SNP	.											.	MUC4	1505	.	0			c.A10495T						.						36.0	30.0	32.0					3																	195507956		637	1577	2214	SO:0001583	missense	4585	exon2			CACCTGTGGATGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10495A>T	chr3.hg19:g.195507956T>A	ENSP00000417498:p.Thr3499Ser	187.0	0.0		195.0	33.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	5.711	0.315625	0.10789	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37411	1.2;1.33	0.743	0.743	0.18347	.	.	.	.	.	T	0.15219	0.0367	N	0.19112	0.55	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.12656	-1.0539	8	.	.	.	.	3.5009	0.07673	0.0:0.0:0.4186:0.5813	.	3371	E7ESK3	.	S	3499	ENSP00000417498:T3499S;ENSP00000420243:T3499S	.	T	-	1	0	MUC4	196992735	0.005000	0.15991	0.035000	0.18076	0.035000	0.12851	-0.329000	0.07935	0.077000	0.16863	0.076000	0.15429	ACA	.	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
POLN	353497	hgsc.bcm.edu	37	4	2209958	2209958	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:2209958T>G	ENST00000511885.2	-	5	823	c.470A>C	c.(469-471)aAa>aCa	p.K157T	POLN_ENST00000382865.1_Missense_Mutation_p.K157T|POLN_ENST00000515357.1_5'UTR			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	157					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			TGTAATATGTTTTCTTTTAAG	0.323								DNA polymerases (catalytic subunits)																													p.K157T		Atlas-SNP	.											.	POLN	82	.	0			c.A470C						.						56.0	58.0	57.0					4																	2209958		2203	4299	6502	SO:0001583	missense	353497	exon3			ATATGTTTTCTTT	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.470A>C	chr4.hg19:g.2209958T>G	ENSP00000435506:p.Lys157Thr	82.0	0.0		143.0	21.0	NM_181808	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	hg19	CCDS3360.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416734	0.42918	.	.	ENSG00000130997	ENST00000511885;ENST00000382865	T;T	0.50548	0.74;0.74	5.27	5.27	0.74061	.	0.376324	0.26915	N	0.021848	T	0.45577	0.1349	L	0.29908	0.895	0.30641	N	0.756507	D;P	0.65815	0.995;0.877	P;B	0.51582	0.674;0.417	T	0.52457	-0.8573	10	0.56958	D	0.05	-12.1722	11.5991	0.50993	0.0:0.0:0.0:1.0	.	157;157	E7ERY2;Q7Z5Q5	.;DPOLN_HUMAN	T	157	ENSP00000435506:K157T;ENSP00000372316:K157T	ENSP00000372316:K157T	K	-	2	0	POLN	2179756	0.835000	0.29415	0.929000	0.37066	0.103000	0.19146	0.913000	0.28611	1.987000	0.57996	0.459000	0.35465	AAA	.	.		0.323	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
RGS12	6002	hgsc.bcm.edu	37	4	3427240	3427240	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:3427240A>G	ENST00000344733.5	+	14	4188	c.3284A>G	c.(3283-3285)gAc>gGc	p.D1095G	RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000336727.3_Missense_Mutation_p.D1095G|RGS12_ENST00000306648.7_Missense_Mutation_p.D493G|RGS12_ENST00000382788.3_Missense_Mutation_p.D1095G|RGS12_ENST00000338806.4_Missense_Mutation_p.D447G|RGS12_ENST00000538395.1_Missense_Mutation_p.D437G	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1095	RBD 2. {ECO:0000255|PROSITE- ProRule:PRU00262}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCGAGTCTGGACGGACAGCGG	0.577																																					p.D1095G		Atlas-SNP	.											.	RGS12	128	.	0			c.A3284G						.						130.0	138.0	135.0					4																	3427240		2203	4300	6503	SO:0001583	missense	6002	exon14			GTCTGGACGGACA	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.3284A>G	chr4.hg19:g.3427240A>G	ENSP00000339381:p.Asp1095Gly	131.0	0.0		148.0	35.0	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	hg19	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.269248	0.59540	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.41758	1.28;1.29;1.29;1.02;0.99;1.04	4.76	4.76	0.60689	Raf-like Ras-binding (3);	0.000000	0.85682	D	0.000000	T	0.59729	0.2215	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.984;1.0;1.0;1.0	D;D;D;D;P;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.885;1.0;1.0;1.0	T	0.61544	-0.7041	10	0.52906	T	0.07	-29.3243	13.7417	0.62852	1.0:0.0:0.0:0.0	.	437;294;294;437;447;493;1095;1095	B7Z764;B3KVS7;A8K440;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;.;RGS12_HUMAN;.	G	1095;1095;1095;493;447;437	ENSP00000339381:D1095G;ENSP00000338509:D1095G;ENSP00000372238:D1095G;ENSP00000304459:D493G;ENSP00000342133:D447G;ENSP00000438888:D437G	ENSP00000304459:D493G	D	+	2	0	RGS12	3397038	1.000000	0.71417	0.961000	0.40146	0.498000	0.33706	8.418000	0.90250	1.903000	0.55091	0.529000	0.55759	GAC	.	.		0.577	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
UCHL1	7345	hgsc.bcm.edu	37	4	41266155	41266155	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:41266155A>T	ENST00000284440.4	+	8	706	c.562A>T	c.(562-564)Agt>Tgt	p.S188C	UCHL1_ENST00000512788.1_Missense_Mutation_p.S188C|UCHL1_ENST00000503431.1_Missense_Mutation_p.S188C|UCHL1_ENST00000508768.1_Missense_Mutation_p.S172C	NM_004181.4	NP_004172.2	P09936	UCHL1_HUMAN	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)	188					adult walking behavior (GO:0007628)|axon target recognition (GO:0007412)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|cell proliferation (GO:0008283)|eating behavior (GO:0042755)|muscle fiber development (GO:0048747)|negative regulation of MAP kinase activity (GO:0043407)|neuromuscular process (GO:0050905)|protein deubiquitination (GO:0016579)|response to ischemia (GO:0002931)|sensory perception of pain (GO:0019233)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	alpha-2A adrenergic receptor binding (GO:0031694)|cysteine-type endopeptidase activity (GO:0004197)|ligase activity (GO:0016874)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(2)	8						CCATGGCGCCAGTTCAGAGGA	0.443																																					p.S188C		Atlas-SNP	.											.	UCHL1	19	.	0			c.A562T						.						166.0	156.0	159.0					4																	41266155		2203	4300	6503	SO:0001583	missense	7345	exon8			GGCGCCAGTTCAG	BC000332	CCDS3462.1	4p13	2011-07-21			ENSG00000154277	ENSG00000154277	3.4.19.12	"""Parkinson disease"""	12513	protein-coding gene	gene with protein product		191342		PARK5		1840236	Standard	NM_004181		Approved	PGP9.5, Uch-L1	uc003gvo.3	P09936	OTTHUMG00000099377	ENST00000284440.4:c.562A>T	chr4.hg19:g.41266155A>T	ENSP00000284440:p.Ser188Cys	69.0	0.0		97.0	53.0	NM_004181	Q4W5K6|Q71UM0	Missense_Mutation	SNP	ENST00000284440.4	hg19	CCDS3462.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.175699	0.57692	.	.	ENSG00000154277	ENST00000503431;ENST00000284440;ENST00000508768;ENST00000512788	T;T;T;T	0.63255	0.59;0.59;-0.03;0.59	5.5	5.5	0.81552	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.207764	0.48286	D	0.000200	T	0.61464	0.2349	L	0.38733	1.17	0.45342	D	0.998331	D	0.65815	0.995	P	0.53689	0.732	T	0.56019	-0.8048	10	0.15952	T	0.53	-22.6167	14.3367	0.66595	1.0:0.0:0.0:0.0	.	188	P09936	UCHL1_HUMAN	C	188;188;172;188	ENSP00000422542:S188C;ENSP00000284440:S188C;ENSP00000426895:S172C;ENSP00000423623:S188C	ENSP00000284440:S188C	S	+	1	0	UCHL1	40960912	1.000000	0.71417	0.990000	0.47175	0.814000	0.46013	7.028000	0.76470	2.308000	0.77769	0.533000	0.62120	AGT	.	.		0.443	UCHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216827.1	NM_004181	
POLR2B	5431	hgsc.bcm.edu	37	4	57873096	57873096	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:57873096A>T	ENST00000381227.1	+	11	1745	c.1332A>T	c.(1330-1332)ctA>ctT	p.L444L	POLR2B_ENST00000314595.5_Silent_p.L444L|POLR2B_ENST00000441246.2_Silent_p.L437L|POLR2B_ENST00000431623.2_Silent_p.L369L			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	444					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					CTGATGGCCTAAAATACTCTT	0.408																																					p.L444L		Atlas-SNP	.											.	POLR2B	108	.	0			c.A1332T						.						84.0	90.0	88.0					4																	57873096		2203	4300	6503	SO:0001819	synonymous_variant	5431	exon10			TGGCCTAAAATAC		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1332A>T	chr4.hg19:g.57873096A>T		263.0	0.0		461.0	111.0	NM_000938	A8K1A8|Q8IZ61	Silent	SNP	ENST00000381227.1	hg19	CCDS3511.1																																																																																			.	.		0.408	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
LPHN3	23284	hgsc.bcm.edu	37	4	62862048	62862048	+	Silent	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:62862048T>C	ENST00000514591.1	+	19	3401	c.3072T>C	c.(3070-3072)ttT>ttC	p.F1024F	LPHN3_ENST00000504896.1_Silent_p.F1024F|LPHN3_ENST00000545650.1_Silent_p.F1024F|LPHN3_ENST00000508946.1_Silent_p.F1024F|LPHN3_ENST00000506700.1_Silent_p.F1024F|LPHN3_ENST00000506746.1_Silent_p.F1092F|LPHN3_ENST00000511324.1_Silent_p.F1092F|LPHN3_ENST00000508693.1_Silent_p.F1092F|LPHN3_ENST00000514996.1_Silent_p.F1024F|LPHN3_ENST00000512091.2_Silent_p.F1024F|LPHN3_ENST00000509896.1_Silent_p.F1092F|LPHN3_ENST00000507164.1_Silent_p.F1092F|LPHN3_ENST00000514157.1_Silent_p.F1024F|LPHN3_ENST00000506720.1_Silent_p.F1092F|LPHN3_ENST00000507625.1_Silent_p.F1092F			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1011					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TTTGGAGTTTTATAGGACCAG	0.393																																					p.F1024F		Atlas-SNP	.											.	LPHN3	800	.	0			c.T3072C						.						190.0	183.0	185.0					4																	62862048		1891	4122	6013	SO:0001819	synonymous_variant	23284	exon17			GAGTTTTATAGGA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3072T>C	chr4.hg19:g.62862048T>C		132.0	0.0		65.0	50.0	NM_015236	E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	hg19	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	T	6.319	0.426890	0.11987	.	.	ENSG00000150471	ENST00000502815	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	T	0.70325	0.3211	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70156	-0.4949	4	.	.	.	.	14.4383	0.67298	0.0:0.0:0.0:1.0	.	.	.	.	H	482	.	.	Y	+	1	0	LPHN3	62544643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.233000	0.51311	1.818000	0.53035	0.460000	0.39030	TAT	.	.		0.393	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
PTPN13	5783	hgsc.bcm.edu	37	4	87692580	87692580	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:87692580T>A	ENST00000411767.2	+	31	5123	c.5060T>A	c.(5059-5061)gTa>gAa	p.V1687E	PTPN13_ENST00000427191.2_Missense_Mutation_p.V1668E|PTPN13_ENST00000316707.6_Missense_Mutation_p.V1496E|PTPN13_ENST00000436978.1_Missense_Mutation_p.V1692E|PTPN13_ENST00000511467.1_Missense_Mutation_p.V1692E			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1687					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGCAACATGGTATCACAGGCA	0.428																																					p.V1692E		Atlas-SNP	.											.	PTPN13	203	.	0			c.T5075A						.						92.0	92.0	92.0					4																	87692580		2070	4221	6291	SO:0001583	missense	5783	exon31			ACATGGTATCACA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5060T>A	chr4.hg19:g.87692580T>A	ENSP00000407249:p.Val1687Glu	223.0	0.0		100.0	82.0	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	hg19	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	T	10.55	1.382560	0.25031	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.53857	0.6;0.62;0.69;0.6;0.62	4.92	2.27	0.28462	.	1.043520	0.07682	N	0.937336	T	0.39118	0.1066	L	0.34521	1.04	0.09310	N	1	B;B;P;B	0.39717	0.001;0.321;0.684;0.321	B;B;B;B	0.40602	0.003;0.334;0.265;0.334	T	0.28870	-1.0030	10	0.30854	T	0.27	.	2.1852	0.03885	0.1275:0.1492:0.132:0.5912	.	1496;1668;1687;1692	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	E	1668;1692;1496;1687;1692;1636	ENSP00000408368:V1668E;ENSP00000394794:V1692E;ENSP00000322675:V1496E;ENSP00000407249:V1687E;ENSP00000426626:V1692E	ENSP00000322675:V1496E	V	+	2	0	PTPN13	87911604	0.000000	0.05858	0.001000	0.08648	0.563000	0.35712	0.055000	0.14229	0.838000	0.34948	-0.263000	0.10527	GTA	.	.		0.428	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
INTU	27152	hgsc.bcm.edu	37	4	128628111	128628111	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:128628111G>A	ENST00000335251.6	+	12	2361	c.2258G>A	c.(2257-2259)gGg>gAg	p.G753E		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	753					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						GAAGAAAGTGGGACCTTGCTT	0.438																																					p.G753E		Atlas-SNP	.											.	INTU	92	.	0			c.G2258A						.						188.0	190.0	189.0					4																	128628111		2203	4300	6503	SO:0001583	missense	27152	exon12			AAAGTGGGACCTT	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.2258G>A	chr4.hg19:g.128628111G>A	ENSP00000334003:p.Gly753Glu	77.0	0.0		39.0	31.0	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	hg19	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	4.171	0.030270	0.08101	.	.	ENSG00000164066	ENST00000335251	.	.	.	4.36	2.57	0.30868	.	0.313071	0.33670	N	0.004678	T	0.34803	0.0910	L	0.47716	1.5	0.80722	D	1	P	0.38504	0.634	B	0.36186	0.219	T	0.13602	-1.0503	9	0.09338	T	0.73	-2.0343	3.9214	0.09245	0.1529:0.1265:0.5827:0.1378	.	753	Q9ULD6	PDZD6_HUMAN	E	753	.	ENSP00000334003:G753E	G	+	2	0	INTU	128847561	0.988000	0.35896	0.339000	0.25562	0.013000	0.08279	2.472000	0.45136	0.730000	0.32425	0.650000	0.86243	GGG	.	.		0.438	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
SH3D19	152503	hgsc.bcm.edu	37	4	152080413	152080413	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:152080413A>T	ENST00000409252.2	-	8	1601	c.894T>A	c.(892-894)aaT>aaA	p.N298K	SH3D19_ENST00000424281.1_Missense_Mutation_p.N262K|SH3D19_ENST00000427414.2_Missense_Mutation_p.N262K|SH3D19_ENST00000409598.4_Missense_Mutation_p.N298K|SH3D19_ENST00000514152.1_Missense_Mutation_p.N298K|SH3D19_ENST00000455740.1_Missense_Mutation_p.N298K|SH3D19_ENST00000304527.4_Missense_Mutation_p.N298K			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	298	Pro-rich.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TTCTCTCAACATTACTGAGCT	0.363																																					p.N298K		Atlas-SNP	.											.	SH3D19	54	.	0			c.T894A						.						124.0	117.0	120.0					4																	152080413		2203	4300	6503	SO:0001583	missense	152503	exon9			CTCAACATTACTG	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.894T>A	chr4.hg19:g.152080413A>T	ENSP00000386848:p.Asn298Lys	96.0	0.0		68.0	21.0	NM_001128923	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	hg19	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	A	11.22	1.573240	0.28092	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.69561	-0.41;0.25;-0.41;-0.39;-0.39;0.25;-0.41	5.52	0.48	0.16804	.	0.587217	0.16016	N	0.233521	T	0.55545	0.1927	L	0.54323	1.7	0.09310	N	1	P;P;P;P	0.40834	0.611;0.73;0.73;0.611	B;B;B;B	0.42771	0.159;0.302;0.397;0.159	T	0.42464	-0.9450	10	0.16896	T	0.51	-8.0147	4.1815	0.10378	0.5186:0.0:0.3285:0.1529	.	298;298;262;76	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	K	298;298;298;262;262;298;298	ENSP00000387030:N298K;ENSP00000302913:N298K;ENSP00000416708:N298K;ENSP00000404542:N262K;ENSP00000415694:N262K;ENSP00000386848:N298K;ENSP00000423449:N298K	ENSP00000302913:N298K	N	-	3	2	SH3D19	152299863	0.012000	0.17670	0.541000	0.28102	0.326000	0.28443	0.162000	0.16501	0.178000	0.19917	0.460000	0.39030	AAT	.	.		0.363	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
IRX4	50805	hgsc.bcm.edu	37	5	1882077	1882077	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:1882077A>T	ENST00000505790.1	-	3	598	c.142T>A	c.(142-144)Tac>Aac	p.Y48N	IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000513692.1_Missense_Mutation_p.Y48N|IRX4_ENST00000231357.2_Missense_Mutation_p.Y48N|CTD-2194D22.3_ENST00000506335.1_RNA	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	48					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		ACCGGGCAGTAGACCGGCGCC	0.726																																					p.Y48N		Atlas-SNP	.											.	IRX4	45	.	0			c.T142A						.						3.0	4.0	4.0					5																	1882077		1796	3742	5538	SO:0001583	missense	50805	exon2			GGCAGTAGACCGG	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.142T>A	chr5.hg19:g.1882077A>T	ENSP00000423161:p.Tyr48Asn	76.0	0.0		87.0	59.0	NM_016358	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	hg19	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	a	19.62	3.861304	0.71949	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692;ENST00000511126	T;T;T;D	0.83075	-0.11;-0.11;-0.11;-1.68	3.9	3.9	0.45041	.	0.000000	0.64402	U	0.000001	D	0.86606	0.5973	L	0.43923	1.385	0.58432	D	0.999999	D	0.71674	0.998	D	0.80764	0.994	D	0.86851	0.2023	10	0.52906	T	0.07	-16.9238	12.6999	0.57026	1.0:0.0:0.0:0.0	.	48	P78413	IRX4_HUMAN	N	48	ENSP00000231357:Y48N;ENSP00000423161:Y48N;ENSP00000424235:Y48N;ENSP00000421772:Y48N	ENSP00000231357:Y48N	Y	-	1	0	IRX4	1935077	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	7.924000	0.87555	1.544000	0.49359	0.378000	0.23410	TAC	.	.		0.726	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
ERBB2IP	55914	hgsc.bcm.edu	37	5	65322213	65322213	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:65322213A>C	ENST00000284037.5	+	13	1493	c.1104A>C	c.(1102-1104)caA>caC	p.Q368H	ERBB2IP_ENST00000380936.1_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.Q368H|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.Q368H	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	368					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		GTGATATGCAAAAATTAAAAG	0.303																																					p.Q368H		Atlas-SNP	.											.	ERBB2IP	120	.	0			c.A1104C						.						59.0	65.0	63.0					5																	65322213		2203	4290	6493	SO:0001583	missense	55914	exon13			TATGCAAAAATTA		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.1104A>C	chr5.hg19:g.65322213A>C	ENSP00000284037:p.Gln368His	82.0	0.0		88.0	18.0	NM_001253701	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	hg19	CCDS58953.1	.	.	.	.	.	.	.	.	.	.	A	18.62	3.663090	0.67700	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T;T	0.56776	0.44;0.44;2.31;0.44;0.44;0.44;0.44;0.44;0.44;0.44	4.93	-3.27	0.05048	.	0.000000	0.85682	D	0.000000	T	0.54046	0.1834	L	0.28014	0.82	0.54753	D	0.999988	D;D;D;D;D;D;D;D	0.76494	0.995;0.999;0.995;0.999;0.999;0.999;0.993;0.998	D;D;D;D;D;D;D;D	0.91635	0.95;0.986;0.95;0.999;0.987;0.998;0.946;0.968	T	0.54951	-0.8216	10	0.72032	D	0.01	.	12.7342	0.57214	0.4041:0.0:0.5959:0.0	.	368;368;368;368;368;368;368;368	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.;.	H	368	ENSP00000284037:Q368H;ENSP00000370330:Q368H;ENSP00000397833:Q368H;ENSP00000370326:Q368H;ENSP00000370323:Q368H;ENSP00000370322:Q368H;ENSP00000370325:Q368H;ENSP00000422766:Q368H;ENSP00000426632:Q368H;ENSP00000422015:Q368H	ENSP00000284037:Q368H	Q	+	3	2	ERBB2IP	65357969	1.000000	0.71417	0.987000	0.45799	0.985000	0.73830	0.647000	0.24812	-0.542000	0.06249	-0.899000	0.02877	CAA	.	.		0.303	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695	
GPR98	84059	hgsc.bcm.edu	37	5	90070014	90070014	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:90070014G>A	ENST00000405460.2	+	60	12393	c.12297G>A	c.(12295-12297)caG>caA	p.Q4099Q		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4099	Calx-beta 27. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTGAGTCCCAGAAGACCATTG	0.418																																					p.Q4099Q		Atlas-SNP	.											.	GPR98	605	.	0			c.G12297A						.						86.0	83.0	84.0					5																	90070014		1974	4146	6120	SO:0001819	synonymous_variant	84059	exon60			GTCCCAGAAGACC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12297G>A	chr5.hg19:g.90070014G>A		65.0	0.0		51.0	11.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	hg19	CCDS47246.1																																																																																			.	.		0.418	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128977564	128977564	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:128977564A>T	ENST00000274487.4	+	11	1910	c.1765A>T	c.(1765-1767)Aca>Tca	p.T589S	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	589	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGTTATTTGCACAGGATTATG	0.378																																					p.T589S		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.A1765T						.						191.0	163.0	173.0					5																	128977564		2203	4300	6503	SO:0001583	missense	171019	exon11			ATTTGCACAGGAT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1765A>T	chr5.hg19:g.128977564A>T	ENSP00000274487:p.Thr589Ser	86.0	0.0		79.0	20.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.871418	0.33069	.	.	ENSG00000145808	ENST00000274487	T	0.64260	-0.09	3.85	2.68	0.31781	.	0.087960	0.44902	D	0.000403	T	0.45716	0.1356	N	0.21142	0.635	0.35230	D	0.776866	P	0.46220	0.874	B	0.42555	0.391	T	0.53165	-0.8477	9	.	.	.	.	9.8019	0.40770	0.9158:0.0:0.0842:0.0	.	589	Q8TE59	ATS19_HUMAN	S	589	ENSP00000274487:T589S	.	T	+	1	0	ADAMTS19	129005463	0.999000	0.42202	0.848000	0.33437	0.980000	0.70556	2.334000	0.43920	0.819000	0.34492	0.482000	0.46254	ACA	.	.		0.378	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
CXXC5	51523	hgsc.bcm.edu	37	5	139060694	139060694	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:139060694G>A	ENST00000302517.3	+	2	1300	c.586G>A	c.(586-588)Gtg>Atg	p.V196M	CXXC5_ENST00000511048.1_Missense_Mutation_p.V196M|CXXC5_ENST00000515038.1_3'UTR	NM_016463.7	NP_057547.5	Q7LFL8	CXXC5_HUMAN	CXXC finger protein 5	196					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATGGAGGCTGTGGCAGGTGC	0.627																																					p.V196M		Atlas-SNP	.											.	CXXC5	27	.	0			c.G586A						.						26.0	33.0	31.0					5																	139060694		2129	4242	6371	SO:0001583	missense	51523	exon2			GAGGCTGTGGCAG	AK024338	CCDS43370.1	5q31.3	2014-02-18	2011-12-01						26943	protein-coding gene	gene with protein product	"""retinoid-inducible nuclear factor"", ""WT1-induced Inhibitor of Dishevelled"""	612752				11042152, 19001364, 19182210, 20220130	Standard	NM_016463		Approved	HSPC195, RINF, WID	uc010jfg.1	Q7LFL8		ENST00000302517.3:c.586G>A	chr5.hg19:g.139060694G>A	ENSP00000302543:p.Val196Met	72.0	0.0		55.0	13.0	NM_016463	B3KND0|C8CBA8|Q8TB79|Q9NV51|Q9P0S8	Missense_Mutation	SNP	ENST00000302517.3	hg19	CCDS43370.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341980	0.61073	.	.	ENSG00000171604	ENST00000302517;ENST00000511048;ENST00000511457	T;T;T	0.47869	0.83;0.83;0.83	5.68	5.68	0.88126	.	0.128526	0.53938	D	0.000048	T	0.50701	0.1631	N	0.24115	0.695	0.40705	D	0.982513	D	0.67145	0.996	P	0.57548	0.823	T	0.45877	-0.9231	10	0.33141	T	0.24	-27.0177	17.9548	0.89065	0.0:0.0:1.0:0.0	.	196	Q7LFL8	CXXC5_HUMAN	M	196	ENSP00000302543:V196M;ENSP00000427379:V196M;ENSP00000430949:V196M	ENSP00000302543:V196M	V	+	1	0	CXXC5	139040878	1.000000	0.71417	0.967000	0.41034	0.607000	0.37147	6.803000	0.75180	2.681000	0.91329	0.561000	0.74099	GTG	.	.		0.627	CXXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372744.1	NM_016463	
PCDHB13	56123	hgsc.bcm.edu	37	5	140595369	140595369	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:140595369G>A	ENST00000341948.4	+	1	1861	c.1674G>A	c.(1672-1674)tcG>tcA	p.S558S		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGACAACTCGCCCTTCGTGC	0.721																																					p.S558S		Atlas-SNP	.											PCDHB13,colon,carcinoma,0,2	PCDHB13	142	.	0			c.G1674A						.						23.0	26.0	25.0					5																	140595369		2202	4291	6493	SO:0001819	synonymous_variant	56123	exon1			CAACTCGCCCTTC	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1674G>A	chr5.hg19:g.140595369G>A		25.0	0.0		30.0	17.0	NM_018933	A8K9V6	Silent	SNP	ENST00000341948.4	hg19	CCDS4255.1																																																																																			.	.		0.721	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
GRIA1	2890	hgsc.bcm.edu	37	5	153035418	153035418	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:153035418A>T	ENST00000285900.5	+	5	1028	c.685A>T	c.(685-687)Att>Ttt	p.I229F	GRIA1_ENST00000521843.2_Missense_Mutation_p.I160F|GRIA1_ENST00000448073.4_Missense_Mutation_p.I239F|GRIA1_ENST00000518142.1_Missense_Mutation_p.I149F|GRIA1_ENST00000340592.5_Missense_Mutation_p.I229F|GRIA1_ENST00000518783.1_Missense_Mutation_p.I239F	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	229					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CTACCACTACATTCTTGCAAA	0.443																																					p.I239F		Atlas-SNP	.											.	GRIA1	321	.	0			c.A715T						.						122.0	112.0	115.0					5																	153035418		2203	4300	6503	SO:0001583	missense	2890	exon5			CACTACATTCTTG		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.685A>T	chr5.hg19:g.153035418A>T	ENSP00000285900:p.Ile229Phe	66.0	0.0		75.0	22.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	hg19	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.562863	0.86335	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6	4.84	4.84	0.62591	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.49184	0.1542	L	0.54323	1.7	0.80722	D	1	D;D;P;D;D;P	0.89917	1.0;1.0;0.941;1.0;1.0;0.813	D;D;P;D;D;P	0.91635	0.999;0.999;0.587;0.999;0.999;0.518	T	0.41360	-0.9513	10	0.36615	T	0.2	.	13.8871	0.63714	1.0:0.0:0.0:0.0	.	239;239;149;239;229;229	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	F	229;229;149;183;229;160;160;239;239	ENSP00000285900:I229F;ENSP00000427920:I149F;ENSP00000339343:I229F;ENSP00000427864:I160F;ENSP00000442108:I160F;ENSP00000428994:I239F;ENSP00000415569:I239F	ENSP00000285900:I229F	I	+	1	0	GRIA1	153015611	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.578000	0.90777	1.934000	0.56057	0.450000	0.29827	ATT	.	.		0.443	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
TIMD4	91937	hgsc.bcm.edu	37	5	156381475	156381475	+	Silent	SNP	A	A	T	rs371298031		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:156381475A>T	ENST00000274532.2	-	2	407	c.351T>A	c.(349-351)ccT>ccA	p.P117P	TIMD4_ENST00000407087.3_Silent_p.P117P	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	117	Ig-like V-type.					integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGAACCAGCCAGGCACTTCTA	0.507																																					p.P117P		Atlas-SNP	.											.	TIMD4	94	.	0			c.T351A						.						85.0	78.0	81.0					5																	156381475		2203	4300	6503	SO:0001819	synonymous_variant	91937	exon2			CCAGCCAGGCACT	BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.351T>A	chr5.hg19:g.156381475A>T		72.0	0.0		68.0	45.0	NM_138379	B5MCL9	Silent	SNP	ENST00000274532.2	hg19	CCDS4332.1																																																																																			.	.		0.507	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
NIPAL4	348938	hgsc.bcm.edu	37	5	156899882	156899882	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:156899882G>A	ENST00000311946.7	+	6	1431	c.1315G>A	c.(1315-1317)Gac>Aac	p.D439N	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Missense_Mutation_p.D420N	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	439						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						TAGACTGGAAGACAAGAACGT	0.483																																					p.D439N		Atlas-SNP	.											.	NIPAL4	48	.	0			c.G1315A						.						44.0	43.0	43.0					5																	156899882		1900	4124	6024	SO:0001583	missense	348938	exon6			CTGGAAGACAAGA	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1315G>A	chr5.hg19:g.156899882G>A	ENSP00000311687:p.Asp439Asn	74.0	0.0		64.0	43.0	NM_001099287	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	hg19	CCDS47328.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277479	0.80580	.	.	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.92348	-2.83;-3.02	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.94311	0.8172	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.93554	0.6889	10	0.45353	T	0.12	-30.539	20.3437	0.98782	0.0:0.0:1.0:0.0	.	420;439	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	N	420;439	ENSP00000406456:D420N;ENSP00000311687:D439N	ENSP00000311687:D439N	D	+	1	0	NIPAL4	156832460	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	8.141000	0.89618	2.815000	0.96918	0.561000	0.74099	GAC	.	.		0.483	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
ZBED8	63920	hgsc.bcm.edu	37	5	159821530	159821530	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:159821530C>G	ENST00000408953.3	-	2	1475	c.968G>C	c.(967-969)aGt>aCt	p.S323T	C5orf54_ENST00000523213.1_Missense_Mutation_p.S323T	NM_022090.3	NP_071373.2														breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						aaggaggacactatattctat	0.383																																					p.S323T		Atlas-SNP	.											.	C5orf54	46	.	0			c.G968C						.						48.0	49.0	49.0					5																	159821530		2203	4299	6502	SO:0001583	missense	63920	exon2			AGGACACTATATT																												ENST00000408953.3:c.968G>C	chr5.hg19:g.159821530C>G	ENSP00000386184:p.Ser323Thr	88.0	0.0		81.0	18.0	NM_022090		Missense_Mutation	SNP	ENST00000408953.3	hg19	CCDS34283.1	.	.	.	.	.	.	.	.	.	.	C	0.802	-0.755028	0.03019	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	D;D	0.84146	-1.81;-1.81	2.78	0.73	0.18271	.	.	.	.	.	T	0.63604	0.2525	N	0.05230	-0.09	0.21579	N	0.99964	B	0.06786	0.001	B	0.06405	0.002	T	0.49051	-0.8979	9	0.13470	T	0.59	.	4.523	0.11968	0.0:0.6256:0.0:0.3744	.	323	Q8IZ13	CE054_HUMAN	T	323	ENSP00000386184:S323T;ENSP00000428831:S323T	ENSP00000386184:S323T	S	-	2	0	C5orf54	159754108	0.996000	0.38824	0.999000	0.59377	0.997000	0.91878	0.140000	0.16056	0.160000	0.19432	0.655000	0.94253	AGT	.	.		0.383	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374143.1		
FGFR4	2264	hgsc.bcm.edu	37	5	176520211	176520211	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:176520211C>T	ENST00000292408.4	+	9	1375	c.1130C>T	c.(1129-1131)tCc>tTc	p.S377F	FGFR4_ENST00000292410.3_Intron|FGFR4_ENST00000393637.1_Intron|FGFR4_ENST00000502906.1_Missense_Mutation_p.S377F|FGFR4_ENST00000393648.2_Intron	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	377					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	GCGTCGGGCTCCCTGGCCTTG	0.692										TSP Lung(9;0.080)																											p.S377F		Atlas-SNP	.											.	FGFR4	174	.	0			c.C1130T						.						42.0	35.0	37.0					5																	176520211		2203	4298	6501	SO:0001583	missense	2264	exon9			CGGGCTCCCTGGC	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1130C>T	chr5.hg19:g.176520211C>T	ENSP00000292408:p.Ser377Phe	109.0	0.0		85.0	25.0	NM_002011	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	hg19	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	C	3.574	-0.086980	0.07097	.	.	ENSG00000160867	ENST00000292408;ENST00000502906;ENST00000377207	T;T	0.80994	-1.44;-1.44	4.98	4.98	0.66077	.	0.411878	0.28996	N	0.013475	T	0.59838	0.2223	N	0.11818	0.18	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.54820	-0.8236	10	0.08837	T	0.75	.	8.1914	0.31370	0.0:0.7557:0.1599:0.0844	.	377	P22455	FGFR4_HUMAN	F	377;377;605	ENSP00000292408:S377F;ENSP00000424960:S377F	ENSP00000292408:S377F	S	+	2	0	FGFR4	176452817	0.997000	0.39634	0.983000	0.44433	0.827000	0.46813	2.519000	0.45546	2.317000	0.78254	0.561000	0.74099	TCC	.	.		0.692	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
ZNF454	285676	hgsc.bcm.edu	37	5	178392529	178392529	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr5:178392529A>T	ENST00000320129.3	+	5	1427	c.1124A>T	c.(1123-1125)cAg>cTg	p.Q375L	ZNF454_ENST00000519564.1_Missense_Mutation_p.Q375L	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		ACTGAACATCAGAGAATTCAT	0.408																																					p.Q375L		Atlas-SNP	.											.	ZNF454	99	.	0			c.A1124T						.						40.0	43.0	42.0					5																	178392529		2203	4300	6503	SO:0001583	missense	285676	exon5			AACATCAGAGAAT	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1124A>T	chr5.hg19:g.178392529A>T	ENSP00000326249:p.Gln375Leu	101.0	0.0		98.0	34.0	NM_001178089	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	hg19	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.533295	0.45073	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.05580	3.42;3.42	4.07	4.07	0.47477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38837	N	0.001558	T	0.03520	0.0101	N	0.04655	-0.195	0.31085	N	0.711441	B	0.17667	0.023	B	0.13407	0.009	T	0.09185	-1.0686	10	0.51188	T	0.08	-12.8824	11.3069	0.49340	1.0:0.0:0.0:0.0	.	375	Q8N9F8	ZN454_HUMAN	L	375	ENSP00000326249:Q375L;ENSP00000430354:Q375L	ENSP00000326249:Q375L	Q	+	2	0	ZNF454	178325135	0.004000	0.15560	1.000000	0.80357	0.997000	0.91878	1.527000	0.35975	1.845000	0.53610	0.454000	0.30748	CAG	.	.		0.408	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
HIVEP1	3096	hgsc.bcm.edu	37	6	12124094	12124094	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:12124094G>T	ENST00000379388.2	+	4	4398	c.4066G>T	c.(4066-4068)Gtt>Ttt	p.V1356F	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1356					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TACTCTGAATGTTCCTGGATG	0.433																																					p.V1356F		Atlas-SNP	.											.	HIVEP1	242	.	0			c.G4066T						.						77.0	72.0	74.0					6																	12124094		1911	4150	6061	SO:0001583	missense	3096	exon4			CTGAATGTTCCTG	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4066G>T	chr6.hg19:g.12124094G>T	ENSP00000368698:p.Val1356Phe	86.0	0.0		158.0	24.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	hg19	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732437	0.69189	.	.	ENSG00000095951	ENST00000379388	T	0.20881	2.04	5.79	4.03	0.46877	.	0.250947	0.20930	N	0.083115	T	0.36026	0.0952	M	0.86740	2.835	0.80722	D	1	D	0.71674	0.998	P	0.61874	0.895	T	0.38415	-0.9662	9	.	.	.	-12.0308	12.3092	0.54920	0.136:0.0:0.864:0.0	.	1356	P15822	ZEP1_HUMAN	F	1356	ENSP00000368698:V1356F	.	V	+	1	0	HIVEP1	12232080	1.000000	0.71417	0.252000	0.24328	0.940000	0.58332	4.622000	0.61240	0.802000	0.34089	0.655000	0.94253	GTT	.	.		0.433	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
POM121L2	94026	hgsc.bcm.edu	37	6	27279067	27279067	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:27279067G>T	ENST00000444565.1	-	1	882	c.883C>A	c.(883-885)Cct>Act	p.P295T	POM121L2_ENST00000377451.2_Missense_Mutation_p.P295T	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	295										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GGAGAGGAAGGCCGATGACAA	0.478																																					p.P295T		Atlas-SNP	.											.	POM121L2	61	.	0			c.C883A						.						55.0	51.0	52.0					6																	27279067		692	1591	2283	SO:0001583	missense	94026	exon1			AGGAAGGCCGATG	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.883C>A	chr6.hg19:g.27279067G>T	ENSP00000392726:p.Pro295Thr	92.0	0.0		117.0	63.0	NM_033482	C9J1I7	Missense_Mutation	SNP	ENST00000444565.1	hg19	CCDS59497.1	.	.	.	.	.	.	.	.	.	.	G	0.227	-1.024077	0.02061	.	.	ENSG00000158553	ENST00000429945;ENST00000377451;ENST00000444565	T;T;T	0.12147	2.71;2.71;2.71	3.64	-2.63	0.06133	.	1.723700	0.03684	N	0.245964	T	0.01730	0.0055	N	0.11255	0.115	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.42865	-0.9426	10	0.25751	T	0.34	.	4.4023	0.11392	0.2754:0.0:0.5342:0.1904	.	295	C9J1I7	.	T	9;295;295	ENSP00000415181:P9T;ENSP00000366671:P295T;ENSP00000392726:P295T	ENSP00000366671:P295T	P	-	1	0	POM121L2	27387046	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.199000	0.03032	-0.388000	0.07797	-0.459000	0.05422	CCT	.	.		0.478	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
OR12D3	81797	hgsc.bcm.edu	37	6	29342331	29342331	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:29342331A>G	ENST00000396806.3	-	1	737	c.734T>C	c.(733-735)aTg>aCg	p.M245T	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						ACATACCACCATAAAATGGGA	0.463																																					p.M245T		Atlas-SNP	.											.	OR12D3	55	.	0			c.T734C						.						66.0	64.0	65.0					6																	29342331		1511	2708	4219	SO:0001583	missense	81797	exon1			ACCACCATAAAAT		CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.734T>C	chr6.hg19:g.29342331A>G	ENSP00000380023:p.Met245Thr	137.0	0.0		173.0	16.0	NM_030959	A2BDZ1|Q5SQI8|Q6IF23	Missense_Mutation	SNP	ENST00000396806.3	hg19	CCDS4658.1	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.378804	0.01204	.	.	ENSG00000112462	ENST00000377143;ENST00000396806	T	0.35236	1.32	4.19	0.423	0.16463	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03095	0.0091	N	0.02202	-0.64	0.09310	N	1	B	0.02656	0.0	B	0.13407	0.009	T	0.46952	-0.9154	9	0.02654	T	1	-2.9467	8.616	0.33831	0.4425:0.0:0.5575:0.0	.	245	Q9UGF7	O12D3_HUMAN	T	245	ENSP00000380023:M245T	ENSP00000366348:M245T	M	-	2	0	OR12D3	29450310	0.000000	0.05858	0.011000	0.14972	0.666000	0.39218	-0.256000	0.08757	-0.074000	0.12820	0.172000	0.16884	ATG	.	.		0.463	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076056.3		
RNF39	80352	hgsc.bcm.edu	37	6	30039406	30039406	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:30039406T>G	ENST00000244360.6	-	4	842	c.745A>C	c.(745-747)Agc>Cgc	p.S249R	RNF39_ENST00000376751.3_Missense_Mutation_p.S249R	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	249	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										AGTTGTACGCTGCGGCGGTCG	0.721																																					p.S249R	NSCLC(8;188 360 1520 20207 31481)	Atlas-SNP	.											.	RNF39	27	.	0			c.A745C						.						2.0	2.0	2.0					6																	30039406		1146	2075	3221	SO:0001583	missense	80352	exon4			GTACGCTGCGGCG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.745A>C	chr6.hg19:g.30039406T>G	ENSP00000244360:p.Ser249Arg	2.0	0.0		20.0	8.0	NM_025236	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	hg19	CCDS4673.1	.	.	.	.	.	.	.	.	.	.	t	14.36	2.511611	0.44660	.	.	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.11495	2.77;2.77	4.7	0.99	0.19807	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.119810	0.36665	N	0.002478	T	0.02767	0.0083	L	0.33668	1.02	0.27010	N	0.964703	B;B	0.21071	0.051;0.009	B;B	0.29077	0.098;0.022	T	0.40739	-0.9547	10	0.48119	T	0.1	-18.9153	7.3644	0.26764	0.0:0.2778:0.0:0.7222	.	249;249	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	R	249	ENSP00000365942:S249R;ENSP00000244360:S249R	ENSP00000244360:S249R	S	-	1	0	RNF39	30147385	0.000000	0.05858	0.984000	0.44739	0.246000	0.25737	0.219000	0.17641	0.006000	0.14734	0.381000	0.24937	AGC	.	.		0.721	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
DPCR1	135656	hgsc.bcm.edu	37	6	30918786	30918786	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:30918786G>T	ENST00000462446.1	+	2	2573	c.2545G>T	c.(2545-2547)Gcc>Tcc	p.A849S	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	293						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						AGAAAGCACAGCCAATGAGAA	0.478																																					p.A849S		Atlas-SNP	.											.	DPCR1	99	.	0			c.G2545T						.						79.0	73.0	75.0					6																	30918786		692	1591	2283	SO:0001583	missense	135656	exon2			AGCACAGCCAATG	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.2545G>T	chr6.hg19:g.30918786G>T	ENSP00000417182:p.Ala849Ser	45.0	0.0		94.0	45.0	NM_080870	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	hg19	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	g	0.721	-0.783597	0.02907	.	.	ENSG00000168631	ENST00000462446	T	0.49432	0.78	0.645	-1.29	0.09288	.	.	.	.	.	T	0.11707	0.0285	L	0.47716	1.5	0.09310	N	0.999998	D	0.55172	0.97	B	0.39152	0.292	T	0.25012	-1.0144	8	0.08381	T	0.77	.	.	.	.	.	849	E9PEI6	.	S	849	ENSP00000417182:A849S	ENSP00000417182:A849S	A	+	1	0	DPCR1	31026765	0.000000	0.05858	0.011000	0.14972	0.010000	0.07245	-0.572000	0.05881	-0.330000	0.08514	0.154000	0.16183	GCC	.	.		0.478	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
TNXB	7148	hgsc.bcm.edu	37	6	32015532	32015532	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:32015532T>A	ENST00000375244.3	-	30	10504	c.10303A>T	c.(10303-10305)Atc>Ttc	p.I3435F	TNXB_ENST00000375247.2_Missense_Mutation_p.I3433F|TNXB_ENST00000451343.1_5'Flank			P22105	TENX_HUMAN	tenascin XB	3480	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCAGCAGAGATGGGGCCCAGT	0.622																																					p.I3433F		Atlas-SNP	.											.	TNXB	553	.	0			c.A10297T						.						31.0	38.0	36.0					6																	32015532		1342	2577	3919	SO:0001583	missense	7148	exon30			CAGAGATGGGGCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10303A>T	chr6.hg19:g.32015532T>A	ENSP00000364393:p.Ile3435Phe	45.0	0.0		76.0	22.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	hg19		.	.	.	.	.	.	.	.	.	.	T	9.330	1.060266	0.19987	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04654	3.58;3.58	4.76	-5.29	0.02747	.	1.287300	0.05452	N	0.549714	T	0.02342	0.0072	M	0.74258	2.255	0.09310	N	1	B	0.21821	0.061	B	0.28305	0.088	T	0.45411	-0.9263	10	0.35671	T	0.21	.	7.6649	0.28426	0.0:0.5218:0.1037:0.3744	.	3433	P22105-3	.	F	3435;3433	ENSP00000364393:I3435F;ENSP00000364396:I3433F	ENSP00000364393:I3435F	I	-	1	0	TNXB	32123510	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.767000	0.00782	-0.846000	0.04174	-1.039000	0.02377	ATC	.	.		0.622	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
LRFN2	57497	hgsc.bcm.edu	37	6	40400714	40400714	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:40400714G>T	ENST00000338305.6	-	2	681	c.139C>A	c.(139-141)Ccc>Acc	p.P47T		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	47	LRRNT.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					ATATCAGGGGGTACAAAGAGC	0.617																																					p.P47T		Atlas-SNP	.											.	LRFN2	133	.	0			c.C139A						.						46.0	52.0	50.0					6																	40400714		2203	4300	6503	SO:0001583	missense	57497	exon2			CAGGGGGTACAAA	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.139C>A	chr6.hg19:g.40400714G>T	ENSP00000345985:p.Pro47Thr	91.0	0.0		146.0	63.0	NM_020737	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	hg19	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835636	0.71373	.	.	ENSG00000156564	ENST00000338305	T	0.04360	3.64	5.52	5.52	0.82312	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.14700	0.0355	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00354	-1.1794	10	0.87932	D	0	.	17.9922	0.89172	0.0:0.0:1.0:0.0	.	47	Q9ULH4	LRFN2_HUMAN	T	47	ENSP00000345985:P47T	ENSP00000345985:P47T	P	-	1	0	LRFN2	40508692	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.869000	0.99810	2.620000	0.88729	0.655000	0.94253	CCC	.	.		0.617	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
TREML1	340205	hgsc.bcm.edu	37	6	41121500	41121500	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:41121500G>A	ENST00000426005.2	-	2	415	c.372C>T	c.(370-372)ccC>ccT	p.P124P	TREML1_ENST00000373127.4_Silent_p.P124P|TREML1_ENST00000437044.2_Intron	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	124					calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					ACTCACCTGGGGGCAGTATGT	0.607																																					p.P124P		Atlas-SNP	.											.	TREML1	20	.	0			c.C372T						.						46.0	51.0	49.0					6																	41121500		2203	4300	6503	SO:0001819	synonymous_variant	340205	exon2			ACCTGGGGGCAGT	AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.372C>T	chr6.hg19:g.41121500G>A		85.0	0.0		150.0	20.0	NM_178174	Q496B3|Q8IWY1|Q8IWY2	Silent	SNP	ENST00000426005.2	hg19	CCDS4851.1																																																																																			.	.		0.607	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043538.2	NM_178174	
CAPN11	11131	hgsc.bcm.edu	37	6	44149032	44149032	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:44149032T>A	ENST00000398776.1	+	19	1951	c.1913T>A	c.(1912-1914)cTg>cAg	p.L638Q	CAPN11_ENST00000542245.1_Missense_Mutation_p.L638Q	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	638	Domain IV.|EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCAAGATCCTGTGGAAAAAA	0.512																																					p.L638Q		Atlas-SNP	.											.	CAPN11	66	.	0			c.T1913A						.						65.0	66.0	66.0					6																	44149032		1874	4104	5978	SO:0001583	missense	11131	exon19			AGATCCTGTGGAA	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1913T>A	chr6.hg19:g.44149032T>A	ENSP00000381758:p.Leu638Gln	63.0	0.0		95.0	52.0	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	hg19	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.594535	0.86953	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	D;D	0.81579	-1.51;-1.51	4.93	4.93	0.64822	EF-hand-like domain (1);	0.000000	0.36066	N	0.002819	D	0.93058	0.7790	H	0.98901	4.365	0.49687	D	0.999811	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95466	0.8547	10	0.87932	D	0	.	13.907	0.63843	0.0:0.0:0.0:1.0	.	292;638	B4DT90;Q9UMQ6	.;CAN11_HUMAN	Q	638	ENSP00000381758:L638Q;ENSP00000441078:L638Q	ENSP00000381758:L638Q	L	+	2	0	CAPN11	44257010	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.856000	0.86956	2.066000	0.61787	0.448000	0.29417	CTG	.	.		0.512	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
GSTA4	2941	hgsc.bcm.edu	37	6	52849299	52849299	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:52849299T>A	ENST00000370959.1	-	5	494	c.377A>T	c.(376-378)cAg>cTg	p.Q126L	GSTA4_ENST00000486559.1_5'UTR|GSTA4_ENST00000541324.1_Missense_Mutation_p.Q33L|GSTA4_ENST00000370960.1_Missense_Mutation_p.Q33L			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	126	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	TATAGCCTTCTGGGCCATGTT	0.448																																					p.Q126L		Atlas-SNP	.											.	GSTA4	20	.	0			c.A377T						.						127.0	111.0	116.0					6																	52849299		2203	4300	6503	SO:0001583	missense	2941	exon5			GCCTTCTGGGCCA	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.377A>T	chr6.hg19:g.52849299T>A	ENSP00000359998:p.Gln126Leu	70.0	0.0		156.0	65.0	NM_001512	B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Missense_Mutation	SNP	ENST00000370959.1	hg19	CCDS4948.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.070658	0.55539	.	.	ENSG00000170899	ENST00000370963;ENST00000541324;ENST00000370960;ENST00000370959;ENST00000457564	T;T;T;T;T	0.01838	4.61;4.61;4.61;4.61;4.61	5.0	5.0	0.66597	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.873402	0.10333	N	0.687322	T	0.01489	0.0048	L	0.43923	1.385	0.33135	D	0.543598	B	0.23058	0.079	B	0.22386	0.039	T	0.39354	-0.9618	10	0.72032	D	0.01	-2.9179	14.6648	0.68899	0.0:0.0:0.0:1.0	.	126	O15217	GSTA4_HUMAN	L	126;33;33;126;33	ENSP00000360002:Q126L;ENSP00000439439:Q33L;ENSP00000359999:Q33L;ENSP00000359998:Q126L;ENSP00000394228:Q33L	ENSP00000359998:Q126L	Q	-	2	0	GSTA4	52957258	0.391000	0.25221	1.000000	0.80357	0.889000	0.51656	3.562000	0.53777	1.996000	0.58369	0.455000	0.32223	CAG	.	.		0.448	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040946.1	NM_001512	
KHDRBS2	202559	hgsc.bcm.edu	37	6	62407112	62407112	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:62407112A>T	ENST00000281156.4	-	8	1218	c.940T>A	c.(940-942)Tat>Aat	p.Y314N		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TAGCTGTCATAGGCATCCTCA	0.393																																					p.Y314N		Atlas-SNP	.											.	KHDRBS2	103	.	0			c.T940A						.						132.0	108.0	116.0					6																	62407112		2203	4300	6503	SO:0001583	missense	202559	exon8			TGTCATAGGCATC	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.940T>A	chr6.hg19:g.62407112A>T	ENSP00000281156:p.Tyr314Asn	53.0	0.0		94.0	43.0	NM_152688	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	hg19	CCDS4963.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839534	0.71488	.	.	ENSG00000112232	ENST00000281156	T	0.61040	0.14	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.70771	0.3262	M	0.77103	2.36	0.54753	D	0.999984	D	0.89917	1.0	D	0.87578	0.998	T	0.75825	-0.3181	10	0.72032	D	0.01	-1.8458	14.2277	0.65871	1.0:0.0:0.0:0.0	.	314	Q5VWX1	KHDR2_HUMAN	N	314	ENSP00000281156:Y314N	ENSP00000281156:Y314N	Y	-	1	0	KHDRBS2	62465071	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.303000	0.72794	2.161000	0.67846	0.528000	0.53228	TAT	.	.		0.393	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688	
DDX43	55510	hgsc.bcm.edu	37	6	74118988	74118988	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:74118988C>A	ENST00000370336.4	+	10	1355	c.1197C>A	c.(1195-1197)gaC>gaA	p.D399E	DDX43_ENST00000479773.1_3'UTR	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	399	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						ATGAAGCAGACAAGATGTTGG	0.373																																					p.D399E		Atlas-SNP	.											.	DDX43	69	.	0			c.C1197A						.						195.0	184.0	188.0					6																	74118988		2203	4300	6503	SO:0001583	missense	55510	exon10			AGCAGACAAGATG		CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1197C>A	chr6.hg19:g.74118988C>A	ENSP00000359361:p.Asp399Glu	90.0	0.0		77.0	17.0	NM_018665	B4E0C8|Q6NXR1	Missense_Mutation	SNP	ENST00000370336.4	hg19	CCDS4977.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623597	0.46840	.	.	ENSG00000080007	ENST00000370336	T	0.07444	3.19	4.82	2.89	0.33648	RNA helicase, ATP-dependent, DEAD-box, conserved site (1);DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50355	-0.8838	10	0.87932	D	0	.	10.4945	0.44770	0.0:0.8172:0.0:0.1828	.	399	Q9NXZ2	DDX43_HUMAN	E	399	ENSP00000359361:D399E	ENSP00000359361:D399E	D	+	3	2	DDX43	74175709	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	1.702000	0.37836	1.066000	0.40716	0.455000	0.32223	GAC	.	.		0.373	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	NM_018665	
COL12A1	1303	hgsc.bcm.edu	37	6	75887629	75887629	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:75887629T>A	ENST00000322507.8	-	12	2496	c.2187A>T	c.(2185-2187)ctA>ctT	p.L729L	COL12A1_ENST00000416123.2_Silent_p.L729L|COL12A1_ENST00000483888.2_Silent_p.L729L|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	729	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTGTCACCTTTAGGTTTCGAG	0.313																																					p.L729L		Atlas-SNP	.											.	COL12A1	385	.	0			c.A2187T						.						92.0	88.0	89.0					6																	75887629		1813	4083	5896	SO:0001819	synonymous_variant	1303	exon12			CACCTTTAGGTTT	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2187A>T	chr6.hg19:g.75887629T>A		38.0	0.0		36.0	33.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.313	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
SNAP91	9892	hgsc.bcm.edu	37	6	84417640	84417640	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:84417640C>A	ENST00000439399.2	-	2	323	c.7G>T	c.(7-9)Ggc>Tgc	p.G3C	SNAP91_ENST00000437520.1_Missense_Mutation_p.G3C|SNAP91_ENST00000520302.1_Missense_Mutation_p.G3C|SNAP91_ENST00000521743.1_Missense_Mutation_p.G3C|SNAP91_ENST00000195649.6_Missense_Mutation_p.G3C|SNAP91_ENST00000521485.1_Missense_Mutation_p.G3C|SNAP91_ENST00000369694.2_Missense_Mutation_p.G3C|SNAP91_ENST00000520213.1_Missense_Mutation_p.G3C|SNAP91_ENST00000428679.2_Missense_Mutation_p.G3C	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	3					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AGCGTTTGGCCCGACATCTTC	0.587																																					p.G3C		Atlas-SNP	.											SNAP91_ENST00000439399,right_lower_lobe,carcinoma,0,2	SNAP91	199	.	0			c.G7T						.						55.0	60.0	58.0					6																	84417640		1985	4168	6153	SO:0001583	missense	9892	exon2			TTTGGCCCGACAT	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.7G>T	chr6.hg19:g.84417640C>A	ENSP00000400459:p.Gly3Cys	25.0	0.0		42.0	41.0	NM_001242794	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234605	0.95207	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690;ENST00000523484;ENST00000519825	T;T;T;T;T;T;T;T;T;T	0.56444	0.98;0.96;0.96;0.98;0.99;1.34;0.98;0.96;1.34;0.46	5.36	5.36	0.76844	.	0.092984	0.85682	D	0.000000	T	0.71384	0.3333	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75625	-0.3253	10	0.87932	D	0	-7.6719	19.0968	0.93255	0.0:1.0:0.0:0.0	.	3;3;3	O60641-3;E5RI02;E1P549	.;.;.	C	3	ENSP00000429776:G3C;ENSP00000358708:G3C;ENSP00000400459:G3C;ENSP00000195649:G3C;ENSP00000412492:G3C;ENSP00000413277:G3C;ENSP00000428511:G3C;ENSP00000428215:G3C;ENSP00000428026:G3C;ENSP00000430071:G3C	ENSP00000195649:G3C	G	-	1	0	SNAP91	84474359	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.811000	0.86092	2.516000	0.84829	0.462000	0.41574	GGC	.	.		0.587	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
CNR1	1268	hgsc.bcm.edu	37	6	88854869	88854869	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:88854869C>T	ENST00000537554.1	-	2	3687	c.125G>A	c.(124-126)gGg>gAg	p.G42E	CNR1_ENST00000549890.1_Missense_Mutation_p.G42E|CNR1_ENST00000549716.1_Intron|CNR1_ENST00000369499.2_Missense_Mutation_p.G42E|CNR1_ENST00000535130.1_Missense_Mutation_p.G42E|CNR1_ENST00000369501.2_Missense_Mutation_p.G42E|CNR1_ENST00000428600.2_Missense_Mutation_p.G42E|CNR1_ENST00000362094.5_Intron|CNR1_ENST00000468898.1_Intron	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	42					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TGGGAAGTACCCTAATTTGGA	0.507																																					p.G42E		Atlas-SNP	.											.	CNR1	91	.	0			c.G125A						.						126.0	116.0	119.0					6																	88854869		2203	4300	6503	SO:0001583	missense	1268	exon4			AAGTACCCTAATT	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.125G>A	chr6.hg19:g.88854869C>T	ENSP00000441046:p.Gly42Glu	87.0	0.0		102.0	90.0	NM_001160258	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	ENST00000537554.1	hg19	CCDS5015.1	.	.	.	.	.	.	.	.	.	.	C	8.676	0.904070	0.17760	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000428600;ENST00000551417	T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	5.77	5.77	0.91146	.	0.319833	0.38111	N	0.001818	T	0.56891	0.2016	L	0.43152	1.355	0.80722	D	1	B	0.17038	0.02	B	0.15052	0.012	T	0.60551	-0.7241	10	0.87932	D	0	.	13.2318	0.59947	0.0:0.9276:0.0:0.0724	.	42	P21554	CNR1_HUMAN	E	42	ENSP00000358513:G42E;ENSP00000442689:G42E;ENSP00000441046:G42E;ENSP00000358511:G42E;ENSP00000446819:G42E;ENSP00000412192:G42E	ENSP00000358511:G42E	G	-	2	0	CNR1	88911588	0.998000	0.40836	0.979000	0.43373	0.112000	0.19704	3.768000	0.55295	2.732000	0.93576	0.563000	0.77884	GGG	.	.		0.507	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2		
TCF21	6943	hgsc.bcm.edu	37	6	134210900	134210900	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:134210900G>A	ENST00000367882.4	+	1	625	c.365G>A	c.(364-366)aGg>aAg	p.R122K	RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607641.1_RNA|RP3-323P13.2_ENST00000606544.1_RNA|TCF21_ENST00000237316.3_Missense_Mutation_p.R122K|RP3-323P13.2_ENST00000607033.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	122	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		GACACGCTCAGGCTGGCGTCC	0.627																																					p.R122K		Atlas-SNP	.											.	TCF21	30	.	0			c.G365A						.						89.0	88.0	89.0					6																	134210900		2199	4299	6498	SO:0001583	missense	6943	exon1			CGCTCAGGCTGGC	AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.365G>A	chr6.hg19:g.134210900G>A	ENSP00000356857:p.Arg122Lys	221.0	0.0		155.0	36.0	NM_003206	E1P581|O43545|Q6ICV0|Q9BZ14	Missense_Mutation	SNP	ENST00000367882.4	hg19	CCDS5167.1	.	.	.	.	.	.	.	.	.	.	G	33	5.231283	0.95207	.	.	ENSG00000118526	ENST00000367882;ENST00000237316	D;D	0.98105	-4.72;-4.72	4.17	4.17	0.49024	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.97108	0.9055	L	0.33339	1.005	0.80722	D	1	P	0.52061	0.95	D	0.66716	0.946	D	0.97789	1.0237	10	0.51188	T	0.08	-26.9552	16.86	0.86014	0.0:0.0:1.0:0.0	.	122	O43680	TCF21_HUMAN	K	122	ENSP00000356857:R122K;ENSP00000237316:R122K	ENSP00000237316:R122K	R	+	2	0	TCF21	134252593	1.000000	0.71417	0.985000	0.45067	0.997000	0.91878	9.813000	0.99286	2.033000	0.60031	0.462000	0.41574	AGG	.	.		0.627	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392	
BCLAF1	9774	hgsc.bcm.edu	37	6	136597179	136597179	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:136597179T>A	ENST00000531224.1	-	5	1736	c.1484A>T	c.(1483-1485)cAg>cTg	p.Q495L	BCLAF1_ENST00000527759.1_Missense_Mutation_p.Q493L|BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000527536.1_Missense_Mutation_p.Q495L|BCLAF1_ENST00000392348.2_Missense_Mutation_p.Q493L|BCLAF1_ENST00000353331.4_Missense_Mutation_p.Q493L	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	495					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTCAGGTGACTGAGTTTCTTT	0.393																																					p.Q495L	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.A1484T						.						189.0	198.0	195.0					6																	136597179		2203	4300	6503	SO:0001583	missense	9774	exon5			GGTGACTGAGTTT	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1484A>T	chr6.hg19:g.136597179T>A	ENSP00000435210:p.Gln495Leu	113.0	0.0		132.0	42.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	14.80	2.644507	0.47258	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49	5.22	5.22	0.72569	.	0.000000	0.56097	D	0.000022	T	0.06781	0.0173	N	0.08118	0	0.80722	D	1	D;B;D	0.56968	0.978;0.106;0.978	P;B;P	0.61328	0.887;0.019;0.887	T	0.42361	-0.9456	10	0.15952	T	0.53	-7.0642	10.6694	0.45749	0.1428:0.0:0.0:0.8572	.	493;493;495	Q9NYF8-2;Q9NYF8-3;Q9NYF8	.;.;BCLF1_HUMAN	L	495;493;495;493;493;495	ENSP00000435210:Q495L;ENSP00000229446:Q493L;ENSP00000435441:Q495L;ENSP00000434826:Q493L;ENSP00000376159:Q493L;ENSP00000431734:Q495L	ENSP00000229446:Q493L	Q	-	2	0	BCLAF1	136638872	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.966000	0.49208	2.124000	0.65301	0.373000	0.22412	CAG	.	.		0.393	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151151983	151151983	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:151151983A>G	ENST00000358517.2	+	15	1947	c.1736A>G	c.(1735-1737)gAt>gGt	p.D579G	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.D579G			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	579							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CTATGTGAAGATAGCACTTCT	0.527																																					p.D579G		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.A1736G						.						137.0	123.0	128.0					6																	151151983		2203	4300	6503	SO:0001583	missense	57480	exon16			GTGAAGATAGCAC	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1736A>G	chr6.hg19:g.151151983A>G	ENSP00000351318:p.Asp579Gly	101.0	0.0		60.0	50.0	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	hg19	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307249	0.23821	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.59083	0.29;0.29	5.55	5.55	0.83447	.	0.474690	0.25009	N	0.033850	T	0.37972	0.1023	L	0.54323	1.7	0.26701	N	0.971156	B;B;B	0.32245	0.116;0.361;0.361	B;B;B	0.29077	0.098;0.081;0.081	T	0.36962	-0.9726	10	0.46703	T	0.11	.	15.7008	0.77541	1.0:0.0:0.0:0.0	.	386;579;579	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	G	579	ENSP00000356297:D579G;ENSP00000351318:D579G	ENSP00000351318:D579G	D	+	2	0	PLEKHG1	151193676	1.000000	0.71417	0.861000	0.33841	0.124000	0.20399	5.439000	0.66556	2.114000	0.64651	0.459000	0.35465	GAT	.	.		0.527	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
TTLL2	83887	hgsc.bcm.edu	37	6	167754699	167754699	+	Silent	SNP	C	C	A	rs201555411		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:167754699C>A	ENST00000239587.5	+	3	1399	c.1311C>A	c.(1309-1311)atC>atA	p.I437I		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	437					cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		ATTCCAACATCGACGCTGCAA	0.423																																					p.I437I		Atlas-SNP	.											TTLL2,NS,carcinoma,0,1	TTLL2	82	.	0			c.C1311A						.						99.0	94.0	96.0					6																	167754699		2203	4300	6503	SO:0001819	synonymous_variant	83887	exon3			CAACATCGACGCT	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.1311C>A	chr6.hg19:g.167754699C>A		66.0	0.0		56.0	54.0	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Silent	SNP	ENST00000239587.5	hg19	CCDS5301.1																																																																																			.	C|1.000;T|0.000		0.423	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
PHF10	55274	hgsc.bcm.edu	37	6	170112536	170112536	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:170112536T>A	ENST00000339209.4	-	8	1026	c.903A>T	c.(901-903)tcA>tcT	p.S301S	PHF10_ENST00000366780.4_Silent_p.S299S	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	301	Essential to induce neural progenitor proliferation. {ECO:0000250}.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		CGCCATCATCTGAATCACCAT	0.478																																					p.S301S		Atlas-SNP	.											.	PHF10	76	.	0			c.A903T						.						161.0	158.0	159.0					6																	170112536		2203	4300	6503	SO:0001819	synonymous_variant	55274	exon8			ATCATCTGAATCA	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.903A>T	chr6.hg19:g.170112536T>A		258.0	0.0		171.0	147.0	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Silent	SNP	ENST00000339209.4	hg19	CCDS5308.2																																																																																			.	.		0.478	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
FTSJ2	29960	hgsc.bcm.edu	37	7	2279075	2279075	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:2279075C>G	ENST00000242257.8	-	2	304	c.276G>C	c.(274-276)caG>caC	p.Q92H	NUDT1_ENST00000397048.1_5'Flank|FTSJ2_ENST00000486040.1_5'UTR|NUDT1_ENST00000397046.1_5'Flank|NUDT1_ENST00000397049.1_5'Flank|NUDT1_ENST00000356714.1_5'Flank|FTSJ2_ENST00000440306.2_Missense_Mutation_p.Q92H|FTSJ2_ENST00000407040.1_5'Flank	NM_013393.1	NP_037525.1			FtsJ RNA methyltransferase homolog 2 (E. coli)											endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.7e-14)		CGTTGACCTTCTGCACCGCCA	0.652																																					p.Q92H		Atlas-SNP	.											.	FTSJ2	22	.	0			c.G276C						.						25.0	25.0	25.0					7																	2279075		2202	4300	6502	SO:0001583	missense	29960	exon2			GACCTTCTGCACC	AF093415	CCDS5328.1	7p22	2012-06-12	2012-06-12		ENSG00000122687	ENSG00000122687			16352	protein-coding gene	gene with protein product	"""rRNA (uridine-2'-O-)-methyltransferase"", ""MRM2 RNA methyltransferase homolog (S. cerevisiae)"""	606906				11827451	Standard	NM_013393		Approved	FJH1, MRM2	uc003slm.3	Q9UI43	OTTHUMG00000023866	ENST00000242257.8:c.276G>C	chr7.hg19:g.2279075C>G	ENSP00000242257:p.Gln92His	38.0	0.0		38.0	20.0	NM_013393		Missense_Mutation	SNP	ENST00000242257.8	hg19	CCDS5328.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.679829	0.29783	.	.	ENSG00000122687	ENST00000242257;ENST00000440306	T;T	0.34472	1.36;1.36	6.03	3.17	0.36434	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.456425	0.23404	N	0.048554	T	0.32224	0.0822	L	0.53780	1.695	0.45161	D	0.998179	B	0.13594	0.008	B	0.20577	0.03	T	0.15350	-1.0440	10	0.62326	D	0.03	.	8.0968	0.30833	0.0:0.628:0.2439:0.1281	.	92	Q9UI43	RRMJ2_HUMAN	H	92	ENSP00000242257:Q92H;ENSP00000392343:Q92H	ENSP00000242257:Q92H	Q	-	3	2	FTSJ2	2245601	0.860000	0.29831	0.616000	0.29078	0.179000	0.23085	0.570000	0.23653	0.828000	0.34709	0.655000	0.94253	CAG	.	.		0.652	FTSJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060187.1	NM_013393	
USP42	84132	hgsc.bcm.edu	37	7	6189834	6189834	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:6189834G>A	ENST00000306177.5	+	13	2165	c.2007G>A	c.(2005-2007)ccG>ccA	p.P669P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	669					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		ACAGTGACCCGAAAGAAAACG	0.572																																					p.P669P		Atlas-SNP	.											.	USP42	138	.	0			c.G2007A						.						35.0	39.0	37.0					7																	6189834		2048	4199	6247	SO:0001819	synonymous_variant	84132	exon13			TGACCCGAAAGAA	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2007G>A	chr7.hg19:g.6189834G>A		48.0	0.0		50.0	31.0	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	hg19	CCDS47535.1																																																																																			.	.		0.572	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
PHF14	9678	hgsc.bcm.edu	37	7	11030469	11030469	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:11030469A>G	ENST00000403050.3	+	4	1492	c.1040A>G	c.(1039-1041)cAt>cGt	p.H347R	PHF14_ENST00000445996.2_Missense_Mutation_p.H62R	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	347					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ATTACAGTCCATGAAGGTAAT	0.368																																					p.H347R		Atlas-SNP	.											.	PHF14	90	.	0			c.A1040G						.						120.0	108.0	112.0					7																	11030469		1892	4129	6021	SO:0001583	missense	9678	exon4			CAGTCCATGAAGG	AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.1040A>G	chr7.hg19:g.11030469A>G	ENSP00000385795:p.His347Arg	99.0	0.0		122.0	50.0	NM_014660	A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	hg19	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522455	0.85600	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	D;D	0.99005	-5.32;-5.32	5.08	5.08	0.68730	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.049587	0.85682	D	0.000000	D	0.99489	0.9818	H	0.95402	3.665	0.80722	D	1	D;D;D;D	0.89917	0.96;0.968;0.991;1.0	D;D;D;D	0.80764	0.923;0.954;0.991;0.994	D	0.98202	1.0468	10	0.87932	D	0	.	15.1637	0.72803	1.0:0.0:0.0:0.0	.	62;62;347;347	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	R	347;62	ENSP00000385795:H347R;ENSP00000403907:H62R	ENSP00000385795:H347R	H	+	2	0	PHF14	10996994	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.270000	0.95690	2.045000	0.60652	0.477000	0.44152	CAT	.	.		0.368	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660	
IGF2BP3	10643	hgsc.bcm.edu	37	7	23391021	23391021	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:23391021A>T	ENST00000258729.3	-	6	942	c.586T>A	c.(586-588)Ttg>Atg	p.L196M	IGF2BP3_ENST00000491719.1_5'UTR	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	196	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						CGCAGAGGCAAATCACATGGT	0.572																																					p.L196M		Atlas-SNP	.											.	IGF2BP3	71	.	0			c.T586A						.						94.0	86.0	88.0					7																	23391021		2203	4300	6503	SO:0001583	missense	10643	exon6			GAGGCAAATCACA	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.586T>A	chr7.hg19:g.23391021A>T	ENSP00000258729:p.Leu196Met	67.0	0.0		69.0	35.0	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	hg19	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	A	19.13	3.767709	0.69878	.	.	ENSG00000136231	ENST00000258729	T	0.45668	0.89	5.88	-2.67	0.06059	K Homology (1);K Homology, type 1 (1);	0.116863	0.56097	D	0.000024	T	0.31389	0.0795	L	0.35487	1.065	0.33660	D	0.609529	P	0.37158	0.585	P	0.47206	0.541	T	0.32161	-0.9917	10	0.38643	T	0.18	-8.5335	3.3418	0.07122	0.2347:0.2999:0.3682:0.0972	.	196	O00425	IF2B3_HUMAN	M	196	ENSP00000258729:L196M	ENSP00000258729:L196M	L	-	1	2	IGF2BP3	23357546	0.944000	0.32072	0.997000	0.53966	0.948000	0.59901	0.141000	0.16076	-0.062000	0.13088	0.459000	0.35465	TTG	.	.		0.572	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
AVL9	23080	hgsc.bcm.edu	37	7	32599056	32599056	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:32599056C>A	ENST00000318709.4	+	10	1416	c.1195C>A	c.(1195-1197)Ccc>Acc	p.P399T	AVL9_ENST00000409301.1_Missense_Mutation_p.P399T|AVL9_ENST00000404479.1_Missense_Mutation_p.P399T	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	399					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GTATGGCATGCCCCTGGCCAT	0.393																																					p.P399T		Atlas-SNP	.											.	AVL9	66	.	0			c.C1195A						.						52.0	53.0	53.0					7																	32599056		2119	4034	6153	SO:0001583	missense	23080	exon10			GGCATGCCCCTGG	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.1195C>A	chr7.hg19:g.32599056C>A	ENSP00000315568:p.Pro399Thr	126.0	0.0		128.0	32.0	NM_015060	Q92573	Missense_Mutation	SNP	ENST00000318709.4	hg19	CCDS34613.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829534	0.90955	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.89294	0.6674	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;0.975;1.0	D;P;D	0.91635	0.999;0.796;0.999	D	0.90751	0.4657	10	0.87932	D	0	-12.1445	19.3887	0.94570	0.0:1.0:0.0:0.0	.	399;399;399	Q8N6Z3;Q8NBF6-2;Q8NBF6	.;.;AVL9_HUMAN	T	399;399;399;399;330	ENSP00000315568:P399T;ENSP00000387011:P399T;ENSP00000385242:P399T;ENSP00000395134:P330T	ENSP00000315568:P399T	P	+	1	0	AVL9	32565581	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.458000	0.80787	2.826000	0.97356	0.655000	0.94253	CCC	.	.		0.393	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
GLI3	2737	hgsc.bcm.edu	37	7	42007259	42007259	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:42007259A>T	ENST00000395925.3	-	14	2450	c.2366T>A	c.(2365-2367)aTg>aAg	p.M789K	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	789					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TCGCGGAAACATTCCATTCAC	0.512									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.M789K		Atlas-SNP	.											.	GLI3	312	.	0			c.T2366A						.						288.0	281.0	283.0					7																	42007259		2203	4300	6503	SO:0001583	missense	2737	exon14	Familial Cancer Database	;	GGAAACATTCCAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2366T>A	chr7.hg19:g.42007259A>T	ENSP00000379258:p.Met789Lys	139.0	0.0		144.0	65.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.883752	0.33255	.	.	ENSG00000106571	ENST00000395925	T	0.12879	2.64	5.58	3.23	0.37069	.	0.347019	0.41194	D	0.000939	T	0.13927	0.0337	L	0.57536	1.79	0.80722	D	1	B	0.16396	0.017	B	0.17098	0.017	T	0.04930	-1.0917	10	0.34782	T	0.22	.	8.8253	0.35052	0.7879:0.0:0.2121:0.0	.	789	P10071	GLI3_HUMAN	K	789	ENSP00000379258:M789K	ENSP00000379258:M789K	M	-	2	0	GLI3	41973784	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	3.692000	0.54727	0.428000	0.26173	0.533000	0.62120	ATG	.	.		0.512	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
HECW1	23072	hgsc.bcm.edu	37	7	43484963	43484963	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:43484963C>A	ENST00000395891.2	+	11	2797	c.2192C>A	c.(2191-2193)aCg>aAg	p.T731K	HECW1_ENST00000453890.1_Missense_Mutation_p.T731K	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	731					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TCCGAGAGCACGGTCTTCTCC	0.632																																					p.T731K		Atlas-SNP	.											.	HECW1	540	.	0			c.C2192A						.						70.0	76.0	74.0					7																	43484963		2134	4233	6367	SO:0001583	missense	23072	exon11			AGAGCACGGTCTT	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2192C>A	chr7.hg19:g.43484963C>A	ENSP00000379228:p.Thr731Lys	93.0	0.0		65.0	29.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	hg19	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	25.5	4.641062	0.87859	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.45276	1.38;0.9	4.62	4.62	0.57501	.	0.419197	0.26812	N	0.022366	T	0.53562	0.1804	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.975	T	0.45498	-0.9257	10	0.19590	T	0.45	.	17.4549	0.87604	0.0:1.0:0.0:0.0	.	731;731	B4DH42;Q76N89	.;HECW1_HUMAN	K	731	ENSP00000379228:T731K;ENSP00000407774:T731K	ENSP00000265522:T731K	T	+	2	0	HECW1	43451488	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	7.567000	0.82357	2.106000	0.64143	0.591000	0.81541	ACG	.	.		0.632	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
ABCA13	154664	hgsc.bcm.edu	37	7	48278844	48278844	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:48278844A>T	ENST00000435803.1	+	9	928	c.904A>T	c.(904-906)Aca>Tca	p.T302S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	302					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCAGATTCCCACAGACACTTC	0.433																																					p.T302S		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A904T						.						68.0	66.0	66.0					7																	48278844		1916	4130	6046	SO:0001583	missense	154664	exon9			ATTCCCACAGACA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.904A>T	chr7.hg19:g.48278844A>T	ENSP00000411096:p.Thr302Ser	53.0	0.0		50.0	21.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	2.938	-0.219609	0.06061	.	.	ENSG00000179869	ENST00000435803	D	0.89343	-2.5	4.87	2.46	0.29980	.	0.606251	0.14683	N	0.304644	T	0.79082	0.4386	N	0.19112	0.55	0.09310	N	0.999999	B	0.10296	0.003	B	0.11329	0.006	T	0.69643	-0.5090	10	0.72032	D	0.01	.	6.3152	0.21186	0.7983:0.0:0.2017:0.0	.	302	Q86UQ4	ABCAD_HUMAN	S	302	ENSP00000411096:T302S	ENSP00000411096:T302S	T	+	1	0	ABCA13	48249390	0.467000	0.25831	0.046000	0.18839	0.043000	0.13939	0.894000	0.28350	0.886000	0.36113	0.533000	0.62120	ACA	.	.		0.433	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
MUC17	140453	hgsc.bcm.edu	37	7	100676441	100676441	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:100676441G>A	ENST00000306151.4	+	3	1808	c.1744G>A	c.(1744-1746)Gtg>Atg	p.V582M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	582	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCAGGCTGGTGGTCAGTTC	0.473																																					p.V582M		Atlas-SNP	.											.	MUC17	804	.	0			c.G1744A						.						263.0	269.0	267.0					7																	100676441		2203	4300	6503	SO:0001583	missense	140453	exon3			AGGCTGGTGGTCA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1744G>A	chr7.hg19:g.100676441G>A	ENSP00000302716:p.Val582Met	77.0	0.0		69.0	38.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	g	2.045	-0.419012	0.04766	.	.	ENSG00000169876	ENST00000306151	T	0.02763	4.17	0.647	-0.467	0.12150	.	.	.	.	.	T	0.01800	0.0057	N	0.14661	0.345	0.09310	N	1	B	0.23806	0.091	B	0.17979	0.02	T	0.46062	-0.9218	9	0.46703	T	0.11	.	4.6401	0.12545	0.2876:0.0:0.7124:0.0	.	582	Q685J3	MUC17_HUMAN	M	582	ENSP00000302716:V582M	ENSP00000302716:V582M	V	+	1	0	MUC17	100463161	0.007000	0.16637	0.000000	0.03702	0.001000	0.01503	0.635000	0.24629	-0.175000	0.10725	0.395000	0.25975	GTG	.	.		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	hgsc.bcm.edu	37	7	100684989	100684989	+	Missense_Mutation	SNP	C	C	T	rs190089107		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:100684989C>T	ENST00000306151.4	+	3	10356	c.10292C>T	c.(10291-10293)aCc>aTc	p.T3431I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3431	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTCTGGTGACCACTTCTACT	0.488																																					p.T3431I		Atlas-SNP	.											.	MUC17	804	.	0			c.C10292T						.						231.0	239.0	236.0					7																	100684989		2203	4300	6503	SO:0001583	missense	140453	exon3			TGGTGACCACTTC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10292C>T	chr7.hg19:g.100684989C>T	ENSP00000302716:p.Thr3431Ile	97.0	0.0		99.0	47.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	8.430	0.848466	0.17034	.	.	ENSG00000169876	ENST00000306151	T	0.01933	4.55	1.52	-0.968	0.10313	.	.	.	.	.	T	0.02767	0.0083	N	0.19112	0.55	0.09310	N	1	P	0.51449	0.945	P	0.53062	0.717	T	0.47142	-0.9140	9	0.39692	T	0.17	.	6.214	0.20646	0.0:0.7206:0.0:0.2794	.	3431	Q685J3	MUC17_HUMAN	I	3431	ENSP00000302716:T3431I	ENSP00000302716:T3431I	T	+	2	0	MUC17	100471709	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	1.155000	0.31700	-0.582000	0.05929	0.186000	0.17326	ACC	.	C|1.000;G|0.000		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
RBM28	55131	hgsc.bcm.edu	37	7	127978350	127978350	+	Silent	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:127978350T>G	ENST00000223073.2	-	5	609	c.495A>C	c.(493-495)ctA>ctC	p.L165L	RBM28_ENST00000415472.2_Intron	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	165	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						TACCTGCTTCTAGGAGGTTTT	0.418																																					p.L165L		Atlas-SNP	.											.	RBM28	71	.	0			c.A495C						.						122.0	112.0	116.0					7																	127978350		2203	4300	6503	SO:0001819	synonymous_variant	55131	exon5			TGCTTCTAGGAGG	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.495A>C	chr7.hg19:g.127978350T>G		106.0	0.0		103.0	43.0	NM_018077	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	ENST00000223073.2	hg19	CCDS5801.1																																																																																			.	.		0.418	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077	
CPA4	51200	hgsc.bcm.edu	37	7	129951962	129951962	+	Splice_Site	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:129951962T>A	ENST00000222482.4	+	10	1106	c.1078T>A	c.(1078-1080)Tat>Aat	p.Y360N	CPA4_ENST00000445470.2_Splice_Site_p.Y327N|CPA4_ENST00000493259.1_Splice_Site_p.Y256N	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	360					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					CACCACTGTCTGTAAGTACTC	0.502																																					p.Y360N		Atlas-SNP	.											.	CPA4	47	.	0			c.T1078A						.						76.0	71.0	73.0					7																	129951962		2203	4300	6503	SO:0001630	splice_region_variant	51200	exon10			ACTGTCTGTAAGT	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.1078+1T>A	chr7.hg19:g.129951962T>A		57.0	0.0		51.0	25.0	NM_016352	B7Z576|Q86UY9	Missense_Mutation	SNP	ENST00000222482.4	hg19	CCDS5818.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.637109	0.87760	.	.	ENSG00000128510	ENST00000445470;ENST00000222482;ENST00000538687;ENST00000493259	T;T;T	0.05786	3.39;3.39;3.39	5.88	5.88	0.94601	Peptidase M14, carboxypeptidase A (2);	0.129240	0.53938	D	0.000045	T	0.32466	0.0830	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.85130	0.997;0.962	T	0.24190	-1.0167	10	0.87932	D	0	.	15.1337	0.72545	0.0:0.0:0.0:1.0	.	327;360	B7Z576;Q9UI42	.;CBPA4_HUMAN	N	327;360;165;256	ENSP00000412947:Y327N;ENSP00000222482:Y360N;ENSP00000419660:Y256N	ENSP00000222482:Y360N	Y	+	1	0	CPA4	129739198	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	6.796000	0.75145	2.257000	0.74773	0.459000	0.35465	TAT	.	.		0.502	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352	Missense_Mutation
HIPK2	28996	hgsc.bcm.edu	37	7	139416674	139416675	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:139416674_139416675TC>AA	ENST00000406875.3	-	2	253_254	c.159_160GA>TT	c.(157-162)caGAgc>caTTgc	p.53_54QS>HC	HIPK2_ENST00000428878.2_Missense_Mutation_p.53_54QS>HC|HIPK2_ENST00000342645.6_Missense_Mutation_p.53_54QS>HC	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	53					adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					ATGTTCTTGCTCTGGCTATACA	0.54																																					p.S54C|p.Q53H		Atlas-SNP	.											.	HIPK2	192	.	0			c.A160T|c.G159T						.																																			SO:0001583	missense	28996	exon2			TCTTGCTCTGGCT|CTTGCTCTGGCTA	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.159_160delinsAA	chr7.hg19:g.139416674_139416675delinsAA	ENSP00000385571:p.Q53_S54delinsHC	135.0	0.0		122.0|124.0	66.0|67.0	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	hg19																																																																																				.	.		0.540	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
MRPS33	51650	hgsc.bcm.edu	37	7	140710338	140710338	+	Silent	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:140710338T>C	ENST00000393008.3	-	2	251	c.96A>G	c.(94-96)aaA>aaG	p.K32K	MRPS33_ENST00000472343.1_5'Flank|MRPS33_ENST00000496958.1_Silent_p.K32K|MRPS33_ENST00000324787.5_Silent_p.K32K|MRPS33_ENST00000467334.1_Silent_p.K22K|MRPS33_ENST00000469351.1_Silent_p.K32K	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	32					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					GTTTCACCACTTTCATAGACT	0.468																																					p.K32K		Atlas-SNP	.											.	MRPS33	8	.	0			c.A96G						.						163.0	146.0	151.0					7																	140710338		2203	4300	6503	SO:0001819	synonymous_variant	51650	exon2			CACCACTTTCATA	AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.96A>G	chr7.hg19:g.140710338T>C		161.0	0.0		156.0	57.0	NM_016071		Silent	SNP	ENST00000393008.3	hg19	CCDS5864.1																																																																																			.	.		0.468	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348878.1	NM_053035	
CNPY1	285888	hgsc.bcm.edu	37	7	155301641	155301641	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:155301641T>A	ENST00000321736.5	-	2	254	c.92A>T	c.(91-93)gAa>gTa	p.E31V	CNPY1_ENST00000406197.1_Missense_Mutation_p.E31V|AC008060.5_ENST00000415333.1_RNA	NM_001103176.1	NP_001096646.1	Q3B7I2	CNPY1_HUMAN	canopy FGF signaling regulator 1	31										breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		TTTTTTAAATTCTTGGTATAT	0.388																																					p.E31V		Atlas-SNP	.											.	CNPY1	20	.	0			c.A92T						.						69.0	68.0	68.0					7																	155301641		1794	4061	5855	SO:0001583	missense	285888	exon2			TTAAATTCTTGGT		CCDS43684.1	7q36.3	2014-02-12	2013-07-23		ENSG00000146910	ENSG00000146910			27786	protein-coding gene	gene with protein product		612493	"""canopy 1 homolog (zebrafish)"""			16488878	Standard	NM_001103176		Approved		uc003wmc.1	Q3B7I2	OTTHUMG00000151353	ENST00000321736.5:c.92A>T	chr7.hg19:g.155301641T>A	ENSP00000317439:p.Glu31Val	124.0	0.0		107.0	42.0	NM_001103176	A6NGX3	Missense_Mutation	SNP	ENST00000321736.5	hg19	CCDS43684.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.556167	0.45487	.	.	ENSG00000146910	ENST00000406197;ENST00000321736	T;T	0.32272	1.46;1.46	4.85	3.69	0.42338	.	0.113150	0.64402	D	0.000020	T	0.20659	0.0497	.	.	.	0.30935	N	0.726513	B	0.25351	0.124	B	0.21917	0.037	T	0.18335	-1.0340	9	0.87932	D	0	-17.5333	3.6404	0.08165	0.1304:0.0756:0.1355:0.6585	.	31	Q3B7I2	CNPY1_HUMAN	V	31	ENSP00000384514:E31V;ENSP00000317439:E31V	ENSP00000317439:E31V	E	-	2	0	CNPY1	154994402	1.000000	0.71417	0.520000	0.27837	0.443000	0.32047	2.600000	0.46240	0.709000	0.31976	0.455000	0.32223	GAA	.	.		0.388	CNPY1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322335.1	XM_001129537	
MNX1	3110	hgsc.bcm.edu	37	7	156802352	156802352	+	Splice_Site	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr7:156802352A>T	ENST00000252971.6	-	1	992		c.e1+1		MNX1-AS2_ENST00000429228.1_RNA|MNX1_ENST00000469500.1_5'Flank|MNX1_ENST00000543409.1_5'Flank|MNX1-AS1_ENST00000480284.1_RNA	NM_005515.3	NP_005506.3	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1						anatomical structure morphogenesis (GO:0009653)|diaphragm development (GO:0060539)|dorsal/ventral neural tube patterning (GO:0021904)|endocrine pancreas development (GO:0031018)|humoral immune response (GO:0006959)|motor neuron axon guidance (GO:0008045)|nerve development (GO:0021675)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGGGTACTCACAGTTGAAGT	0.711																																					.		Atlas-SNP	.											.	MNX1	17	.	0			c.691+2T>A						.						11.0	11.0	11.0					7																	156802352		2133	4174	6307	SO:0001630	splice_region_variant	3110	exon2			GTACTCACAGTTG	AF107457	CCDS34788.1, CCDS55187.1	7q36	2012-03-09	2007-08-09	2007-08-09	ENSG00000130675	ENSG00000130675		"""Homeoboxes / ANTP class : HOXL subclass"""	4979	protein-coding gene	gene with protein product		142994	"""homeo box HB9"", ""homeobox HB9"""	HLXB9		9843207	Standard	NM_001165255		Approved	HB9, HOXHB9, SCRA1	uc003wmz.4	P50219	OTTHUMG00000157181	ENST00000252971.6:c.691+1T>A	chr7.hg19:g.156802352A>T		69.0	0.0		55.0	24.0	NM_005515	F5H401|Q9Y648	Splice_Site	SNP	ENST00000252971.6	hg19	CCDS34788.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.646622	0.67358	.	.	ENSG00000130675	ENST00000252971;ENST00000542972	.	.	.	3.12	3.12	0.35913	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7819	0.46382	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MNX1	156495113	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.846000	0.86887	1.331000	0.45412	0.449000	0.29647	.	.	.		0.711	MNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347796.3		Intron
MSR1	4481	hgsc.bcm.edu	37	8	16035438	16035438	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:16035438A>T	ENST00000262101.5	-	2	181	c.60T>A	c.(58-60)tcT>tcA	p.S20S	MSR1_ENST00000355282.2_Silent_p.S20S|MSR1_ENST00000445506.2_Silent_p.S38S|MSR1_ENST00000536385.1_5'UTR|MSR1_ENST00000381998.4_Silent_p.S20S|MSR1_ENST00000350896.3_Silent_p.S20S			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	20					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CAAATTTCACAGATTCGGAGC	0.418																																					p.S20S		Atlas-SNP	.											.	MSR1	140	.	0			c.T60A						.						87.0	80.0	82.0					8																	16035438		2203	4300	6503	SO:0001819	synonymous_variant	4481	exon2			TTTCACAGATTCG	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.60T>A	chr8.hg19:g.16035438A>T		77.0	0.0		41.0	36.0	NM_138715	D3DSP3|O60505|P21759|Q45F10	Silent	SNP	ENST00000262101.5	hg19	CCDS5995.1																																																																																			.	.		0.418	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
TEX15	56154	hgsc.bcm.edu	37	8	30705371	30705371	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:30705371A>G	ENST00000256246.2	-	1	1237	c.1163T>C	c.(1162-1164)aTa>aCa	p.I388T	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	388					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GGCCTGGGGTATGTCTTTTGG	0.338																																					p.I388T		Atlas-SNP	.											.	TEX15	350	.	0			c.T1163C						.						110.0	109.0	109.0					8																	30705371		2203	4299	6502	SO:0001583	missense	56154	exon1			TGGGGTATGTCTT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1163T>C	chr8.hg19:g.30705371A>G	ENSP00000256246:p.Ile388Thr	124.0	0.0		60.0	51.0	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	hg19	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	A	8.274	0.814017	0.16537	.	.	ENSG00000133863	ENST00000256246	T	0.12039	2.72	5.61	0.49	0.16861	.	0.199081	0.35320	N	0.003300	T	0.06781	0.0173	N	0.17082	0.46	0.09310	N	1	B	0.21821	0.061	B	0.19391	0.025	T	0.25779	-1.0122	10	0.87932	D	0	.	3.6348	0.08145	0.5706:0.0:0.153:0.2763	.	388	Q9BXT5	TEX15_HUMAN	T	388	ENSP00000256246:I388T	ENSP00000256246:I388T	I	-	2	0	TEX15	30824913	0.549000	0.26481	0.005000	0.12908	0.001000	0.01503	1.452000	0.35156	0.132000	0.18615	-0.256000	0.11100	ATA	.	.		0.338	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
RGS20	8601	hgsc.bcm.edu	37	8	54792132	54792132	+	Silent	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:54792132C>T	ENST00000297313.3	+	2	572	c.480C>T	c.(478-480)gaC>gaT	p.D160D	RGS20_ENST00000276500.4_5'Flank|RGS20_ENST00000344277.6_Intron|RGS20_ENST00000522225.1_5'Flank|RP11-1070A24.2_ENST00000606037.1_RNA	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	160					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			GGGAAGAAGACGCCACCGCTG	0.706																																					p.D160D		Atlas-SNP	.											.	RGS20	51	.	0			c.C480T						.						11.0	9.0	10.0					8																	54792132		2045	4035	6080	SO:0001819	synonymous_variant	8601	exon2			AGAAGACGCCACC	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.480C>T	chr8.hg19:g.54792132C>T		90.0	0.0		95.0	20.0	NM_170587	Q96BG9	Silent	SNP	ENST00000297313.3	hg19	CCDS6155.1																																																																																			.	.		0.706	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
PREX2	80243	hgsc.bcm.edu	37	8	69143582	69143582	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:69143582G>T	ENST00000288368.4	+	40	5067	c.4790G>T	c.(4789-4791)tGc>tTc	p.C1597F		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1597					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TACAAGCTGTGCGAGCCACCT	0.448																																					p.C1597F		Atlas-SNP	.											.	PREX2	614	.	0			c.G4790T						.						67.0	58.0	61.0					8																	69143582		2203	4300	6503	SO:0001583	missense	80243	exon40			AGCTGTGCGAGCC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4790G>T	chr8.hg19:g.69143582G>T	ENSP00000288368:p.Cys1597Phe	70.0	0.0		92.0	34.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907386	0.72868	.	.	ENSG00000046889	ENST00000288368	T	0.61040	0.14	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.67822	0.2934	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70263	-0.4920	10	0.87932	D	0	.	16.5942	0.84791	0.0:0.0:1.0:0.0	.	1597	Q70Z35	PREX2_HUMAN	F	1597	ENSP00000288368:C1597F	ENSP00000288368:C1597F	C	+	2	0	PREX2	69306136	1.000000	0.71417	0.993000	0.49108	0.904000	0.53231	6.408000	0.73285	2.655000	0.90218	0.551000	0.68910	TGC	.	.		0.448	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
TERF1	7013	hgsc.bcm.edu	37	8	73932979	73932979	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:73932979G>C	ENST00000276603.5	+	3	499	c.476G>C	c.(475-477)gGt>gCt	p.G159A	TERF1_ENST00000276602.6_Missense_Mutation_p.G159A|RNU6-285P_ENST00000410556.1_RNA	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	159	TRFH dimerization.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			ATGATTTGGGGTTCAATTGAA	0.289																																					p.G159A		Atlas-SNP	.											.	TERF1	48	.	0			c.G476C						.						42.0	40.0	40.0					8																	73932979		2202	4293	6495	SO:0001583	missense	7013	exon3			TTTGGGGTTCAAT	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.476G>C	chr8.hg19:g.73932979G>C	ENSP00000276603:p.Gly159Ala	266.0	0.0		356.0	135.0	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Missense_Mutation	SNP	ENST00000276603.5	hg19	CCDS6211.1	.	.	.	.	.	.	.	.	.	.	G	3.503	-0.101319	0.06967	.	.	ENSG00000147601	ENST00000276603;ENST00000276602;ENST00000518874;ENST00000517390	.	.	.	4.82	-1.45	0.08828	Telomere repeat-binding factor, dimerisation domain (4);	1.369990	0.04350	N	0.355562	T	0.12944	0.0314	N	0.00926	-1.1	0.21782	N	0.999542	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.21621	-1.0240	9	0.18276	T	0.48	.	8.8466	0.35174	0.544:0.3273:0.1288:0.0	.	159;159	P54274-2;P54274	.;TERF1_HUMAN	A	159;159;127;55	.	ENSP00000276602:G159A	G	+	2	0	TERF1	74095533	0.090000	0.21635	0.978000	0.43139	0.991000	0.79684	-0.285000	0.08410	-0.148000	0.11234	0.467000	0.42956	GGT	.	.		0.289	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
ZFAND1	79752	hgsc.bcm.edu	37	8	82615054	82615054	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:82615054T>C	ENST00000220669.5	-	8	701	c.683A>G	c.(682-684)gAt>gGt	p.D228G	ZFAND1_ENST00000519338.1_5'UTR|ZFAND1_ENST00000521895.1_Silent_p.G118G|ZFAND1_ENST00000523096.1_Missense_Mutation_p.D221G|ZFAND1_ENST00000521287.1_Missense_Mutation_p.D121G|ZFAND1_ENST00000522520.1_Missense_Mutation_p.D121G	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	228							zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CAAAGTATGATCCAAGGGTAA	0.353																																					p.D228G		Atlas-SNP	.											.	ZFAND1	29	.	0			c.A683G						.						128.0	139.0	135.0					8																	82615054		2203	4300	6503	SO:0001583	missense	79752	exon8			GTATGATCCAAGG		CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.683A>G	chr8.hg19:g.82615054T>C	ENSP00000220669:p.Asp228Gly	182.0	0.0		202.0	25.0	NM_024699	E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Missense_Mutation	SNP	ENST00000220669.5	hg19	CCDS6232.1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863645	0.71949	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000522520;ENST00000521287	.	.	.	5.61	5.61	0.85477	.	0.143872	0.64402	D	0.000011	T	0.65407	0.2688	M	0.65975	2.015	0.80722	D	1	P;P	0.47762	0.9;0.9	P;P	0.49012	0.598;0.493	T	0.67650	-0.5616	9	0.48119	T	0.1	.	15.794	0.78394	0.0:0.0:0.0:1.0	.	221;228	E5RIG0;Q8TCF1	.;ZFAN1_HUMAN	G	221;228;121;121	.	ENSP00000220669:D228G	D	-	2	0	ZFAND1	82777609	1.000000	0.71417	0.975000	0.42487	0.982000	0.71751	7.198000	0.77823	2.137000	0.66172	0.477000	0.44152	GAT	.	.		0.353	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379739.1	NM_024699	
TP53INP1	94241	hgsc.bcm.edu	37	8	95952315	95952315	+	Silent	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:95952315G>T	ENST00000342697.4	-	3	653	c.246C>A	c.(244-246)tcC>tcA	p.S82S	NDUFAF6_ENST00000396113.1_Intron|TP53INP1_ENST00000448464.2_Silent_p.S82S|TP53INP1_ENST00000378776.4_Silent_p.S82S	NM_033285.3	NP_150601.1	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	82					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to hydroperoxide (GO:0071447)|cellular response to methyl methanesulfonate (GO:0072703)|cellular response to UV (GO:0034644)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|response to heat (GO:0009408)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)			kidney(2)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	9	Breast(36;8.75e-07)					GGAGAAAGCAGGAATCACTTG	0.473																																					p.S82S		Atlas-SNP	.											.	TP53INP1	22	.	0			c.C246A						.						118.0	117.0	118.0					8																	95952315		2203	4300	6503	SO:0001819	synonymous_variant	94241	exon3			AAAGCAGGAATCA	AF409115	CCDS6265.1, CCDS47899.1	8q22	2004-03-11				ENSG00000164938			18022	protein-coding gene	gene with protein product		606185				11511362, 12438758	Standard	NM_033285		Approved	DKFZp434M1317, FLJ22139, P53DINP1, SIP, TP53INP1A, TP53INP1B, Teap	uc003yhg.3	Q96A56		ENST00000342697.4:c.246C>A	chr8.hg19:g.95952315G>T		161.0	0.0		165.0	23.0	NM_001135733	B2RCE5|Q969R9	Silent	SNP	ENST00000342697.4	hg19	CCDS6265.1																																																																																			.	.		0.473	TP53INP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379818.1		
OSR2	116039	hgsc.bcm.edu	37	8	99963924	99963924	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:99963924T>G	ENST00000297565.4	+	4	1430	c.934T>G	c.(934-936)Ttc>Gtc	p.F312V	OSR2_ENST00000457907.2_Missense_Mutation_p.F433V|OSR2_ENST00000435298.2_3'UTR|OSR2_ENST00000522510.1_Missense_Mutation_p.F312V	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	312					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			GCGGCAGGACTTCTAGAGAAG	0.627																																					p.F312V		Atlas-SNP	.											.	OSR2	56	.	0			c.T934G						.						27.0	30.0	30.0					8																	99963924		1976	4135	6111	SO:0001583	missense	116039	exon4			CAGGACTTCTAGA	AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.934T>G	chr8.hg19:g.99963924T>G	ENSP00000297565:p.Phe312Val	49.0	0.0		69.0	29.0	NM_001142462	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	ENST00000297565.4	hg19	CCDS47901.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.196137	0.58126	.	.	ENSG00000164920	ENST00000297565;ENST00000522510;ENST00000457907	T;T;T	0.12361	2.98;2.98;2.69	5.32	5.32	0.75619	.	0.089158	0.47093	D	0.000246	T	0.19167	0.0460	M	0.86097	2.795	0.46458	D	0.99905	P;B	0.43094	0.799;0.043	B;B	0.30401	0.115;0.011	T	0.12915	-1.0529	9	.	.	.	.	15.4552	0.75308	0.0:0.0:0.0:1.0	.	433;312	B4E3B7;Q8N2R0	.;OSR2_HUMAN	V	312;312;433	ENSP00000297565:F312V;ENSP00000430780:F312V;ENSP00000414657:F433V	.	F	+	1	0	OSR2	100033100	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.449000	0.80643	2.222000	0.72286	0.533000	0.62120	TTC	.	.		0.627	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001	
DENND3	22898	hgsc.bcm.edu	37	8	142151309	142151309	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:142151309A>G	ENST00000262585.2	+	4	547	c.269A>G	c.(268-270)tAc>tGc	p.Y90C	DENND3_ENST00000518347.1_Missense_Mutation_p.Y170C|DENND3_ENST00000519811.1_Missense_Mutation_p.Y170C|DENND3_ENST00000424248.1_Missense_Mutation_p.Y90C	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	90					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TAGGATGAGTACTGTTTCTAC	0.527																																					p.Y90C		Atlas-SNP	.											.	DENND3	127	.	0			c.A269G						.						165.0	122.0	137.0					8																	142151309		2203	4300	6503	SO:0001583	missense	22898	exon4			ATGAGTACTGTTT	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.269A>G	chr8.hg19:g.142151309A>G	ENSP00000262585:p.Tyr90Cys	61.0	0.0		78.0	23.0	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	hg19	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	A	3.007	-0.204700	0.06180	.	.	ENSG00000105339	ENST00000519291;ENST00000518347;ENST00000262585;ENST00000424248;ENST00000519811;ENST00000523058;ENST00000518249	T;T;T;T	0.45668	2.92;2.51;2.92;0.89	5.14	-0.135	0.13477	.	0.959493	0.08722	N	0.903310	T	0.25195	0.0612	N	0.16478	0.41	0.09310	N	1	B;B;B	0.12630	0.004;0.002;0.006	B;B;B	0.08055	0.002;0.002;0.003	T	0.21280	-1.0250	10	0.38643	T	0.18	-21.0611	7.603	0.28087	0.3016:0.4882:0.2102:0.0	.	170;90;170	E9PF32;A2RUS2;E5RIR7	.;DEND3_HUMAN;.	C	103;170;90;90;170;170;3	ENSP00000262585:Y90C;ENSP00000410594:Y90C;ENSP00000428714:Y170C;ENSP00000430786:Y170C	ENSP00000262585:Y90C	Y	+	2	0	DENND3	142220491	0.000000	0.05858	0.018000	0.16275	0.151000	0.21798	0.014000	0.13333	-0.270000	0.09285	0.533000	0.62120	TAC	.	.		0.527	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
ZNF16	7564	hgsc.bcm.edu	37	8	146157778	146157778	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr8:146157778T>A	ENST00000276816.4	-	4	581	c.395A>T	c.(394-396)cAg>cTg	p.Q132L	ZNF16_ENST00000394909.2_Missense_Mutation_p.Q132L	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	132	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GTCCCCCTCCTGGGAGAGGGA	0.567																																					p.Q132L		Atlas-SNP	.											.	ZNF16	80	.	0			c.A395T						.						71.0	77.0	75.0					8																	146157778		2203	4300	6503	SO:0001583	missense	7564	exon3			CCCTCCTGGGAGA	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.395A>T	chr8.hg19:g.146157778T>A	ENSP00000276816:p.Gln132Leu	68.0	0.0		91.0	46.0	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	hg19	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	T	8.998	0.979507	0.18812	.	.	ENSG00000170631	ENST00000276816;ENST00000394909;ENST00000532351	T;T;T	0.10005	2.92;2.92;4.54	3.85	-3.33	0.04958	.	.	.	.	.	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B	0.26400	0.148	B	0.19391	0.025	T	0.43605	-0.9381	9	0.24483	T	0.36	.	7.4432	0.27196	0.0:0.5521:0.161:0.2869	.	132	P17020	ZNF16_HUMAN	L	132	ENSP00000276816:Q132L;ENSP00000378369:Q132L;ENSP00000434321:Q132L	ENSP00000276816:Q132L	Q	-	2	0	ZNF16	146128582	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-2.768000	0.00781	-0.757000	0.04697	0.460000	0.39030	CAG	.	.		0.567	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
VLDLR	7436	hgsc.bcm.edu	37	9	2641451	2641451	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr9:2641451T>A	ENST00000382100.3	+	4	756	c.400T>A	c.(400-402)Tgt>Agt	p.C134S	VLDLR_ENST00000382099.2_Missense_Mutation_p.C134S|RP11-125B21.2_ENST00000599229.1_RNA	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	134	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		GTCCTGGAGATGTGATGGTGA	0.428																																					p.C134S		Atlas-SNP	.											.	VLDLR	68	.	0			c.T400A						.						244.0	220.0	228.0					9																	2641451		2203	4300	6503	SO:0001583	missense	7436	exon4			TGGAGATGTGATG		CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.400T>A	chr9.hg19:g.2641451T>A	ENSP00000371532:p.Cys134Ser	127.0	0.0		60.0	50.0	NM_003383	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	ENST00000382100.3	hg19	CCDS6446.1	.	.	.	.	.	.	.	.	.	.	T	32	5.135462	0.94517	.	.	ENSG00000147852	ENST00000382100;ENST00000382099	D;D	0.99751	-6.63;-6.63	6.07	6.07	0.98685	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000018	D	0.99904	0.9954	H	0.99705	4.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96006	0.8997	10	0.87932	D	0	.	16.6288	0.85011	0.0:0.0:0.0:1.0	.	134;134	Q5VVF5;P98155	.;VLDLR_HUMAN	S	134	ENSP00000371532:C134S;ENSP00000371531:C134S	ENSP00000371531:C134S	C	+	1	0	VLDLR	2631451	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.326000	0.78906	0.533000	0.62120	TGT	.	.		0.428	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383	
GABBR2	9568	hgsc.bcm.edu	37	9	101068512	101068512	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr9:101068512G>A	ENST00000259455.2	-	15	2579	c.2120C>T	c.(2119-2121)gCc>gTc	p.A707V		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	707					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GGAGACAGCGGCCCCGATGAT	0.572																																					p.A707V		Atlas-SNP	.											.	GABBR2	126	.	0			c.C2120T						.						147.0	100.0	116.0					9																	101068512		2203	4300	6503	SO:0001583	missense	9568	exon15			ACAGCGGCCCCGA	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.2120C>T	chr9.hg19:g.101068512G>A	ENSP00000259455:p.Ala707Val	186.0	0.0		77.0	69.0	NM_005458	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	ENST00000259455.2	hg19	CCDS6736.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904030	0.92035	.	.	ENSG00000136928	ENST00000259455	D	0.86694	-2.16	5.0	5.0	0.66597	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.87330	0.6150	N	0.13327	0.33	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.87769	0.2604	10	0.38643	T	0.18	.	15.8197	0.78631	0.0:0.0:1.0:0.0	.	707	O75899	GABR2_HUMAN	V	707	ENSP00000259455:A707V	ENSP00000259455:A707V	A	-	2	0	GABBR2	100108333	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	9.641000	0.98458	2.328000	0.79073	0.561000	0.74099	GCC	.	.		0.572	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1		
AKNA	80709	hgsc.bcm.edu	37	9	117139221	117139221	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr9:117139221C>T	ENST00000307564.4	-	3	1027	c.866G>A	c.(865-867)tGc>tAc	p.C289Y	AKNA_ENST00000374075.5_Missense_Mutation_p.C208Y|AKNA_ENST00000312033.3_Missense_Mutation_p.C289Y|AKNA_ENST00000223791.3_5'UTR|AKNA_ENST00000374088.3_Missense_Mutation_p.C289Y	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	289					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGGCTGAGGGCAGAAGAATCT	0.582																																					p.C289Y		Atlas-SNP	.											.	AKNA	119	.	0			c.G866A						.						119.0	106.0	110.0					9																	117139221		2203	4300	6503	SO:0001583	missense	80709	exon3			TGAGGGCAGAAGA	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.866G>A	chr9.hg19:g.117139221C>T	ENSP00000303769:p.Cys289Tyr	91.0	0.0		30.0	26.0	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	hg19	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.475252	0.26511	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.35973	2.49;2.49;2.49;1.28	4.62	-0.0976	0.13632	.	0.998707	0.08102	N	0.997607	T	0.18257	0.0438	N	0.24115	0.695	0.09310	N	1	P;P;P	0.39157	0.483;0.531;0.662	B;B;B	0.31191	0.092;0.059;0.125	T	0.19516	-1.0303	10	0.62326	D	0.03	-2.6896	2.5187	0.04675	0.3038:0.4387:0.1499:0.1076	.	289;289;208	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	Y	289;130;289;208;289;289	ENSP00000303769:C289Y;ENSP00000363201:C289Y;ENSP00000363188:C208Y;ENSP00000309222:C289Y	ENSP00000303769:C289Y	C	-	2	0	AKNA	116179042	0.135000	0.22499	0.130000	0.21974	0.138000	0.21146	0.473000	0.22132	0.281000	0.22233	0.561000	0.74099	TGC	.	.		0.582	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
URM1	81605	hgsc.bcm.edu	37	9	131133678	131133678	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr9:131133678G>C	ENST00000372853.4	+	1	81	c.19G>C	c.(19-21)Gtg>Ctg	p.V7L	URM1_ENST00000452446.1_Missense_Mutation_p.V7L|URM1_ENST00000372850.1_Missense_Mutation_p.V7L|URM1_ENST00000372847.1_Missense_Mutation_p.V7L	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						GCCCTTGTCAGTGGAGGTGGA	0.642																																					p.V7L		Atlas-SNP	.											.	URM1	19	.	0			c.G19C						.						42.0	44.0	43.0					9																	131133678		2203	4300	6503	SO:0001583	missense	81605	exon1			TTGTCAGTGGAGG	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.19G>C	chr9.hg19:g.131133678G>C	ENSP00000361944:p.Val7Leu	90.0	0.0		40.0	33.0	NM_001265582		Missense_Mutation	SNP	ENST00000372853.4	hg19	CCDS6900.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656387	0.47467	.	.	ENSG00000167118	ENST00000372853;ENST00000452446;ENST00000372850;ENST00000372847	.	.	.	5.28	5.28	0.74379	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	0.237244	0.36482	N	0.002579	T	0.33760	0.0874	N	0.04508	-0.205	0.40356	D	0.979184	B;B	0.32781	0.384;0.001	B;B	0.36666	0.23;0.006	T	0.41466	-0.9507	9	0.87932	D	0	-9.8629	12.0435	0.53466	0.0:0.1731:0.8269:0.0	.	7;7	Q9BTM9-2;Q9BTM9	.;URM1_HUMAN	L	7	.	ENSP00000361938:V7L	V	+	1	0	URM1	130173499	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.043000	0.49823	2.746000	0.94184	0.655000	0.94253	GTG	.	.		0.642	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054422.1	NM_030914	
NTNG2	84628	hgsc.bcm.edu	37	9	135116364	135116364	+	Silent	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr9:135116364C>A	ENST00000393229.3	+	7	2066	c.1290C>A	c.(1288-1290)cgC>cgA	p.R430R	NTNG2_ENST00000490694.1_3'UTR|NTNG2_ENST00000393228.4_Silent_p.R422R|NTNG2_ENST00000360670.3_Silent_p.R436R	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	430	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GCGAGTGCCGCGAGGGCGCGG	0.721																																					p.R430R		Atlas-SNP	.											.	NTNG2	66	.	0			c.C1290A						.						27.0	26.0	27.0					9																	135116364		2200	4298	6498	SO:0001819	synonymous_variant	84628	exon7			GTGCCGCGAGGGC	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.1290C>A	chr9.hg19:g.135116364C>A		47.0	0.0		23.0	22.0	NM_032536	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	ENST00000393229.3	hg19	CCDS6946.1																																																																																			.	.		0.721	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	
DHTKD1	55526	hgsc.bcm.edu	37	10	12126675	12126675	+	Silent	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:12126675G>T	ENST00000263035.4	+	3	509	c.447G>T	c.(445-447)cgG>cgT	p.R149R	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	149					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TTGCCAAGCGGTTTGAGGAAC	0.453																																					p.R149R		Atlas-SNP	.											.	DHTKD1	104	.	0			c.G447T						.						162.0	164.0	163.0					10																	12126675		2203	4300	6503	SO:0001819	synonymous_variant	55526	exon3			CAAGCGGTTTGAG	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.447G>T	chr10.hg19:g.12126675G>T		139.0	0.0		132.0	63.0	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Silent	SNP	ENST00000263035.4	hg19	CCDS7087.1																																																																																			.	.		0.453	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
MKX	283078	hgsc.bcm.edu	37	10	28023482	28023482	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:28023482T>A	ENST00000375790.5	-	5	1173	c.741A>T	c.(739-741)caA>caT	p.Q247H	MKX_ENST00000419761.1_Missense_Mutation_p.Q247H			Q8IYA7	MKX_HUMAN	mohawk homeobox	247					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						AGTGGTTTCTTTGCCTTGTTT	0.438																																					p.Q247H		Atlas-SNP	.											.	MKX	43	.	0			c.A741T						.						206.0	194.0	198.0					10																	28023482		2203	4300	6503	SO:0001583	missense	283078	exon5			GTTTCTTTGCCTT	BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.741A>T	chr10.hg19:g.28023482T>A	ENSP00000364946:p.Gln247His	142.0	0.0		119.0	63.0	NM_001242702	B3KWM5	Missense_Mutation	SNP	ENST00000375790.5	hg19	CCDS7156.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056995	0.55325	.	.	ENSG00000150051	ENST00000375790;ENST00000419761	T;T	0.17528	2.27;2.27	5.99	0.568	0.17333	.	0.207528	0.51477	D	0.000093	T	0.15696	0.0378	L	0.44542	1.39	0.30965	N	0.723181	P	0.34837	0.472	B	0.37888	0.26	T	0.11397	-1.0589	10	0.66056	D	0.02	-8.1533	10.5158	0.44889	0.0:0.3744:0.0:0.6256	.	247	Q8IYA7	MKX_HUMAN	H	247	ENSP00000364946:Q247H;ENSP00000400896:Q247H	ENSP00000364946:Q247H	Q	-	3	2	MKX	28063488	1.000000	0.71417	0.984000	0.44739	0.981000	0.71138	1.114000	0.31196	0.168000	0.19655	0.529000	0.55759	CAA	.	.		0.438	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047332.3	NM_173576	
EPC1	80314	hgsc.bcm.edu	37	10	32560684	32560684	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:32560684T>A	ENST00000263062.8	-	14	2505	c.2236A>T	c.(2236-2238)Aca>Tca	p.T746S	RP11-166N17.1_ENST00000415731.2_RNA|EPC1_ENST00000319778.6_Missense_Mutation_p.T723S|EPC1_ENST00000375110.2_Missense_Mutation_p.T673S	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	746					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				ACCTGAGTTGTTGCAGAATTG	0.423																																					p.T746S		Atlas-SNP	.											.	EPC1	74	.	0			c.A2236T						.						206.0	193.0	197.0					10																	32560684		2203	4300	6503	SO:0001583	missense	80314	exon14			GAGTTGTTGCAGA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.2236A>T	chr10.hg19:g.32560684T>A	ENSP00000263062:p.Thr746Ser	147.0	0.0		139.0	71.0	NM_025209	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	hg19	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	T	5.504	0.277946	0.10403	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.37	4.23	0.50019	.	0.093976	0.64402	D	0.000001	T	0.33440	0.0863	N	0.19112	0.55	0.36500	D	0.868942	B;B;B	0.24721	0.11;0.046;0.002	B;B;B	0.24006	0.05;0.02;0.015	T	0.22173	-1.0224	9	0.06891	T	0.86	-4.7732	12.5282	0.56098	0.0:0.0:0.1396:0.8604	.	673;723;746	Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;EPC1_HUMAN	S	673;723;746	.	ENSP00000263062:T746S	T	-	1	0	EPC1	32600690	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.484000	0.60271	0.859000	0.35456	0.378000	0.23410	ACA	.	.		0.423	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
FRMPD2	143162	hgsc.bcm.edu	37	10	49392912	49392912	+	Missense_Mutation	SNP	T	T	A	rs529008159		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:49392912T>A	ENST00000374201.3	-	19	2674	c.2372A>T	c.(2371-2373)aAt>aTt	p.N791I	FRMPD2_ENST00000305531.3_Missense_Mutation_p.N766I|FRMPD2_ENST00000407470.4_Missense_Mutation_p.N759I	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	791	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTCTCCCTCATTAATGACAAA	0.393																																					p.N791I		Atlas-SNP	.											.	FRMPD2	157	.	0			c.A2372T						.						77.0	72.0	74.0					10																	49392912		2203	4300	6503	SO:0001583	missense	143162	exon19			CCCTCATTAATGA	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2372A>T	chr10.hg19:g.49392912T>A	ENSP00000363317:p.Asn791Ile	86.0	0.0		78.0	28.0	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	hg19	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	T	6.881	0.531961	0.13127	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.27402	1.67;1.67;1.67	5.15	1.42	0.22433	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.07593	0.0191	N	0.00670	-1.27	0.25495	N	0.987608	B;B;B	0.22800	0.019;0.075;0.019	B;B;B	0.18263	0.013;0.021;0.013	T	0.23619	-1.0183	9	0.33940	T	0.23	.	1.1533	0.01790	0.2456:0.0984:0.1509:0.5052	.	766;791;759	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	I	791;766;759	ENSP00000363317:N791I;ENSP00000307079:N766I;ENSP00000384339:N759I	ENSP00000307079:N766I	N	-	2	0	FRMPD2	49062918	1.000000	0.71417	0.954000	0.39281	0.943000	0.58893	2.627000	0.46469	0.923000	0.37045	0.482000	0.46254	AAT	.	.		0.393	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
VSTM4	196740	hgsc.bcm.edu	37	10	50256624	50256624	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:50256624C>A	ENST00000332853.4	-	6	697	c.674G>T	c.(673-675)gGg>gTg	p.G225V		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						GACAGTCTCCCCTGAGCTGTA	0.478																																					p.G225V		Atlas-SNP	.											.	VSTM4	83	.	0			c.G674T						.						62.0	56.0	58.0					10																	50256624		2203	4300	6503	SO:0001583	missense	196740	exon6			GTCTCCCCTGAGC	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.674G>T	chr10.hg19:g.50256624C>A	ENSP00000331062:p.Gly225Val	72.0	0.0		79.0	12.0	NM_001031746	B4DNI6|Q96MX7	Missense_Mutation	SNP	ENST00000332853.4	hg19	CCDS31198.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059076	0.76074	.	.	ENSG00000165633	ENST00000332853	T	0.13778	2.56	6.06	6.06	0.98353	.	0.053530	0.85682	D	0.000000	T	0.24160	0.0585	L	0.34521	1.04	0.80722	D	1	D	0.63880	0.993	P	0.58660	0.843	T	0.00086	-1.2094	10	0.66056	D	0.02	-40.5081	16.1283	0.81408	0.0:1.0:0.0:0.0	.	225	Q8IW00	VSTM4_HUMAN	V	225	ENSP00000331062:G225V	ENSP00000331062:G225V	G	-	2	0	VSTM4	49926630	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	4.436000	0.59948	2.871000	0.98454	0.655000	0.94253	GGG	.	.		0.478	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984	
CLRN3	119467	hgsc.bcm.edu	37	10	129681969	129681969	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:129681969C>A	ENST00000368671.3	-	2	562	c.400G>T	c.(400-402)Ggg>Tgg	p.G134W		NM_152311.3	NP_689524.1	Q8NCR9	CLRN3_HUMAN	clarin 3	134						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				CCACCGAGCCCGTTCCAGGTG	0.562																																					p.G134W		Atlas-SNP	.											.	CLRN3	27	.	0			c.G400T						.						71.0	69.0	70.0					10																	129681969		2203	4300	6503	SO:0001583	missense	119467	exon2			CGAGCCCGTTCCA	BC029478	CCDS7656.1	10q26.2	2006-11-24	2006-11-23	2006-11-23	ENSG00000180745	ENSG00000180745			20795	protein-coding gene	gene with protein product			"""transmembrane protein 12"""	TMEM12		12145752, 12080385	Standard	NM_152311		Approved	MGC32871, USH3AL1	uc001lka.1	Q8NCR9	OTTHUMG00000019253	ENST00000368671.3:c.400G>T	chr10.hg19:g.129681969C>A	ENSP00000357660:p.Gly134Trp	120.0	0.0		89.0	43.0	NM_152311	Q6MZX8	Missense_Mutation	SNP	ENST00000368671.3	hg19	CCDS7656.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258323	0.59321	.	.	ENSG00000180745	ENST00000368671	T	0.77229	-1.08	5.21	5.21	0.72293	.	0.229367	0.37261	N	0.002172	D	0.84575	0.5502	L	0.60455	1.87	0.24579	N	0.993883	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77117	-0.2706	10	0.59425	D	0.04	-7.3572	11.5595	0.50768	0.2262:0.7738:0.0:0.0	.	134;66	Q8NCR9;Q8NCR9-2	CLRN3_HUMAN;.	W	134	ENSP00000357660:G134W	ENSP00000357660:G134W	G	-	1	0	CLRN3	129571959	0.703000	0.27826	0.286000	0.24833	0.979000	0.70002	3.070000	0.50033	2.426000	0.82243	0.655000	0.94253	GGG	.	.		0.562	CLRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050987.1	NM_152311	
GPR123	84435	hgsc.bcm.edu	37	10	134942775	134942775	+	Silent	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr10:134942775C>T	ENST00000392607.3	+	7	1879	c.1443C>T	c.(1441-1443)gtC>gtT	p.V481V	GPR123_ENST00000392606.2_Silent_p.V384V|GPR123_ENST00000607359.1_Silent_p.V1200V	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	481					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TCCCCATGGTCACCCAGCCCG	0.731																																					p.V481V		Atlas-SNP	.											.	GPR123	118	.	0			c.C1443T						.						9.0	10.0	10.0					10																	134942775		2049	4009	6058	SO:0001819	synonymous_variant	84435	exon7			CATGGTCACCCAG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.1443C>T	chr10.hg19:g.134942775C>T		58.0	0.0		49.0	22.0	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	hg19	CCDS41580.1																																																																																			.	.		0.731	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
HBE1	3046	hgsc.bcm.edu	37	11	5291051	5291051	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:5291051C>A	ENST00000380237.1	-	3	414	c.70G>T	c.(70-72)Gct>Tct	p.A24S	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000292896.2_Missense_Mutation_p.A24S|HBG2_ENST00000380252.1_Intron			P02100	HBE_HUMAN	hemoglobin, epsilon 1	24					blood coagulation (GO:0007596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein heterooligomerization (GO:0051291)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|skin(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCACCTCCAGCCTCTTCCACA	0.493																																					p.A24S		Atlas-SNP	.											.	HBE1	42	.	0			c.G70T						.						116.0	104.0	108.0					11																	5291051		2201	4297	6498	SO:0001583	missense	3046	exon1			CTCCAGCCTCTTC	BC015537	CCDS7756.1	11p15.5	2012-10-02			ENSG00000213931	ENSG00000213931			4830	protein-coding gene	gene with protein product		142100				2649166	Standard	NM_005330		Approved	HBE	uc001mal.1	P02100	OTTHUMG00000066675	ENST00000380237.1:c.70G>T	chr11.hg19:g.5291051C>A	ENSP00000369586:p.Ala24Ser	91.0	0.0		61.0	11.0	NM_005330	Q6FH44	Missense_Mutation	SNP	ENST00000380237.1	hg19	CCDS7756.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076211	0.36662	.	.	ENSG00000213931	ENST00000380237;ENST00000292896;ENST00000396895	D;D;D	0.89123	-2.47;-2.47;-2.47	5.81	-4.13	0.03904	Globin-like (1);Globin, structural domain (1);	1.765680	0.03665	U	0.243169	D	0.86707	0.5997	L	0.43152	1.355	0.09310	N	1	B	0.23806	0.091	B	0.39771	0.309	T	0.76375	-0.2982	10	0.87932	D	0	-1.4852	5.0442	0.14475	0.0894:0.3965:0.0888:0.4253	.	24	P02100	HBE_HUMAN	S	24	ENSP00000369586:A24S;ENSP00000292896:A24S;ENSP00000380104:A24S	ENSP00000292896:A24S	A	-	1	0	HBE1	5247627	0.000000	0.05858	0.879000	0.34478	0.384000	0.30261	-0.113000	0.10774	-0.591000	0.05859	-1.128000	0.01989	GCT	.	.		0.493	HBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142973.2	NM_005330	
SWAP70	23075	hgsc.bcm.edu	37	11	9750888	9750888	+	Splice_Site	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:9750888A>T	ENST00000318950.6	+	6	892		c.e6-1		SWAP70_ENST00000447399.2_Splice_Site	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit						isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		TTTCTGTTTTAGTCCTTGCCT	0.279																																					.		Atlas-SNP	.											.	SWAP70	40	.	0			c.790-2A>T						.						62.0	67.0	65.0					11																	9750888		2201	4294	6495	SO:0001630	splice_region_variant	23075	exon6			TGTTTTAGTCCTT	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.790-1A>T	chr11.hg19:g.9750888A>T		145.0	0.0		115.0	36.0	NM_015055	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Splice_Site	SNP	ENST00000318950.6	hg19	CCDS31426.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211506	0.79240	.	.	ENSG00000133789	ENST00000447399;ENST00000318950;ENST00000534662	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6436	0.77029	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SWAP70	9707464	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.962000	0.93254	2.100000	0.63781	0.533000	0.62120	.	.	.		0.279	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	Intron
SBF2	81846	hgsc.bcm.edu	37	11	9853870	9853870	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:9853870A>G	ENST00000256190.8	-	27	3690	c.3553T>C	c.(3553-3555)Tgg>Cgg	p.W1185R		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1185	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GAGTTCTTCCAACATACAACA	0.502																																					p.W1185R		Atlas-SNP	.											.	SBF2	146	.	0			c.T3553C						.						122.0	108.0	113.0					11																	9853870		2201	4294	6495	SO:0001583	missense	81846	exon27			TCTTCCAACATAC	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.3553T>C	chr11.hg19:g.9853870A>G	ENSP00000256190:p.Trp1185Arg	120.0	0.0		98.0	24.0	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	hg19	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.847013	0.91277	.	.	ENSG00000133812	ENST00000256190	D	0.93189	-3.18	5.53	5.53	0.82687	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.98786	1.0734	10	0.87932	D	0	.	15.9464	0.79796	1.0:0.0:0.0:0.0	.	1185	Q86WG5	MTMRD_HUMAN	R	1185	ENSP00000256190:W1185R	ENSP00000256190:W1185R	W	-	1	0	SBF2	9810446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.272000	0.95707	2.232000	0.73038	0.402000	0.26972	TGG	.	.		0.502	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
CTC-497E21.3	0	hgsc.bcm.edu	37	11	13031125	13031125	+	lincRNA	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:13031125T>A	ENST00000533002.1	-	0	0																											GGTTGCGCCATGGATCCTTCG	0.657																																					p.M1K		Atlas-SNP	.											.	.	.	.	0			c.T2A						.						17.0	22.0	20.0					11																	13031125		2019	4165	6184			644943	exon1			GCGCCATGGATCC																													chr11.hg19:g.13031125T>A		37.0	0.0		39.0	25.0	NM_001080521		Missense_Mutation	SNP	ENST00000533002.1	hg19																																																																																				.	.		0.657	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
CD44	960	hgsc.bcm.edu	37	11	35236397	35236397	+	Splice_Site	SNP	A	A	T	rs200427375		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:35236397A>T	ENST00000428726.2	+	15	1933		c.e15-1		CD44_ENST00000360158.4_Splice_Site|CD44_ENST00000526669.2_Intron|CD44_ENST00000263398.6_Splice_Site|CD44_ENST00000278386.6_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000434472.2_Splice_Site|RP1-68D18.2_ENST00000510619.2_RNA|CD44_ENST00000449691.2_Splice_Site|RP1-68D18.4_ENST00000528869.1_RNA|CD44_ENST00000433892.2_Splice_Site|CD44_ENST00000415148.2_Splice_Site|CD44_ENST00000437706.2_Splice_Site|CD44_ENST00000433354.2_Splice_Site	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)						blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	TGCTCATTACAGGAGACCAAG	0.418																																					.		Atlas-SNP	.											.	CD44	48	.	0			c.1811-2A>T						.						108.0	96.0	100.0					11																	35236397		2202	4298	6500	SO:0001630	splice_region_variant	960	exon15			CATTACAGGAGAC	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1811-1A>T	chr11.hg19:g.35236397A>T		92.0	0.0		57.0	36.0	NM_000610	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Splice_Site	SNP	ENST00000428726.2	hg19	CCDS7897.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.205698	0.39003	.	.	ENSG00000026508	ENST00000263398;ENST00000415148;ENST00000433354;ENST00000449691;ENST00000437706;ENST00000360158;ENST00000428726;ENST00000433892;ENST00000434472;ENST00000442151;ENST00000526000;ENST00000279452;ENST00000525688;ENST00000278385	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4259	0.44378	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD44	35192973	0.997000	0.39634	0.963000	0.40424	0.123000	0.20343	3.508000	0.53378	2.228000	0.72767	0.533000	0.62120	.	.	.		0.418	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610	Intron
OR8H2	390151	hgsc.bcm.edu	37	11	55873254	55873254	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:55873254T>G	ENST00000313503.1	+	1	736	c.736T>G	c.(736-738)Ttg>Gtg	p.L246V		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTCTCATCTCTTGGGAGTCAC	0.363										HNSCC(53;0.14)																											p.L246V		Atlas-SNP	.											.	OR8H2	117	.	0			c.T736G						.						97.0	96.0	97.0					11																	55873254		2201	4296	6497	SO:0001583	missense	390151	exon1			CATCTCTTGGGAG	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.736T>G	chr11.hg19:g.55873254T>G	ENSP00000323982:p.Leu246Val	113.0	0.0		85.0	24.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	hg19	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	t	3.019	-0.202212	0.06219	.	.	ENSG00000181767	ENST00000313503	T	0.38077	1.16	3.58	0.192	0.15134	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41605	D	0.000848	T	0.24967	0.0606	N	0.20401	0.57	0.09310	N	1	P	0.35944	0.529	P	0.48524	0.58	T	0.09185	-1.0686	10	0.30078	T	0.28	.	0.6683	0.00854	0.3831:0.2695:0.126:0.2214	.	246	Q8N162	OR8H2_HUMAN	V	246	ENSP00000323982:L246V	ENSP00000323982:L246V	L	+	1	2	OR8H2	55629830	0.000000	0.05858	0.045000	0.18777	0.207000	0.24258	-1.518000	0.02246	0.271000	0.22005	-0.503000	0.04515	TTG	.	.		0.363	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
OR8H1	219469	hgsc.bcm.edu	37	11	56058142	56058142	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:56058142C>T	ENST00000313022.2	-	1	424	c.397G>A	c.(397-399)Gtt>Att	p.V133I		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					GACATAATAACTGGGTAACGT	0.443																																					p.V133I		Atlas-SNP	.											.	OR8H1	89	.	0			c.G397A						.						102.0	98.0	100.0					11																	56058142		2201	4296	6497	SO:0001583	missense	219469	exon1			TAATAACTGGGTA	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.397G>A	chr11.hg19:g.56058142C>T	ENSP00000323595:p.Val133Ile	124.0	0.0		86.0	21.0	NM_001005199	B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	hg19	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	C	9.831	1.188492	0.21954	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.01335	5.0	3.94	0.528	0.17089	GPCR, rhodopsin-like superfamily (1);	0.620606	0.14356	N	0.324791	T	0.01124	0.0037	L	0.31845	0.965	0.09310	N	1	B	0.15141	0.012	B	0.17433	0.018	T	0.48692	-0.9013	10	0.35671	T	0.21	.	0.2847	0.00249	0.3323:0.2689:0.1627:0.2361	.	133	Q8NGG4	OR8H1_HUMAN	I	133;129	ENSP00000323595:V133I	ENSP00000323595:V133I	V	-	1	0	OR8H1	55814718	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.991000	0.01478	0.367000	0.24454	0.544000	0.68410	GTT	.	.		0.443	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199	
CLP1	10978	hgsc.bcm.edu	37	11	57427466	57427466	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:57427466A>T	ENST00000533682.1	+	2	1243	c.518A>T	c.(517-519)gAt>gTt	p.D173V	CLP1_ENST00000302731.4_Intron|CLP1_ENST00000525602.1_Missense_Mutation_p.D173V|CLP1_ENST00000529430.1_Missense_Mutation_p.D184V			Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						CGGCCTGCAGATGTCGAAGAG	0.552																																					p.D173V		Atlas-SNP	.											.	CLP1	40	.	0			c.A518T						.						48.0	42.0	44.0					11																	57427466		2201	4296	6497	SO:0001583	missense	10978	exon2			CTGCAGATGTCGA	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000533682.1:c.518A>T	chr11.hg19:g.57427466A>T	ENSP00000434995:p.Asp173Val	87.0	0.0		56.0	30.0	NM_006831	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000533682.1	hg19	CCDS7964.1	.	.	.	.	.	.	.	.	.	.	a	25.3	4.620264	0.87460	.	.	ENSG00000172409	ENST00000529430;ENST00000533682;ENST00000525602	T;T;T	0.25912	1.77;1.77;1.77	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.44912	0.1316	L	0.50847	1.595	0.80722	D	1	D	0.63046	0.992	D	0.71184	0.972	T	0.21280	-1.0250	10	0.40728	T	0.16	-9.864	15.6143	0.76753	1.0:0.0:0.0:0.0	.	173	Q92989	CLP1_HUMAN	V	184;173;173	ENSP00000433406:D184V;ENSP00000434995:D173V;ENSP00000436066:D173V	ENSP00000436066:D173V	D	+	2	0	CLP1	57184042	1.000000	0.71417	0.779000	0.31741	0.789000	0.44602	9.212000	0.95126	2.169000	0.68431	0.468000	0.43344	GAT	.	.		0.552	CLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393462.3	NM_006831	
SLC22A9	114571	hgsc.bcm.edu	37	11	63176219	63176219	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:63176219T>C	ENST00000279178.3	+	9	1718	c.1469T>C	c.(1468-1470)cTa>cCa	p.L490P	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	490					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						ATGATGATCCTAAGTGTGTAT	0.488																																					p.L490P		Atlas-SNP	.											.	SLC22A9	77	.	0			c.T1469C						.						143.0	127.0	132.0					11																	63176219		2201	4298	6499	SO:0001583	missense	114571	exon9			TGATCCTAAGTGT	AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.1469T>C	chr11.hg19:g.63176219T>C	ENSP00000279178:p.Leu490Pro	102.0	0.0		87.0	29.0	NM_080866	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	hg19	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.019672	0.35606	.	.	ENSG00000149742	ENST00000279178	T	0.61510	0.1	2.63	2.63	0.31362	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.561525	0.18066	N	0.152763	T	0.81640	0.4865	H	0.97682	4.055	0.26267	N	0.97848	D	0.89917	1.0	D	0.79108	0.992	T	0.72225	-0.4355	10	0.87932	D	0	.	8.7198	0.34434	0.0:0.0:0.0:1.0	.	490	Q8IVM8	S22A9_HUMAN	P	490	ENSP00000279178:L490P	ENSP00000279178:L490P	L	+	2	0	SLC22A9	62932795	0.006000	0.16342	0.006000	0.13384	0.042000	0.13812	1.609000	0.36858	1.224000	0.43551	0.172000	0.16884	CTA	.	.		0.488	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1	NM_080866	
SLC22A9	114571	hgsc.bcm.edu	37	11	63177289	63177289	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:63177289A>T	ENST00000279178.3	+	10	1866	c.1617A>T	c.(1615-1617)agA>agT	p.R539S	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	539					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						AAGACCCCAGAGAACCAAAGC	0.418																																					p.R539S		Atlas-SNP	.											.	SLC22A9	77	.	0			c.A1617T						.						68.0	72.0	71.0					11																	63177289		2201	4298	6499	SO:0001583	missense	114571	exon10			CCCCAGAGAACCA	AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.1617A>T	chr11.hg19:g.63177289A>T	ENSP00000279178:p.Arg539Ser	72.0	0.0		61.0	41.0	NM_080866	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	hg19	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	A	8.781	0.928174	0.18131	.	.	ENSG00000149742	ENST00000279178	T	0.64618	-0.11	2.9	0.449	0.16619	.	1.787490	0.02935	N	0.139719	T	0.59622	0.2207	M	0.69523	2.12	0.09310	N	1	B	0.29552	0.248	B	0.29598	0.104	T	0.25187	-1.0139	10	0.30078	T	0.28	.	4.7987	0.13284	0.7029:0.0:0.2971:0.0	.	539	Q8IVM8	S22A9_HUMAN	S	539	ENSP00000279178:R539S	ENSP00000279178:R539S	R	+	3	2	SLC22A9	62933865	0.484000	0.25964	0.001000	0.08648	0.003000	0.03518	1.770000	0.38532	-0.024000	0.13941	0.332000	0.21555	AGA	.	.		0.418	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1	NM_080866	
C11orf84	144097	hgsc.bcm.edu	37	11	63585819	63585819	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:63585819C>T	ENST00000294244.4	+	3	888	c.589C>T	c.(589-591)Cgc>Tgc	p.R197C		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	197	Pro-rich.									endometrium(3)|kidney(1)|lung(3)|skin(1)	8						CAGGGGACTCCGCCCCCTCGA	0.612																																					p.R197C		Atlas-SNP	.											.	C11orf84	33	.	0			c.C589T						.						42.0	52.0	49.0					11																	63585819		2201	4298	6499	SO:0001583	missense	144097	exon3			GGACTCCGCCCCC	BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.589C>T	chr11.hg19:g.63585819C>T	ENSP00000294244:p.Arg197Cys	52.0	0.0		31.0	19.0	NM_138471	Q68CV7|Q6PHS2|Q96IH0	Missense_Mutation	SNP	ENST00000294244.4	hg19	CCDS31594.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069228	0.76301	.	.	ENSG00000168005	ENST00000294244	T	0.62105	0.05	5.54	5.54	0.83059	.	0.441048	0.25291	N	0.031737	T	0.76054	0.3934	L	0.56769	1.78	0.50467	D	0.999879	D	0.89917	1.0	D	0.87578	0.998	T	0.77611	-0.2523	10	0.87932	D	0	-27.3467	14.987	0.71356	0.0:1.0:0.0:0.0	.	197	Q9BUA3	CK084_HUMAN	C	197	ENSP00000294244:R197C	ENSP00000294244:R197C	R	+	1	0	C11orf84	63342395	0.996000	0.38824	0.993000	0.49108	0.776000	0.43924	3.729000	0.54999	2.610000	0.88304	0.561000	0.74099	CGC	.	.		0.612	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396084.1	NM_138471	
FAT3	120114	hgsc.bcm.edu	37	11	92534161	92534161	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:92534161T>C	ENST00000298047.6	+	9	7999	c.7982T>C	c.(7981-7983)gTc>gCc	p.V2661A	FAT3_ENST00000409404.2_Missense_Mutation_p.V2661A|FAT3_ENST00000525166.1_Missense_Mutation_p.V2511A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2661	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGCTGGATGGTCACAAAGGGT	0.463										TCGA Ovarian(4;0.039)																											p.V2661A		Atlas-SNP	.											.	FAT3	1822	.	0			c.T7982C						.						36.0	34.0	35.0					11																	92534161		1880	4110	5990	SO:0001583	missense	120114	exon9			GGATGGTCACAAA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7982T>C	chr11.hg19:g.92534161T>C	ENSP00000298047:p.Val2661Ala	121.0	0.0		83.0	51.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	T	16.85	3.236298	0.58886	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.50001	0.76;0.76;0.76	6.17	6.17	0.99709	.	.	.	.	.	T	0.61739	0.2371	M	0.67569	2.06	0.80722	D	1	D	0.61080	0.989	P	0.58520	0.84	T	0.56938	-0.7896	9	0.18276	T	0.48	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	2661	Q8TDW7-3	.	A	2661;2661;2511	ENSP00000298047:V2661A;ENSP00000387040:V2661A;ENSP00000432586:V2511A	ENSP00000298047:V2661A	V	+	2	0	FAT3	92173809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.975000	0.88055	2.371000	0.80710	0.533000	0.62120	GTC	.	.		0.463	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
MMP7	4316	hgsc.bcm.edu	37	11	102398359	102398359	+	Missense_Mutation	SNP	C	C	A	rs138303399		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:102398359C>A	ENST00000260227.4	-	3	432	c.380G>T	c.(379-381)cGa>cTa	p.R127L		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	127					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	TGACACTAATCGATCCACTGT	0.423																																					p.R127L		Atlas-SNP	.											.	MMP7	27	.	0			c.G380T						.						127.0	122.0	124.0					11																	102398359		2203	4299	6502	SO:0001583	missense	4316	exon3			ACTAATCGATCCA	Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.380G>T	chr11.hg19:g.102398359C>A	ENSP00000260227:p.Arg127Leu	93.0	0.0		68.0	20.0	NM_002423	Q9BTK9	Missense_Mutation	SNP	ENST00000260227.4	hg19	CCDS8317.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332448	0.24167	.	.	ENSG00000137673	ENST00000260227	T	0.53640	0.61	4.85	-2.09	0.07232	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	1.285220	0.05639	N	0.583068	T	0.34803	0.0910	L	0.48260	1.515	0.09310	N	1	B;B;B	0.29232	0.238;0.097;0.097	B;B;B	0.31946	0.138;0.078;0.054	T	0.22243	-1.0222	10	0.27785	T	0.31	-22.2589	0.1779	0.00120	0.2343:0.1986:0.2399:0.3271	.	127;127;127	B4DDW4;Q53GF1;P09237	.;.;MMP7_HUMAN	L	127	ENSP00000260227:R127L	ENSP00000260227:R127L	R	-	2	0	MMP7	101903569	0.000000	0.05858	0.071000	0.20095	0.325000	0.28411	0.262000	0.18460	-0.318000	0.08665	-0.251000	0.11542	CGA	.	C|1.000;T|0.000		0.423	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109633.2		
GUCY1A2	2977	hgsc.bcm.edu	37	11	106810255	106810255	+	Silent	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:106810255C>T	ENST00000526355.2	-	4	1605	c.1137G>A	c.(1135-1137)ctG>ctA	p.L379L	GUCY1A2_ENST00000282249.2_Silent_p.L379L|GUCY1A2_ENST00000347596.2_Silent_p.L379L	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	379					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	ACAGTCGCAGCAGGACCCTTT	0.468																																					p.L379L		Atlas-SNP	.											.	GUCY1A2	180	.	0			c.G1137A						.						91.0	92.0	92.0					11																	106810255		2201	4298	6499	SO:0001819	synonymous_variant	2977	exon4			TCGCAGCAGGACC	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1137G>A	chr11.hg19:g.106810255C>T		189.0	0.0		123.0	35.0	NM_000855	A1L4C4|B7ZLT5	Silent	SNP	ENST00000526355.2	hg19	CCDS8335.1																																																																																			.	.		0.468	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
DRD2	1813	hgsc.bcm.edu	37	11	113281601	113281601	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:113281601T>C	ENST00000362072.3	-	8	1524	c.1180A>G	c.(1180-1182)Atc>Gtc	p.I394V	DRD2_ENST00000538967.1_Missense_Mutation_p.I396V|DRD2_ENST00000355319.2_Missense_Mutation_p.I396V|DRD2_ENST00000346454.3_Missense_Mutation_p.I365V|DRD2_ENST00000544518.1_Missense_Mutation_p.I393V|DRD2_ENST00000542968.1_Missense_Mutation_p.I394V|RP11-159N11.3_ENST00000546284.1_RNA	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	394	Agonist binding. {ECO:0000250}.				activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATGTTCAGGATGTGTGTGATG	0.597																																					p.I394V		Atlas-SNP	.											.	DRD2	98	.	0			c.A1180G						.						198.0	144.0	162.0					11																	113281601		2201	4296	6497	SO:0001583	missense	1813	exon8			TCAGGATGTGTGT	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.1180A>G	chr11.hg19:g.113281601T>C	ENSP00000354859:p.Ile394Val	149.0	0.0		104.0	65.0	NM_000795	Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	hg19	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	T	13.99	2.402652	0.42613	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11	5.86	5.86	0.93980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.44393	0.1291	L	0.31294	0.92	0.80722	D	1	B;B;P	0.34934	0.254;0.296;0.476	B;B;P	0.47786	0.283;0.124;0.557	T	0.25572	-1.0128	10	0.18710	T	0.47	.	16.2436	0.82429	0.0:0.0:0.0:1.0	.	393;365;394	F8VUV1;P14416-2;P14416	.;.;DRD2_HUMAN	V	396;365;394;393;394;396	ENSP00000347474:I396V;ENSP00000278597:I365V;ENSP00000354859:I394V;ENSP00000441068:I393V;ENSP00000442172:I394V;ENSP00000438215:I396V	ENSP00000278597:I365V	I	-	1	0	DRD2	112786811	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	8.025000	0.88777	2.232000	0.73038	0.533000	0.62120	ATC	.	.		0.597	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
OR8D1	283159	hgsc.bcm.edu	37	11	124180322	124180322	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:124180322A>T	ENST00000357821.2	-	1	411	c.341T>A	c.(340-342)cTc>cAc	p.L114H		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GGCAGTCAGGAGGTAACCCTC	0.478																																					p.L114H		Atlas-SNP	.											.	OR8D1	53	.	0			c.T341A						.						78.0	72.0	74.0					11																	124180322		2201	4299	6500	SO:0001583	missense	283159	exon1			GTCAGGAGGTAAC	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.341T>A	chr11.hg19:g.124180322A>T	ENSP00000350474:p.Leu114His	117.0	0.0		118.0	83.0	NM_001002917	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	ENST00000357821.2	hg19	CCDS31706.1	.	.	.	.	.	.	.	.	.	.	a	17.39	3.376924	0.61735	.	.	ENSG00000196341	ENST00000357821	T	0.03717	3.83	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.311359	0.18016	U	0.154411	T	0.22975	0.0555	H	0.94847	3.59	0.09310	N	1	D	0.67145	0.996	P	0.60886	0.88	T	0.20472	-1.0274	10	0.87932	D	0	.	13.302	0.60330	1.0:0.0:0.0:0.0	.	114	Q8WZ84	OR8D1_HUMAN	H	114	ENSP00000350474:L114H	ENSP00000350474:L114H	L	-	2	0	OR8D1	123685532	0.290000	0.24343	0.003000	0.11579	0.014000	0.08584	4.269000	0.58890	1.813000	0.52934	0.416000	0.27883	CTC	.	.		0.478	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917	
CACNA1C	775	hgsc.bcm.edu	37	12	2717739	2717739	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:2717739T>A	ENST00000347598.4	+	28	3479	c.3479T>A	c.(3478-3480)gTg>gAg	p.V1160E	CACNA1C_ENST00000399649.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V1140E|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V1160E|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399629.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000327702.7_Missense_Mutation_p.V1140E|CACNA1C_ENST00000480911.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V1140E|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V1140E|CACNA1C_ENST00000335762.5_Missense_Mutation_p.V1165E	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1160	Dihydropyridine binding. {ECO:0000250}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AACTACCGTGTGGAGatctcc	0.537																																					p.V1160E		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.T3479A						.						106.0	94.0	98.0					12																	2717739		2203	4300	6503	SO:0001583	missense	775	exon28			ACCGTGTGGAGAT	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3479T>A	chr12.hg19:g.2717739T>A	ENSP00000266376:p.Val1160Glu	92.0	0.0		115.0	18.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	hg19	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651912	0.88056	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95	4.74	4.74	0.60224	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98397	0.9467	L	0.52905	1.665	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;P;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;1.0;1.0;0.999;0.999;0.961;1.0;1.0;0.564;0.999;1.0;1.0;0.998;0.993;1.0;0.749;0.998;1.0;1.0;0.999;0.994;1.0	D;D;D;D;D;D;D;D;P;D;D;B;D;D;D;D;P;D;B;D;D;D;D;D;D	0.91635	0.996;0.997;0.99;0.996;0.998;0.997;0.999;0.953;0.786;0.998;0.996;0.312;0.999;0.998;0.999;0.991;0.786;0.998;0.288;0.991;0.998;0.998;0.995;0.986;0.997	D	0.99612	1.0981	10	0.72032	D	0.01	.	14.6917	0.69091	0.0:0.0:0.0:1.0	.	1140;1137;1160;1140;1140;1140;1140;1140;1140;1160;1140;1111;1160;1140;1140;1140;1140;1140;1140;1140;1140;1140;1140;1140;1140	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	E	1165;1140;1140;1140;1140;1140;1140;1140;1140;1140;1160;1160;1140;1140;1140;1140;1140;1140;1140;1140;1140;1140;1140;981	ENSP00000336982:V1165E;ENSP00000382563:V1140E;ENSP00000437936:V1140E;ENSP00000382552:V1140E;ENSP00000382547:V1140E;ENSP00000382506:V1140E;ENSP00000382530:V1140E;ENSP00000382546:V1140E;ENSP00000382500:V1140E;ENSP00000382549:V1140E;ENSP00000266376:V1160E;ENSP00000382515:V1160E;ENSP00000382510:V1140E;ENSP00000341092:V1140E;ENSP00000382537:V1140E;ENSP00000329877:V1140E;ENSP00000382557:V1140E;ENSP00000385724:V1140E;ENSP00000382512:V1140E;ENSP00000382542:V1140E;ENSP00000382526:V1140E;ENSP00000385896:V1140E;ENSP00000382504:V1140E	ENSP00000323129:V981E	V	+	2	0	CACNA1C	2588000	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.525000	0.81892	2.116000	0.64780	0.533000	0.62120	GTG	.	.		0.537	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
TULP3	7289	hgsc.bcm.edu	37	12	3047308	3047308	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:3047308A>T	ENST00000448120.2	+	10	1103	c.1052A>T	c.(1051-1053)cAg>cTg	p.Q351L	TULP3_ENST00000397132.2_Missense_Mutation_p.Q351L	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	351					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TCAAGGTGGCAGAACAGAACT	0.483																																					p.Q351L		Atlas-SNP	.											.	TULP3	45	.	0			c.A1052T						.						112.0	102.0	106.0					12																	3047308		2203	4300	6503	SO:0001583	missense	7289	exon10			GGTGGCAGAACAG	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1052A>T	chr12.hg19:g.3047308A>T	ENSP00000410051:p.Gln351Leu	104.0	0.0		124.0	93.0	NM_003324	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	hg19	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	a	10.27	1.304855	0.23736	.	.	ENSG00000078246	ENST00000228245;ENST00000544943;ENST00000542730;ENST00000448120;ENST00000397132	D;D;D	0.96491	-4.03;-4.03;-4.03	5.2	5.2	0.72013	Tubby, C-terminal (3);	0.231550	0.45361	D	0.000373	D	0.95825	0.8641	L	0.36672	1.1	0.48511	D	0.999661	B;B;D	0.71674	0.028;0.024;0.998	B;B;D	0.62955	0.056;0.032;0.909	D	0.95450	0.8533	10	0.66056	D	0.02	-20.4892	8.8747	0.35339	0.9167:0.0:0.0833:0.0	.	175;351;351	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	L	351;78;175;351;351	ENSP00000442631:Q78L;ENSP00000410051:Q351L;ENSP00000380321:Q351L	ENSP00000228245:Q351L	Q	+	2	0	TULP3	2917569	1.000000	0.71417	0.963000	0.40424	0.068000	0.16541	6.368000	0.73104	1.955000	0.56771	0.529000	0.55759	CAG	.	.		0.483	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
KCNA5	3741	hgsc.bcm.edu	37	12	5153590	5153590	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:5153590C>T	ENST00000252321.3	+	1	506	c.277C>T	c.(277-279)Ccc>Tcc	p.P93S		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	93					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ACGGCCGCCTCCCGAGGACGA	0.726																																					p.P93S		Atlas-SNP	.											.	KCNA5	138	.	0			c.C277T						.						10.0	12.0	11.0					12																	5153590		2173	4249	6422	SO:0001583	missense	3741	exon1			CCGCCTCCCGAGG	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.277C>T	chr12.hg19:g.5153590C>T	ENSP00000252321:p.Pro93Ser	31.0	0.0		30.0	22.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	hg19	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.293620	0.40594	.	.	ENSG00000130037	ENST00000252321	D	0.97303	-4.33	4.49	-2.52	0.06346	.	7739.210000	0.00166	N	0.000000	D	0.92459	0.7606	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.85588	0.1244	10	0.27785	T	0.31	.	7.5544	0.27817	0.1078:0.2767:0.5351:0.0804	.	93	P22460	KCNA5_HUMAN	S	93	ENSP00000252321:P93S	ENSP00000252321:P93S	P	+	1	0	KCNA5	5023851	0.000000	0.05858	0.000000	0.03702	0.510000	0.34073	-1.555000	0.02170	-0.772000	0.04602	-0.295000	0.09555	CCC	.	.		0.726	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
CLEC2B	9976	hgsc.bcm.edu	37	12	10005943	10005943	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:10005943A>G	ENST00000228438.2	-	5	1339	c.406T>C	c.(406-408)Tgt>Cgt	p.C136R	CLEC2B_ENST00000538152.1_Missense_Mutation_p.C67R	NM_005127.2	NP_005118.2	Q92478	CLC2B_HUMAN	C-type lectin domain family 2, member B	136	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.			ATARCY -> TTAQIQ (in Ref. 6). {ECO:0000305}.		integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(3)|lung(1)	5						TCGGTGTAACATCTAGCTGTT	0.383																																					p.C136R		Atlas-SNP	.											.	CLEC2B	19	.	0			c.T406C						.						190.0	158.0	169.0					12																	10005943		2203	4300	6503	SO:0001583	missense	9976	exon5			TGTAACATCTAGC	X96719	CCDS8605.1	12p13-p12	2005-02-09	2005-02-09	2005-02-09		ENSG00000110852		"""C-type lectin domain containing"""	2053	protein-coding gene	gene with protein product		603242	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced)"""	CLECSF2		9038101	Standard	NM_005127		Approved	AICL, HP10085	uc001qwn.3	Q92478		ENST00000228438.2:c.406T>C	chr12.hg19:g.10005943A>G	ENSP00000228438:p.Cys136Arg	77.0	0.0		79.0	60.0	NM_005127	B2R9U1|Q8IZE9|Q9BS74|Q9UQB4	Missense_Mutation	SNP	ENST00000228438.2	hg19	CCDS8605.1	.	.	.	.	.	.	.	.	.	.	A	0.139	-1.104296	0.01828	.	.	ENSG00000110852	ENST00000228438;ENST00000538152	T;T	0.60672	0.17;0.17	2.94	2.94	0.34122	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.47093	D	0.000254	T	0.61299	0.2336	M	0.90369	3.11	0.58432	D	0.999995	B	0.22414	0.069	B	0.30401	0.115	T	0.58901	-0.7554	10	0.24483	T	0.36	.	7.7084	0.28663	1.0:0.0:0.0:0.0	.	136	Q92478	CLC2B_HUMAN	R	136;67	ENSP00000228438:C136R;ENSP00000437946:C67R	ENSP00000228438:C136R	C	-	1	0	CLEC2B	9897210	0.016000	0.18221	0.948000	0.38648	0.059000	0.15707	0.871000	0.28023	1.604000	0.50143	0.528000	0.53228	TGT	.	.		0.383	CLEC2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399881.1	NM_005127	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43826449	43826449	+	Silent	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:43826449A>G	ENST00000389420.3	-	20	2885	c.2886T>C	c.(2884-2886)caT>caC	p.H962H	ADAMTS20_ENST00000395541.2_Silent_p.H116H|ADAMTS20_ENST00000553158.1_Silent_p.H962H	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	962					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CACAGTTACCATGGCATAGTT	0.388																																					p.H962H		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.T2886C						.						144.0	126.0	132.0					12																	43826449		2203	4300	6503	SO:0001819	synonymous_variant	80070	exon20			GTTACCATGGCAT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2886T>C	chr12.hg19:g.43826449A>G		120.0	0.0		141.0	94.0	NM_025003	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	hg19	CCDS31778.2																																																																																			.	.		0.388	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
HDAC7	51564	hgsc.bcm.edu	37	12	48191236	48191236	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:48191236T>G	ENST00000427332.2	-	6	547	c.391A>C	c.(391-393)Agc>Cgc	p.S131R	HDAC7_ENST00000080059.7_Missense_Mutation_p.S170R|HDAC7_ENST00000380610.4_Missense_Mutation_p.S187R|HDAC7_ENST00000552960.1_Missense_Mutation_p.S153R|HDAC7_ENST00000354334.3_Missense_Mutation_p.S170R			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	131	Interaction with MEF2A. {ECO:0000250}.|Transcription repression 1. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		AAAAAGCTGCTGAGCATGGAG	0.617																																					p.S170R		Atlas-SNP	.											.	HDAC7	71	.	0			c.A508C						.						115.0	108.0	110.0					12																	48191236		2203	4300	6503	SO:0001583	missense	51564	exon6			AGCTGCTGAGCAT	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.391A>C	chr12.hg19:g.48191236T>G	ENSP00000404394:p.Ser131Arg	68.0	0.0		72.0	54.0	NM_001098416	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	hg19		.	.	.	.	.	.	.	.	.	.	T	16.59	3.164491	0.57476	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332;ENST00000447463;ENST00000434070;ENST00000421231	T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	4.84	2.5	0.30297	.	0.391229	0.28700	N	0.014427	T	0.20373	0.0490	L	0.38175	1.15	0.28826	N	0.897409	P;P;P	0.45474	0.688;0.859;0.634	B;B;B	0.43274	0.28;0.414;0.219	T	0.06215	-1.0839	10	0.51188	T	0.08	.	7.9829	0.30194	0.0:0.1704:0.0:0.8296	.	170;153;170	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	R	170;170;153;187;131;131;131;131	ENSP00000080059:S170R;ENSP00000351326:S170R;ENSP00000448532:S153R;ENSP00000369984:S187R;ENSP00000404394:S131R;ENSP00000389501:S131R;ENSP00000388561:S131R;ENSP00000412155:S131R	ENSP00000080059:S170R	S	-	1	0	HDAC7	46477503	0.995000	0.38212	0.998000	0.56505	0.996000	0.88848	0.801000	0.27055	0.456000	0.26937	0.533000	0.62120	AGC	.	.		0.617	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
LARP4	113251	hgsc.bcm.edu	37	12	50869368	50869368	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:50869368A>T	ENST00000398473.2	+	16	2008	c.1896A>T	c.(1894-1896)tcA>tcT	p.S632S	LARP4_ENST00000429001.3_Silent_p.S638S|LARP4_ENST00000347328.5_Silent_p.S561S|LARP4_ENST00000518444.1_Silent_p.S631S|LARP4_ENST00000293618.8_Silent_p.S561S	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	632					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						AGCCATCTTCAGTTCTTGTGC	0.443																																					p.S632S		Atlas-SNP	.											.	LARP4	58	.	0			c.A1896T						.						157.0	159.0	158.0					12																	50869368		1832	4095	5927	SO:0001819	synonymous_variant	113251	exon16			ATCTTCAGTTCTT	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1896A>T	chr12.hg19:g.50869368A>T		152.0	0.0		175.0	45.0	NM_052879	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Silent	SNP	ENST00000398473.2	hg19	CCDS41782.1																																																																																			.	.		0.443	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	
STAT6	6778	hgsc.bcm.edu	37	12	57498539	57498539	+	Silent	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:57498539C>G	ENST00000300134.3	-	10	1384	c.1059G>C	c.(1057-1059)ggG>ggC	p.G353G	STAT6_ENST00000454075.3_Silent_p.G353G|STAT6_ENST00000537215.2_Silent_p.G243G|STAT6_ENST00000556155.1_Silent_p.G353G|STAT6_ENST00000543873.2_Silent_p.G353G|STAT6_ENST00000538913.2_Silent_p.G243G	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	353					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						AGCAGCAGTTCCCAGGAATGC	0.557																																					p.G353G		Atlas-SNP	.											.	STAT6	69	.	0			c.G1059C						.						130.0	105.0	114.0					12																	57498539		2203	4300	6503	SO:0001819	synonymous_variant	6778	exon10			GCAGTTCCCAGGA	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1059G>C	chr12.hg19:g.57498539C>G		69.0	0.0		71.0	19.0	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Silent	SNP	ENST00000300134.3	hg19	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	C	9.796	1.179159	0.21787	.	.	ENSG00000166888	ENST00000553533	.	.	.	4.79	0.643	0.17770	.	.	.	.	.	T	0.56877	0.2015	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48747	-0.9008	4	.	.	.	-14.7093	9.1917	0.37204	0.2581:0.2814:0.4605:0.0	.	.	.	.	Q	54	.	.	E	-	1	0	STAT6	55784806	0.072000	0.21174	0.996000	0.52242	0.995000	0.86356	0.054000	0.14205	-0.065000	0.13021	-0.127000	0.14921	GAA	.	.		0.557	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
C12orf56	115749	hgsc.bcm.edu	37	12	64724758	64724758	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:64724758A>T	ENST00000543942.2	-	3	1096	c.470T>A	c.(469-471)cTg>cAg	p.L157Q	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Missense_Mutation_p.L157Q	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	157										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		AGATTCTTTCAGACTTCTGGA	0.299																																					p.L157Q		Atlas-SNP	.											.	C12orf56	42	.	0			c.T470A						.						46.0	44.0	44.0					12																	64724758		1804	4054	5858	SO:0001583	missense	115749	exon3			TCTTTCAGACTTC		CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.470T>A	chr12.hg19:g.64724758A>T	ENSP00000446101:p.Leu157Gln	65.0	0.0		70.0	57.0	NM_001170633		Missense_Mutation	SNP	ENST00000543942.2	hg19		.	.	.	.	.	.	.	.	.	.	A	1.143	-0.648932	0.03506	.	.	ENSG00000185306	ENST00000333722;ENST00000543942;ENST00000433716;ENST00000543259	.	.	.	3.63	1.19	0.21007	.	1.003290	0.08032	N	0.993706	T	0.30103	0.0754	L	0.41027	1.25	0.09310	N	1	B	0.28713	0.22	B	0.29176	0.099	T	0.28713	-1.0035	8	.	.	.	-0.1005	3.0377	0.06128	0.671:0.0:0.1186:0.2104	.	157	Q8IXR9-2	.	Q	157;157;157;144	.	.	L	-	2	0	C12orf56	63011025	0.000000	0.05858	0.057000	0.19452	0.010000	0.07245	0.286000	0.18902	0.238000	0.21222	0.402000	0.26972	CTG	.	.		0.299	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401058.2	NM_001099676	
UTP20	27340	hgsc.bcm.edu	37	12	101693811	101693811	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:101693811G>T	ENST00000261637.4	+	14	1821	c.1647G>T	c.(1645-1647)atG>atT	p.M549I		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	549					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CACTCTTCATGACTGTTGACA	0.438																																					p.M549I		Atlas-SNP	.											.	UTP20	222	.	0			c.G1647T						.						182.0	171.0	175.0					12																	101693811		2203	4300	6503	SO:0001583	missense	27340	exon14			CTTCATGACTGTT	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.1647G>T	chr12.hg19:g.101693811G>T	ENSP00000261637:p.Met549Ile	286.0	1.0		198.0	180.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	hg19	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	G	1.788	-0.480141	0.04383	.	.	ENSG00000120800	ENST00000261637	T	0.64438	-0.1	5.39	1.35	0.21983	Armadillo-type fold (1);	1.509520	0.02968	N	0.143982	T	0.44685	0.1305	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.24368	-1.0162	10	0.33940	T	0.23	1.6205	5.1172	0.14840	0.2409:0.2885:0.4706:0.0	.	549	O75691	UTP20_HUMAN	I	549	ENSP00000261637:M549I	ENSP00000261637:M549I	M	+	3	0	UTP20	100217942	0.131000	0.22433	0.002000	0.10522	0.075000	0.17131	0.373000	0.20484	0.235000	0.21160	-0.181000	0.13052	ATG	.	.		0.438	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
CCDC53	51019	hgsc.bcm.edu	37	12	102419817	102419817	+	Splice_Site	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:102419817C>G	ENST00000240079.6	-	6	597		c.e6-1		CCDC53_ENST00000539515.1_Splice_Site|CCDC53_ENST00000545679.1_Splice_Site	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53							actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						CTGGTACACCCTAAGCAAAGG	0.318																																					.		Atlas-SNP	.											.	CCDC53	14	.	0			c.436-1G>C						.						49.0	45.0	46.0					12																	102419817		1814	4075	5889	SO:0001630	splice_region_variant	51019	exon7			TACACCCTAAGCA	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.436-1G>C	chr12.hg19:g.102419817C>G		63.0	0.0		64.0	15.0	NM_016053	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Splice_Site	SNP	ENST00000240079.6	hg19	CCDS44959.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677624	0.68042	.	.	ENSG00000120860	ENST00000240079;ENST00000545679;ENST00000542923	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0001	0.86378	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC53	100943947	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.374000	0.66167	2.756000	0.94617	0.655000	0.94253	.	.	.		0.318	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398685.1	NM_016053	Intron
VSIG10	54621	hgsc.bcm.edu	37	12	118533474	118533474	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:118533474T>A	ENST00000359236.5	-	2	501	c.225A>T	c.(223-225)ccA>ccT	p.P75P	VSIG10_ENST00000536905.1_5'UTR	NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	75	Ig-like C2-type 1.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						GAGGCTCAGCTGGCCGGAGGC	0.582																																					p.P75P		Atlas-SNP	.											.	VSIG10	41	.	0			c.A225T						.						68.0	79.0	76.0					12																	118533474		2139	4259	6398	SO:0001819	synonymous_variant	54621	exon2			CTCAGCTGGCCGG		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.225A>T	chr12.hg19:g.118533474T>A		137.0	0.0		139.0	132.0	NM_019086	Q9NWQ7	Silent	SNP	ENST00000359236.5	hg19	CCDS44992.1																																																																																			.	.		0.582	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
WASF3	10810	hgsc.bcm.edu	37	13	27239184	27239184	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr13:27239184A>G	ENST00000335327.5	+	4	331	c.153A>G	c.(151-153)atA>atG	p.I51M	WASF3_ENST00000496788.1_3'UTR|WASF3_ENST00000361042.4_Missense_Mutation_p.I51M	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	51					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CTGAAGACATATTTGGTGAGT	0.433																																					p.I51M		Atlas-SNP	.											.	WASF3	68	.	0			c.A153G						.						108.0	101.0	103.0					13																	27239184		2203	4300	6503	SO:0001583	missense	10810	exon4			AGACATATTTGGT	AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.153A>G	chr13.hg19:g.27239184A>G	ENSP00000335055:p.Ile51Met	71.0	0.0		41.0	15.0	NM_006646	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	hg19	CCDS9318.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.190623	0.78789	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.68765	-0.35;-0.35	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	M	0.69358	2.11	0.58432	D	0.999998	P;P	0.48589	0.706;0.912	B;P	0.50934	0.425;0.654	T	0.74734	-0.3565	10	0.44086	T	0.13	-25.4541	15.8529	0.78947	1.0:0.0:0.0:0.0	.	51;51	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	M	51	ENSP00000354325:I51M;ENSP00000335055:I51M	ENSP00000335055:I51M	I	+	3	3	WASF3	26137184	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.127000	0.50484	2.147000	0.66899	0.528000	0.53228	ATA	.	.		0.433	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
FLT1	2321	hgsc.bcm.edu	37	13	29001941	29001941	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr13:29001941G>A	ENST00000282397.4	-	9	1475	c.1224C>T	c.(1222-1224)agC>agT	p.S408S	FLT1_ENST00000539099.1_Silent_p.S408S|FLT1_ENST00000541932.1_Silent_p.S408S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	408	Ig-like C2-type 4.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACTGTTTTATGCTCAGCAAGA	0.398																																					p.S408S		Atlas-SNP	.											.	FLT1	393	.	0			c.C1224T						.						160.0	142.0	148.0					13																	29001941		2203	4300	6503	SO:0001819	synonymous_variant	2321	exon9			TTTTATGCTCAGC	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1224C>T	chr13.hg19:g.29001941G>A		83.0	0.0		38.0	19.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	hg19	CCDS9330.1																																																																																			.	.		0.398	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
EPSTI1	94240	hgsc.bcm.edu	37	13	43469145	43469146	+	Splice_Site	DNP	CC	CC	AA			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr13:43469145_43469146CC>AA	ENST00000398762.3	-	11	946_947	c.947_948GG>TT	c.(946-948)tGG>tTT	p.W316F	EPSTI1_ENST00000313624.7_Splice_Site_p.W305F|EPSTI1_ENST00000313640.7_Splice_Site_p.W316F			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	316										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		AAAAACTCACCCAGCTGTTACC	0.386																																					p.W316C|p.W316L		Atlas-SNP	.											.	EPSTI1	47	.	0			c.G948T|c.G947T						.																																			SO:0001630	splice_region_variant	94240	exon11			ACTCACCCAGCTG|CTCACCCAGCTGT	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.947_948delinsAA	chr13.hg19:g.43469145_43469146delinsAA		83.0|82.0	0.0		21.0	13.0	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	hg19	CCDS9387.1																																																																																			.	.		0.386	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	Missense_Mutation
RB1	5925	hgsc.bcm.edu	37	13	49027173	49027173	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr13:49027173A>C	ENST00000267163.4	+	18	1878	c.1740A>C	c.(1738-1740)gaA>gaC	p.E580D		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	580	Pocket; binds T and E1A.|Spacer.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)|p.R579fs*29(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGGACCGAGAAGGACCAACTG	0.343		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.E580D		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	26	Whole gene deletion(15)|Unknown(10)|Deletion - Frameshift(1)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|eye(2)|adrenal_gland(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	c.A1740C						.						122.0	115.0	117.0					13																	49027173		2203	4300	6503	SO:0001583	missense	5925	exon18	Familial Cancer Database		CCGAGAAGGACCA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1740A>C	chr13.hg19:g.49027173A>C	ENSP00000267163:p.Glu580Asp	46.0	0.0		32.0	11.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	10.07	1.250301	0.22880	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.92348	-3.02	5.75	0.379	0.16213	.	0.125321	0.56097	D	0.000033	D	0.87160	0.6108	M	0.62723	1.935	0.47341	D	0.999392	B	0.02656	0.0	B	0.04013	0.001	T	0.76274	-0.3019	10	0.32370	T	0.25	.	5.8904	0.18909	0.5421:0.0:0.3405:0.1174	.	580	P06400	RB_HUMAN	D	559;580	ENSP00000267163:E580D	ENSP00000267163:E580D	E	+	3	2	RB1	47925174	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.067000	0.30616	0.099000	0.17552	0.533000	0.62120	GAA	.	.		0.343	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
ABCC4	10257	hgsc.bcm.edu	37	13	95816633	95816633	+	Splice_Site	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr13:95816633T>A	ENST00000376887.4	-	16	2288	c.2174A>T	c.(2173-2175)cAg>cTg	p.Q725L	ABCC4_ENST00000412704.1_Intron|ABCC4_ENST00000536256.1_Splice_Site_p.Q650L|ABCC4_ENST00000431522.1_Splice_Site_p.Q725L	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	725	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	ATTATTTACCTGAGCTGCAGT	0.383																																					p.Q725L		Atlas-SNP	.											.	ABCC4	248	.	0			c.A2174T						.						92.0	88.0	89.0					13																	95816633		2203	4300	6503	SO:0001630	splice_region_variant	10257	exon16			TTTACCTGAGCTG	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.2175+1A>T	chr13.hg19:g.95816633T>A		100.0	0.0		60.0	15.0	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	hg19	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.743117	0.49151	.	.	ENSG00000125257	ENST00000376887;ENST00000536256;ENST00000431522	D;D;D	0.94184	-3.37;-2.84;-2.84	5.39	3.97	0.46021	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.225800	0.47093	D	0.000250	D	0.95277	0.8468	M	0.92219	3.285	0.80722	D	1	B;B;B	0.28971	0.209;0.229;0.105	B;B;B	0.38954	0.286;0.25;0.169	D	0.93939	0.7221	10	0.87932	D	0	.	11.1043	0.48193	0.1687:0.0:0.0:0.8313	.	650;725;725	B7Z3Q7;Q8IVZ4;O15439	.;.;MRP4_HUMAN	L	725;650;725	ENSP00000366084:Q725L;ENSP00000442024:Q650L;ENSP00000398562:Q725L	ENSP00000366084:Q725L	Q	-	2	0	ABCC4	94614634	1.000000	0.71417	0.966000	0.40874	0.727000	0.41649	3.120000	0.50430	0.811000	0.34303	0.528000	0.53228	CAG	.	.		0.383	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	Missense_Mutation
RNASE1	6035	hgsc.bcm.edu	37	14	21270099	21270099	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:21270099T>A	ENST00000397967.4	-	2	635	c.129A>T	c.(127-129)tcA>tcT	p.S43S	RNASE1_ENST00000555698.1_Silent_p.S3S|RNASE1_ENST00000340900.3_Silent_p.S43S|RNASE1_ENST00000412779.2_Silent_p.S43S|RNASE1_ENST00000397970.4_Silent_p.S43S	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	43					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	GGGAACTGTCTGAGTCCATAT	0.572																																					p.S43S		Atlas-SNP	.											.	RNASE1	14	.	0			c.A129T						.						69.0	65.0	66.0					14																	21270099		2203	4300	6503	SO:0001819	synonymous_variant	6035	exon3			ACTGTCTGAGTCC	BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.129A>T	chr14.hg19:g.21270099T>A		41.0	0.0		43.0	8.0	NM_198235	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Silent	SNP	ENST00000397967.4	hg19	CCDS9559.1																																																																																			.	.		0.572	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3		
TOX4	9878	hgsc.bcm.edu	37	14	21961062	21961062	+	Silent	SNP	T	T	A	rs571846793		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:21961062T>A	ENST00000405508.1	+	8	1563	c.1287T>A	c.(1285-1287)gcT>gcA	p.A429A	TOX4_ENST00000262709.3_Silent_p.A429A|TOX4_ENST00000448790.2_Silent_p.A406A			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	429	Gln/Pro-rich.|Poly-Ala.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.A429A(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		CAGCAGCAGCTGCTGCTGCTG	0.582													T|||	1	0.000199681	0.0	0.0014	5008	,	,		14814	0.0		0.0	False		,,,				2504	0.0				p.A429A		Atlas-SNP	.											TOX4,NS,carcinoma,0,2	TOX4	50	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1287A						.						63.0	73.0	70.0					14																	21961062		2201	4298	6499	SO:0001819	synonymous_variant	9878	exon7			AGCAGCTGCTGCT	AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1287T>A	chr14.hg19:g.21961062T>A		102.0	0.0		70.0	3.0	NM_014828	B4DPY8|B4DSM0|E7EV69	Silent	SNP	ENST00000405508.1	hg19	CCDS32043.1																																																																																			.	.		0.582	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
DACT1	51339	hgsc.bcm.edu	37	14	59112597	59112597	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:59112597G>T	ENST00000335867.4	+	4	1280	c.1256G>T	c.(1255-1257)tGg>tTg	p.W419L	DACT1_ENST00000556859.1_Missense_Mutation_p.W138L|DACT1_ENST00000395153.3_Missense_Mutation_p.W382L|DACT1_ENST00000541264.2_Missense_Mutation_p.W138L			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	419					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CCGAAGCAGTGGTCGAAAGAA	0.572																																					p.W419L		Atlas-SNP	.											.	DACT1	119	.	0			c.G1256T						.						58.0	62.0	61.0					14																	59112597		2203	4300	6503	SO:0001583	missense	51339	exon4			AGCAGTGGTCGAA	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1256G>T	chr14.hg19:g.59112597G>T	ENSP00000337439:p.Trp419Leu	59.0	0.0		38.0	19.0	NM_016651	A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	hg19	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	G	2.967	-0.213384	0.06140	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.35	4.46	0.54185	.	0.442842	0.27567	N	0.018793	T	0.34832	0.0911	L	0.56769	1.78	0.33000	D	0.526163	P;B	0.35348	0.496;0.288	B;B	0.33521	0.165;0.086	T	0.42224	-0.9464	10	0.10636	T	0.68	-4.7606	10.9689	0.47428	0.1503:0.0:0.8497:0.0	.	382;419	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	L	138;138;382;419;138	ENSP00000451598:W138L;ENSP00000378581:W138L;ENSP00000378582:W382L;ENSP00000337439:W419L;ENSP00000442850:W138L	ENSP00000337439:W419L	W	+	2	0	DACT1	58182350	1.000000	0.71417	0.996000	0.52242	0.046000	0.14306	3.059000	0.49947	1.271000	0.44313	0.563000	0.77884	TGG	.	.		0.572	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651	
SYNE2	23224	hgsc.bcm.edu	37	14	64522760	64522760	+	Silent	SNP	C	C	G	rs373355920		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:64522760C>G	ENST00000344113.4	+	49	10055	c.9843C>G	c.(9841-9843)ccC>ccG	p.P3281P	SYNE2_ENST00000358025.3_Silent_p.P3281P|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.P3314P	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3281					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.P3281P(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCATTATACCCTACAGAGTAG	0.433																																					p.P3281P		Atlas-SNP	.											SYNE2,caecum,carcinoma,0,1	SYNE2	577	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9843G						.						78.0	72.0	74.0					14																	64522760		1942	4136	6078	SO:0001819	synonymous_variant	23224	exon49			TATACCCTACAGA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9843C>G	chr14.hg19:g.64522760C>G		227.0	0.0		176.0	58.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.433	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
EXD2	55218	hgsc.bcm.edu	37	14	69676318	69676318	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:69676318A>T	ENST00000409018.3	+	2	259	c.131A>T	c.(130-132)cAg>cTg	p.Q44L	EXD2_ENST00000409949.1_5'UTR|RP11-363J20.1_ENST00000554898.1_lincRNA|EXD2_ENST00000409014.1_5'UTR|EXD2_ENST00000449989.1_5'Flank|EXD2_ENST00000409242.1_5'UTR|EXD2_ENST00000312994.5_Missense_Mutation_p.Q44L|EXD2_ENST00000409675.1_Intron|EXD2_ENST00000492815.1_3'UTR	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	44							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CAACAGCCACAGCAGAAAGTG	0.577																																					p.Q44L		Atlas-SNP	.											.	EXD2	43	.	0			c.A131T						.																																			SO:0001583	missense	55218	exon2			AGCCACAGCAGAA	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.131A>T	chr14.hg19:g.69676318A>T	ENSP00000387331:p.Gln44Leu	110.0	0.0		82.0	55.0	NM_001193361	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	ENST00000409018.3	hg19	CCDS53902.1	.	.	.	.	.	.	.	.	.	.	A	9.730	1.161941	0.21538	.	.	ENSG00000081177	ENST00000409018;ENST00000193422;ENST00000312994	T;T	0.75821	-0.97;-0.97	5.43	1.69	0.24217	.	.	.	.	.	T	0.53818	0.1820	N	0.24115	0.695	0.31422	N	0.674153	B	0.02656	0.0	B	0.04013	0.001	T	0.47522	-0.9111	9	0.29301	T	0.29	-0.5606	2.8782	0.05639	0.6251:0.1516:0.0783:0.145	.	44	G5E947	.	L	44	ENSP00000387331:Q44L;ENSP00000313140:Q44L	ENSP00000193422:Q44L	Q	+	2	0	EXD2	68746071	0.000000	0.05858	0.663000	0.29738	0.120000	0.20174	-1.197000	0.03038	0.330000	0.23485	-0.333000	0.08304	CAG	.	.		0.577	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1		
MLH3	27030	hgsc.bcm.edu	37	14	75505088	75505088	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:75505088T>C	ENST00000556740.1	-	5	3633	c.3598A>G	c.(3598-3600)Att>Gtt	p.I1200V	MLH3_ENST00000544985.1_Missense_Mutation_p.I160V|MLH3_ENST00000556257.1_Intron|MLH3_ENST00000355774.2_Missense_Mutation_p.I1200V|MLH3_ENST00000238662.7_Missense_Mutation_p.I1200V|MLH3_ENST00000380968.2_Missense_Mutation_p.I146V|MLH3_ENST00000555671.1_5'Flank			Q9UHC1	MLH3_HUMAN	mutL homolog 3	1200					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		AAACAGGCAATAAACTTGTTA	0.368								Mismatch excision repair (MMR)																													p.I1200V		Atlas-SNP	.											.	MLH3	200	.	0			c.A3598G						.						134.0	122.0	126.0					14																	75505088		2203	4300	6503	SO:0001583	missense	27030	exon6			AGGCAATAAACTT	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.3598A>G	chr14.hg19:g.75505088T>C	ENSP00000452316:p.Ile1200Val	77.0	0.0		57.0	21.0	NM_014381	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	hg19	CCDS32123.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766194	0.69878	.	.	ENSG00000119684	ENST00000355774;ENST00000380968;ENST00000238662;ENST00000556740;ENST00000544985	T;T;D;T;T	0.86230	-1.21;-1.21;-2.09;-1.21;0.24	5.58	5.58	0.84498	MutL, C-terminal, dimerisation (1);	0.053490	0.85682	D	0.000000	D	0.92919	0.7747	M	0.78285	2.405	0.32419	N	0.549637	D;D	0.71674	0.998;0.984	D;D	0.66716	0.938;0.946	D	0.94788	0.7959	10	0.66056	D	0.02	-18.7395	15.7499	0.77976	0.0:0.0:0.0:1.0	.	1200;1200	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	V	1200;146;1200;1200;160	ENSP00000348020:I1200V;ENSP00000370355:I146V;ENSP00000238662:I1200V;ENSP00000452316:I1200V;ENSP00000441371:I160V	ENSP00000238662:I1200V	I	-	1	0	MLH3	74574841	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.300000	0.65721	2.134000	0.65973	0.459000	0.35465	ATT	.	.		0.368	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
SERPINA3	12	hgsc.bcm.edu	37	14	95088801	95088801	+	Silent	SNP	A	A	T	rs1802958	byFrequency	TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:95088801A>T	ENST00000467132.1	+	4	2189	c.1041A>T	c.(1039-1041)acA>acT	p.T347T	SERPINA3_ENST00000482740.1_Silent_p.T129T|SERPINA3_ENST00000393078.3_Silent_p.T347T|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393080.4_Silent_p.T347T			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	347					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		CAGGGATCACAGGGGCCAGGA	0.498																																					p.T347T		Atlas-SNP	.											.	SERPINA3	78	.	0			c.A1041T						.						74.0	69.0	71.0					14																	95088801		2203	4300	6503	SO:0001819	synonymous_variant	12	exon4			GATCACAGGGGCC	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.1041A>T	chr14.hg19:g.95088801A>T		124.0	0.0		76.0	21.0	NM_001085	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Silent	SNP	ENST00000467132.1	hg19	CCDS32150.1																																																																																			.	A|0.990;G|0.010		0.498	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085	
HERC2	8924	hgsc.bcm.edu	37	15	28460799	28460799	+	Missense_Mutation	SNP	C	C	G	rs558450056		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:28460799C>G	ENST00000261609.7	-	39	6286	c.6178G>C	c.(6178-6180)Gca>Cca	p.A2060P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.A2060P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTGAAGGGTGCGTGCCCTTCC	0.617																																					p.A2060P		Atlas-SNP	.											HERC2,NS,carcinoma,0,1	HERC2	501	.	1	Substitution - Missense(1)	lung(1)	c.G6178C						.						17.0	14.0	15.0					15																	28460799		2201	4292	6493	SO:0001583	missense	8924	exon39			AGGGTGCGTGCCC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6178G>C	chr15.hg19:g.28460799C>G	ENSP00000261609:p.Ala2060Pro	123.0	0.0		101.0	65.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513389	0.27123	.	.	ENSG00000128731	ENST00000261609	T	0.39787	1.06	4.28	2.38	0.29361	.	0.220211	0.37136	N	0.002237	T	0.24547	0.0595	N	0.19112	0.55	0.34906	D	0.746953	B	0.26975	0.165	B	0.19148	0.024	T	0.19976	-1.0289	10	0.48119	T	0.1	.	8.8827	0.35384	0.1481:0.7732:0.0:0.0788	.	2060	O95714	HERC2_HUMAN	P	2060	ENSP00000261609:A2060P	ENSP00000261609:A2060P	A	-	1	0	HERC2	26134394	1.000000	0.71417	0.041000	0.18516	0.553000	0.35397	2.487000	0.45268	0.448000	0.26722	-0.347000	0.07816	GCA	.	.		0.617	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TMCO5A	145942	hgsc.bcm.edu	37	15	38228513	38228513	+	Splice_Site	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:38228513A>T	ENST00000319669.4	+	2	92		c.e2-1		TMCO5A_ENST00000558158.1_Splice_Site|TMCO5A_ENST00000540944.1_Splice_Site|TMCO5A_ENST00000559502.1_Splice_Site	NM_152453.2	NP_689666.2	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A							integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	15						CTGAGTCTATAGGTCGGAGAA	0.383																																					.		Atlas-SNP	.											.	TMCO5A	42	.	0			.						.						74.0	73.0	73.0					15																	38228513		2200	4297	6497	SO:0001630	splice_region_variant	145942	.			GTCTATAGGTCGG	BC029221	CCDS10046.1	15q14	2008-06-10	2008-06-10	2008-06-10	ENSG00000166069	ENSG00000166069			28558	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 5"""	TMCO5		12477932	Standard	NM_152453		Approved	MGC35118	uc001zjw.3	Q8N6Q1	OTTHUMG00000129787	ENST00000319669.4:c.-10-1A>T	chr15.hg19:g.38228513A>T		67.0	0.0		66.0	17.0	.	Q8NA63	Splice_Site	SNP	ENST00000319669.4	hg19	CCDS10046.1																																																																																			.	.		0.383	TMCO5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252012.1	NM_152453	Intron
PLA2G4B	100137049	hgsc.bcm.edu	37	15	42137485	42137485	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:42137485A>G	ENST00000452633.1	+	15	1676	c.1324A>G	c.(1324-1326)Aaa>Gaa	p.K442E	PLA2G4B_ENST00000542534.2_Missense_Mutation_p.K673E|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.K673E|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.K673E|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.K442E			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	442	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		CCTCAACACCAAAGGGCAGAG	0.562																																					p.K673E		Atlas-SNP	.											.	JMJD7-PLA2G4B	90	.	0			c.A2017G						.						65.0	61.0	62.0					15																	42137485		2203	4300	6503	SO:0001583	missense	8681	exon19			AACACCAAAGGGC	AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.1324A>G	chr15.hg19:g.42137485A>G	ENSP00000396045:p.Lys442Glu	85.0	0.0		48.0	8.0	NM_005090	B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000452633.1	hg19	CCDS45241.1	.	.	.	.	.	.	.	.	.	.	.	26.4	4.738644	0.89573	.	.	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.04502	3.61;3.61;3.61;3.61	5.31	5.31	0.75309	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.64402	D	0.000002	T	0.21962	0.0529	M	0.79258	2.445	0.47009	D	0.999281	D;D;D;D	0.89917	1.0;0.999;1.0;0.998	D;D;D;D	0.97110	1.0;0.996;1.0;0.994	T	0.00360	-1.1790	10	0.59425	D	0.04	-1.8065	14.5476	0.68044	1.0:0.0:0.0:0.0	.	442;673;143;673	P0C869;P0C869-7;P0C869-4;P0C869-6	PA24B_HUMAN;.;.;.	E	673;673;442;442	ENSP00000371886:K673E;ENSP00000342785:K673E;ENSP00000416610:K442E;ENSP00000396045:K442E	ENSP00000342785:K673E	K	+	1	0	JMJD7-PLA2G4B;PLA2G4B	39924777	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.148000	0.77389	2.146000	0.66826	0.459000	0.35465	AAA	.	.		0.562	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345969.1	NM_001114633	
TP53BP1	7158	hgsc.bcm.edu	37	15	43700285	43700285	+	Splice_Site	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:43700285G>T	ENST00000263801.3	-	27	5839	c.5587C>A	c.(5587-5589)Caa>Aaa	p.Q1863K	TP53BP1_ENST00000450115.2_Splice_Site_p.Q1866K|TP53BP1_ENST00000382039.3_Splice_Site_p.Q1818K|TP53BP1_ENST00000382044.4_Splice_Site_p.Q1868K	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1863					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TCACGGGGTTGCCTATGAAGG	0.448								Other conserved DNA damage response genes																													p.Q1868K		Atlas-SNP	.											.	TP53BP1	157	.	0			c.C5602A						.						65.0	64.0	64.0					15																	43700285		2201	4298	6499	SO:0001630	splice_region_variant	7158	exon27			GGGGTTGCCTATG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5586-1C>A	chr15.hg19:g.43700285G>T		71.0	0.0		35.0	5.0	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	hg19	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.330941	0.81690	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.36	5.36	0.76844	BRCT (1);	0.195493	0.46442	D	0.000296	D	0.85115	0.5623	L	0.50333	1.59	0.42923	D	0.994298	B;B;B	0.33549	0.417;0.246;0.355	B;B;B	0.35470	0.108;0.189;0.203	T	0.82898	-0.0229	10	0.29301	T	0.29	-10.7917	18.4214	0.90591	0.0:0.0:1.0:0.0	.	1863;1868;1866	Q12888;Q12888-2;F8VY86	TP53B_HUMAN;.;.	K	1863;1868;1818;1866	ENSP00000263801:Q1863K;ENSP00000371475:Q1868K;ENSP00000371470:Q1818K;ENSP00000393497:Q1866K	ENSP00000263801:Q1863K	Q	-	1	0	TP53BP1	41487577	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.589000	0.82641	2.663000	0.90544	0.591000	0.81541	CAA	.	.		0.448	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		Missense_Mutation
SLC12A1	6557	hgsc.bcm.edu	37	15	48577419	48577419	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:48577419A>T	ENST00000558405.1	+	20	2616	c.2602A>T	c.(2602-2604)Aac>Tac	p.N868Y	SLC12A1_ENST00000396577.3_Missense_Mutation_p.N868Y|SLC12A1_ENST00000380993.3_Missense_Mutation_p.N868Y			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	868					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TGGCAAGTTGAACATTACTAA	0.373																																					p.N868Y		Atlas-SNP	.											.	SLC12A1	243	.	0			c.A2602T						.						106.0	113.0	111.0					15																	48577419		2198	4297	6495	SO:0001583	missense	6557	exon21			AAGTTGAACATTA		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2602A>T	chr15.hg19:g.48577419A>T	ENSP00000453409:p.Asn868Tyr	223.0	1.0		156.0	90.0	NM_001184832	A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	hg19	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	A	9.497	1.102260	0.20632	.	.	ENSG00000074803	ENST00000380993;ENST00000396577	D;D	0.85339	-1.97;-1.97	5.52	1.61	0.23674	.	0.245554	0.46758	D	0.000277	T	0.76543	0.4002	L	0.34521	1.04	0.35231	D	0.776947	B;B	0.22541	0.017;0.071	B;B	0.28385	0.028;0.089	T	0.74262	-0.3722	10	0.62326	D	0.03	.	8.3507	0.32301	0.5657:0.3659:0.0684:0.0	.	868;868	E9PDW4;Q13621	.;S12A1_HUMAN	Y	868	ENSP00000370381:N868Y;ENSP00000379822:N868Y	ENSP00000370381:N868Y	N	+	1	0	SLC12A1	46364711	1.000000	0.71417	0.998000	0.56505	0.133000	0.20885	2.108000	0.41854	0.446000	0.26666	0.533000	0.62120	AAC	.	.		0.373	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		
PRTG	283659	hgsc.bcm.edu	37	15	55931838	55931838	+	Splice_Site	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:55931838A>T	ENST00000389286.4	-	13	2372		c.e13+1			NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GGAGCTACATACGTTTGAAGG	0.493																																					.		Atlas-SNP	.											.	PRTG	110	.	0			c.2324+2T>A						.						115.0	118.0	117.0					15																	55931838		2003	4172	6175	SO:0001630	splice_region_variant	283659	exon14			CTACATACGTTTG	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.2324+1T>A	chr15.hg19:g.55931838A>T		102.0	0.0		91.0	31.0	NM_173814		Splice_Site	SNP	ENST00000389286.4	hg19	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727835	0.89390	.	.	ENSG00000166450	ENST00000389286	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3502	0.74376	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRTG	53719130	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.625000	0.90965	2.213000	0.71641	0.533000	0.62120	.	.	.		0.493	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	Intron
RFX7	64864	hgsc.bcm.edu	37	15	56388218	56388218	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:56388218C>T	ENST00000559447.2	-	9	1688	c.1417G>A	c.(1417-1419)Ggg>Agg	p.G473R	RFX7_ENST00000317318.6_Missense_Mutation_p.G570R|RFX7_ENST00000423270.1_Missense_Mutation_p.G570R|RFX7_ENST00000422057.1_Missense_Mutation_p.G473R			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	473					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CTTTTCTGCCCCAAAAGGGCA	0.453																																					p.G570R		Atlas-SNP	.											.	RFX7	170	.	0			c.G1708A						.						65.0	59.0	61.0					15																	56388218		1888	4098	5986	SO:0001583	missense	64864	exon9			TCTGCCCCAAAAG			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1417G>A	chr15.hg19:g.56388218C>T	ENSP00000453281:p.Gly473Arg	64.0	0.0		29.0	7.0	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	hg19		.	.	.	.	.	.	.	.	.	.	C	13.90	2.375275	0.42105	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.54071	0.6;0.59;0.6	5.09	5.09	0.68999	.	0.000000	0.56097	D	0.000025	T	0.34164	0.0888	N	0.19112	0.55	0.45791	D	0.998677	P;P	0.46706	0.745;0.883	B;B	0.36719	0.169;0.231	T	0.33059	-0.9883	10	0.62326	D	0.03	-2.5911	11.0249	0.47739	0.0:0.9147:0.0:0.0853	.	473;473	Q2KHR2;C9JU50	RFX7_HUMAN;.	R	473;570;570	ENSP00000387504:G473R;ENSP00000313299:G570R;ENSP00000397644:G570R	ENSP00000313299:G570R	G	-	1	0	RFX7	54175510	0.352000	0.24895	0.868000	0.34077	0.973000	0.67179	4.349000	0.59385	2.336000	0.79503	0.655000	0.94253	GGG	.	.		0.453	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
RLBP1	6017	hgsc.bcm.edu	37	15	89754011	89754011	+	Silent	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr15:89754011G>T	ENST00000268125.5	-	8	1153	c.714C>A	c.(712-714)atC>atA	p.I238I		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	238	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	GGATGAAGTGGATGGCTTTGA	0.582																																					p.I238I		Atlas-SNP	.											.	RLBP1	34	.	0			c.C714A						.						155.0	118.0	131.0					15																	89754011		2200	4299	6499	SO:0001819	synonymous_variant	6017	exon8			GAAGTGGATGGCT	BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.714C>A	chr15.hg19:g.89754011G>T		202.0	0.0		211.0	87.0	NM_000326	B2R667	Silent	SNP	ENST00000268125.5	hg19	CCDS32324.1																																																																																			.	.		0.582	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421135.1	NM_000326	
FLYWCH1	84256	hgsc.bcm.edu	37	16	2980531	2980531	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:2980531A>G	ENST00000253928.9	+	4	851	c.446A>G	c.(445-447)cAa>cGa	p.Q149R	FLYWCH1_ENST00000399667.2_Missense_Mutation_p.Q149R|FLYWCH1_ENST00000416288.2_Missense_Mutation_p.Q148R			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	149						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						AAGTGCCGCCAACATGCTGAG	0.672																																					p.Q148R		Atlas-SNP	.											.	FLYWCH1	27	.	0			c.A443G						.						11.0	12.0	12.0					16																	2980531		1973	4130	6103	SO:0001583	missense	84256	exon4			GCCGCCAACATGC	AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.446A>G	chr16.hg19:g.2980531A>G	ENSP00000253928:p.Gln149Arg	50.0	0.0		69.0	27.0	NM_020912	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	ENST00000253928.9	hg19		.	.	.	.	.	.	.	.	.	.	A	8.605	0.887820	0.17540	.	.	ENSG00000059122	ENST00000399667;ENST00000253928;ENST00000416288	.	.	.	3.42	1.16	0.20824	Zinc finger, FLYWCH-type (1);	.	.	.	.	T	0.27765	0.0683	L	0.31664	0.95	0.09310	N	1	B;B	0.25904	0.033;0.137	B;B	0.25140	0.018;0.058	T	0.22695	-1.0209	8	0.52906	T	0.07	.	5.022	0.14365	0.7451:0.0:0.2549:0.0	.	149;148	Q4VC44;Q4VC44-2	FWCH1_HUMAN;.	R	149;149;148	.	ENSP00000253928:Q149R	Q	+	2	0	FLYWCH1	2920532	0.009000	0.17119	0.013000	0.15412	0.329000	0.28539	2.019000	0.41001	0.218000	0.20820	0.533000	0.62120	CAA	.	.		0.672	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000436479.1	NM_032296	
CCDC64B	146439	hgsc.bcm.edu	37	16	3085406	3085406	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:3085406A>T	ENST00000572449.1	-	2	154	c.92T>A	c.(91-93)cTg>cAg	p.L31Q	RP11-473M20.5_ENST00000382225.3_RNA|CCDC64B_ENST00000573514.1_5'Flank|CCDC64B_ENST00000389347.4_Missense_Mutation_p.L31Q			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	31										breast(1)|endometrium(2)|large_intestine(1)	4						CCGCCGCTCCAGCACAAAGGG	0.677																																					p.L31Q		Atlas-SNP	.											.	CCDC64B	19	.	0			c.T92A						.						13.0	16.0	15.0					16																	3085406		1871	4084	5955	SO:0001583	missense	146439	exon1			CGCTCCAGCACAA	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.92T>A	chr16.hg19:g.3085406A>T	ENSP00000459043:p.Leu31Gln	59.0	0.0		66.0	39.0	NM_001103175	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	hg19	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	a	17.24	3.340349	0.60963	.	.	ENSG00000162069	ENST00000389347	T	0.31510	1.49	5.08	5.08	0.68730	.	0.135593	0.31976	N	0.006764	T	0.47563	0.1452	L	0.50333	1.59	0.41676	D	0.989269	D	0.71674	0.998	D	0.69142	0.962	T	0.48210	-0.9055	10	0.62326	D	0.03	-16.8351	12.8084	0.57626	1.0:0.0:0.0:0.0	.	31	A1A5D9	BICR2_HUMAN	Q	31	ENSP00000373998:L31Q	ENSP00000373998:L31Q	L	-	2	0	CCDC64B	3025407	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.470000	0.45119	1.913000	0.55393	0.375000	0.23000	CTG	.	.		0.677	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
RBFOX1	54715	hgsc.bcm.edu	37	16	7629893	7629893	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:7629893C>T	ENST00000550418.1	+	6	1373	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	RBFOX1_ENST00000535565.2_Intron|RBFOX1_ENST00000340209.4_Missense_Mutation_p.R134W|RBFOX1_ENST00000355637.4_Missense_Mutation_p.R149W|RBFOX1_ENST00000547372.1_Missense_Mutation_p.R172W|RBFOX1_ENST00000311745.5_Missense_Mutation_p.R149W|RBFOX1_ENST00000553186.1_Missense_Mutation_p.R129W|RBFOX1_ENST00000547338.1_Missense_Mutation_p.R129W|RBFOX1_ENST00000436368.2_Missense_Mutation_p.R149W|RBFOX1_ENST00000422070.4_Missense_Mutation_p.R172W|RBFOX1_ENST00000552089.1_Missense_Mutation_p.R164W	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	129	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CTTCAGGTTCCGGGATCCGGA	0.542																																					p.R149W	Ovarian(157;934 2567 15163 39509)	Atlas-SNP	.											RBFOX1_ENST00000550418,NS,adenoma,0,6	RBFOX1	341	.	0			c.C445T						.						99.0	91.0	93.0					16																	7629893		2197	4300	6497	SO:0001583	missense	54715	exon3			AGGTTCCGGGATC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.385C>T	chr16.hg19:g.7629893C>T	ENSP00000450031:p.Arg129Trp	165.0	0.0		214.0	103.0	NM_145891	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	hg19	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555076	0.86231	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T;T	0.36340	2.33;2.33;2.33;2.33;2.33;1.26;2.33;2.33;2.33;2.33;2.33;2.33	5.39	5.39	0.77823	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.57125	0.2032	M	0.64170	1.965	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.99;0.996;0.999;0.996;0.996;0.996;0.999;0.996	T	0.59332	-0.7474	10	0.87932	D	0	-7.8681	14.0697	0.64852	0.1505:0.8495:0.0:0.0	.	149;172;149;149;149;129;129;172	F8WAC5;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;RFOX1_HUMAN;.	W	128;129;129;172;172;164;129;129;149;149;149;149;134	ENSP00000450402:R128W;ENSP00000450031:R129W;ENSP00000447753:R129W;ENSP00000446842:R172W;ENSP00000391269:R172W;ENSP00000448496:R164W;ENSP00000447281:R129W;ENSP00000447717:R129W;ENSP00000402745:R149W;ENSP00000309117:R149W;ENSP00000347855:R149W;ENSP00000344196:R134W	ENSP00000309117:R149W	R	+	1	2	RBFOX1	7569894	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.713000	0.47194	2.537000	0.85549	0.655000	0.94253	CGG	.	.		0.542	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
KIAA0430	9665	hgsc.bcm.edu	37	16	15727694	15727694	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:15727694G>T	ENST00000396368.3	-	5	1219	c.1013C>A	c.(1012-1014)cCa>cAa	p.P338Q	KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000344181.3_Missense_Mutation_p.P160Q|KIAA0430_ENST00000540441.2_Missense_Mutation_p.P338Q|KIAA0430_ENST00000551742.1_Missense_Mutation_p.P338Q|KIAA0430_ENST00000602337.1_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	338					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGCAACTTCTGGTGACCCTTA	0.398																																					p.P338Q		Atlas-SNP	.											.	KIAA0430	154	.	0			c.C1013A						.						55.0	52.0	53.0					16																	15727694		1813	4082	5895	SO:0001583	missense	9665	exon5			ACTTCTGGTGACC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.1013C>A	chr16.hg19:g.15727694G>T	ENSP00000379654:p.Pro338Gln	110.0	0.0		133.0	51.0	NM_014647	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	hg19	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927974	0.92389	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000551742;ENST00000551298	.	.	.	5.78	5.78	0.91487	.	0.098545	0.64402	D	0.000001	T	0.74107	0.3673	L	0.56769	1.78	0.37147	D	0.901981	P;P	0.45827	0.867;0.79	P;P	0.54815	0.761;0.581	T	0.76963	-0.2764	9	0.66056	D	0.02	.	20.3754	0.98918	0.0:0.0:1.0:0.0	.	337;337	Q9Y4F3-5;Q9Y4F3	.;LKAP_HUMAN	Q	338;338;337;160;338;338	.	ENSP00000315718:P337Q	P	-	2	0	KIAA0430	15635195	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.221000	0.89774	2.894000	0.99253	0.591000	0.81541	CCA	.	.		0.398	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
MYH11	4629	hgsc.bcm.edu	37	16	15853461	15853461	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:15853461A>T	ENST00000300036.5	-	12	1482	c.1373T>A	c.(1372-1374)cTg>cAg	p.L458Q	MYH11_ENST00000452625.2_Missense_Mutation_p.L465Q|MYH11_ENST00000396324.3_Missense_Mutation_p.L465Q|MYH11_ENST00000576790.2_Missense_Mutation_p.L458Q	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	458	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AGCTATATCCAGGATCCCCAG	0.532			T	CBFB	AML																																p.L465Q		Atlas-SNP	.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	520	.	0			c.T1394A						.						144.0	135.0	138.0					16																	15853461		2197	4300	6497	SO:0001583	missense	4629	exon13			ATATCCAGGATCC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1373T>A	chr16.hg19:g.15853461A>T	ENSP00000300036:p.Leu458Gln	122.0	0.0		125.0	63.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	hg19	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.961010	0.92791	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	5.75	5.75	0.90469	Myosin head, motor domain (3);	0.000000	0.64402	D	0.000004	D	0.96188	0.8757	H	0.99609	4.655	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	D	0.98104	1.0416	10	0.87932	D	0	.	15.2367	0.73436	1.0:0.0:0.0:0.0	.	465;458;458;465;458;465	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	Q	458;458;465;465;465	ENSP00000300036:L458Q;ENSP00000345136:L458Q;ENSP00000379616:L465Q;ENSP00000407821:L465Q	ENSP00000300036:L458Q	L	-	2	0	MYH11	15760962	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.185000	0.69588	0.459000	0.35465	CTG	.	.		0.532	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
CHD9	80205	hgsc.bcm.edu	37	16	53341643	53341643	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:53341643A>C	ENST00000398510.3	+	32	6918	c.6831A>C	c.(6829-6831)aaA>aaC	p.K2277N	CHD9_ENST00000447540.1_Missense_Mutation_p.K2278N|CHD9_ENST00000564845.1_Missense_Mutation_p.K2277N|CHD9_ENST00000566029.1_Missense_Mutation_p.K2277N			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2277					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CAGTTCTGAAAGGAAAGTGGC	0.403																																					p.K2277N		Atlas-SNP	.											.	CHD9	203	.	0			c.A6831C						.						58.0	58.0	58.0					16																	53341643		1915	4125	6040	SO:0001583	missense	80205	exon33			TCTGAAAGGAAAG	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6831A>C	chr16.hg19:g.53341643A>C	ENSP00000381522:p.Lys2277Asn	165.0	0.0		183.0	31.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	hg19		.	.	.	.	.	.	.	.	.	.	A	15.32	2.800049	0.50208	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.88431	-2.33;-2.38	5.71	4.62	0.57501	.	0.000000	0.64402	D	0.000008	D	0.91616	0.7351	L	0.55481	1.735	0.53005	D	0.999963	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0	D;D;D;D;D	0.85130	0.994;0.991;0.997;0.994;0.996	D	0.89847	0.4007	10	0.38643	T	0.18	-22.8772	9.6337	0.39795	0.8479:0.0:0.1521:0.0	.	343;2277;2278;2277;2277	C9JR69;B7ZML1;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;.;CHD9_HUMAN;.	N	2278;2277;343	ENSP00000396345:K2278N;ENSP00000381522:K2277N	ENSP00000381522:K2277N	K	+	3	2	CHD9	51899144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.335000	0.43929	1.095000	0.41419	0.528000	0.53228	AAA	.	.		0.403	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
GPR114	221188	hgsc.bcm.edu	37	16	57608882	57608882	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:57608882A>G	ENST00000340339.4	+	11	1887	c.1364A>G	c.(1363-1365)gAc>gGc	p.D455G	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.D455G	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	455					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						GCCTGCCATGACACTGTCACT	0.642																																					p.D455G		Atlas-SNP	.											.	GPR114	52	.	0			c.A1364G						.						86.0	66.0	73.0					16																	57608882		2198	4300	6498	SO:0001583	missense	221188	exon11			GCCATGACACTGT	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.1364A>G	chr16.hg19:g.57608882A>G	ENSP00000342981:p.Asp455Gly	36.0	0.0		36.0	6.0	NM_153837	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	hg19	CCDS10785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.95|13.95	2.390974|2.390974	0.42410|0.42410	.|.	.|.	ENSG00000159618|ENSG00000159618	ENST00000340339;ENST00000349457|ENST00000394361	T;T|.	0.44083|.	0.93;0.93|.	5.56|5.56	5.56|5.56	0.83823|0.83823	GPCR, family 2-like (1);|.	0.100786|.	0.43579|.	D|.	0.000551|.	T|T	0.52964|0.52964	0.1767|0.1767	L|L	0.55017|0.55017	1.72|1.72	0.38398|0.38398	D|D	0.945598|0.945598	D|B	0.89917|0.28605	1.0|0.217	D|B	0.97110|0.24701	1.0|0.055	T|T	0.58578|0.58578	-0.7612|-0.7612	10|8	0.19147|0.62326	T|D	0.46|0.03	.|.	13.0786|13.0786	0.59100|0.59100	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	455|416	Q8IZF4|B4E148	GP114_HUMAN|.	G|A	455|416	ENSP00000342981:D455G;ENSP00000290823:D455G|.	ENSP00000342981:D455G|ENSP00000377888:T416A	D|T	+|+	2|1	0|0	GPR114|GPR114	56166383|56166383	0.997000|0.997000	0.39634|0.39634	0.454000|0.454000	0.27019|0.27019	0.326000|0.326000	0.28443|0.28443	3.773000|3.773000	0.55333|0.55333	2.116000|2.116000	0.64780|0.64780	0.402000|0.402000	0.26972|0.26972	GAC|ACA	.	.		0.642	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837	
DRC7	84229	hgsc.bcm.edu	37	16	57731872	57731872	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:57731872T>A	ENST00000360716.3	+	3	232	c.11T>A	c.(10-12)cTg>cAg	p.L4Q	RP11-405F3.4_ENST00000563062.1_RNA|CCDC135_ENST00000336825.8_Missense_Mutation_p.L4Q|CCDC135_ENST00000394337.4_Missense_Mutation_p.L4Q			Q8IY82	CC135_HUMAN		4					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						ATGGAGGTCCTGAGggagaag	0.607																																					p.L4Q		Atlas-SNP	.											.	CCDC135	97	.	0			c.T11A						.						70.0	71.0	71.0					16																	57731872		2198	4300	6498	SO:0001583	missense	84229	exon2			AGGTCCTGAGGGA																												ENST00000360716.3:c.11T>A	chr16.hg19:g.57731872T>A	ENSP00000353942:p.Leu4Gln	52.0	0.0		39.0	8.0	NM_032269	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	hg19	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042265	0.55003	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.19250	2.6;2.16;2.6	4.3	4.3	0.51218	.	0.000000	0.47455	D	0.000228	T	0.41627	0.1167	M	0.66939	2.045	0.31928	N	0.612499	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.52011	-0.8632	10	0.87932	D	0	-11.9756	10.1444	0.42755	0.0:0.0:0.0:1.0	.	4;4	Q8IY82-2;Q8IY82	.;CC135_HUMAN	Q	4	ENSP00000377869:L4Q;ENSP00000338938:L4Q;ENSP00000353942:L4Q	ENSP00000338938:L4Q	L	+	2	0	CCDC135	56289373	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	3.418000	0.52721	2.165000	0.68154	0.448000	0.29417	CTG	.	.		0.607	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
CTCF	10664	hgsc.bcm.edu	37	16	67662374	67662374	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:67662374G>A	ENST00000264010.4	+	9	2064	c.1620G>A	c.(1618-1620)atG>atA	p.M540I	CTCF_ENST00000401394.1_Missense_Mutation_p.M212I	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	540					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TTCTCGACATGCACTTCAAGC	0.542																																					p.M540I	Colon(175;1200 1966 6945 23069 27405)	Atlas-SNP	.											.	CTCF	193	.	0			c.G1620A						.						213.0	177.0	189.0					16																	67662374		2198	4300	6498	SO:0001583	missense	10664	exon9			CGACATGCACTTC	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1620G>A	chr16.hg19:g.67662374G>A	ENSP00000264010:p.Met540Ile	168.0	0.0		178.0	113.0	NM_006565	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	hg19	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626207	0.66901	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.59502	0.26;0.26	5.72	5.72	0.89469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.42040	0.1185	N	0.12663	0.25	0.80722	D	1	B;B	0.29627	0.023;0.252	B;B	0.25884	0.011;0.064	T	0.26224	-1.0109	10	0.29301	T	0.29	-3.2266	19.488	0.95037	0.0:0.0:1.0:0.0	.	212;540	B5MC38;P49711	.;CTCF_HUMAN	I	540;212	ENSP00000264010:M540I;ENSP00000384707:M212I	ENSP00000264010:M540I	M	+	3	0	CTCF	66219875	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.845000	0.86875	2.702000	0.92279	0.462000	0.41574	ATG	.	.		0.542	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
SLC12A4	6560	hgsc.bcm.edu	37	16	67985728	67985728	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:67985728T>A	ENST00000316341.3	-	8	1270	c.1130A>T	c.(1129-1131)cAg>cTg	p.Q377L	SLC12A4_ENST00000422611.2_Missense_Mutation_p.Q379L|SLC12A4_ENST00000338335.3_Missense_Mutation_p.Q377L|SLC12A4_ENST00000576616.1_Missense_Mutation_p.Q377L|SLC12A4_ENST00000537830.2_Missense_Mutation_p.Q371L|SLC12A4_ENST00000541864.2_Missense_Mutation_p.Q346L|SLC12A4_ENST00000572037.1_Missense_Mutation_p.Q329L|SLC12A4_ENST00000572010.1_5'Flank	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	377					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGACCCACCCTGGAGCACACC	0.632																																					p.Q379L		Atlas-SNP	.											.	SLC12A4	81	.	0			c.A1136T						.						47.0	34.0	38.0					16																	67985728		2198	4300	6498	SO:0001583	missense	6560	exon7			CCACCCTGGAGCA		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1130A>T	chr16.hg19:g.67985728T>A	ENSP00000318557:p.Gln377Leu	55.0	0.0		72.0	44.0	NM_001145962	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	hg19	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	T	5.354	0.250690	0.10130	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06	4.33	4.33	0.51752	.	0.148508	0.64402	D	0.000014	T	0.21962	0.0529	N	0.00112	-2.095	0.37516	D	0.917357	B;B;B;B;B;B	0.10296	0.0;0.0;0.003;0.0;0.0;0.0	B;B;B;B;B;B	0.13407	0.0;0.0;0.009;0.0;0.0;0.0	T	0.32693	-0.9897	10	0.11182	T	0.66	.	13.6063	0.62050	0.0:0.0:0.0:1.0	.	379;377;346;371;377;377	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	L	379;346;371;377;377	ENSP00000395983:Q379L;ENSP00000438334:Q346L;ENSP00000445962:Q371L;ENSP00000343374:Q377L;ENSP00000318557:Q377L	ENSP00000318557:Q377L	Q	-	2	0	SLC12A4	66543229	0.776000	0.28616	1.000000	0.80357	0.941000	0.58515	0.775000	0.26689	1.958000	0.56883	0.383000	0.25322	CAG	.	.		0.632	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
HYDIN	54768	hgsc.bcm.edu	37	16	70852337	70852337	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:70852337T>A	ENST00000393567.2	-	84	14716	c.14566A>T	c.(14566-14568)Aac>Tac	p.N4856Y		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4856					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCAGAGGGTTCTCCAACTTG	0.582																																					p.N4856Y		Atlas-SNP	.											.	HYDIN	788	.	0			c.A14566T						.						37.0	35.0	36.0					16																	70852337		1960	4156	6116	SO:0001583	missense	54768	exon84			GAGGGTTCTCCAA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14566A>T	chr16.hg19:g.70852337T>A	ENSP00000377197:p.Asn4856Tyr	69.0	0.0		77.0	16.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	hg19	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.825014	0.90955	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.10192	2.9	5.84	5.84	0.93424	.	0.000000	0.35615	U	0.003090	T	0.42040	0.1185	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51180	-0.8738	10	0.87932	D	0	.	15.8872	0.79261	0.0:0.0:0.0:1.0	.	4855	F8WD23	.	Y	4856;4855	ENSP00000377197:N4856Y	ENSP00000313052:N4855Y	N	-	1	0	HYDIN	69409838	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.384000	0.79751	2.227000	0.72691	0.496000	0.49642	AAC	.	.		0.582	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
ZNF469	84627	hgsc.bcm.edu	37	16	88499480	88499480	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:88499480C>T	ENST00000437464.1	+	2	5518	c.5518C>T	c.(5518-5520)Ccc>Tcc	p.P1840S	ZNF469_ENST00000565624.1_Missense_Mutation_p.P1868S	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1840					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						ACTGACTGCCCCCCGGGGCAG	0.667																																					p.P1840S		Atlas-SNP	.											.	ZNF469	121	.	0			c.C5518T						.						9.0	13.0	12.0					16																	88499480		688	1581	2269	SO:0001583	missense	84627	exon2			ACTGCCCCCCGGG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.5518C>T	chr16.hg19:g.88499480C>T	ENSP00000402343:p.Pro1840Ser	130.0	0.0		118.0	25.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.624739	0.28889	.	.	ENSG00000225614	ENST00000437464	T	0.06068	3.35	3.25	0.829	0.18847	.	.	.	.	.	T	0.03783	0.0107	N	0.19112	0.55	0.09310	N	1	B	0.26081	0.141	B	0.24269	0.052	T	0.42965	-0.9420	9	0.28530	T	0.3	.	4.6941	0.12795	0.2326:0.6242:0.0:0.1433	.	1840	Q96JG9	ZN469_HUMAN	S	1840	ENSP00000402343:P1840S	ENSP00000402343:P1840S	P	+	1	0	ZNF469	87026981	0.000000	0.05858	0.008000	0.14137	0.023000	0.10783	0.203000	0.17315	1.336000	0.45506	0.467000	0.42956	CCC	.	.		0.667	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
CDH15	1013	hgsc.bcm.edu	37	16	89256721	89256721	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr16:89256721C>A	ENST00000289746.2	+	8	1114	c.1049C>A	c.(1048-1050)gCg>gAg	p.A350E		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	350	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGCTGCAGGCGGCTGCCCTT	0.637																																					p.A350E		Atlas-SNP	.											.	CDH15	54	.	0			c.C1049A						.						26.0	26.0	26.0					16																	89256721		2195	4297	6492	SO:0001583	missense	1013	exon8			TGCAGGCGGCTGC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1049C>A	chr16.hg19:g.89256721C>A	ENSP00000289746:p.Ala350Glu	161.0	0.0		111.0	22.0	NM_004933		Missense_Mutation	SNP	ENST00000289746.2	hg19	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	C	0.344	-0.948778	0.02304	.	.	ENSG00000129910	ENST00000289746	T	0.61627	0.09	4.37	2.29	0.28610	Cadherin (4);Cadherin-like (1);	0.469026	0.16700	U	0.203181	T	0.48390	0.1497	L	0.53249	1.67	0.09310	N	1	P	0.42993	0.797	B	0.41088	0.347	T	0.33624	-0.9861	10	0.36615	T	0.2	.	6.0759	0.19915	0.0:0.6608:0.1571:0.1821	.	350	P55291	CAD15_HUMAN	E	350	ENSP00000289746:A350E	ENSP00000289746:A350E	A	+	2	0	CDH15	87784222	0.026000	0.19158	0.565000	0.28409	0.023000	0.10783	0.300000	0.19156	0.839000	0.34971	-0.266000	0.10368	GCG	.	.		0.637	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
ACAP1	9744	hgsc.bcm.edu	37	17	7251303	7251303	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:7251303T>A	ENST00000158762.3	+	15	1612	c.1406T>A	c.(1405-1407)cTa>cAa	p.L469Q	ACAP1_ENST00000570504.1_5'Flank|ACAP1_ENST00000574499.1_5'Flank|ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000571471.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	469	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.|Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GAGCCAGAACTAGTGAAGGTA	0.587																																					p.L469Q		Atlas-SNP	.											.	ACAP1	66	.	0			c.T1406A						.						86.0	79.0	82.0					17																	7251303		2203	4300	6503	SO:0001583	missense	9744	exon15			CAGAACTAGTGAA	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1406T>A	chr17.hg19:g.7251303T>A	ENSP00000158762:p.Leu469Gln	38.0	0.0		25.0	17.0	NM_014716	Q53XN9	Missense_Mutation	SNP	ENST00000158762.3	hg19	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.342215	0.81911	.	.	ENSG00000072818	ENST00000158762	T	0.38401	1.14	5.01	5.01	0.66863	.	0.148584	0.45606	D	0.000348	T	0.43033	0.1229	N	0.25201	0.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.20306	-1.0279	10	0.23891	T	0.37	.	12.713	0.57100	0.0:0.0:0.0:1.0	.	469	Q15027	ACAP1_HUMAN	Q	469	ENSP00000158762:L469Q	ENSP00000158762:L469Q	L	+	2	0	ACAP1	7192027	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.552000	0.82192	2.106000	0.64143	0.459000	0.35465	CTA	.	.		0.587	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
SHMT1	6470	hgsc.bcm.edu	37	17	18250860	18250860	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:18250860T>A	ENST00000316694.3	-	5	603	c.469A>T	c.(469-471)Aag>Tag	p.K157*	SHMT1_ENST00000539052.1_Nonsense_Mutation_p.K19*|SHMT1_ENST00000354098.3_Nonsense_Mutation_p.K157*|SHMT1_ENST00000352886.6_Nonsense_Mutation_p.K157*	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	157					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	ATTTTCTTCTTGTCTGTCATG	0.502																																					p.K157X		Atlas-SNP	.											.	SHMT1	36	.	0			c.A469T						.						136.0	135.0	135.0					17																	18250860		2203	4300	6503	SO:0001587	stop_gained	6470	exon5			TCTTCTTGTCTGT		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.469A>T	chr17.hg19:g.18250860T>A	ENSP00000318868:p.Lys157*	86.0	0.0		137.0	43.0	NM_148918	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Nonsense_Mutation	SNP	ENST00000316694.3	hg19	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.847223	0.91277	.	.	ENSG00000176974	ENST00000316694;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-37.6832	15.4913	0.75607	0.0:0.0:0.0:1.0	.	.	.	.	X	157;157;19;157;157	.	ENSP00000318868:K157X	K	-	1	0	SHMT1	18191585	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	7.858000	0.86971	2.114000	0.64651	0.379000	0.24179	AAG	.	.		0.502	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169	
RDM1	201299	hgsc.bcm.edu	37	17	34257110	34257110	+	Silent	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:34257110C>A	ENST00000293273.6	-	2	291	c.246G>T	c.(244-246)cgG>cgT	p.R82R	RDM1_ENST00000431884.2_Silent_p.R82R|RDM1_ENST00000425909.3_Silent_p.R82R|RDM1_ENST00000394528.3_Silent_p.R82R|RDM1_ENST00000394529.3_Silent_p.R59R|RDM1_ENST00000591402.1_Silent_p.R59R|RDM1_ENST00000430160.2_Silent_p.R59R|RDM1_ENST00000394527.1_Silent_p.R59R|RDM1_ENST00000419453.2_Silent_p.R59R	NM_145654.3	NP_663629.1	Q8NG50	RDM1_HUMAN	RAD52 motif containing 1	82	Necessary for nuclear localization and for nucleolar accumulation in response to heat shock.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(3)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)	9		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AAAGCTGCTTCCGGTCGCATG	0.473								Other identified genes with known or suspected DNA repair function																													p.R82R		Atlas-SNP	.											.	RDM1	46	.	0			c.G246T						.						107.0	118.0	114.0					17																	34257110		2203	4300	6503	SO:0001819	synonymous_variant	201299	exon2			CTGCTTCCGGTCG	AB080728	CCDS11301.1, CCDS42299.1, CCDS54111.1, CCDS54108.1, CCDS54109.1, CCDS54110.1, CCDS59280.1, CCDS59281.1	17q11.2	2014-04-10	2014-04-10	2005-10-20	ENSG00000187456	ENSG00000278023		"""RNA binding motif (RRM) containing"""	19950	protein-coding gene	gene with protein product		612896	"""RAD52 homolog B (S. cerevisiae)"", ""RAD52 motif 1"""	RAD52B		15611051	Standard	NM_001163120		Approved	MGC33977	uc002hkh.3	Q8NG50	OTTHUMG00000188399	ENST00000293273.6:c.246G>T	chr17.hg19:g.34257110C>A		104.0	0.0		158.0	31.0	NM_001034836	A0JP55|A8MV46|A8MY68|A8MZ92|A8RCS5|A8RCT0|A8RCT5|A8RCT8|A8RCU3|A8RCU8|A8RCW0|A8RCW5	Silent	SNP	ENST00000293273.6	hg19	CCDS11301.1																																																																																			.	.		0.473	RDM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256588.2	NM_145654	
KRT40	125115	hgsc.bcm.edu	37	17	39140202	39140202	+	Silent	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:39140202G>T	ENST00000398486.2	-	3	484	c.324C>A	c.(322-324)cgC>cgA	p.R108R	KRT40_ENST00000377755.4_Silent_p.R108R	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	108	Coil 1A.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				CCTCCAGGCTGCGCACCTTCT	0.522																																					p.R108R		Atlas-SNP	.											.	KRT40	27	.	0			c.C324A						.						186.0	186.0	186.0					17																	39140202		2203	4295	6498	SO:0001819	synonymous_variant	125115	exon3			CAGGCTGCGCACC	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.324C>A	chr17.hg19:g.39140202G>T		93.0	0.0		120.0	46.0	NM_182497	Q6IFU5	Silent	SNP	ENST00000398486.2	hg19	CCDS42320.1																																																																																			.	.		0.522	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	
KRT37	8688	hgsc.bcm.edu	37	17	39579146	39579146	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:39579146C>T	ENST00000225550.3	-	3	615	c.616G>A	c.(616-618)Gac>Aac	p.D206N	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	206	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CCGCACTTGTCCGCCTCCACC	0.637																																					p.D206N		Atlas-SNP	.											.	KRT37	61	.	0			c.G616A						.						76.0	68.0	71.0					17																	39579146		2203	4300	6503	SO:0001583	missense	8688	exon3			ACTTGTCCGCCTC	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.616G>A	chr17.hg19:g.39579146C>T	ENSP00000225550:p.Asp206Asn	50.0	0.0		49.0	25.0	NM_003770		Missense_Mutation	SNP	ENST00000225550.3	hg19	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.007700	0.75046	.	.	ENSG00000108417	ENST00000225550	D	0.89485	-2.52	4.78	4.78	0.61160	Filament (1);	0.000000	0.48767	D	0.000161	D	0.94830	0.8330	M	0.85710	2.77	0.48830	D	0.99971	D	0.89917	1.0	D	0.77557	0.99	D	0.95718	0.8764	10	0.87932	D	0	.	16.7565	0.85501	0.0:1.0:0.0:0.0	.	206	O76014	KRT37_HUMAN	N	206	ENSP00000225550:D206N	ENSP00000225550:D206N	D	-	1	0	KRT37	36832672	1.000000	0.71417	0.975000	0.42487	0.177000	0.22998	5.961000	0.70356	2.202000	0.70862	0.655000	0.94253	GAC	.	.		0.637	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
KRT35	3886	hgsc.bcm.edu	37	17	39637038	39637038	+	Silent	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:39637038C>G	ENST00000393989.1	-	1	354	c.312G>C	c.(310-312)ctG>ctC	p.L104L	KRT35_ENST00000246639.2_Silent_p.L74L	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	104	Coil 1A.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				GGCGGTCGTTCAGGGATTGCA	0.642																																					p.L104L		Atlas-SNP	.											.	KRT35	58	.	0			c.G312C						.						64.0	69.0	67.0					17																	39637038		2203	4300	6503	SO:0001819	synonymous_variant	3886	exon1			GTCGTTCAGGGAT	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.312G>C	chr17.hg19:g.39637038C>G		96.0	0.0		103.0	57.0	NM_002280	O76012|Q92651	Silent	SNP	ENST00000393989.1	hg19	CCDS11394.2																																																																																			.	.		0.642	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	
AOC2	314	hgsc.bcm.edu	37	17	41001329	41001329	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:41001329C>G	ENST00000253799.3	+	2	1842	c.1815C>G	c.(1813-1815)agC>agG	p.S605R	AOC2_ENST00000452774.2_Intron|AOC3_ENST00000308423.2_5'Flank	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	605					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		AGATCCACAGCCCCCTTGGCA	0.622																																					p.S605R		Atlas-SNP	.											.	AOC2	61	.	0			c.C1815G						.						93.0	100.0	98.0					17																	41001329		2203	4300	6503	SO:0001583	missense	314	exon2			CCACAGCCCCCTT	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1815C>G	chr17.hg19:g.41001329C>G	ENSP00000253799:p.Ser605Arg	99.0	0.0		117.0	23.0	NM_009590	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	hg19	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040090	0.35989	.	.	ENSG00000131480	ENST00000253799	T	0.03951	3.75	5.02	1.79	0.24919	Copper amine oxidase, C-terminal (3);	0.081242	0.85682	D	0.000000	T	0.17704	0.0425	M	0.81239	2.535	0.80722	D	1	D	0.67145	0.996	D	0.69824	0.966	T	0.00601	-1.1650	10	0.56958	D	0.05	-8.6457	9.2367	0.37470	0.0:0.6829:0.0:0.3171	.	605	O75106	AOC2_HUMAN	R	605	ENSP00000253799:S605R	ENSP00000253799:S605R	S	+	3	2	AOC2	38254855	1.000000	0.71417	0.980000	0.43619	0.216000	0.24613	0.945000	0.29056	0.707000	0.31934	-0.254000	0.11334	AGC	.	.		0.622	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
OSBPL7	114881	hgsc.bcm.edu	37	17	45897358	45897358	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:45897358C>A	ENST00000007414.3	-	3	371	c.180G>T	c.(178-180)tgG>tgT	p.W60C	OSBPL7_ENST00000392507.3_Missense_Mutation_p.W60C	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	60	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.W60*(1)		autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						CCTTCAGAGGCCACTTCCTCT	0.647																																					p.W60C		Atlas-SNP	.											OSBPL7,NS,carcinoma,0,1	OSBPL7	65	.	1	Substitution - Nonsense(1)	endometrium(1)	c.G180T						.						33.0	30.0	31.0					17																	45897358		2203	4300	6503	SO:0001583	missense	114881	exon3			CAGAGGCCACTTC	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.180G>T	chr17.hg19:g.45897358C>A	ENSP00000007414:p.Trp60Cys	30.0	0.0		38.0	20.0	NM_145798	D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	hg19	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863586	0.32884	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.20598	2.06;2.06	4.86	3.9	0.45041	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.207171	0.45126	D	0.000397	T	0.49064	0.1535	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.54801	-0.8239	10	0.72032	D	0.01	-16.9164	10.1261	0.42649	0.0:0.905:0.0:0.095	.	60	Q9BZF2	OSBL7_HUMAN	C	60	ENSP00000007414:W60C;ENSP00000376295:W60C	ENSP00000007414:W60C	W	-	3	0	OSBPL7	43252357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.603000	0.67619	1.037000	0.40024	0.561000	0.74099	TGG	.	.		0.647	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
DLX4	1748	hgsc.bcm.edu	37	17	48050405	48050405	+	Intron	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:48050405C>A	ENST00000240306.3	+	2	578				DLX4_ENST00000411890.2_Silent_p.L12L|DLX4_ENST00000503410.1_Intron	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4						multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						GCTCCCTCCTCGCCCCCTACA	0.627																																					p.L12L		Atlas-SNP	.											.	DLX4	25	.	0			c.C36A						.						51.0	61.0	58.0					17																	48050405		2203	4300	6503	SO:0001627	intron_variant	1748	exon1			CCTCCTCGCCCCC		CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.284-32C>A	chr17.hg19:g.48050405C>A		283.0	0.0		292.0	113.0	NM_001934	D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Silent	SNP	ENST00000240306.3	hg19	CCDS11555.1																																																																																			.	.		0.627	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366214.1		
TRIM37	4591	hgsc.bcm.edu	37	17	57057829	57057829	+	IGR	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:57057829T>A	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.Y569N	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AGACCCAGGCTACCTAGATCT	0.498									Mulibrey Nanism																												p.Y569N		Atlas-SNP	.											.	PPM1E	97	.	0			c.T1705A						.						92.0	83.0	86.0					17																	57057829		2203	4300	6503	SO:0001628	intergenic_variant	22843	exon7	Familial Cancer Database	Perheentupa syndrome	CCAGGCTACCTAG	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			chr17.hg19:g.57057829T>A		133.0	0.0		119.0	47.0	NM_014906	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000393066.3	hg19	CCDS45746.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.180128	0.57800	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.24350	1.86	5.74	5.74	0.90152	.	0.167698	0.53938	D	0.000058	T	0.33990	0.0882	L	0.29908	0.895	0.41422	D	0.987805	D;D	0.59357	0.958;0.985	P;P	0.55391	0.587;0.775	T	0.08106	-1.0738	10	0.59425	D	0.04	-3.7716	16.0334	0.80603	0.0:0.0:0.0:1.0	.	578;569	Q8WY54-3;Q8WY54-2	.;.	N	569;420	ENSP00000312411:Y569N	ENSP00000312411:Y569N	Y	+	1	0	PPM1E	54412611	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.517000	0.53443	2.197000	0.70478	0.402000	0.26972	TAC	.	.		0.498	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445928.1	NM_015294	
ABCA5	23461	hgsc.bcm.edu	37	17	67283767	67283767	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:67283767A>T	ENST00000392676.3	-	15	2092	c.2028T>A	c.(2026-2028)gcT>gcA	p.A676A	ABCA5_ENST00000392677.2_Silent_p.A676A|ABCA5_ENST00000588877.1_Silent_p.A676A			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	676	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	CAAGAATGTCAGCTTCATCCA	0.388																																					p.A676A		Atlas-SNP	.											.	ABCA5	162	.	0			c.T2028A						.						157.0	155.0	156.0					17																	67283767		2203	4300	6503	SO:0001819	synonymous_variant	23461	exon14			AATGTCAGCTTCA	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.2028T>A	chr17.hg19:g.67283767A>T		87.0	0.0		106.0	19.0	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Silent	SNP	ENST00000392676.3	hg19	CCDS11685.1																																																																																			.	.		0.388	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
CEP131	22994	hgsc.bcm.edu	37	17	79193699	79193699	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:79193699T>A	ENST00000269392.4	-	2	405	c.158A>T	c.(157-159)gAg>gTg	p.E53V	AZI1_ENST00000450824.2_Missense_Mutation_p.E53V|AZI1_ENST00000575907.1_Missense_Mutation_p.E53V|AZI1_ENST00000374782.3_Missense_Mutation_p.E53V	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		53					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCTCTTCTGCTCGCTGCCTGT	0.652																																					p.E53V		Atlas-SNP	.											.	AZI1	145	.	0			c.A158T						.						135.0	115.0	122.0					17																	79193699		2203	4300	6503	SO:0001583	missense	22994	exon2			TTCTGCTCGCTGC																												ENST00000269392.4:c.158A>T	chr17.hg19:g.79193699T>A	ENSP00000269392:p.Glu53Val	93.0	0.0		92.0	18.0	NM_014984	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	hg19		.	.	.	.	.	.	.	.	.	.	T	12.56	1.975780	0.34848	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.25749	1.78;1.78;1.78	3.72	1.38	0.22167	.	0.298284	0.30464	N	0.009574	T	0.38665	0.1049	L	0.57536	1.79	0.09310	N	1	D;D;D;D	0.76494	0.996;0.996;0.994;0.999	P;P;P;D	0.85130	0.9;0.9;0.869;0.997	T	0.09292	-1.0681	10	0.72032	D	0.01	-12.4528	4.2967	0.10904	0.0:0.1136:0.207:0.6794	.	53;53;53;53	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	V	53	ENSP00000393583:E53V;ENSP00000363914:E53V;ENSP00000269392:E53V	ENSP00000269392:E53V	E	-	2	0	AZI1	76808294	0.049000	0.20398	0.056000	0.19401	0.586000	0.36452	0.816000	0.27267	0.413000	0.25759	0.379000	0.24179	GAG	.	.		0.652	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
SMCHD1	23347	hgsc.bcm.edu	37	18	2732311	2732311	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:2732311A>T	ENST00000320876.6	+	25	3435	c.3097A>T	c.(3097-3099)Agt>Tgt	p.S1033C	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.S1033C	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1033					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GTTGCTTCCCAGTAGCCATGT	0.373																																					p.S1033C		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A3097T						.						150.0	136.0	140.0					18																	2732311		1865	4107	5972	SO:0001583	missense	23347	exon25			CTTCCCAGTAGCC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3097A>T	chr18.hg19:g.2732311A>T	ENSP00000326603:p.Ser1033Cys	194.0	0.0		176.0	80.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.219684	0.79464	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.47177	0.85;0.87	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.66336	0.2779	M	0.63843	1.955	0.43334	D	0.995379	D	0.89917	1.0	D	0.83275	0.996	T	0.70063	-0.4975	10	0.87932	D	0	-17.0425	15.1893	0.73032	1.0:0.0:0.0:0.0	.	1033	A6NHR9	SMHD1_HUMAN	C	1033	ENSP00000326603:S1033C;ENSP00000261598:S1033C	ENSP00000261598:S1033C	S	+	1	0	SMCHD1	2722311	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.165000	0.77544	1.974000	0.57490	0.533000	0.62120	AGT	.	.		0.373	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
PTPRM	5797	hgsc.bcm.edu	37	18	7949192	7949192	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:7949192G>A	ENST00000332175.8	+	6	1714	c.677G>A	c.(676-678)cGa>cAa	p.R226Q	PTPRM_ENST00000400060.4_Missense_Mutation_p.R226Q|PTPRM_ENST00000580170.1_Missense_Mutation_p.R226Q|PTPRM_ENST00000400053.4_Missense_Mutation_p.R164Q|PTPRM_ENST00000444013.1_Missense_Mutation_p.R13Q	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	226	Ig-like C2-type.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R226L(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				ATTGATGTGCGAGATGCTCCT	0.458																																					p.R226Q		Atlas-SNP	.											PTPRM,NS,carcinoma,0,1	PTPRM	185	.	1	Substitution - Missense(1)	lung(1)	c.G677A						.						121.0	108.0	113.0					18																	7949192		2203	4300	6503	SO:0001583	missense	5797	exon6			ATGTGCGAGATGC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.677G>A	chr18.hg19:g.7949192G>A	ENSP00000331418:p.Arg226Gln	72.0	0.0		54.0	11.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308618	0.23821	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.50548	1.99;1.99;1.99;0.74	5.86	2.0	0.26442	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.174053	0.48286	N	0.000184	T	0.32585	0.0834	L	0.47716	1.5	0.09310	N	1	P;B;B	0.52463	0.953;0.006;0.006	B;B;B	0.41374	0.355;0.002;0.002	T	0.22103	-1.0226	10	0.16420	T	0.52	.	5.4981	0.16813	0.1254:0.1146:0.641:0.119	.	13;226;226	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	Q	226;226;164;13	ENSP00000331418:R226Q;ENSP00000382933:R226Q;ENSP00000382927:R164Q;ENSP00000387608:R13Q	ENSP00000331418:R226Q	R	+	2	0	PTPRM	7939192	0.995000	0.38212	0.003000	0.11579	0.732000	0.41865	4.642000	0.61383	0.150000	0.19136	0.650000	0.86243	CGA	.	.		0.458	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
IMPA2	3613	hgsc.bcm.edu	37	18	12028869	12028869	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:12028869G>T	ENST00000269159.3	+	7	870	c.628G>T	c.(628-630)Gca>Tca	p.A210S	RP11-703I16.1_ENST00000587619.1_RNA|IMPA2_ENST00000589238.1_Missense_Mutation_p.A21S|IMPA2_ENST00000588927.1_Missense_Mutation_p.A21S	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	210					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	CTCCACATTGGCACTCTGCCA	0.607																																					p.A210S		Atlas-SNP	.											.	IMPA2	27	.	0			c.G628T						.						97.0	94.0	95.0					18																	12028869		2203	4300	6503	SO:0001583	missense	3613	exon7			ACATTGGCACTCT	AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.628G>T	chr18.hg19:g.12028869G>T	ENSP00000269159:p.Ala210Ser	61.0	0.0		58.0	23.0	NM_014214	B0YJ29|Q9UJT3	Missense_Mutation	SNP	ENST00000269159.3	hg19	CCDS11855.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216138	0.58452	.	.	ENSG00000141401	ENST00000269159	T	0.40476	1.03	5.75	5.75	0.90469	.	0.061316	0.64402	D	0.000004	T	0.35740	0.0942	N	0.25144	0.715	0.50813	D	0.999891	B;B	0.12013	0.005;0.003	B;B	0.17433	0.012;0.018	T	0.09574	-1.0668	10	0.56958	D	0.05	-27.4388	19.9417	0.97165	0.0:0.0:1.0:0.0	.	183;210	O14732-2;O14732	.;IMPA2_HUMAN	S	210	ENSP00000269159:A210S	ENSP00000269159:A210S	A	+	1	0	IMPA2	12018869	1.000000	0.71417	0.982000	0.44146	0.920000	0.55202	4.597000	0.61062	2.720000	0.93068	0.655000	0.94253	GCA	.	.		0.607	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254601.1		
B4GALT6	9331	hgsc.bcm.edu	37	18	29264373	29264373	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:29264373C>T	ENST00000306851.5	-	1	313	c.17G>A	c.(16-18)cGg>cAg	p.R6Q	B4GALT6_ENST00000237019.7_Missense_Mutation_p.R6Q|RP11-549B18.1_ENST00000565978.1_RNA|B4GALT6_ENST00000383131.3_Missense_Mutation_p.R6Q	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	6					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			CCGCATCATCCGCCTGAGCAC	0.572																																					p.R6Q		Atlas-SNP	.											.	B4GALT6	44	.	0			c.G17A						.						178.0	148.0	158.0					18																	29264373		2203	4300	6503	SO:0001583	missense	9331	exon1			ATCATCCGCCTGA	AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.17G>A	chr18.hg19:g.29264373C>T	ENSP00000306459:p.Arg6Gln	72.0	0.0		58.0	11.0	NM_004775	O60514|Q6NT09	Missense_Mutation	SNP	ENST00000306851.5	hg19	CCDS11900.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234781	0.79800	.	.	ENSG00000118276	ENST00000306851;ENST00000237019;ENST00000383131	T;T;T	0.52057	1.09;0.85;0.68	5.22	4.35	0.52113	.	0.644914	0.13949	N	0.351648	T	0.40247	0.1109	L	0.54323	1.7	0.37105	D	0.900095	P;B;B	0.38745	0.645;0.005;0.384	B;B;B	0.30495	0.116;0.003;0.078	T	0.45425	-0.9262	10	0.44086	T	0.13	-8.0387	11.5759	0.50860	0.0:0.9126:0.0:0.0874	.	6;6;6	Q6NT09;G3XA83;Q9UBX8	.;.;B4GT6_HUMAN	Q	6	ENSP00000306459:R6Q;ENSP00000237019:R6Q;ENSP00000372613:R6Q	ENSP00000237019:R6Q	R	-	2	0	B4GALT6	27518371	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	1.653000	0.37323	1.185000	0.42971	0.561000	0.74099	CGG	.	.		0.572	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254942.2	NM_004775	
PIAS2	9063	hgsc.bcm.edu	37	18	44408008	44408008	+	Silent	SNP	T	T	G	rs373537803		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:44408008T>G	ENST00000585916.1	-	11	1421	c.1422A>C	c.(1420-1422)atA>atC	p.I474I	PIAS2_ENST00000545673.1_Silent_p.I184I|PIAS2_ENST00000324794.7_Silent_p.I474I	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	474					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						AAGAGCTTTCTATTGTAAGAT	0.413																																					p.I474I		Atlas-SNP	.											.	PIAS2	85	.	0			c.A1422C						.						137.0	122.0	127.0					18																	44408008		2203	4300	6503	SO:0001819	synonymous_variant	9063	exon11			GCTTTCTATTGTA	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1422A>C	chr18.hg19:g.44408008T>G		97.0	0.0		71.0	33.0	NM_173206	O75927|Q96BT5|Q96KE3	Silent	SNP	ENST00000585916.1	hg19	CCDS32824.1																																																																																			.	.		0.413	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671	
CDH20	28316	hgsc.bcm.edu	37	18	59158023	59158023	+	Silent	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:59158023T>C	ENST00000262717.4	+	2	635	c.237T>C	c.(235-237)taT>taC	p.Y79Y	CDH20_ENST00000536675.2_Silent_p.Y79Y|CDH20_ENST00000538374.1_Silent_p.Y79Y			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				ACCCTTTGTATGTCGGCAAGG	0.448																																					p.Y79Y		Atlas-SNP	.											.	CDH20	117	.	0			c.T237C						.						113.0	114.0	114.0					18																	59158023		2203	4300	6503	SO:0001819	synonymous_variant	28316	exon1			TTTGTATGTCGGC	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.237T>C	chr18.hg19:g.59158023T>C		131.0	0.0		112.0	47.0	NM_031891	Q495S3	Silent	SNP	ENST00000262717.4	hg19	CCDS11977.1																																																																																			.	.		0.448	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
SERPINB3	6317	hgsc.bcm.edu	37	18	61325773	61325773	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr18:61325773T>C	ENST00000283752.5	-	5	586	c.443A>G	c.(442-444)aAc>aGc	p.N148S	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Missense_Mutation_p.N148S	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	148					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						CACCCAGGAGTTAATCTTCTT	0.413																																					p.N148S		Atlas-SNP	.											.	SERPINB3	90	.	0			c.A443G						.						110.0	99.0	103.0					18																	61325773		2203	4298	6501	SO:0001583	missense	6317	exon5			CAGGAGTTAATCT	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.443A>G	chr18.hg19:g.61325773T>C	ENSP00000283752:p.Asn148Ser	106.0	0.0		113.0	22.0	NM_006919	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	hg19	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407977	0.62399	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.92048	-2.96;-2.96	2.97	2.97	0.34412	Serpin domain (3);	0.000000	0.41194	D	0.000924	D	0.96895	0.8986	H	0.96208	3.785	0.39652	D	0.970482	D;D;D	0.89917	1.0;0.998;0.998	D;P;P	0.91635	0.999;0.876;0.876	D	0.97533	1.0081	10	0.87932	D	0	.	11.271	0.49138	0.0:0.0:0.0:1.0	.	148;148;148	P29508-2;P29508;Q5K684	.;SPB3_HUMAN;.	S	148	ENSP00000283752:N148S;ENSP00000329498:N148S	ENSP00000283752:N148S	N	-	2	0	SERPINB3	59476753	1.000000	0.71417	0.999000	0.59377	0.843000	0.47879	6.271000	0.72569	1.615000	0.50252	0.374000	0.22700	AAC	.	.		0.413	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
GRIN3B	116444	hgsc.bcm.edu	37	19	1005395	1005395	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:1005395T>A	ENST00000234389.3	+	3	1914	c.1895T>A	c.(1894-1896)gTg>gAg	p.V632E	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	632					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGACGCACCGTGTCCAGCAAG	0.647																																					p.V632E		Atlas-SNP	.											.	GRIN3B	46	.	0			c.T1895A						.						120.0	112.0	114.0					19																	1005395		2203	4300	6503	SO:0001583	missense	116444	exon3			GCACCGTGTCCAG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1895T>A	chr19.hg19:g.1005395T>A	ENSP00000234389:p.Val632Glu	128.0	0.0		97.0	70.0	NM_138690	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	hg19	CCDS32861.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.184765	0.57909	.	.	ENSG00000116032	ENST00000234389	T	0.25414	1.8	4.36	2.07	0.26955	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.418400	0.24957	N	0.034250	T	0.49541	0.1563	M	0.84948	2.725	0.51767	D	0.999932	D	0.69078	0.997	D	0.68039	0.955	T	0.49082	-0.8976	10	0.87932	D	0	.	9.7544	0.40494	0.0:0.0:0.3349:0.6651	.	632	O60391	NMD3B_HUMAN	E	632	ENSP00000234389:V632E	ENSP00000234389:V632E	V	+	2	0	GRIN3B	956395	0.911000	0.30947	0.097000	0.21041	0.885000	0.51271	1.385000	0.34408	0.064000	0.16427	0.254000	0.18369	GTG	.	.		0.647	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
TMEM259	91304	hgsc.bcm.edu	37	19	1014293	1014293	+	Silent	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:1014293C>G	ENST00000356663.3	-	2	526	c.405G>C	c.(403-405)ggG>ggC	p.G135G	TMEM259_ENST00000333175.5_Silent_p.G135G	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	135						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CCGGGAAGCTCCCGCGGCCGC	0.632																																					p.G135G		Atlas-SNP	.											.	.	.	.	0			c.G405C						.						36.0	39.0	38.0					19																	1014293		2202	4300	6502	SO:0001819	synonymous_variant	91304	exon2			GAAGCTCCCGCGG	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.405G>C	chr19.hg19:g.1014293C>G		132.0	0.0		100.0	33.0	NM_033420	O60392|Q8NF79|Q96H30	Silent	SNP	ENST00000356663.3	hg19	CCDS32862.1																																																																																			.	.		0.632	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
ATP8B3	148229	hgsc.bcm.edu	37	19	1796124	1796124	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:1796124G>T	ENST00000310127.6	-	17	2132	c.1894C>A	c.(1894-1896)Ctg>Atg	p.L632M	ATP8B3_ENST00000539485.1_Missense_Mutation_p.L632M|ATP8B3_ENST00000525591.1_Missense_Mutation_p.L585M	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	632					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATTATGGCCAGGACCTGGTAG	0.667											OREG0025127	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L632M		Atlas-SNP	.											.	ATP8B3	108	.	0			c.C1894A						.						63.0	68.0	66.0					19																	1796124		2025	4171	6196	SO:0001583	missense	148229	exon17			TGGCCAGGACCTG	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1894C>A	chr19.hg19:g.1796124G>T	ENSP00000311336:p.Leu632Met	94.0	0.0	598	75.0	36.0	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	hg19	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092795	0.76756	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.72282	-0.64;-0.64;-0.64	4.8	4.8	0.61643	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.64402	D	0.000003	D	0.86581	0.5967	M	0.93328	3.405	0.37288	D	0.908141	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90425	0.4420	10	0.66056	D	0.02	.	10.8197	0.46597	0.0881:0.0:0.9119:0.0	.	632;585	O60423;Q7Z485	AT8B3_HUMAN;.	M	632;632;585	ENSP00000311336:L632M;ENSP00000443574:L632M;ENSP00000437115:L585M	ENSP00000311336:L632M	L	-	1	2	ATP8B3	1747124	1.000000	0.71417	0.924000	0.36721	0.746000	0.42486	4.013000	0.57138	2.384000	0.81235	0.561000	0.74099	CTG	.	.		0.667	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
MUC16	94025	hgsc.bcm.edu	37	19	9071656	9071656	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:9071656A>C	ENST00000397910.4	-	3	15993	c.15790T>G	c.(15790-15792)Tct>Gct	p.S5264A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5266	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTTCTGCAGATTTTGTCTTA	0.512																																					p.S5264A		Atlas-SNP	.											.	MUC16	4315	.	0			c.T15790G						.						177.0	173.0	174.0					19																	9071656		2050	4188	6238	SO:0001583	missense	94025	exon3			CTGCAGATTTTGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.15790T>G	chr19.hg19:g.9071656A>C	ENSP00000381008:p.Ser5264Ala	95.0	0.0		50.0	22.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	3.924	-0.017585	0.07681	.	.	ENSG00000181143	ENST00000397910	T	0.02395	4.31	1.94	-0.305	0.12784	.	.	.	.	.	T	0.02267	0.0070	L	0.29908	0.895	.	.	.	P	0.49961	0.93	B	0.40444	0.329	T	0.43940	-0.9360	8	0.87932	D	0	.	4.3269	0.11045	0.6175:0.0:0.3825:0.0	.	5264	B5ME49	.	A	5264	ENSP00000381008:S5264A	ENSP00000381008:S5264A	S	-	1	0	MUC16	8932656	0.005000	0.15991	0.000000	0.03702	0.003000	0.03518	0.323000	0.19593	-0.147000	0.11254	0.369000	0.22263	TCT	.	.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
S1PR5	53637	hgsc.bcm.edu	37	19	10624601	10624601	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:10624601A>T	ENST00000439028.3	-	2	1212	c.1087T>A	c.(1087-1089)Tcg>Acg	p.S363T	S1PR5_ENST00000333430.4_Missense_Mutation_p.S363T	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	363					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	GAGCGCTCCGAGCCGCTGAAG	0.736																																					p.S363T		Atlas-SNP	.											.	S1PR5	33	.	0			c.T1087A						.						9.0	13.0	11.0					19																	10624601		2114	4130	6244	SO:0001583	missense	53637	exon2			GCTCCGAGCCGCT	AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.1087T>A	chr19.hg19:g.10624601A>T	ENSP00000416915:p.Ser363Thr	46.0	0.0		18.0	15.0	NM_030760	Q6NW11	Missense_Mutation	SNP	ENST00000439028.3	hg19	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	A	8.508	0.865793	0.17250	.	.	ENSG00000180739	ENST00000439028;ENST00000333430	D;D	0.81908	-1.55;-1.55	4.27	3.23	0.37069	.	16.274900	0.00166	U	0.000003	T	0.78648	0.4316	L	0.32530	0.975	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.62525	-0.6836	10	0.72032	D	0.01	.	9.1471	0.36939	0.8363:0.0:0.0:0.1636	.	363	Q9H228	S1PR5_HUMAN	T	363	ENSP00000416915:S363T;ENSP00000328472:S363T	ENSP00000328472:S363T	S	-	1	0	S1PR5	10485601	0.035000	0.19736	0.004000	0.12327	0.034000	0.12701	0.426000	0.21363	0.665000	0.31066	0.260000	0.18958	TCG	.	.		0.736	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452015.1	NM_030760	
RTBDN	83546	hgsc.bcm.edu	37	19	12936625	12936625	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:12936625T>A	ENST00000458671.2	-	6	737	c.585A>T	c.(583-585)ggA>ggT	p.G195G	RTBDN_ENST00000322912.5_Silent_p.G227G|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000592204.1_Silent_p.G205G|RTBDN_ENST00000589272.1_3'UTR|RTBDN_ENST00000393233.2_3'UTR	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	195						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GGCCCCGTCGTCCTGGTCTGG	0.701											OREG0025275	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G227G		Atlas-SNP	.											.	RTBDN	26	.	0			c.A681T						.						26.0	24.0	24.0					19																	12936625		2202	4299	6501	SO:0001819	synonymous_variant	83546	exon7			CCGTCGTCCTGGT	AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.585A>T	chr19.hg19:g.12936625T>A		156.0	0.0	683	105.0	89.0	NM_031429	F1T0I8|Q9BWT5	Silent	SNP	ENST00000458671.2	hg19	CCDS45994.1																																																																																			.	.		0.701	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429	
OR7C2	26658	hgsc.bcm.edu	37	19	15052983	15052983	+	Missense_Mutation	SNP	T	T	C	rs78307433|rs3044711|rs397816267	byFrequency	TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:15052983T>C	ENST00000248072.3	+	1	683	c.683T>C	c.(682-684)gTa>gCa	p.V228A		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					GTCCTAAGAGTATCTGCCAGA	0.468																																					p.V228A		Atlas-SNP	.											.	OR7C2	50	.	0			c.T683C						.						168.0	156.0	160.0					19																	15052983		2203	4300	6503	SO:0001583	missense	26658	exon1			TAAGAGTATCTGC	U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.683T>C	chr19.hg19:g.15052983T>C	ENSP00000248072:p.Val228Ala	101.0	0.0		1064.0	44.0	NM_012377	O43881|Q6IFP9	Missense_Mutation	SNP	ENST00000248072.3	hg19	CCDS12320.1	.	.	.	.	.	.	.	.	.	.	t	12.45	1.940332	0.34283	.	.	ENSG00000127529	ENST00000248072	T	0.00115	8.71	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.356137	0.19827	U	0.105170	T	0.00210	0.0006	L	0.56396	1.775	0.09310	N	1	B	0.25272	0.122	B	0.32980	0.156	T	0.22730	-1.0208	10	0.87932	D	0	.	10.9678	0.47422	0.0:0.0:0.0:1.0	.	228	O60412	OR7C2_HUMAN	A	228	ENSP00000248072:V228A	ENSP00000248072:V228A	V	+	2	0	OR7C2	14913983	0.075000	0.21258	0.003000	0.11579	0.004000	0.04260	1.824000	0.39072	1.770000	0.52166	0.421000	0.28195	GTA	.	.		0.468	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1		
FCHO1	23149	hgsc.bcm.edu	37	19	17886926	17886926	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:17886926C>A	ENST00000596536.1	+	16	1421	c.1138C>A	c.(1138-1140)Ctc>Atc	p.L380I	FCHO1_ENST00000596951.1_Missense_Mutation_p.L380I|FCHO1_ENST00000539407.1_Missense_Mutation_p.L380I|FCHO1_ENST00000389133.4_Missense_Mutation_p.L380I|FCHO1_ENST00000595033.1_Missense_Mutation_p.L330I|FCHO1_ENST00000252771.7_Missense_Mutation_p.L380I|FCHO1_ENST00000600676.1_Missense_Mutation_p.L380I|FCHO1_ENST00000597512.1_Missense_Mutation_p.L387I|FCHO1_ENST00000594202.1_Missense_Mutation_p.L380I	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	380	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						AGCGGCACAGCTCAGGGCCAC	0.677																																					p.L380I		Atlas-SNP	.											.	FCHO1	69	.	0			c.C1138A						.						68.0	61.0	63.0					19																	17886926		2203	4300	6503	SO:0001583	missense	23149	exon15			GCACAGCTCAGGG	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1138C>A	chr19.hg19:g.17886926C>A	ENSP00000470731:p.Leu380Ile	45.0	0.0		34.0	32.0	NM_001161358	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	ENST00000596536.1	hg19	CCDS32955.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116144	0.77323	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.51325	0.71;0.71;0.71	4.65	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.67869	0.2939	M	0.78916	2.43	0.51233	D	0.999911	D;D	0.89917	0.999;1.0	D;D	0.83275	0.991;0.996	T	0.71659	-0.4526	10	0.59425	D	0.04	-25.0572	13.0187	0.58773	0.0:1.0:0.0:0.0	.	380;380	O14526;O14526-2	FCHO1_HUMAN;.	I	380	ENSP00000252771:L380I;ENSP00000373785:L380I;ENSP00000437978:L380I	ENSP00000252771:L380I	L	+	1	0	FCHO1	17747926	1.000000	0.71417	0.997000	0.53966	0.630000	0.37929	6.454000	0.73493	2.115000	0.64714	0.491000	0.48974	CTC	.	.		0.677	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122	
ZNF486	90649	hgsc.bcm.edu	37	19	20308783	20308783	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:20308783A>G	ENST00000335117.8	+	4	1321	c.1264A>G	c.(1264-1266)Act>Gct	p.T422A	CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						CTCAAATCTAACTGAACATAA	0.383																																					p.T422A		Atlas-SNP	.											.	ZNF486	74	.	0			c.A1264G						.						29.0	32.0	31.0					19																	20308783		2195	4291	6486	SO:0001583	missense	90649	exon4			AATCTAACTGAAC	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.1264A>G	chr19.hg19:g.20308783A>G	ENSP00000335042:p.Thr422Ala	113.0	0.0		71.0	28.0	NM_052852	Q0VG00	Missense_Mutation	SNP	ENST00000335117.8	hg19	CCDS46029.1	.	.	.	.	.	.	.	.	.	.	-	4.646	0.120118	0.08881	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.35605	1.3	0.85	0.85	0.18980	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30324	0.0761	N	0.17723	0.515	0.09310	N	1	P	0.52316	0.952	P	0.54664	0.758	T	0.10847	-1.0612	9	0.51188	T	0.08	.	2.9159	0.05752	0.6536:0.0:0.3464:0.0	.	422	Q96H40	ZN486_HUMAN	A	461;422	ENSP00000335042:T422A	ENSP00000335042:T422A	T	+	1	0	ZNF486	20169783	0.000000	0.05858	0.248000	0.24265	0.247000	0.25773	-0.760000	0.04756	0.166000	0.19597	0.164000	0.16699	ACT	.	.		0.383	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447843.2	NM_052852	
KMT2B	9757	hgsc.bcm.edu	37	19	36214899	36214899	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:36214899C>T	ENST00000222270.7	+	8	3325	c.3325C>T	c.(3325-3327)Cga>Tga	p.R1109*	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Nonsense_Mutation_p.R1109*	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1109					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCGGACCCCCCGAGAAAATGG	0.567																																					p.R1109X		Atlas-SNP	.											.	MLL4	229	.	0			c.C3325T						.						16.0	19.0	18.0					19																	36214899		1733	3896	5629	SO:0001587	stop_gained	8085	exon8			ACCCCCCGAGAAA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.3325C>T	chr19.hg19:g.36214899C>T	ENSP00000222270:p.Arg1109*	72.0	0.0		137.0	21.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	41	8.982603	0.99025	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.97	4.94	0.65067	.	0.000000	0.37761	N	0.001951	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.14	0.65313	0.1791:0.8209:0.0:0.0	.	.	.	.	X	1109	.	ENSP00000222270:R1109X	R	+	1	2	AD000671.1	40906739	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.193000	0.42658	1.435000	0.47434	0.655000	0.94253	CGA	.	.		0.567	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
SIPA1L3	23094	hgsc.bcm.edu	37	19	38572737	38572737	+	Missense_Mutation	SNP	G	G	A	rs377070862		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:38572737G>A	ENST00000222345.6	+	3	1041	c.532G>A	c.(532-534)Gag>Aag	p.E178K		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	178					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CACCCTCAGCGAGTGTGACGC	0.721																																					p.E178K		Atlas-SNP	.											.	SIPA1L3	150	.	0			c.G532A						.	G	LYS/GLU	1,4395		0,1,2197	27.0	33.0	31.0		532	5.2	1.0	19		31	0,8592		0,0,4296	no	missense	SIPA1L3	NM_015073.1	56	0,1,6493	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	178/1782	38572737	1,12987	2198	4296	6494	SO:0001583	missense	23094	exon3			CTCAGCGAGTGTG	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.532G>A	chr19.hg19:g.38572737G>A	ENSP00000222345:p.Glu178Lys	37.0	0.0		58.0	11.0	NM_015073	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	hg19	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752569	0.89753	2.27E-4	0.0	ENSG00000105738	ENST00000222345	T	0.81415	-1.49	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.85256	0.5655	L	0.32530	0.975	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.86958	0.2090	10	0.72032	D	0.01	-36.8277	17.5458	0.87861	0.0:0.0:1.0:0.0	.	178	O60292	SI1L3_HUMAN	K	178	ENSP00000222345:E178K	ENSP00000222345:E178K	E	+	1	0	SIPA1L3	43264577	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	9.657000	0.98554	2.434000	0.82447	0.563000	0.77884	GAG	.	.		0.721	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
ACTN4	81	hgsc.bcm.edu	37	19	39207845	39207845	+	Silent	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:39207845G>A	ENST00000252699.2	+	10	1108	c.1032G>A	c.(1030-1032)ccG>ccA	p.P344P	ACTN4_ENST00000390009.3_Silent_p.P125P|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	344					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGCACAAGCCGCCCAAGGTGC	0.627																																					p.P344P	Colon(168;199 1940 10254 46213 46384)	Atlas-SNP	.											.	ACTN4	69	.	0			c.G1032A						.						110.0	84.0	93.0					19																	39207845		2203	4300	6503	SO:0001819	synonymous_variant	81	exon10			CAAGCCGCCCAAG	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1032G>A	chr19.hg19:g.39207845G>A		101.0	0.0		176.0	14.0	NM_004924	A4K467|D6PXK4|O76048	Silent	SNP	ENST00000252699.2	hg19	CCDS12518.1																																																																																			.	.		0.627	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		
CEACAM7	1087	hgsc.bcm.edu	37	19	42187899	42187899	+	Missense_Mutation	SNP	T	T	A	rs201378485		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:42187899T>A	ENST00000006724.3	-	3	724	c.523A>T	c.(523-525)Aca>Tca	p.T175S	CEACAM7_ENST00000338196.4_Intron|CEACAM7_ENST00000599715.1_5'Flank|CEACAM7_ENST00000602225.1_Intron|CEACAM7_ENST00000401731.1_Missense_Mutation_p.T175S	NM_006890.3	NP_008821.1	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 7	175	Ig-like C2-type.					anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		AGGTAGGTTGTGTTCTGAGTC	0.527																																					p.T175S		Atlas-SNP	.											.	CEACAM7	33	.	0			c.A523T						.						169.0	160.0	163.0					19																	42187899		2203	4300	6503	SO:0001583	missense	1087	exon3			AGGTTGTGTTCTG	X98311	CCDS12583.1	19q13.2	2013-01-29			ENSG00000007306	ENSG00000007306		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1819	protein-coding gene	gene with protein product	"""carcinoembryonic antigen gene family member 2"""			CGM2		7806520, 9135022	Standard	XM_005278379		Approved	CEA	uc002ori.1	Q14002	OTTHUMG00000151063	ENST00000006724.3:c.523A>T	chr19.hg19:g.42187899T>A	ENSP00000006724:p.Thr175Ser	91.0	0.0		130.0	86.0	NM_006890	A8K848|O15148|O15149|Q0VAC1|Q13983|Q9UPJ2	Missense_Mutation	SNP	ENST00000006724.3	hg19	CCDS12583.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.608016	0.46527	.	.	ENSG00000007306	ENST00000006724;ENST00000412062;ENST00000401731	T;T	0.12774	2.65;2.65	2.83	1.74	0.24563	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23649	0.0572	L	0.50847	1.595	0.09310	N	1	B	0.31519	0.327	P	0.51055	0.657	T	0.39522	-0.9610	9	0.72032	D	0.01	.	5.0416	0.14462	0.0:0.1706:0.0:0.8294	.	175	Q14002	CEAM7_HUMAN	S	175;154;175	ENSP00000006724:T175S;ENSP00000385932:T175S	ENSP00000006724:T175S	T	-	1	0	CEACAM7	46879739	0.001000	0.12720	0.051000	0.19133	0.240000	0.25518	0.139000	0.16036	1.060000	0.40578	0.260000	0.18958	ACA	.	T|1.000;C|0.000		0.527	CEACAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321145.1	NM_006890	
KCNN4	3783	hgsc.bcm.edu	37	19	44271859	44271859	+	Splice_Site	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:44271859T>C	ENST00000262888.3	-	8	1515	c.1120A>G	c.(1120-1122)Atg>Gtg	p.M374V		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	374					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	ATCATGTGCATCTGGGTGGGA	0.572																																					p.M374V		Atlas-SNP	.											.	KCNN4	37	.	0			c.A1120G						.						104.0	104.0	104.0					19																	44271859		2203	4300	6503	SO:0001630	splice_region_variant	3783	exon8			TGTGCATCTGGGT	AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.1120-1A>G	chr19.hg19:g.44271859T>C		69.0	0.0		82.0	49.0	NM_002250	Q53XR4	Missense_Mutation	SNP	ENST00000262888.3	hg19	CCDS12630.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314385	0.40996	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	D	0.99854	-7.19	3.87	3.87	0.44632	Calmodulin-binding domain (2);	0.042709	0.85682	D	0.000000	D	0.98960	0.9646	L	0.27053	0.805	0.52501	D	0.999958	B;B	0.33171	0.116;0.4	B;B	0.34873	0.026;0.191	D	0.99981	1.2604	10	0.29301	T	0.29	-42.0596	11.2923	0.49258	0.0:0.0:0.0:1.0	.	268;374	D1MQ10;O15554	.;KCNN4_HUMAN	V	374;242	ENSP00000262888:M374V	ENSP00000262888:M374V	M	-	1	0	KCNN4	48963699	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	3.808000	0.55598	1.989000	0.58080	0.528000	0.53228	ATG	.	.		0.572	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	Missense_Mutation
PTGIR	5739	hgsc.bcm.edu	37	19	47127137	47127137	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:47127137C>T	ENST00000291294.2	-	2	479	c.346G>A	c.(346-348)Gag>Aag	p.E116K	PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000596260.1_Missense_Mutation_p.E116K	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	116					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	AGGCAGCGCTCCACGGCCATG	0.711																																					p.E116K		Atlas-SNP	.											.	PTGIR	31	.	0			c.G346A						.						15.0	14.0	15.0					19																	47127137		2185	4272	6457	SO:0001583	missense	5739	exon2			AGCGCTCCACGGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.346G>A	chr19.hg19:g.47127137C>T	ENSP00000291294:p.Glu116Lys	57.0	0.0		98.0	20.0	NM_000960		Missense_Mutation	SNP	ENST00000291294.2	hg19	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002773	0.93287	.	.	ENSG00000160013	ENST00000291294	T	0.74632	-0.86	4.85	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.87549	0.6205	M	0.91300	3.195	0.47547	D	0.999453	D	0.89917	1.0	D	0.91635	0.999	D	0.89142	0.3517	10	0.87932	D	0	-11.5675	10.9984	0.47591	0.0:0.9092:0.0:0.0908	.	116	P43119	PI2R_HUMAN	K	116	ENSP00000291294:E116K	ENSP00000291294:E116K	E	-	1	0	PTGIR	51818977	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.612000	0.82975	1.264000	0.44198	0.563000	0.77884	GAG	.	.		0.711	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
ZNF808	388558	hgsc.bcm.edu	37	19	53056843	53056843	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:53056843A>T	ENST00000359798.4	+	5	854	c.674A>T	c.(673-675)cAc>cTc	p.H225L		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CAGGAAGTACACATGAGAGAA	0.383																																					p.H225L		Atlas-SNP	.											.	ZNF808	81	.	0			c.A674T						.						131.0	138.0	136.0					19																	53056843		2203	4300	6503	SO:0001583	missense	388558	exon5			AAGTACACATGAG	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.674A>T	chr19.hg19:g.53056843A>T	ENSP00000352846:p.His225Leu	70.0	0.0		153.0	98.0	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	hg19	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	8.272	0.813496	0.16537	.	.	ENSG00000198482	ENST00000359798	T	0.25912	1.77	1.01	1.01	0.19927	.	.	.	.	.	T	0.35508	0.0934	H	0.96748	3.875	0.09310	N	1	P	0.49783	0.928	B	0.37047	0.24	T	0.49244	-0.8960	9	0.66056	D	0.02	.	3.8502	0.08951	0.6045:0.3954:0.0:0.0	.	225	Q8N4W9	ZN808_HUMAN	L	225	ENSP00000352846:H225L	ENSP00000352846:H225L	H	+	2	0	ZNF808	57748655	0.000000	0.05858	0.002000	0.10522	0.036000	0.12997	0.950000	0.29122	0.701000	0.31803	0.254000	0.18369	CAC	.	.		0.383	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
BIRC8	112401	hgsc.bcm.edu	37	19	53793422	53793422	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:53793422A>T	ENST00000426466.1	-	1	1453	c.206T>A	c.(205-207)cTg>cAg	p.L69Q		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	69					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		CTCTTCTAGCAGATATTTGCA	0.433																																					p.L69Q		Atlas-SNP	.											.	BIRC8	54	.	0			c.T206A						.						130.0	125.0	126.0					19																	53793422		2203	4300	6503	SO:0001583	missense	112401	exon1			TCTAGCAGATATT	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.206T>A	chr19.hg19:g.53793422A>T	ENSP00000412957:p.Leu69Gln	132.0	0.0		196.0	124.0	NM_033341	Q6IPY1|Q96RW5	Missense_Mutation	SNP	ENST00000426466.1	hg19	CCDS12863.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.622332	0.28889	.	.	ENSG00000163098	ENST00000426466	T	0.73897	-0.79	0.502	0.502	0.16932	Baculoviral inhibition of apoptosis protein repeat (5);	.	.	.	.	D	0.87378	0.6162	H	0.96269	3.795	0.41402	D	0.987682	D	0.89917	1.0	D	0.81914	0.995	D	0.84814	0.0792	9	0.87932	D	0	-5.0376	5.4107	0.16346	0.9999:0.0:1.0E-4:0.0	.	69	Q96P09	BIRC8_HUMAN	Q	69	ENSP00000412957:L69Q	ENSP00000412957:L69Q	L	-	2	0	BIRC8	58485234	0.894000	0.30519	0.011000	0.14972	0.004000	0.04260	2.000000	0.40816	0.486000	0.27676	0.344000	0.21773	CTG	.	.		0.433	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341	
NLRP2	55655	hgsc.bcm.edu	37	19	55493848	55493848	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:55493848T>A	ENST00000543010.1	+	6	925	c.782T>A	c.(781-783)cTg>cAg	p.L261Q	NLRP2_ENST00000537859.1_Missense_Mutation_p.L239Q|NLRP2_ENST00000448584.2_Missense_Mutation_p.L261Q|NLRP2_ENST00000427260.2_Missense_Mutation_p.L238Q|NLRP2_ENST00000263437.6_Missense_Mutation_p.L258Q|NLRP2_ENST00000538819.1_Missense_Mutation_p.L237Q|NLRP2_ENST00000391721.4_Missense_Mutation_p.L237Q|NLRP2_ENST00000339757.7_Missense_Mutation_p.L239Q	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	261	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TTTGCAGAGCTGGTCTTCAGG	0.532																																					p.L261Q		Atlas-SNP	.											.	NLRP2	161	.	0			c.T782A						.						56.0	54.0	55.0					19																	55493848		2203	4300	6503	SO:0001583	missense	55655	exon6			CAGAGCTGGTCTT	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.782T>A	chr19.hg19:g.55493848T>A	ENSP00000445135:p.Leu261Gln	123.0	0.0		177.0	48.0	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	hg19	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.531553	0.45073	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	D;D;D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	1.55	1.55	0.23275	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.91908	0.7438	H	0.94964	3.605	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.77004	0.989;0.962;0.986;0.976;0.986	T	0.80879	-0.1185	9	0.87932	D	0	.	7.2028	0.25891	0.0:0.0:0.0:1.0	.	238;239;258;237;261	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	Q	261;237;239;261;239;238;237;258	ENSP00000445135:L261Q;ENSP00000375601:L237Q;ENSP00000344074:L239Q;ENSP00000409370:L261Q;ENSP00000440601:L239Q;ENSP00000402474:L238Q;ENSP00000441133:L237Q;ENSP00000263437:L258Q	ENSP00000263437:L258Q	L	+	2	0	NLRP2	60185660	0.084000	0.21492	0.004000	0.12327	0.015000	0.08874	3.079000	0.50104	0.987000	0.38709	0.397000	0.26171	CTG	.	.		0.532	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
ZNF256	10172	hgsc.bcm.edu	37	19	58453484	58453484	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:58453484C>G	ENST00000282308.3	-	3	888	c.692G>C	c.(691-693)gGa>gCa	p.G231A	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	231					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		AATGAGGTCTCCCTGGTGCTG	0.428																																					p.G231A	NSCLC(55;1313 1552 8040 11996)	Atlas-SNP	.											.	ZNF256	117	.	0			c.G692C						.						195.0	174.0	181.0					19																	58453484		2203	4300	6503	SO:0001583	missense	10172	exon3			AGGTCTCCCTGGT	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.692G>C	chr19.hg19:g.58453484C>G	ENSP00000282308:p.Gly231Ala	106.0	0.0		201.0	25.0	NM_005773	B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	ENST00000282308.3	hg19	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	.	8.561	0.877749	0.17395	.	.	ENSG00000152454	ENST00000282308	T	0.27104	1.69	3.04	-2.04	0.07343	.	.	.	.	.	T	0.14743	0.0356	N	0.25332	0.735	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.28004	-1.0057	9	0.59425	D	0.04	.	4.6251	0.12474	0.0:0.3883:0.1644:0.4474	.	231	Q9Y2P7	ZN256_HUMAN	A	231	ENSP00000282308:G231A	ENSP00000282308:G231A	G	-	2	0	ZNF256	63145296	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.132000	0.01309	-0.186000	0.10533	-0.384000	0.06662	GGA	.	.		0.428	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
TASP1	55617	hgsc.bcm.edu	37	20	13550171	13550171	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:13550171G>T	ENST00000337743.4	-	7	671	c.551C>A	c.(550-552)cCt>cAt	p.P184H	TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_Intron	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	184					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CATGATGTTAGGAGGGCAAGA	0.338																																					p.P184H		Atlas-SNP	.											.	TASP1	52	.	0			c.C551A						.						89.0	92.0	91.0					20																	13550171		2203	4300	6503	SO:0001583	missense	55617	exon7			ATGTTAGGAGGGC	AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.551C>A	chr20.hg19:g.13550171G>T	ENSP00000338624:p.Pro184His	43.0	0.0		44.0	30.0	NM_017714	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	ENST00000337743.4	hg19	CCDS13116.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492158	0.64074	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	D;D	0.87650	-2.28;-2.28	5.88	5.88	0.94601	.	0.217137	0.49916	D	0.000128	D	0.90700	0.7082	L	0.53249	1.67	0.80722	D	1	D;D	0.54207	0.965;0.959	P;P	0.60789	0.879;0.806	D	0.90948	0.4803	10	0.72032	D	0.01	-13.3836	14.6531	0.68811	0.0:0.0:0.8545:0.1455	.	184;161	Q9H6P5;Q5JWM4	TASP1_HUMAN;.	H	161;184;161	ENSP00000338624:P184H;ENSP00000400580:P161H	ENSP00000338624:P184H	P	-	2	0	TASP1	13498171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.289000	0.65656	2.779000	0.95612	0.650000	0.86243	CCT	.	.		0.338	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
GZF1	64412	hgsc.bcm.edu	37	20	23350846	23350846	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:23350846C>T	ENST00000338121.5	+	6	1981	c.1904C>T	c.(1903-1905)tCg>tTg	p.S635L	GZF1_ENST00000544236.1_Missense_Mutation_p.S159L|GZF1_ENST00000377051.2_Missense_Mutation_p.S635L|GZF1_ENST00000542987.1_Missense_Mutation_p.S144L			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	635					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TCCAAGCTTTCGGATAAATTG	0.478																																					p.S635L		Atlas-SNP	.											.	GZF1	61	.	0			c.C1904T						.						107.0	86.0	93.0					20																	23350846		2203	4300	6503	SO:0001583	missense	64412	exon5			AGCTTTCGGATAA	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1904C>T	chr20.hg19:g.23350846C>T	ENSP00000338290:p.Ser635Leu	177.0	0.0		119.0	13.0	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	ENST00000338121.5	hg19	CCDS13151.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.818664	0.32145	.	.	ENSG00000125812	ENST00000544236;ENST00000338121;ENST00000542987;ENST00000377051	T;T;T;T	0.10668	3.02;2.85;3.31;2.85	5.77	4.83	0.62350	.	0.489251	0.17196	N	0.183330	T	0.07863	0.0197	L	0.32530	0.975	0.20638	N	0.999874	P	0.48640	0.913	B	0.31191	0.125	T	0.17501	-1.0367	10	0.56958	D	0.05	.	13.8745	0.63645	0.0:0.9271:0.0:0.0729	.	635	Q9H116	GZF1_HUMAN	L	159;635;144;635	ENSP00000445458:S159L;ENSP00000338290:S635L;ENSP00000445118:S144L;ENSP00000366250:S635L	ENSP00000338290:S635L	S	+	2	0	GZF1	23298846	0.186000	0.23225	0.104000	0.21259	0.024000	0.10985	3.577000	0.53885	1.453000	0.47775	-0.136000	0.14681	TCG	.	.		0.478	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
NOL4L	140688	hgsc.bcm.edu	37	20	31043960	31043960	+	Silent	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:31043960C>T	ENST00000359676.5	-	3	490	c.348G>A	c.(346-348)ctG>ctA	p.L116L	C20orf112_ENST00000475781.1_5'UTR|RP5-1184F4.5_ENST00000442179.1_RNA	NM_001256798.1|NM_080616.4	NP_001243727.1|NP_542183.2	Q96MY1	NOL4L_HUMAN		116						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						CGCGGCTCCGCAGCCCGTCGG	0.652																																					p.L360L		Atlas-SNP	.											.	C20orf112	39	.	0			c.G1080A						.						63.0	68.0	66.0					20																	31043960		2203	4299	6502	SO:0001819	synonymous_variant	140688	exon6			GCTCCGCAGCCCG																												ENST00000359676.5:c.348G>A	chr20.hg19:g.31043960C>T		56.0	0.0		48.0	12.0	NM_001256798	Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Silent	SNP	ENST00000359676.5	hg19	CCDS13202.1																																																																																			.	.		0.652	C20orf112-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078628.2		
RBPJL	11317	hgsc.bcm.edu	37	20	43942173	43942173	+	Missense_Mutation	SNP	C	C	T	rs370206478		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:43942173C>T	ENST00000343694.3	+	7	757	c.685C>T	c.(685-687)Cgc>Tgc	p.R229C	RBPJL_ENST00000372741.3_Missense_Mutation_p.R229C|RBPJL_ENST00000372743.1_Missense_Mutation_p.R229C	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	229					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				GGTCTCCACACGCTACCTCTC	0.612																																					p.R229C		Atlas-SNP	.											.	RBPJL	67	.	0			c.C685T						.	C	CYS/ARG	0,4406		0,0,2203	97.0	77.0	84.0		685	4.1	1.0	20		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	RBPJL	NM_014276.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	229/518	43942173	1,13005	2203	4300	6503	SO:0001583	missense	11317	exon7			TCCACACGCTACC	AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.685C>T	chr20.hg19:g.43942173C>T	ENSP00000341243:p.Arg229Cys	59.0	0.0		65.0	47.0	NM_014276	O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	ENST00000343694.3	hg19	CCDS13349.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135960	0.77662	0.0	1.16E-4	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.38077	1.16;1.16;1.16	5.06	4.11	0.48088	Beta-trefoil (2);	0.000000	0.64402	D	0.000001	T	0.58380	0.2118	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.63120	-0.6708	10	0.87932	D	0	-31.8817	12.0946	0.53747	0.3117:0.6883:0.0:0.0	.	229;229	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	C	229	ENSP00000361828:R229C;ENSP00000361826:R229C;ENSP00000341243:R229C	ENSP00000341243:R229C	R	+	1	0	RBPJL	43375587	0.996000	0.38824	0.955000	0.39395	0.961000	0.63080	3.414000	0.52693	1.339000	0.45563	0.557000	0.71058	CGC	.	.		0.612	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276	
PREX1	57580	hgsc.bcm.edu	37	20	47273608	47273608	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:47273608A>T	ENST00000371941.3	-	18	2115	c.2093T>A	c.(2092-2094)cTg>cAg	p.L698Q	PREX1_ENST00000396220.1_Missense_Mutation_p.L698Q	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	698	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CAGGAGGCGCAGAGGGCGGCG	0.642																																					p.L698Q		Atlas-SNP	.											.	PREX1	441	.	0			c.T2093A						.						64.0	50.0	54.0					20																	47273608		2203	4300	6503	SO:0001583	missense	57580	exon18			AGGCGCAGAGGGC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2093T>A	chr20.hg19:g.47273608A>T	ENSP00000361009:p.Leu698Gln	36.0	0.0		45.0	13.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.857728	0.91433	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.54675	0.56;0.56	5.12	5.12	0.69794	PDZ/DHR/GLGF (2);	0.150693	0.29868	U	0.010993	T	0.60051	0.2239	L	0.29908	0.895	0.58432	D	0.999997	D	0.89917	1.0	D	0.64877	0.93	T	0.64791	-0.6324	10	0.87932	D	0	.	14.9361	0.70957	1.0:0.0:0.0:0.0	.	698	Q8TCU6	PREX1_HUMAN	Q	698	ENSP00000361009:L698Q;ENSP00000379522:L698Q	ENSP00000361009:L698Q	L	-	2	0	PREX1	46707015	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.333000	0.96459	1.926000	0.55796	0.459000	0.35465	CTG	.	.		0.642	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PREX1	57580	hgsc.bcm.edu	37	20	47444283	47444283	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:47444283C>T	ENST00000371941.3	-	1	137	c.115G>A	c.(115-117)Gcc>Acc	p.A39T	PREX1_ENST00000396220.1_Missense_Mutation_p.A39T	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	39					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			Tcccgggcggccgcgcacggg	0.786																																					p.A39T		Atlas-SNP	.											.	PREX1	441	.	0			c.G115A						.						4.0	4.0	4.0					20																	47444283		1839	3824	5663	SO:0001583	missense	57580	exon1			GGGCGGCCGCGCA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.115G>A	chr20.hg19:g.47444283C>T	ENSP00000361009:p.Ala39Thr	70.0	0.0		62.0	16.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054883	0.75960	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.61627	0.11;0.09	3.09	3.09	0.35607	Dbl homology (DH) domain (1);	.	.	.	.	T	0.54743	0.1877	N	0.08118	0	0.30375	N	0.78254	D	0.63880	0.993	D	0.72338	0.977	T	0.55431	-0.8142	9	0.48119	T	0.1	.	10.948	0.47312	0.0:1.0:0.0:0.0	.	39	Q8TCU6	PREX1_HUMAN	T	39	ENSP00000361009:A39T;ENSP00000379522:A39T	ENSP00000361009:A39T	A	-	1	0	PREX1	46877690	0.868000	0.29978	1.000000	0.80357	0.503000	0.33858	-0.052000	0.11865	1.579000	0.49836	0.195000	0.17529	GCC	.	.		0.786	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
ZFP64	55734	hgsc.bcm.edu	37	20	50782528	50782528	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:50782528T>A	ENST00000216923.4	-	3	672	c.323A>T	c.(322-324)cAa>cTa	p.Q108L	ZFP64_ENST00000477786.1_5'UTR|ZFP64_ENST00000371515.4_Missense_Mutation_p.Q106L|ZFP64_ENST00000346617.4_Intron|ZFP64_ENST00000371518.2_Missense_Mutation_p.Q108L|ZFP64_ENST00000361387.2_Missense_Mutation_p.Q108L	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CAGGTAAGTTTGATAGCCATG	0.428																																					p.Q108L		Atlas-SNP	.											.	ZFP64	240	.	0			c.A323T						.						156.0	138.0	144.0					20																	50782528		2203	4300	6503	SO:0001583	missense	55734	exon3			TAAGTTTGATAGC	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.323A>T	chr20.hg19:g.50782528T>A	ENSP00000216923:p.Gln108Leu	107.0	0.0		94.0	66.0	NM_018197	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	hg19	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.816946	0.70912	.	.	ENSG00000020256	ENST00000371518;ENST00000361387;ENST00000216923;ENST00000371515;ENST00000371516	T;T;T;T	0.08807	3.14;3.14;3.07;3.05	5.76	5.76	0.90799	.	0.000000	0.56097	D	0.000031	T	0.24236	0.0587	L	0.56769	1.78	0.50632	D	0.999885	D;D;D	0.64830	0.994;0.994;0.993	D;D;D	0.74348	0.983;0.983;0.977	T	0.00563	-1.1669	10	0.33141	T	0.24	-13.2416	14.6387	0.68708	0.0:0.0:0.0:1.0	.	106;108;108	Q5JWM1;Q9NPA5;Q9NTW7	.;ZF64A_HUMAN;ZF64B_HUMAN	L	108;108;108;106;108	ENSP00000360573:Q108L;ENSP00000355179:Q108L;ENSP00000216923:Q108L;ENSP00000360570:Q106L	ENSP00000216923:Q108L	Q	-	2	0	ZFP64	50215935	1.000000	0.71417	0.998000	0.56505	0.470000	0.32858	5.576000	0.67437	2.201000	0.70794	0.533000	0.62120	CAA	.	.		0.428	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
PHACTR3	116154	hgsc.bcm.edu	37	20	58318246	58318246	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:58318246T>A	ENST00000371015.1	+	2	670	c.203T>A	c.(202-204)cTg>cAg	p.L68Q	PHACTR3_ENST00000395636.2_Missense_Mutation_p.L27Q|PHACTR3_ENST00000361300.4_Missense_Mutation_p.L27Q|PHACTR3_ENST00000541461.1_Missense_Mutation_p.L27Q|PHACTR3_ENST00000355648.4_Missense_Mutation_p.L27Q|PHACTR3_ENST00000359926.3_Missense_Mutation_p.L65Q|PHACTR3_ENST00000395639.4_Missense_Mutation_p.L27Q	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	68						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AACAGCAAACTGGCCACCCTG	0.537																																					p.L68Q		Atlas-SNP	.											.	PHACTR3	104	.	0			c.T203A						.						78.0	80.0	79.0					20																	58318246		2203	4300	6503	SO:0001583	missense	116154	exon2			GCAAACTGGCCAC	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.203T>A	chr20.hg19:g.58318246T>A	ENSP00000360054:p.Leu68Gln	194.0	0.0		154.0	107.0	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	hg19	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.745995	0.89663	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.39787	1.43;1.46;1.06;1.44;1.44;1.44;1.06	4.41	4.41	0.53225	.	0.000000	0.64402	D	0.000002	T	0.58104	0.2099	L	0.54323	1.7	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.996	D;P;P	0.76071	0.987;0.898;0.871	T	0.61888	-0.6970	10	0.87932	D	0	-2.44	12.8102	0.57635	0.0:0.0:0.0:1.0	.	27;68;65	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	Q	65;68;27;27;27;27;27	ENSP00000353002:L65Q;ENSP00000360054:L68Q;ENSP00000379001:L27Q;ENSP00000442483:L27Q;ENSP00000347866:L27Q;ENSP00000378998:L27Q;ENSP00000354555:L27Q	ENSP00000347866:L27Q	L	+	2	0	PHACTR3	57751641	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.822000	0.86651	1.621000	0.50320	0.379000	0.24179	CTG	.	.		0.537	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
PSMA7	5688	hgsc.bcm.edu	37	20	60713291	60713291	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:60713291T>C	ENST00000370873.4	-	5	653	c.527A>G	c.(526-528)tAt>tGt	p.Y176C	PSMA7_ENST00000484488.1_5'UTR|PSMA7_ENST00000370861.1_Missense_Mutation_p.Y106C	NM_002792.3	NP_002783.1	O14818	PSA7_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 7	176					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	identical protein binding (GO:0042802)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|lung(2)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			TTCGTCAGTATAGTTCTTCTC	0.488																																					p.Y176C		Atlas-SNP	.											.	PSMA7	13	.	0			c.A527G						.						200.0	131.0	154.0					20																	60713291		2203	4300	6503	SO:0001583	missense	5688	exon5			TCAGTATAGTTCT	AF022815	CCDS13489.1	20q13.33	2008-07-02			ENSG00000101182	ENSG00000101182		"""Proteasome (prosome, macropain) subunits"""	9536	protein-coding gene	gene with protein product	"""proteasome subunit XAPC7"", ""proteasome subunit RC6-1"""	606607				8764072	Standard	NM_002792		Approved	XAPC7, C6, HSPC, RC6-1	uc002ybx.2	O14818	OTTHUMG00000032895	ENST00000370873.4:c.527A>G	chr20.hg19:g.60713291T>C	ENSP00000359910:p.Tyr176Cys	143.0	0.0		138.0	95.0	NM_002792	B2R515|Q5JXJ2|Q9BR53|Q9H4K5|Q9UEU8	Missense_Mutation	SNP	ENST00000370873.4	hg19	CCDS13489.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	16.38|16.38	3.106349|3.106349	0.56291|0.56291	.|.	.|.	ENSG00000101182|ENSG00000101182	ENST00000442551|ENST00000370873;ENST00000370861	.|T;T	.|0.29142	.|1.58;1.58	5.12|5.12	4.02|4.02	0.46733|0.46733	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72028|0.72028	0.3410|0.3410	H|H	0.99764|0.99764	4.76|4.76	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.77557	.|0.99	T|T	0.80712|0.80712	-0.1260|-0.1260	5|10	.|0.87932	.|D	.|0	.|.	10.76|10.76	0.46259|0.46259	0.0:0.075:0.0:0.925|0.0:0.075:0.0:0.925	.|.	.|176	.|O14818	.|PSA7_HUMAN	V|C	102|176;106	.|ENSP00000359910:Y176C;ENSP00000359898:Y106C	.|ENSP00000359898:Y106C	I|Y	-|-	1|2	0|0	PSMA7|PSMA7	60146686|60146686	1.000000|1.000000	0.71417|0.71417	0.741000|0.741000	0.31004|0.31004	0.493000|0.493000	0.33554|0.33554	7.690000|7.690000	0.84178|0.84178	0.811000|0.811000	0.34303|0.34303	0.460000|0.460000	0.39030|0.39030	ATA|TAT	.	.		0.488	PSMA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079975.1	NM_002792	
GATA5	140628	hgsc.bcm.edu	37	20	61040413	61040413	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr20:61040413G>T	ENST00000252997.2	-	6	1082	c.1021C>A	c.(1021-1023)Ccc>Acc	p.P341T		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	341					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			GCCATGCTGGGCCCAGGGCAC	0.677																																					p.P341T		Atlas-SNP	.											.	GATA5	22	.	0			c.C1021A						.						21.0	21.0	21.0					20																	61040413		2199	4299	6498	SO:0001583	missense	140628	exon6			TGCTGGGCCCAGG	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.1021C>A	chr20.hg19:g.61040413G>T	ENSP00000252997:p.Pro341Thr	8.0	0.0		13.0	8.0	NM_080473	D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	ENST00000252997.2	hg19	CCDS13499.1	.	.	.	.	.	.	.	.	.	.	G	0.057	-1.233072	0.01505	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.98400	-4.91	4.87	2.87	0.33458	.	0.556031	0.18783	N	0.131286	D	0.94748	0.8305	L	0.47716	1.5	0.09310	N	1	B	0.30406	0.278	B	0.22386	0.039	D	0.85861	0.1410	10	0.09843	T	0.71	-3.955	9.6717	0.40017	0.1789:0.0:0.8211:0.0	.	341	Q9BWX5	GATA5_HUMAN	T	341;361;341	ENSP00000252997:P341T	ENSP00000252997:P341T	P	-	1	0	GATA5	60473808	0.006000	0.16342	0.033000	0.17914	0.019000	0.09904	1.132000	0.31418	0.612000	0.30071	-0.464000	0.05259	CCC	.	.		0.677	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473	
ITGB2	3689	hgsc.bcm.edu	37	21	46308698	46308698	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr21:46308698C>G	ENST00000397850.2	-	15	2442	c.1990G>C	c.(1990-1992)Gag>Cag	p.E664Q	ITGB2_ENST00000355153.4_Missense_Mutation_p.E664Q|ITGB2_ENST00000302347.5_Missense_Mutation_p.E664Q|ITGB2_ENST00000397852.1_Missense_Mutation_p.E664Q|ITGB2_ENST00000397854.3_Missense_Mutation_p.E607Q|ITGB2_ENST00000397857.1_Missense_Mutation_p.E664Q			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	664					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GAGTCCCTCTCCTTGCAGGTC	0.637																																					p.E664Q		Atlas-SNP	.											.	ITGB2	107	.	0			c.G1990C						.						78.0	70.0	73.0					21																	46308698		2203	4300	6503	SO:0001583	missense	3689	exon14			CCCTCTCCTTGCA	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1990G>C	chr21.hg19:g.46308698C>G	ENSP00000380948:p.Glu664Gln	37.0	0.0		34.0	23.0	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	hg19	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719643	0.68844	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	4.86	3.91	0.45181	Integrin beta subunit, tail (2);	.	.	.	.	D	0.87755	0.6257	M	0.80028	2.48	0.46927	D	0.99925	P;D	0.57899	0.943;0.981	P;P	0.54759	0.733;0.76	D	0.88448	0.3047	9	0.51188	T	0.08	.	12.2769	0.54741	0.0:0.8274:0.1726:0.0	.	607;664	A8MYE6;P05107	.;ITB2_HUMAN	Q	664;664;607;664;664;664	ENSP00000380950:E664Q;ENSP00000380955:E664Q;ENSP00000380952:E607Q;ENSP00000347279:E664Q;ENSP00000380948:E664Q;ENSP00000303242:E664Q	ENSP00000303242:E664Q	E	-	1	0	ITGB2	45133126	1.000000	0.71417	0.984000	0.44739	0.552000	0.35366	3.436000	0.52856	2.221000	0.72209	0.650000	0.86243	GAG	.	.		0.637	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
PCBP3	54039	hgsc.bcm.edu	37	21	47333904	47333904	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr21:47333904C>T	ENST00000400314.1	+	10	978	c.640C>T	c.(640-642)Ccc>Tcc	p.P214S	PCBP3_ENST00000400309.1_Missense_Mutation_p.P214S|PCBP3_ENST00000449640.1_Missense_Mutation_p.P214S|PCBP3_ENST00000400304.1_Missense_Mutation_p.P182S|PCBP3_ENST00000400310.1_Missense_Mutation_p.P214S|PCBP3_ENST00000400308.1_Intron			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	214					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCCCAAAGCCCGCCTCCAC	0.612																																					p.P214S		Atlas-SNP	.											.	PCBP3	82	.	0			c.C640T						.						71.0	82.0	78.0					21																	47333904		1997	4173	6170	SO:0001583	missense	54039	exon8			CCAAAGCCCGCCT	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.640C>T	chr21.hg19:g.47333904C>T	ENSP00000383168:p.Pro214Ser	33.0	0.0		26.0	11.0	NM_020528	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	ENST00000400314.1	hg19	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.704342	0.88924	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000449640;ENST00000346743;ENST00000400304	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	M	0.82193	2.58	0.80722	D	1	P;B;P;B	0.47677	0.63;0.149;0.899;0.136	B;B;B;B	0.39185	0.293;0.26;0.293;0.105	T	0.61412	-0.7068	10	0.49607	T	0.09	-29.1813	18.6084	0.91275	0.0:1.0:0.0:0.0	.	182;214;214;214	E9PFP8;P57721-4;P57721;P57721-5	.;.;PCBP3_HUMAN;.	S	214;214;214;214;214;182	ENSP00000383168:P214S;ENSP00000383165:P214S;ENSP00000383164:P214S;ENSP00000401198:P214S;ENSP00000383159:P182S	ENSP00000330225:P214S	P	+	1	0	PCBP3	46158332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.368000	0.79567	2.385000	0.81259	0.563000	0.77884	CCC	.	.		0.612	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
P2RX6	9127	hgsc.bcm.edu	37	22	21377002	21377002	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr22:21377002A>T	ENST00000413302.2	+	4	573	c.425A>T	c.(424-426)gAg>gTg	p.E142V	P2RX6_ENST00000336296.2_Missense_Mutation_p.E132V|P2RX6_ENST00000401443.1_Missense_Mutation_p.E116V|P2RX6_ENST00000443995.3_Missense_Mutation_p.E89V|P2RX6_ENST00000402329.3_Intron			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6	142					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										TGGGTCGACGAGGACTGCCCC	0.667																																					p.E142V		Atlas-SNP	.											.	.	.	.	0			c.A425T						.						42.0	35.0	37.0					22																	21377002		2203	4299	6502	SO:0001583	missense	9127	exon4			TCGACGAGGACTG		CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689	ENST00000413302.2:c.425A>T	chr22.hg19:g.21377002A>T	ENSP00000416193:p.Glu142Val	80.0	0.0		98.0	30.0	NM_005446	F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	Missense_Mutation	SNP	ENST00000413302.2	hg19	CCDS13788.2	.	.	.	.	.	.	.	.	.	.	A	13.39	2.221988	0.39300	.	.	ENSG00000099957	ENST00000413302;ENST00000336296;ENST00000401443;ENST00000443995	T;T;T;T	0.04758	3.56;3.56;3.56;3.56	5.06	3.99	0.46301	.	0.648718	0.14434	N	0.319879	T	0.07369	0.0186	M	0.62723	1.935	0.33432	D	0.581202	B;B	0.17667	0.023;0.019	B;B	0.18561	0.022;0.013	T	0.02398	-1.1165	10	0.48119	T	0.1	-11.5456	8.9488	0.35776	0.8122:0.1878:0.0:0.0	.	142;116	O15547;F6V3D7	P2RX6_HUMAN;.	V	142;132;116;89	ENSP00000416193:E142V;ENSP00000338797:E132V;ENSP00000385309:E116V;ENSP00000408088:E89V	ENSP00000338797:E132V	E	+	2	0	P2RX6	19707002	0.899000	0.30636	0.880000	0.34516	0.954000	0.61252	1.034000	0.30204	0.839000	0.34971	0.397000	0.26171	GAG	.	.		0.667	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319625.2	NM_005446	
PRR14L	253143	hgsc.bcm.edu	37	22	32108298	32108298	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr22:32108298T>A	ENST00000327423.6	-	4	5716	c.5527A>T	c.(5527-5529)Agc>Tgc	p.S1843C	PRR14L_ENST00000397493.2_Missense_Mutation_p.S1843C|PRR14L_ENST00000434485.1_Missense_Mutation_p.S1843C	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1843										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GGCATGTGGCTGGAGAAGCTC	0.522																																					p.S1843C		Atlas-SNP	.											.	PRR14L	198	.	0			c.A5527T						.						79.0	82.0	81.0					22																	32108298		2203	4300	6503	SO:0001583	missense	253143	exon4			TGTGGCTGGAGAA	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5527A>T	chr22.hg19:g.32108298T>A	ENSP00000331845:p.Ser1843Cys	142.0	0.0		158.0	78.0	NM_173566	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	ENST00000327423.6	hg19	CCDS13900.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.2|21.2	4.111749|4.111749	0.77210|0.77210	.|.	.|.	ENSG00000183530|ENSG00000183530	ENST00000330495|ENST00000397493;ENST00000327423;ENST00000434485	.|T;T;T	.|0.39406	.|1.08;1.08;1.08	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.113966	.|0.64402	.|D	.|0.000010	T|T	0.62159|0.62159	0.2405|0.2405	M|M	0.63843|0.63843	1.955|1.955	0.36269|0.36269	D|D	0.855075|0.855075	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.77557	.|0.99;0.983;0.99	T|T	0.71699|0.71699	-0.4514|-0.4514	5|10	.|0.87932	.|D	.|0	-3.216|-3.216	15.0747|15.0747	0.72069|0.72069	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1843;1843;1843	.|Q5THK1-2;Q5THK1;Q5THK1-4	.|.;PR14L_HUMAN;.	L|C	145|1843	.|ENSP00000380630:S1843C;ENSP00000331845:S1843C;ENSP00000388314:S1843C	.|ENSP00000331845:S1843C	Q|S	-|-	2|1	0|0	PRR14L|PRR14L	30438298|30438298	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.989000|0.989000	0.77384|0.77384	2.730000|2.730000	0.47335|0.47335	2.155000|2.155000	0.67459|0.67459	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.	.		0.522	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074993.2	NM_173566	
KCNJ4	3761	hgsc.bcm.edu	37	22	38823554	38823554	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr22:38823554A>T	ENST00000303592.3	-	2	842	c.584T>A	c.(583-585)gTg>gAg	p.V195E	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	195					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GCCGTCGCGCACCGAAATGAC	0.627																																					p.V195E		Atlas-SNP	.											.	KCNJ4	74	.	0			c.T584A						.						47.0	46.0	46.0					22																	38823554		2203	4300	6503	SO:0001583	missense	3761	exon2			TCGCGCACCGAAA	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.584T>A	chr22.hg19:g.38823554A>T	ENSP00000306497:p.Val195Glu	44.0	0.0		55.0	31.0	NM_004981	Q14D44	Missense_Mutation	SNP	ENST00000303592.3	hg19	CCDS13971.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.116740	0.77323	.	.	ENSG00000168135	ENST00000303592	D	0.94184	-3.37	4.94	4.94	0.65067	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.077579	0.52532	D	0.000063	D	0.91646	0.7360	N	0.22421	0.69	0.45899	D	0.998742	P	0.41643	0.758	P	0.50162	0.633	D	0.92831	0.6280	10	0.66056	D	0.02	.	14.9516	0.71080	1.0:0.0:0.0:0.0	.	195	P48050	IRK4_HUMAN	E	195	ENSP00000306497:V195E	ENSP00000306497:V195E	V	-	2	0	KCNJ4	37153500	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.292000	0.96076	2.001000	0.58596	0.454000	0.30748	GTG	.	.		0.627	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
PNPLA3	80339	hgsc.bcm.edu	37	22	44332942	44332942	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr22:44332942A>T	ENST00000216180.3	+	6	942	c.769A>T	c.(769-771)Agg>Tgg	p.R257W	PNPLA3_ENST00000423180.2_Missense_Mutation_p.R253W	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	257					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CATCTGCAACAGGCCCCAGCC	0.602																																					p.R257W		Atlas-SNP	.											.	PNPLA3	53	.	0			c.A769T						.						56.0	50.0	52.0					22																	44332942		2203	4300	6503	SO:0001583	missense	80339	exon6			TGCAACAGGCCCC		CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.769A>T	chr22.hg19:g.44332942A>T	ENSP00000216180:p.Arg257Trp	49.0	0.0		50.0	17.0	NM_025225	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Missense_Mutation	SNP	ENST00000216180.3	hg19	CCDS14054.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.267463	0.59540	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	T;T	0.78003	-1.14;-1.14	5.34	-6.67	0.01783	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.976138	0.08355	N	0.958683	T	0.63616	0.2526	L	0.48642	1.525	0.09310	N	1	P	0.39831	0.69	B	0.38327	0.271	T	0.57860	-0.7738	10	0.46703	T	0.11	-7.3393	4.6593	0.12634	0.1532:0.2429:0.4842:0.1197	.	257	Q9NST1	PLPL3_HUMAN	W	257;253	ENSP00000216180:R257W;ENSP00000397987:R253W	ENSP00000216180:R257W	R	+	1	2	PNPLA3	42664275	0.000000	0.05858	0.007000	0.13788	0.040000	0.13550	-0.994000	0.03716	-0.817000	0.04335	0.379000	0.24179	AGG	.	.		0.602	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1	NM_025225	
ARHGAP8	23779	hgsc.bcm.edu	37	22	45210622	45210622	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr22:45210622T>G	ENST00000389774.2	+	6	604	c.463T>G	c.(463-465)Ttg>Gtg	p.L155V	ARHGAP8_ENST00000356099.6_Missense_Mutation_p.L124V|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.L334V|ARHGAP8_ENST00000336963.4_Missense_Mutation_p.L124V|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.L255V|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.L334V|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.L246V	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	155	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		GTGGAACATCTTGAAGCCCCT	0.582																																					p.L246V		Atlas-SNP	.											.	PRR5-ARHGAP8	53	.	0			c.T736G						.						143.0	115.0	125.0					22																	45210622		2203	4300	6503	SO:0001583	missense	553158	exon8			AACATCTTGAAGC	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.463T>G	chr22.hg19:g.45210622T>G	ENSP00000374424:p.Leu155Val	79.0	0.0		88.0	21.0	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	hg19	CCDS33664.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.104867	0.37145	.	.	ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484	ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000336963;ENST00000356099	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	4.04	3.0	0.34707	Cellular retinaldehyde-binding/triple function, C-terminal (5);	.	.	.	.	T	0.15696	0.0378	N	0.20445	0.575	0.24311	N	0.995082	B;B;P;B;B;B;B	0.36683	0.033;0.013;0.565;0.033;0.033;0.027;0.1	B;B;B;B;B;B;B	0.33846	0.043;0.016;0.171;0.063;0.026;0.082;0.098	T	0.11108	-1.0601	9	0.49607	T	0.09	.	8.8767	0.35350	0.0:0.0914:0.0:0.9086	.	160;124;160;155;165;334;255	B7ZMA4;A6ZJ79;A2RU51;P85298;Q6PCC7;B1AHC4;B1AHC3	.;.;.;RHG08_HUMAN;.;.;.	V	255;334;334;246;155;124;124	ENSP00000354732:L255V;ENSP00000262731:L334V;ENSP00000429240:L334V;ENSP00000374423:L246V;ENSP00000374424:L155V;ENSP00000337287:L124V;ENSP00000348407:L124V	ENSP00000337287:L124V	L	+	1	2	PRR5-ARHGAP8;ARHGAP8	43589286	1.000000	0.71417	0.581000	0.28614	0.727000	0.41649	3.562000	0.53777	0.616000	0.30141	0.529000	0.55759	TTG	.	.		0.582	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
MBTPS2	51360	hgsc.bcm.edu	37	X	21887622	21887622	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:21887622C>T	ENST00000379484.5	+	7	895	c.796C>T	c.(796-798)Cct>Tct	p.P266S	MBTPS2_ENST00000365779.2_Missense_Mutation_p.P266S	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	266					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						CAAGGACTCTCCTGCCATTGG	0.393																																					p.P266S		Atlas-SNP	.											.	MBTPS2	52	.	0			c.C796T						.						119.0	105.0	110.0					X																	21887622		2203	4300	6503	SO:0001583	missense	51360	exon7			GACTCTCCTGCCA	AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.796C>T	chrX.hg19:g.21887622C>T	ENSP00000368798:p.Pro266Ser	60.0	0.0		69.0	64.0	NM_015884	Q9UM70|Q9UMD3	Missense_Mutation	SNP	ENST00000379484.5	hg19	CCDS14201.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153233	0.78114	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.95821	-3.82;-2.68	4.84	4.84	0.62591	Peptidase M50 (1);	0.052899	0.85682	D	0.000000	D	0.96087	0.8725	M	0.74881	2.28	0.80722	D	1	P;P	0.47762	0.9;0.817	P;B	0.49799	0.622;0.401	D	0.95522	0.8595	10	0.37606	T	0.19	-16.8949	17.4296	0.87536	0.0:1.0:0.0:0.0	.	266;266	O43462;B9ZVQ3	MBTP2_HUMAN;.	S	266	ENSP00000368798:P266S;ENSP00000368796:P266S	ENSP00000368796:P266S	P	+	1	0	MBTPS2	21797543	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.769000	0.68865	2.386000	0.81285	0.600000	0.82982	CCT	.	.		0.393	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056026.1		
DMD	1756	hgsc.bcm.edu	37	X	32429921	32429921	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:32429921G>T	ENST00000357033.4	-	30	4387	c.4181C>A	c.(4180-4182)gCa>gAa	p.A1394E	DMD_ENST00000378677.2_Missense_Mutation_p.A1390E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1394					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AATATAAGCTGCCAACTGCTT	0.453																																					p.A1394E		Atlas-SNP	.											.	DMD	2127	.	0			c.C4181A						.						125.0	93.0	104.0					X																	32429921		2202	4300	6502	SO:0001583	missense	1756	exon30			TAAGCTGCCAACT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4181C>A	chrX.hg19:g.32429921G>T	ENSP00000354923:p.Ala1394Glu	54.0	0.0		60.0	60.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922775	0.52653	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.16457	2.34;2.34	5.68	5.68	0.88126	.	0.701259	0.11231	U	0.585641	T	0.12902	0.0313	N	0.22421	0.69	0.80722	D	1	B;P;B;B;B	0.40144	0.275;0.704;0.18;0.18;0.18	B;B;B;B;B	0.35182	0.128;0.197;0.06;0.037;0.037	T	0.21724	-1.0237	10	0.07813	T	0.8	.	18.7838	0.91946	0.0:0.0:1.0:0.0	.	1386;1394;1390;53;50	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	E	1386;53;50;1390;1394;1394;1271	ENSP00000367948:A1390E;ENSP00000354923:A1394E	ENSP00000354923:A1394E	A	-	2	0	DMD	32339842	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.916000	0.63362	2.381000	0.81170	0.506000	0.49869	GCA	.	.		0.453	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
BCOR	54880	hgsc.bcm.edu	37	X	39932115	39932115	+	Silent	SNP	T	T	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:39932115T>A	ENST00000378444.4	-	4	2712	c.2484A>T	c.(2482-2484)gcA>gcT	p.A828A	BCOR_ENST00000397354.3_Silent_p.A828A|BCOR_ENST00000378455.4_Silent_p.A828A|BCOR_ENST00000342274.4_Silent_p.A828A	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	828					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CAACACTCTCTGCTGCAAAGC	0.557			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.A828A		Atlas-SNP	.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351	.	0			c.A2484T						.						63.0	60.0	61.0					X																	39932115		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon4			ACTCTCTGCTGCA	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2484A>T	chrX.hg19:g.39932115T>A		63.0	0.0		44.0	39.0	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	hg19	CCDS48093.1																																																																																			.	.		0.557	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
MAOA	4128	hgsc.bcm.edu	37	X	43603116	43603116	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:43603116A>T	ENST00000338702.3	+	13	1461	c.1338A>T	c.(1336-1338)gaA>gaT	p.E446D	MAOA_ENST00000542639.1_Missense_Mutation_p.E313D	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	446					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	GCTACATGGAAGGGGCAGTTG	0.562																																					p.E446D		Atlas-SNP	.											.	MAOA	48	.	0			c.A1338T						.						62.0	41.0	48.0					X																	43603116		2175	4250	6425	SO:0001583	missense	4128	exon13			CATGGAAGGGGCA		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1338A>T	chrX.hg19:g.43603116A>T	ENSP00000340684:p.Glu446Asp	43.0	0.0		34.0	31.0	NM_000240	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	hg19	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.552321	0.45487	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;D	0.92965	-3.14;-3.14	5.93	-1.63	0.08345	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.84723	0.5535	L	0.28192	0.835	0.54753	D	0.999987	B	0.25850	0.136	B	0.35114	0.196	T	0.69124	-0.5228	10	0.14252	T	0.57	.	11.2426	0.48979	0.5702:0.0:0.4298:0.0	.	446	P21397	AOFA_HUMAN	D	446;313	ENSP00000340684:E446D;ENSP00000440846:E313D	ENSP00000340684:E446D	E	+	3	2	MAOA	43488060	1.000000	0.71417	0.994000	0.49952	0.639000	0.38242	1.039000	0.30266	-0.177000	0.10690	-0.314000	0.08810	GAA	.	.		0.562	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
PRAF2	11230	hgsc.bcm.edu	37	X	48931536	48931536	+	Silent	SNP	G	G	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:48931536G>T	ENST00000376390.4	-	1	194	c.111C>A	c.(109-111)gtC>gtA	p.V37V	PRAF2_ENST00000491199.1_5'Flank|WDR45_ENST00000553851.1_Intron|PRAF2_ENST00000376386.3_Silent_p.V37V|AF196779.12_ENST00000376358.3_Intron	NM_007213.1	NP_009144.1	O60831	PRAF2_HUMAN	PRA1 domain family, member 2	37					L-glutamate transport (GO:0015813)|protein transport (GO:0015031)	endosome (GO:0005768)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	8						GGTTGTTGATGACGCGGTGGC	0.667																																					p.V37V		Atlas-SNP	.											.	PRAF2	14	.	0			c.C111A						.						94.0	77.0	83.0					X																	48931536		2203	4300	6503	SO:0001819	synonymous_variant	11230	exon1			GTTGATGACGCGG	BC021213	CCDS14317.1	Xp11.23	2008-02-05	2004-11-15		ENSG00000243279	ENSG00000243279			28911	protein-coding gene	gene with protein product		300840	"""PRA1 domain family 2"""			16481131	Standard	NM_007213		Approved	JM4		O60831	OTTHUMG00000034499	ENST00000376390.4:c.111C>A	chrX.hg19:g.48931536G>T		25.0	0.0		41.0	34.0	NM_007213	B2RD20	Silent	SNP	ENST00000376390.4	hg19	CCDS14317.1																																																																																			.	.		0.667	PRAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083415.2	NM_007213	
OPHN1	4983	hgsc.bcm.edu	37	X	67293091	67293091	+	Silent	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:67293091A>T	ENST00000355520.5	-	20	2378	c.1737T>A	c.(1735-1737)ccT>ccA	p.P579P	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Silent_p.P579P	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	579					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						CTGTCACCCGAGGCGGAGGCA	0.473																																					p.P579P		Atlas-SNP	.											.	OPHN1	75	.	0			c.T1737A						.						104.0	78.0	87.0					X																	67293091		2203	4300	6503	SO:0001819	synonymous_variant	4983	exon20			CACCCGAGGCGGA	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1737T>A	chrX.hg19:g.67293091A>T		97.0	0.0		98.0	91.0	NM_002547	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Silent	SNP	ENST00000355520.5	hg19	CCDS14388.1																																																																																			.	.		0.473	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547	
IL13RA2	3598	hgsc.bcm.edu	37	X	114249118	114249118	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:114249118A>T	ENST00000371936.1	-	5	515	c.266T>A	c.(265-267)cTa>cAa	p.L89Q	IL13RA2_ENST00000243213.1_Missense_Mutation_p.L89Q|IL13RA2_ENST00000468224.1_5'UTR			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	89	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						TTTGTAATGTAGATTCTTAGT	0.358																																					p.L89Q		Atlas-SNP	.											.	IL13RA2	66	.	0			c.T266A						.						95.0	75.0	82.0					X																	114249118		2203	4300	6503	SO:0001583	missense	3598	exon4			TAATGTAGATTCT	X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.266T>A	chrX.hg19:g.114249118A>T	ENSP00000361004:p.Leu89Gln	54.0	0.0		43.0	40.0	NM_000640	A8K7E2|O00667	Missense_Mutation	SNP	ENST00000371936.1	hg19	CCDS14565.1	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578881	0.65878	.	.	ENSG00000123496	ENST00000371936;ENST00000243213	T;T	0.40225	1.04;1.04	5.18	5.18	0.71444	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.332186	0.29002	N	0.013449	T	0.60663	0.2286	M	0.70275	2.135	0.48288	D	0.999629	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.946	T	0.61973	-0.6952	10	0.48119	T	0.1	-12.0276	10.1104	0.42559	1.0:0.0:0.0:0.0	.	89;89	D0EFR8;Q14627	.;I13R2_HUMAN	Q	89	ENSP00000361004:L89Q;ENSP00000243213:L89Q	ENSP00000243213:L89Q	L	-	2	0	IL13RA2	114155374	0.976000	0.34144	0.864000	0.33941	0.948000	0.59901	5.374000	0.66167	1.912000	0.55364	0.437000	0.28790	CTA	.	.		0.358	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057966.1	NM_000640	
KIAA1210	57481	hgsc.bcm.edu	37	X	118223434	118223434	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:118223434A>T	ENST00000402510.2	-	11	1758	c.1759T>A	c.(1759-1761)Ttg>Atg	p.L587M		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	587										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCTAAGGACAAGTGCGAGAAA	0.493																																					p.L587M		Atlas-SNP	.											.	KIAA1210	171	.	0			c.T1759A						.						114.0	103.0	107.0					X																	118223434		1970	4153	6123	SO:0001583	missense	57481	exon11			AGGACAAGTGCGA	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1759T>A	chrX.hg19:g.118223434A>T	ENSP00000384670:p.Leu587Met	42.0	0.0		42.0	40.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	hg19	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	A	14.14	2.446212	0.43429	.	.	ENSG00000250423	ENST00000402510	T	0.15603	2.41	5.21	-2.44	0.06502	.	.	.	.	.	T	0.13543	0.0328	N	0.19112	0.55	0.09310	N	1	P	0.50156	0.932	P	0.50659	0.647	T	0.15983	-1.0418	9	0.45353	T	0.12	.	5.8306	0.18579	0.5243:0.0:0.3428:0.1329	.	587	Q9ULL0	K1210_HUMAN	M	587	ENSP00000384670:L587M	ENSP00000384670:L587M	L	-	1	2	RP13-347D8.6	118107462	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.300000	0.08243	-0.905000	0.03871	-0.404000	0.06349	TTG	.	.		0.493	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
MAGEC1	9947	hgsc.bcm.edu	37	X	140994576	140994576	+	Silent	SNP	C	C	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrX:140994576C>A	ENST00000285879.4	+	4	1672	c.1386C>A	c.(1384-1386)tcC>tcA	p.S462S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	462										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGAGTTCCCCTGAGAGAA	0.483										HNSCC(15;0.026)																											p.S462S		Atlas-SNP	.											.	MAGEC1	317	.	0			c.C1386A						.						99.0	109.0	105.0					X																	140994576		2203	4299	6502	SO:0001819	synonymous_variant	9947	exon4			GAGTTCCCCTGAG	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1386C>A	chrX.hg19:g.140994576C>A		123.0	0.0		121.0	12.0	NM_005462	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	hg19	CCDS35417.1																																																																																			.	.		0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MT-ND5	4540	hgsc.bcm.edu	37	M	12736	12736	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chrM:12736G>A	ENST00000361567.2	+	1	400	c.400G>A	c.(400-402)Gct>Act	p.A134T	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	134					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCTTAGTTACCGCTAACAACC	0.388																																					p.A134T		Atlas-SNP	.											.	.	.	.	0			c.G400A						.																																			SO:0001583	missense	0	exon1			GTTACCGCTAACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.400G>A	chrM.hg19:g.12736G>A	ENSP00000354813:p.Ala134Thr	24.0	0.0		388.0	29.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.388	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
TAS2R9	50835	hgsc.bcm.edu	37	12	10962090	10962091	+	Frame_Shift_Ins	INS	-	-	A			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr12:10962090_10962091insA	ENST00000240691.2	-	1	676_677	c.584_585insT	c.(583-585)ctgfs	p.L195fs	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	195					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AAAATGAGATCAGGCAAAGGAT	0.431																																					p.L195fs		Atlas-Indel,Pindel	.											.	TAS2R9	39	.	0			c.585_586insT						.																																			SO:0001589	frameshift_variant	50835	exon1			.	AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.585dupT	chr12.hg19:g.10962091_10962091dupA	ENSP00000240691:p.Leu195fs	132.0	0.0		168.0	27.0	NM_023917	Q502V7|Q50KT0|Q50KT1|Q645W9	Frame_Shift_Ins	INS	ENST00000240691.2	hg19	CCDS8633.1																																																																																			.	.		0.431	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399933.1		
ZBTB20	26137	hgsc.bcm.edu	37	3	114058003	114058003	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr3:114058003delG	ENST00000474710.1	-	5	2253	c.2075delC	c.(2074-2076)cctfs	p.P692fs	ZBTB20_ENST00000357258.3_Frame_Shift_Del_p.P619fs|ZBTB20_ENST00000464560.1_Frame_Shift_Del_p.P619fs|ZBTB20_ENST00000462705.1_Frame_Shift_Del_p.P619fs|ZBTB20_ENST00000471418.1_Frame_Shift_Del_p.P619fs|ZBTB20_ENST00000393785.2_Frame_Shift_Del_p.P619fs|ZBTB20_ENST00000481632.1_Frame_Shift_Del_p.P619fs	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	692						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.P619fs*43(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TGTGCCTGCAGGGGGGGTCCC	0.632																																					p.P692fs	NSCLC(69;748 1344 9802 11203 30933)	Atlas-Indel,Pindel	.											.	ZBTB20	157	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2076delT						.						56.0	55.0	55.0					3																	114058003		2203	4300	6503	SO:0001589	frameshift_variant	26137	exon5			.	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2075delC	chr3.hg19:g.114058003delG	ENSP00000419153:p.Pro692fs	70.0	0.0		70.0	22.0	NM_001164342	Q63HP6|Q8N6R5|Q9Y410	Frame_Shift_Del	DEL	ENST00000474710.1	hg19	CCDS54626.1																																																																																			.	.		0.632	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
DHX16	8449	hgsc.bcm.edu	37	6	30621047	30621048	+	Frame_Shift_Ins	INS	-	-	T	rs200009023		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr6:30621047_30621048insT	ENST00000376442.3	-	20	3292_3293	c.3097_3098insA	c.(3097-3099)atafs	p.I1033fs	DHX16_ENST00000376437.5_Frame_Shift_Ins_p.I552fs	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	1033					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.I1033fs*>10(1)		kidney(2)|ovary(2)	4						TGTTTTGCCTATTTTTTTGGGC	0.416																																					p.I1033fs		Atlas-Indel,Pindel	.											.,1	DHX16	119	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3098_3099insA						.																																			SO:0001589	frameshift_variant	8449	exon20			.	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.3098dupA	chr6.hg19:g.30621054_30621054dupT	ENSP00000365625:p.Ile1033fs	100.0	0.0		165.0	82.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Frame_Shift_Ins	INS	ENST00000376442.3	hg19	CCDS4685.1																																																																																			.	.		0.416	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
TP53	7157	hgsc.bcm.edu	37	17	7577531	7577538	+	Frame_Shift_Del	DEL	GGGCCTCC	GGGCCTCC	-	rs11540652|rs28934571|rs587782329|rs587782082		TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	GGGCCTCC	GGGCCTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr17:7577531_7577538delGGGCCTCC	ENST00000269305.4	-	7	932_939	c.743_750delGGAGGCCC	c.(742-750)cggaggcccfs	p.RRP248fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.RRP248fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.RRP248fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.RRP248fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.RRP248fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.RRP248fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R249S(348)|p.R248L(75)|p.P250L(45)|p.R249M(38)|p.R249W(37)|p.R249G(30)|p.R249K(20)|p.R248P(19)|p.R155Q(18)|p.R249T(16)|p.P250S(12)|p.R248R(8)|p.0?(8)|p.R249fs*96(6)|p.R249R(6)|p.?(5)|p.I251fs*94(5)|p.P250H(4)|p.P250P(4)|p.P250F(3)|p.R155L(3)|p.P250N(2)|p.R155P(2)|p.P250A(2)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.P250Q(2)|p.R248fs*16(2)|p.N247_R248delNR(2)|p.P250_L252delPIL(2)|p.P250_I251insXXXXXX(1)|p.N247_P250delNRRP(1)|p.unknown(1)|p.R248fs*>39(1)|p.R249fs*15(1)|p.P250T(1)|p.P250_T253delPILT(1)|p.R249_P250insR(1)|p.R249_I251delRPI(1)|p.R248_P250delRRP(1)|p.I251fs*13(1)|p.N247_R249delNRR(1)|p.P250_I251insXXXXXXX(1)|p.R248C(1)|p.I251fs*96(1)|p.R249_T256delRPILTIIT(1)|p.N247_R248>IP(1)|p.R249_P250>SS(1)|p.R249_P250delRP(1)|p.P250_I251insX(1)|p.P250fs*14(1)|p.G245fs*14(1)|p.R249fs*19(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGATGGGCCTCCGGTTCATGCC	0.577	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.248_251del	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,malignant_melanoma,+1,4	TP53	33396	.	1331	Substitution - Missense(1258)|Substitution - coding silent(18)|Deletion - Frameshift(14)|Deletion - In frame(13)|Insertion - Frameshift(8)|Whole gene deletion(8)|Unknown(6)|Insertion - In frame(4)|Complex - compound substitution(2)	liver(260)|lung(173)|large_intestine(168)|breast(120)|upper_aerodigestive_tract(107)|haematopoietic_and_lymphoid_tissue(90)|central_nervous_system(56)|oesophagus(54)|stomach(53)|urinary_tract(53)|ovary(50)|skin(35)|endometrium(29)|prostate(18)|pancreas(12)|bone(10)|biliary_tract(9)|cervix(8)|kidney(4)|soft_tissue(4)|vulva(3)|thyroid(3)|adrenal_gland(3)|peritoneum(2)|small_intestine(2)|eye(1)|genital_tract(1)|pituitary(1)|salivary_gland(1)|thymus(1)	c.744_751del	GRCh37	CM920675|CM973401	TP53	M	rs11540652	.																																			SO:0001589	frameshift_variant	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743_750delGGAGGCCC	chr17.hg19:g.7577531_7577538delGGGCCTCC	ENSP00000269305:p.Arg248fs	77.0	0.0		24.0	18.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PRR12	57479	hgsc.bcm.edu	37	19	50102990	50102992	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr19:50102990_50102992delCTC	ENST00000418929.2	+	5	4152_4154	c.4140_4142delCTC	c.(4138-4143)ttctcc>ttc	p.S1382del		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TGCCCTCCTTCTCCTCGGATGAG	0.616																																					p.1380_1381del		Atlas-Indel,Pindel	.											.	PRR12	157	.	0			c.4139_4141del						.																																			SO:0001651	inframe_deletion	57479	exon5			.	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4140_4142delCTC	chr19.hg19:g.50102993_50102995delCTC	ENSP00000394510:p.Ser1382del	86.0	0.0		126.0	23.0	NM_020719	E9PB06|Q8N4J6	In_Frame_Del	DEL	ENST00000418929.2	hg19	CCDS46143.1																																																																																			.	.		0.616	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
TMX2	51075	hgsc.bcm.edu	37	11	57505430	57505441	+	In_Frame_Del	DEL	TGGCCAACACAA	TGGCCAACACAA	-			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	TGGCCAACACAA	TGGCCAACACAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr11:57505430_57505441delTGGCCAACACAA	ENST00000278422.4	+	3	308_319	c.296_307delTGGCCAACACAA	c.(295-309)gtggccaacacaatt>gtt	p.ANTI100del	TMX2-CTNND1_ENST00000528395.1_Intron|TMX2_ENST00000378312.4_Intron	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	100					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						TTTAGTAAAGTGGCCAACACAATTCTTTTCTT	0.42																																					p.99_102del		Atlas-Indel,Pindel	.											.	TMX2	29	.	0			c.295_306del						.																																			SO:0001651	inframe_deletion	51075	exon3			.	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.296_307delTGGCCAACACAA	chr11.hg19:g.57505430_57505441delTGGCCAACACAA	ENSP00000278422:p.Ala100_Ile103del	160.0	0.0		82.0	22.0	NM_015959	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	In_Frame_Del	DEL	ENST00000278422.4	hg19	CCDS7967.1																																																																																			.	.		0.420	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393708.1	NM_015959	
SLC10A1	6554	hgsc.bcm.edu	37	14	70263762	70263764	+	In_Frame_Del	DEL	GAA	GAA	-	rs200032457	byFrequency	TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr14:70263762_70263764delGAA	ENST00000216540.4	-	1	242_244	c.109_111delTTC	c.(109-111)ttcdel	p.F37del		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	37					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	AGAGCATGATGAAGAACAACATG	0.567																																					p.37_38del		Atlas-Indel,Pindel	.											.	SLC10A1	32	.	0			c.110_112del						.																																			SO:0001651	inframe_deletion	6554	exon1			.	L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.109_111delTTC	chr14.hg19:g.70263765_70263767delGAA	ENSP00000216540:p.Phe37del	114.0	0.0		88.0	43.0	NM_003049	B9EGB6|Q2TU29	In_Frame_Del	DEL	ENST00000216540.4	hg19	CCDS9797.1																																																																																			.	.		0.567	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412464.1		
LCORL	254251	hgsc.bcm.edu	37	4	18023321	18023322	+	In_Frame_Ins	INS	-	-	GCGGCGGCAGCA			TCGA-ED-A7PZ-01A-11D-A33Q-10	TCGA-ED-A7PZ-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9271fe2-2c4b-4513-8eac-853a1acc9568	84111421-4619-45db-918a-9570d676c285	g.chr4:18023321_18023322insGCGGCGGCAGCA	ENST00000382226.5	-	1	161_162	c.53_54insTGCTGCCGCCGC	c.(52-54)gcc>gcTGCTGCCGCCGCc	p.18_18A>AAAAA	LCORL_ENST00000512376.2_5'UTR|LCORL_ENST00000326877.4_In_Frame_Ins_p.18_18A>AAAAA|LCORL_ENST00000539056.1_5'UTR|LCORL_ENST00000382224.1_5'Flank	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	18	Ala-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						cggcggcggcggcggcggcagc	0.688																																					p.A18delinsAAAAA		Atlas-INDEL	.											.	LCORL	60	.	0			c.54_55insTGCTGCCGCCGC						.																																			SO:0001652	inframe_insertion	254251	exon1			.		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.42_53dupTGCTGCCGCCGC	chr4.hg19:g.18023321_18023322insGCGGCGGCAGCA	ENSP00000371661:p.AlaAlaAlaAla22dup	47.0	0.0		72.0	15.0	NM_001166139	Q96NK1	In_Frame_Ins	INS	ENST00000382226.5	hg19	CCDS54749.1																																																																																			.	.		0.688	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_153686	
