#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNN	63923	hgsc.bcm.edu	37	1	175048581	175048581	+	Silent	SNP	G	G	A	rs374925420		TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr1:175048581G>A	ENST00000239462.4	+	3	635	c.522G>A	c.(520-522)gcG>gcA	p.A174A		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	174	EGF-like 1.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCCCCGGGGCGTGCAGCGGCC	0.736																																					p.A174A		Atlas-SNP	.											.	TNN	297	.	0			c.G522A						.	G		0,4160		0,0,2080	5.0	7.0	6.0		522	-8.9	0.4	1		6	1,8017		0,1,4008	no	coding-synonymous	TNN	NM_022093.1		0,1,6088	AA,AG,GG		0.0125,0.0,0.0082		174/1300	175048581	1,12177	2080	4009	6089	SO:0001819	synonymous_variant	63923	exon3			CGGGGCGTGCAGC	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.522G>A	chr1.hg19:g.175048581G>A		38.0	0.0		44.0	18.0	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	hg19	CCDS30943.1																																																																																			.	.		0.736	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
SPTBN1	6711	hgsc.bcm.edu	37	2	54857137	54857137	+	Silent	SNP	C	C	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr2:54857137C>T	ENST00000356805.4	+	15	3059	c.2778C>T	c.(2776-2778)atC>atT	p.I926I	SPTBN1_ENST00000333896.5_Silent_p.I913I	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	926					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGAAGGAAATCAAAGCCCAGC	0.582																																					p.I926I		Atlas-SNP	.											.	SPTBN1	378	.	0			c.C2778T						.						67.0	62.0	64.0					2																	54857137		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon15			GGAAATCAAAGCC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.2778C>T	chr2.hg19:g.54857137C>T		25.0	0.0		25.0	15.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	hg19	CCDS33198.1																																																																																			.	.		0.582	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
STXBP5L	9515	hgsc.bcm.edu	37	3	120941851	120941851	+	Splice_Site	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr3:120941851G>A	ENST00000273666.6	+	11	1229	c.958G>A	c.(958-960)Gaa>Aaa	p.E320K	STXBP5L_ENST00000471454.1_Splice_Site_p.E320K|STXBP5L_ENST00000492541.1_Splice_Site_p.E320K|STXBP5L_ENST00000472879.1_Splice_Site_p.E320K|STXBP5L_ENST00000497029.1_Splice_Site_p.E320K	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	320					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CCTATGTAGCGAACCATTCAT	0.368																																					p.E320K		Atlas-SNP	.											.	STXBP5L	159	.	0			c.G958A						.						140.0	129.0	132.0					3																	120941851		1860	4096	5956	SO:0001630	splice_region_variant	9515	exon11			TGTAGCGAACCAT	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.957-1G>A	chr3.hg19:g.120941851G>A		141.0	0.0		131.0	53.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	hg19	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268878	0.80469	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.38560	1.83;1.84;1.64;1.13;1.63;1.83	4.65	4.65	0.58169	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.321837	0.36815	N	0.002385	T	0.61413	0.2345	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.58470	-0.7631	10	0.31617	T	0.26	-6.7613	17.7198	0.88348	0.0:0.0:1.0:0.0	.	320;320	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	K	320	ENSP00000273666:E320K;ENSP00000420019:E320K;ENSP00000419627:E320K;ENSP00000420287:E320K;ENSP00000420666:E320K;ENSP00000420167:E320K	ENSP00000273666:E320K	E	+	1	0	STXBP5L	122424541	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	9.657000	0.98554	2.397000	0.81536	0.462000	0.41574	GAA	.	.		0.368	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		Missense_Mutation
ZBBX	79740	hgsc.bcm.edu	37	3	166960379	166960379	+	Silent	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr3:166960379G>A	ENST00000392766.2	-	20	2530	c.2190C>T	c.(2188-2190)agC>agT	p.S730S	ZBBX_ENST00000455345.2_Silent_p.S769S|ZBBX_ENST00000307529.5_Silent_p.S769S|ZBBX_ENST00000392764.1_Silent_p.S701S|ZBBX_ENST00000392767.2_Silent_p.S730S	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	730						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						GTGATTGGCTGCTGAAATCTG	0.378																																					p.S769S		Atlas-SNP	.											.	ZBBX	299	.	0			c.C2307T						.						95.0	92.0	93.0					3																	166960379		1823	4079	5902	SO:0001819	synonymous_variant	79740	exon21			TTGGCTGCTGAAA	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2190C>T	chr3.hg19:g.166960379G>A		86.0	0.0		76.0	32.0	NM_001199201	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	ENST00000392766.2	hg19	CCDS3199.2																																																																																			.	.		0.378	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
PCDH12	51294	hgsc.bcm.edu	37	5	141336991	141336991	+	Silent	SNP	C	C	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr5:141336991C>A	ENST00000231484.3	-	1	1636	c.426G>T	c.(424-426)ctG>ctT	p.L142L	PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	142	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGAGATTTCCAGCTCCTGCT	0.572																																					p.L142L		Atlas-SNP	.											.	PCDH12	133	.	0			c.G426T						.						108.0	124.0	119.0					5																	141336991		2203	4300	6503	SO:0001819	synonymous_variant	51294	exon1			GATTTCCAGCTCC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.426G>T	chr5.hg19:g.141336991C>A		128.0	0.0		86.0	46.0	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	hg19	CCDS4269.1																																																																																			.	.		0.572	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
ZNF311	282890	hgsc.bcm.edu	37	6	28963999	28963999	+	Silent	SNP	T	T	G			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr6:28963999T>G	ENST00000377179.3	-	7	1292	c.780A>C	c.(778-780)tcA>tcC	p.S260S	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						GAATTAGATCTGAGTGCCAAC	0.398																																					p.S260S		Atlas-SNP	.											.	ZNF311	59	.	0			c.A780C						.						65.0	76.0	72.0					6																	28963999		1509	2708	4217	SO:0001819	synonymous_variant	282890	exon7			TAGATCTGAGTGC	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.780A>C	chr6.hg19:g.28963999T>G		129.0	0.0		158.0	48.0	NM_001010877	A2BFK5|B0S7Y4|Q92971	Silent	SNP	ENST00000377179.3	hg19	CCDS34357.1																																																																																			.	.		0.398	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076631.3	XM_212581	
FOXP2	93986	hgsc.bcm.edu	37	7	114269944	114269944	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr7:114269944C>A	ENST00000393494.2	+	5	760	c.481C>A	c.(481-483)Caa>Aaa	p.Q161K	FOXP2_ENST00000390668.3_Missense_Mutation_p.Q185K|FOXP2_ENST00000393498.2_Missense_Mutation_p.Q141K|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000403559.4_Missense_Mutation_p.Q178K|FOXP2_ENST00000408937.3_Missense_Mutation_p.Q186K|FOXP2_ENST00000393489.3_Missense_Mutation_p.Q69K|FOXP2_ENST00000360232.4_Missense_Mutation_p.Q161K|FOXP2_ENST00000350908.4_Missense_Mutation_p.Q161K|FOXP2_ENST00000378237.3_Missense_Mutation_p.Q161K|FOXP2_ENST00000393491.3_Missense_Mutation_p.Q69K|FOXP2_ENST00000393500.3_Missense_Mutation_p.Q86K			O15409	FOXP2_HUMAN	forkhead box P2	161	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						gcagcagcagcaacaacagca	0.478																																					p.Q186K		Atlas-SNP	.											.	FOXP2	133	.	0			c.C556A						.						37.0	37.0	37.0					7																	114269944		2202	4298	6500	SO:0001583	missense	93986	exon5			CAGCAGCAACAAC	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.481C>A	chr7.hg19:g.114269944C>A	ENSP00000377132:p.Gln161Lys	36.0	0.0		23.0	5.0	NM_001172767	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	hg19	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828116	0.32329	.	.	ENSG00000128573	ENST00000393500;ENST00000324462;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000452963;ENST00000390668;ENST00000393491	T;T;T;T;T;T;T;T;T;T	0.36520	1.57;1.25;1.6;1.57;1.25;1.25;1.6;1.25;1.6;1.6	5.96	5.96	0.96718	.	0.339974	0.26026	N	0.026793	T	0.32194	0.0821	N	0.03608	-0.345	0.53688	D	0.999974	P;P;P;P;P;P;P	0.43578	0.713;0.713;0.713;0.811;0.811;0.713;0.811	P;P;P;P;P;P;P	0.57846	0.678;0.678;0.678;0.828;0.828;0.678;0.828	T	0.06752	-1.0809	10	0.02654	T	1	.	20.0296	0.97533	0.0:1.0:0.0:0.0	.	161;178;69;161;185;161;186	B7ZLK5;B4DLD9;Q0PRL4;O15409-6;Q8N6B5;O15409;O15409-4	.;.;.;.;.;FOXP2_HUMAN;.	K	86;161;161;186;178;161;139;161;69;161;167;185;69	ENSP00000377137:Q86K;ENSP00000377132:Q161K;ENSP00000386200:Q186K;ENSP00000385069:Q178K;ENSP00000265436:Q161K;ENSP00000367482:Q161K;ENSP00000377129:Q69K;ENSP00000353367:Q161K;ENSP00000375084:Q185K;ENSP00000377130:Q69K	ENSP00000319424:Q161K	Q	+	1	0	FOXP2	114057180	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	3.922000	0.56462	2.831000	0.97527	0.650000	0.86243	CAA	.	.		0.478	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
PTPRN2	5799	hgsc.bcm.edu	37	7	157931034	157931034	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr7:157931034C>T	ENST00000389418.4	-	7	1093	c.1084G>A	c.(1084-1086)Gaa>Aaa	p.E362K	PTPRN2_ENST00000389416.4_Missense_Mutation_p.E345K|PTPRN2_ENST00000389413.3_Missense_Mutation_p.E362K|PTPRN2_ENST00000404321.2_Missense_Mutation_p.E385K|PTPRN2_ENST00000409483.1_Missense_Mutation_p.E324K	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	362					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TCCGCCTGTTCTCCAGACTCT	0.677																																					p.E362K		Atlas-SNP	.											.	PTPRN2	243	.	0			c.G1084A						.						44.0	48.0	47.0					7																	157931034		2203	4300	6503	SO:0001583	missense	5799	exon7			CCTGTTCTCCAGA	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1084G>A	chr7.hg19:g.157931034C>T	ENSP00000374069:p.Glu362Lys	67.0	0.0		59.0	25.0	NM_130843	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	hg19	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.209221	0.39003	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.04119	3.71;3.9;3.92;3.7;3.91	4.24	3.35	0.38373	.	.	.	.	.	T	0.04003	0.0112	N	0.19112	0.55	0.09310	N	1	P;P;P;P;P	0.50156	0.932;0.888;0.932;0.888;0.888	B;B;P;B;B	0.45428	0.395;0.287;0.48;0.287;0.221	T	0.23440	-1.0188	9	0.07990	T	0.79	.	10.3514	0.43939	0.0:0.7999:0.2001:0.0	.	385;324;362;345;362	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	K	324;362;345;362;385	ENSP00000387114:E324K;ENSP00000374064:E362K;ENSP00000374067:E345K;ENSP00000374069:E362K;ENSP00000385464:E385K	ENSP00000374064:E362K	E	-	1	0	PTPRN2	157623795	0.005000	0.15991	0.001000	0.08648	0.038000	0.13279	0.968000	0.29357	0.859000	0.35456	0.655000	0.94253	GAA	.	.		0.677	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
PAPPA	5069	hgsc.bcm.edu	37	9	119109470	119109470	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr9:119109470C>T	ENST00000328252.3	+	15	4315	c.3946C>T	c.(3946-3948)Cac>Tac	p.H1316Y	PAPPA_ENST00000534838.1_Missense_Mutation_p.H354Y	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1316	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CCAGTGCCGTCACCCTGCACA	0.542																																					p.H1316Y		Atlas-SNP	.											.	PAPPA	243	.	0			c.C3946T						.						145.0	106.0	119.0					9																	119109470		2203	4300	6503	SO:0001583	missense	5069	exon15			TGCCGTCACCCTG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3946C>T	chr9.hg19:g.119109470C>T	ENSP00000330658:p.His1316Tyr	113.0	0.0		130.0	53.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	hg19	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695810	0.30052	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.64085	-0.08;-0.08	5.86	4.97	0.65823	Complement control module (2);Sushi/SCR/CCP (3);	0.199744	0.52532	D	0.000063	T	0.46678	0.1405	N	0.19112	0.55	0.34019	D	0.652428	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.51896	-0.8647	10	0.18710	T	0.47	-27.0103	15.2045	0.73169	0.0:0.9326:0.0:0.0674	.	354;1316	F5GZ19;Q13219	.;PAPP1_HUMAN	Y	1316;354	ENSP00000330658:H1316Y;ENSP00000441461:H354Y	ENSP00000330658:H1316Y	H	+	1	0	PAPPA	118149291	1.000000	0.71417	0.995000	0.50966	0.797000	0.45037	3.898000	0.56281	1.490000	0.48466	-0.137000	0.14449	CAC	.	.		0.542	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
MORN5	254956	hgsc.bcm.edu	37	9	124936889	124936889	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr9:124936889G>A	ENST00000373764.3	+	4	484	c.422G>A	c.(421-423)cGc>cAc	p.R141H	MORN5_ENST00000486801.1_3'UTR|MORN5_ENST00000536616.1_Missense_Mutation_p.R141H	NM_198469.2	NP_940871.2	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5	141								p.R141H(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	9						TATAGGAACCGCTTTCTAAGA	0.458																																					p.R141H		Atlas-SNP	.											MORN5,NS,carcinoma,0,1	MORN5	19	.	1	Substitution - Missense(1)	kidney(1)	c.G422A						.						102.0	94.0	97.0					9																	124936889		2203	4300	6503	SO:0001583	missense	254956	exon4			GGAACCGCTTTCT	AK128877	CCDS6836.1, CCDS75894.1	9q34.11	2008-06-23	2008-06-23	2008-06-23	ENSG00000185681	ENSG00000185681			17841	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 113"", ""chromosome 9 open reading frame 18"""	C9orf113, C9orf18			Standard	XM_005251878		Approved	FLJ46909	uc004blw.2	Q5VZ52	OTTHUMG00000020599	ENST00000373764.3:c.422G>A	chr9.hg19:g.124936889G>A	ENSP00000362869:p.Arg141His	76.0	0.0		70.0	15.0	NM_198469	B7Z7I5|Q6ZQN1	Missense_Mutation	SNP	ENST00000373764.3	hg19	CCDS6836.1	.	.	.	.	.	.	.	.	.	.	G	5.420	0.262613	0.10294	.	.	ENSG00000185681	ENST00000373764;ENST00000536616	T;T	0.25414	1.93;1.8	5.12	2.33	0.28932	.	0.506126	0.23241	N	0.050350	T	0.24547	0.0595	M	0.75447	2.3	0.09310	N	1	B;B	0.27416	0.178;0.028	B;B	0.17098	0.017;0.003	T	0.16541	-1.0399	10	0.40728	T	0.16	-20.8112	6.8063	0.23779	0.3606:0.0:0.6394:0.0	.	141;141	B7Z7I5;Q5VZ52	.;MORN5_HUMAN	H	141	ENSP00000362869:R141H;ENSP00000437483:R141H	ENSP00000362869:R141H	R	+	2	0	MORN5	123976710	0.005000	0.15991	0.206000	0.23566	0.063000	0.16089	1.192000	0.32150	0.350000	0.24002	0.650000	0.86243	CGC	.	.		0.458	MORN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053910.2	NM_198469	
INCENP	3619	hgsc.bcm.edu	37	11	61906404	61906404	+	Silent	SNP	G	G	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr11:61906404G>T	ENST00000394818.3	+	7	1420	c.1218G>T	c.(1216-1218)acG>acT	p.T406T	INCENP_ENST00000278849.4_Silent_p.T406T	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	406					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)		p.T406T(2)		breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ACAATGACACGGAGATTGCCA	0.582																																					p.T406T		Atlas-SNP	.											INCENP_ENST00000394818,colon,carcinoma,0,2	INCENP	122	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1218T						.						134.0	122.0	126.0					11																	61906404		2202	4299	6501	SO:0001819	synonymous_variant	3619	exon7			TGACACGGAGATT	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1218G>T	chr11.hg19:g.61906404G>T		44.0	0.0		45.0	3.0	NM_001040694	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	hg19	CCDS44624.1																																																																																			.	.		0.582	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
SART1	9092	hgsc.bcm.edu	37	11	65743929	65743929	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr11:65743929G>A	ENST00000312397.5	+	13	1728	c.1636G>A	c.(1636-1638)Gag>Aag	p.E546K		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	546					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TGAGGATCCCGAGCGGAAGGG	0.652																																					p.E546K		Atlas-SNP	.											.	SART1	41	.	0			c.G1636A						.						34.0	37.0	36.0					11																	65743929		2201	4296	6497	SO:0001583	missense	9092	exon13			GATCCCGAGCGGA	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1636G>A	chr11.hg19:g.65743929G>A	ENSP00000310448:p.Glu546Lys	35.0	0.0		23.0	13.0	NM_005146	A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	hg19	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632773	0.47049	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.22134	1.97	5.1	4.19	0.49359	.	0.126858	0.51477	D	0.000087	T	0.16385	0.0394	L	0.44542	1.39	0.42425	D	0.992656	P	0.35348	0.496	B	0.25614	0.062	T	0.05305	-1.0893	10	0.87932	D	0	-32.6416	11.3252	0.49444	0.0885:0.0:0.9115:0.0	.	546	O43290	SNUT1_HUMAN	K	546;388	ENSP00000310448:E546K	ENSP00000310448:E546K	E	+	1	0	SART1	65500505	1.000000	0.71417	0.829000	0.32907	0.858000	0.48976	6.651000	0.74372	1.389000	0.46526	0.491000	0.48974	GAG	.	.		0.652	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391409.1		
ADIPOR2	79602	hgsc.bcm.edu	37	12	1893123	1893123	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr12:1893123G>A	ENST00000357103.4	+	7	1167	c.916G>A	c.(916-918)Gcc>Acc	p.A306T		NM_024551.2	NP_078827.2	Q86V24	ADR2_HUMAN	adiponectin receptor 2	306					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|female pregnancy (GO:0007565)|heart development (GO:0007507)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of cell growth (GO:0030308)|positive regulation of glucose import (GO:0046326)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|receptor activity (GO:0004872)			endometrium(1)|large_intestine(3)|lung(7)|stomach(1)	12	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			CCTTAAGGCCGCCACCATAGG	0.547																																					p.A306T		Atlas-SNP	.											ADIPOR2,colon,carcinoma,0,1	ADIPOR2	30	.	0			c.G916A						.						87.0	82.0	84.0					12																	1893123		2203	4300	6503	SO:0001583	missense	79602	exon7			AAGGCCGCCACCA	AY424280	CCDS8511.1	12p13	2012-08-22			ENSG00000006831	ENSG00000006831		"""GPCR / Unclassified : Adiponectin receptors"""	24041	protein-coding gene	gene with protein product		607946				12802337	Standard	NM_024551		Approved	PAQR2, ACDCR2	uc001qjm.3	Q86V24	OTTHUMG00000130139	ENST00000357103.4:c.916G>A	chr12.hg19:g.1893123G>A	ENSP00000349616:p.Ala306Thr	147.0	0.0		110.0	67.0	NM_024551	Q53YY5|Q9H737	Missense_Mutation	SNP	ENST00000357103.4	hg19	CCDS8511.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983434	0.35036	.	.	ENSG00000006831	ENST00000357103	T	0.31510	1.49	5.67	5.67	0.87782	.	0.046236	0.85682	D	0.000000	T	0.17365	0.0417	N	0.03608	-0.345	0.58432	D	0.99999	B	0.16396	0.017	B	0.14023	0.01	T	0.11446	-1.0587	10	0.21540	T	0.41	-10.6523	19.7848	0.96432	0.0:0.0:1.0:0.0	.	306	Q86V24	ADR2_HUMAN	T	306	ENSP00000349616:A306T	ENSP00000349616:A306T	A	+	1	0	ADIPOR2	1763384	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	6.556000	0.73932	2.673000	0.90976	0.655000	0.94253	GCC	.	.		0.547	ADIPOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252447.2	NM_024551	
ATF7	11016	hgsc.bcm.edu	37	12	53928285	53928285	+	Splice_Site	SNP	C	C	G			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr12:53928285C>G	ENST00000548446.2	-	6	706		c.e6+1		ATF7_ENST00000420353.2_Splice_Site|ATF7_ENST00000456903.4_Splice_Site|ATF7_ENST00000328463.7_Splice_Site|RP11-793H13.10_ENST00000591834.1_Splice_Site|ATF7_ENST00000415113.1_Splice_Site			P17544	ATF7_HUMAN	activating transcription factor 7						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	TCTGTACTTACCCCATTTGCC	0.478																																					.		Atlas-SNP	.											.	ATF7	51	.	0			c.560+1G>C						.						201.0	195.0	197.0					12																	53928285		1968	4161	6129	SO:0001630	splice_region_variant	11016	exon7			TACTTACCCCATT	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.593+1G>C	chr12.hg19:g.53928285C>G		106.0	0.0		111.0	6.0	NM_006856	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Splice_Site	SNP	ENST00000548446.2	hg19		.	.	.	.	.	.	.	.	.	.	C	22.3	4.274719	0.80580	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000415113;ENST00000420353;ENST00000456903	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9044	0.79412	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATF7	52214552	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.187000	0.77730	2.350000	0.79820	0.561000	0.74099	.	.	.		0.478	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	Intron
SLITRK5	26050	hgsc.bcm.edu	37	13	88329198	88329198	+	Missense_Mutation	SNP	G	G	A	rs372673658		TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr13:88329198G>A	ENST00000325089.6	+	2	1774	c.1555G>A	c.(1555-1557)Gcc>Acc	p.A519T	SLITRK5_ENST00000400028.3_Missense_Mutation_p.A278T	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	519					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CCTCCTGCAGGCCATGCCCTC	0.527																																					p.A519T		Atlas-SNP	.											.	SLITRK5	192	.	0			c.G1555A						.	G	THR/ALA	0,4406		0,0,2203	67.0	70.0	69.0		1555	0.9	1.0	13		69	1,8599		0,1,4299	no	missense	SLITRK5	NM_015567.1	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	519/959	88329198	1,13005	2203	4300	6503	SO:0001583	missense	26050	exon2			CTGCAGGCCATGC	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1555G>A	chr13.hg19:g.88329198G>A	ENSP00000366283:p.Ala519Thr	89.0	0.0		48.0	33.0	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	hg19	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	2.279	-0.365156	0.05103	0.0	1.16E-4	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.56776	0.44;0.44	5.23	0.903	0.19296	.	0.587641	0.17737	N	0.163719	T	0.23611	0.0571	N	0.05574	-0.02	0.29587	N	0.848702	B;B	0.02656	0.0;0.0	B;B	0.15052	0.012;0.006	T	0.10567	-1.0624	9	.	.	.	-5.743	2.4147	0.04433	0.2036:0.1425:0.5095:0.1445	.	278;519	B4DSH5;O94991	.;SLIK5_HUMAN	T	519;278	ENSP00000366283:A519T;ENSP00000442244:A278T	.	A	+	1	0	SLITRK5	87127199	0.977000	0.34250	0.999000	0.59377	0.998000	0.95712	0.237000	0.17985	0.109000	0.17891	0.561000	0.74099	GCC	.	.		0.527	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
METTL17	64745	hgsc.bcm.edu	37	14	21464877	21464877	+	Intron	SNP	G	G	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr14:21464877G>T	ENST00000339374.6	+	13	1498				METTL17_ENST00000556670.2_Intron|RP11-84C10.4_ENST00000557335.1_RNA|SLC39A2_ENST00000298681.4_5'Flank|METTL17_ENST00000382985.4_Silent_p.G424G|SLC39A2_ENST00000554422.1_5'Flank	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17						translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						GCAGGTATGGGGGGTGTGACC	0.587																																					p.G424G		Atlas-SNP	.											.	METTL17	46	.	0			c.G1272T						.						93.0	93.0	93.0					14																	21464877		2203	4300	6503	SO:0001627	intron_variant	64745	exon13			GTATGGGGGGTGT	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.1265+7G>T	chr14.hg19:g.21464877G>T		65.0	0.0		48.0	13.0	NM_001029991	Q9BSH1|Q9BZH2|Q9BZH3	Silent	SNP	ENST00000339374.6	hg19	CCDS9562.1																																																																																			.	.		0.587	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734	
SPPL2A	84888	hgsc.bcm.edu	37	15	51039809	51039809	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr15:51039809A>C	ENST00000261854.5	-	5	741	c.467T>G	c.(466-468)aTt>aGt	p.I156S	RP11-507J18.2_ENST00000558317.1_RNA	NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	156					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TTTCACAGTAATGTTATCTCC	0.363																																					p.I156S	Melanoma(50;790 1209 4069 22965 33125)	Atlas-SNP	.											.	SPPL2A	26	.	0			c.T467G						.						92.0	89.0	90.0					15																	51039809		2196	4293	6489	SO:0001583	missense	84888	exon5			ACAGTAATGTTAT		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.467T>G	chr15.hg19:g.51039809A>C	ENSP00000261854:p.Ile156Ser	207.0	0.0		162.0	94.0	NM_032802	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	ENST00000261854.5	hg19	CCDS10138.1	.	.	.	.	.	.	.	.	.	.	A	9.143	1.014404	0.19277	.	.	ENSG00000138600	ENST00000261854	T	0.07800	3.16	5.73	4.58	0.56647	.	0.097598	0.64402	D	0.000001	T	0.10680	0.0261	L	0.42245	1.32	0.09310	N	1	P	0.36599	0.56	B	0.39876	0.312	T	0.08700	-1.0709	10	0.87932	D	0	-10.3558	12.0718	0.53620	0.8709:0.0:0.0:0.1291	.	156	Q8TCT8	PSL2_HUMAN	S	156	ENSP00000261854:I156S	ENSP00000261854:I156S	I	-	2	0	AC012100.1	48827101	1.000000	0.71417	0.135000	0.22099	0.159000	0.22180	6.640000	0.74319	0.955000	0.37878	0.533000	0.62120	ATT	.	.		0.363	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	NM_032802	
IDH2	3418	hgsc.bcm.edu	37	15	90631838	90631838	+	Missense_Mutation	SNP	C	C	T	rs121913503		TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr15:90631838C>T	ENST00000330062.3	-	4	628	c.515G>A	c.(514-516)aGg>aAg	p.R172K	IDH2_ENST00000539790.1_Missense_Mutation_p.R42K|IDH2_ENST00000540499.2_Missense_Mutation_p.R120K|IDH2_ENST00000559482.1_Intron	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	172					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R172K(116)|p.R172M(21)|p.R172N(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			ATGGGCGTGCCTGCCAATGGT	0.632			M		GBM																																p.R172K		Atlas-SNP	.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	IDH2,NS,haematopoietic_neoplasm,0,179	IDH2	1372	.	138	Substitution - Missense(138)	haematopoietic_and_lymphoid_tissue(67)|central_nervous_system(65)|biliary_tract(6)	c.G515A						.						85.0	81.0	82.0					15																	90631838		2200	4298	6498	SO:0001583	missense	3418	exon4			GCGTGCCTGCCAA		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.515G>A	chr15.hg19:g.90631838C>T	ENSP00000331897:p.Arg172Lys	151.0	0.0		100.0	49.0	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	hg19	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957149	0.53293	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.86432	-2.12;-2.12;-2.12	5.93	4.07	0.47477	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95217	0.8449	H	0.96889	3.9	0.49687	D	0.999812	D	0.89917	1.0	D	0.91635	0.999	D	0.95096	0.8226	10	0.87932	D	0	.	10.781	0.46377	0.0:0.8464:0.0:0.1536	.	172	P48735	IDHP_HUMAN	K	172;42;120	ENSP00000331897:R172K;ENSP00000438457:R42K;ENSP00000446147:R120K	ENSP00000331897:R172K	R	-	2	0	IDH2	88432842	1.000000	0.71417	0.025000	0.17156	0.001000	0.01503	7.797000	0.85911	0.862000	0.35528	-0.258000	0.10820	AGG	.	.		0.632	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
XYLT1	64131	hgsc.bcm.edu	37	16	17353089	17353089	+	Silent	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr16:17353089G>A	ENST00000261381.6	-	3	753	c.669C>T	c.(667-669)gcC>gcT	p.A223A		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	223					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.A223A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGTTGGCTGCGGCTCTGTCCC	0.592																																					p.A223A		Atlas-SNP	.											XYLT1,NS,carcinoma,0,1	XYLT1	147	.	1	Substitution - coding silent(1)	lung(1)	c.C669T						.						106.0	117.0	113.0					16																	17353089		2197	4300	6497	SO:0001819	synonymous_variant	64131	exon3			GGCTGCGGCTCTG	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.669C>T	chr16.hg19:g.17353089G>A		148.0	0.0		153.0	69.0	NM_022166	Q9H1B6	Silent	SNP	ENST00000261381.6	hg19	CCDS10569.1																																																																																			.	.		0.592	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
TBC1D26	353149	hgsc.bcm.edu	37	17	15644532	15644532	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr17:15644532G>A	ENST00000437605.2	+	10	893	c.643G>A	c.(643-645)Gct>Act	p.A215T	AC005324.6_ENST00000580194.1_RNA|AC005324.6_ENST00000434017.1_RNA|AC005324.6_ENST00000433873.1_RNA|ZNF286A_ENST00000413242.2_3'UTR	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	215	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CCAGTTGCTCGCTGGTGAGAG	0.647																																					p.A215T		Atlas-SNP	.											.	TBC1D26	16	.	0			c.G643A						.						88.0	93.0	91.0					17																	15644532		2175	4275	6450	SO:0001583	missense	353149	exon10			TTGCTCGCTGGTG		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.643G>A	chr17.hg19:g.15644532G>A	ENSP00000410111:p.Ala215Thr	37.0	0.0		22.0	14.0	NM_178571	A8K929|Q4G172	Missense_Mutation	SNP	ENST00000437605.2	hg19	CCDS42265.1																																																																																			.	.		0.647	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178571	
RCN3	57333	hgsc.bcm.edu	37	19	50031779	50031779	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr19:50031779G>A	ENST00000270645.3	+	2	497	c.50G>A	c.(49-51)gGg>gAg	p.G17E		NM_020650.2	NP_065701.2	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	17						endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		CTGAGGCACGGGGCCCAGGGG	0.682																																					p.G17E		Atlas-SNP	.											.	RCN3	28	.	0			c.G50A						.						119.0	127.0	124.0					19																	50031779		2203	4300	6503	SO:0001583	missense	57333	exon2			GGCACGGGGCCCA	AY195859	CCDS12771.1	19q13.33	2013-01-10				ENSG00000142552		"""EF-hand domain containing"""	21145	protein-coding gene	gene with protein product							Standard	NM_020650		Approved	RLP49	uc002poj.3	Q96D15		ENST00000270645.3:c.50G>A	chr19.hg19:g.50031779G>A	ENSP00000270645:p.Gly17Glu	82.0	0.0		78.0	28.0	NM_020650	Q9HBZ8	Missense_Mutation	SNP	ENST00000270645.3	hg19	CCDS12771.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331666	0.24167	.	.	ENSG00000142552	ENST00000270645	T	0.09538	2.97	4.22	3.19	0.36642	.	0.185850	0.26421	N	0.024478	T	0.06280	0.0162	N	0.19112	0.55	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.27297	-1.0078	10	0.30854	T	0.27	-34.4868	7.5145	0.27593	0.0971:0.1729:0.73:0.0	.	17	Q96D15	RCN3_HUMAN	E	17	ENSP00000270645:G17E	ENSP00000270645:G17E	G	+	2	0	RCN3	54723591	0.260000	0.24053	0.890000	0.34922	0.361000	0.29550	1.160000	0.31761	2.389000	0.81357	0.456000	0.33151	GGG	.	.		0.682	RCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465261.1	NM_020650	
POLD1	5424	hgsc.bcm.edu	37	19	50917028	50917028	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr19:50917028G>T	ENST00000440232.2	+	19	2333	c.2280G>T	c.(2278-2280)atG>atT	p.M760I	POLD1_ENST00000595904.1_Missense_Mutation_p.M786I|POLD1_ENST00000599857.1_Missense_Mutation_p.M760I|CTD-2545M3.6_ENST00000599632.1_5'Flank	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	760					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		ACTCCGTCATGTGCCGATTCG	0.652								DNA polymerases (catalytic subunits)																													p.M760I		Atlas-SNP	.											.	POLD1	174	.	0			c.G2280T						.						86.0	72.0	77.0					19																	50917028		2203	4300	6503	SO:0001583	missense	5424	exon19			CGTCATGTGCCGA		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2280G>T	chr19.hg19:g.50917028G>T	ENSP00000406046:p.Met760Ile	51.0	0.0		56.0	7.0	NM_002691	Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	hg19	CCDS12795.1	.	.	.	.	.	.	.	.	.	.	G	31	5.058356	0.93846	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.21191	2.02	4.87	4.87	0.63330	DNA polymerase, palm domain (1);DNA-directed DNA polymerase, family B, conserved site (1);DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.68320	0.2988	H	0.99712	4.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.84442	0.0583	10	0.87932	D	0	-59.8404	17.161	0.86803	0.0:0.0:1.0:0.0	.	786;760	E7EVW0;P28340	.;DPOD1_HUMAN	I	760;761	ENSP00000406046:M760I	ENSP00000366129:M761I	M	+	3	0	POLD1	55608840	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	8.774000	0.91767	2.432000	0.82394	0.556000	0.70494	ATG	.	.		0.652	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1		
FPR1	2357	hgsc.bcm.edu	37	19	52249927	52249927	+	Silent	SNP	G	G	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr19:52249927G>T	ENST00000595042.1	-	3	462	c.321C>A	c.(319-321)atC>atA	p.I107I	FPR1_ENST00000304748.4_Silent_p.I107I	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	107					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CGAACAAGTTGATGTCCACTA	0.542																																					p.I107I		Atlas-SNP	.											FPR1,NS,carcinoma,0,1	FPR1	64	.	0			c.C321A						.						130.0	99.0	110.0					19																	52249927		2203	4300	6503	SO:0001819	synonymous_variant	2357	exon3			CAAGTTGATGTCC	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.321C>A	chr19.hg19:g.52249927G>T		75.0	0.0		102.0	40.0	NM_001193306	Q14939|Q7Z6A4|Q86U52|Q9NS48	Silent	SNP	ENST00000595042.1	hg19	CCDS12839.1																																																																																			.	.		0.542	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
SSC5D	284297	hgsc.bcm.edu	37	19	56011599	56011599	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr19:56011599C>T	ENST00000389623.6	+	10	2145	c.2122C>T	c.(2122-2124)Cgg>Tgg	p.R708W	SSC5D_ENST00000587166.1_Missense_Mutation_p.R708W	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	708	Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CCCCCGAGAACGGACCACTAA	0.592																																					p.R708W		Atlas-SNP	.											SSC5D,NS,carcinoma,0,2	SSC5D	65	.	0			c.C2122T						.						25.0	28.0	27.0					19																	56011599		692	1591	2283	SO:0001583	missense	284297	exon10			CGAGAACGGACCA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2122C>T	chr19.hg19:g.56011599C>T	ENSP00000374274:p.Arg708Trp	36.0	0.0		36.0	10.0	NM_001195267	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	hg19	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	C	8.313	0.822627	0.16678	.	.	ENSG00000179954	ENST00000389623;ENST00000541230	T	0.01203	5.18	3.83	-3.54	0.04653	.	.	.	.	.	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.06405	0.002	T	0.47947	-0.9077	9	0.59425	D	0.04	.	0.7399	0.00972	0.1729:0.2401:0.1708:0.4162	.	708	A1L4H1	SRCRL_HUMAN	W	708	ENSP00000374274:R708W	ENSP00000374274:R708W	R	+	1	2	SSC5D	60703411	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.624000	0.05540	-0.609000	0.05724	0.549000	0.68633	CGG	.	.		0.592	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ADRM1	11047	hgsc.bcm.edu	37	20	60882773	60882773	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr20:60882773G>C	ENST00000253003.2	+	7	791	c.745G>C	c.(745-747)Ggg>Cgg	p.G249R	RP11-157P1.4_ENST00000414042.1_RNA|LAMA5_ENST00000492698.1_5'Flank	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	249	Ser-rich.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			GCCCAGTTCCGGGAATGGAGC	0.682																																					p.G249R		Atlas-SNP	.											.	ADRM1	28	.	0			c.G745C						.						24.0	28.0	27.0					20																	60882773		2191	4294	6485	SO:0001583	missense	11047	exon7			AGTTCCGGGAATG	D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.745G>C	chr20.hg19:g.60882773G>C	ENSP00000253003:p.Gly249Arg	51.0	0.0		69.0	27.0	NM_175573	A0PKB1|Q96FJ7|Q9H1P2	Missense_Mutation	SNP	ENST00000253003.2	hg19	CCDS13496.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925897	0.52759	.	.	ENSG00000130706	ENST00000370744;ENST00000253003	.	.	.	5.14	5.14	0.70334	.	0.371360	0.32836	N	0.005582	T	0.67813	0.2933	L	0.43152	1.355	0.58432	D	0.999999	D	0.67145	0.996	D	0.64776	0.929	T	0.68750	-0.5326	9	0.51188	T	0.08	-15.6201	16.3736	0.83374	0.0:0.0:1.0:0.0	.	249	Q16186	ADRM1_HUMAN	R	228;249	.	ENSP00000253003:G249R	G	+	1	0	ADRM1	60316168	1.000000	0.71417	0.797000	0.32132	0.485000	0.33311	4.446000	0.60014	2.391000	0.81399	0.561000	0.74099	GGG	.	.		0.682	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080007.1		
ITGB2	3689	hgsc.bcm.edu	37	21	46309959	46309959	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr21:46309959C>T	ENST00000397850.2	-	13	2043	c.1591G>A	c.(1591-1593)Ggg>Agg	p.G531R	ITGB2_ENST00000355153.4_Missense_Mutation_p.G531R|ITGB2_ENST00000397852.1_Missense_Mutation_p.G531R|ITGB2_ENST00000397854.3_Missense_Mutation_p.G474R|ITGB2_ENST00000397857.1_Missense_Mutation_p.G531R|ITGB2_ENST00000302347.5_Missense_Mutation_p.G531R			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	531	Cysteine-rich tandem repeats.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	CAGTACTGCCCGTATATCAGC	0.647																																					p.G531R		Atlas-SNP	.											.	ITGB2	107	.	0			c.G1591A						.						98.0	81.0	87.0					21																	46309959		2202	4300	6502	SO:0001583	missense	3689	exon12			ACTGCCCGTATAT	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1591G>A	chr21.hg19:g.46309959C>T	ENSP00000380948:p.Gly531Arg	99.0	0.0		82.0	38.0	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	hg19	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424904	0.62733	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.98732	-5.1;-5.1;-5.1;-5.1;-5.1;-5.1	4.77	4.77	0.60923	.	.	.	.	.	D	0.99498	0.9821	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.97903	1.0304	9	0.87932	D	0	.	15.3224	0.74132	0.0:1.0:0.0:0.0	.	474;531	A8MYE6;P05107	.;ITB2_HUMAN	R	531;531;474;531;531;531	ENSP00000380950:G531R;ENSP00000380955:G531R;ENSP00000380952:G474R;ENSP00000347279:G531R;ENSP00000380948:G531R;ENSP00000303242:G531R	ENSP00000303242:G531R	G	-	1	0	ITGB2	45134387	1.000000	0.71417	0.728000	0.30774	0.021000	0.10359	7.135000	0.77276	2.470000	0.83445	0.655000	0.94253	GGG	.	.		0.647	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
PMM1	5372	hgsc.bcm.edu	37	22	41980580	41980580	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr22:41980580G>A	ENST00000216259.7	-	3	317	c.233C>T	c.(232-234)gCc>gTc	p.A78V	PMM1_ENST00000466645.1_5'UTR	NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	78					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						CCCGTTCTCGGCAAACACATA	0.537																																					p.A78V		Atlas-SNP	.											.	PMM1	21	.	0			c.C233T						.						92.0	87.0	89.0					22																	41980580		2203	4300	6503	SO:0001583	missense	5372	exon3			TTCTCGGCAAACA		CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.233C>T	chr22.hg19:g.41980580G>A	ENSP00000216259:p.Ala78Val	58.0	0.0		35.0	4.0	NM_002676	A8K003|Q92586	Missense_Mutation	SNP	ENST00000216259.7	hg19	CCDS14020.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035684	0.75617	.	.	ENSG00000100417	ENST00000216259	D	0.98455	-4.94	4.76	4.76	0.60689	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	M	0.87827	2.91	0.80722	D	1	B	0.18863	0.031	B	0.15484	0.013	D	0.97398	0.9994	10	0.46703	T	0.11	-32.235	17.7702	0.88489	0.0:0.0:1.0:0.0	.	78	Q92871	PMM1_HUMAN	V	78	ENSP00000216259:A78V	ENSP00000216259:A78V	A	-	2	0	PMM1	40310526	1.000000	0.71417	0.947000	0.38551	0.644000	0.38419	9.631000	0.98424	2.191000	0.70037	0.557000	0.71058	GCC	.	.		0.537	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320711.3	NM_002676	
MT-ND2	4536	hgsc.bcm.edu	37	M	4975	4975	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chrM:4975G>A	ENST00000361453.3	+	1	506	c.506G>A	c.(505-507)gGa>gAa	p.G169E	MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TD_ENST00000387419.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	169					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CAGTTGAGGTGGATTAAACCA	0.423																																					p.G169E		Atlas-SNP	.											.	.	.	.	0			c.G506A						.																																			SO:0001583	missense	0	exon1			GAGGTGGATTAAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.506G>A	chrM.hg19:g.4975G>A	ENSP00000355046:p.Gly169Glu	15.0	0.0		28.0	11.0	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.		0.423	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
MT-ND4	4538	hgsc.bcm.edu	37	M	10927	10927	+	Silent	SNP	T	T	C			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chrM:10927T>C	ENST00000361381.2	+	1	168	c.168T>C	c.(166-168)ttT>ttC	p.F56F	MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	56					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TCCCCAACCTTTTCCTCCGAC	0.453																																					p.F56F		Atlas-SNP	.											.	.	.	.	0			c.T168C						.																																			SO:0001819	synonymous_variant	0	exon1			AACCTTTTCCTCC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.168T>C	chrM.hg19:g.10927T>C		12.0	0.0		23.0	23.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Silent	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.453	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
KCNN3	3782	hgsc.bcm.edu	37	1	154842230	154842231	+	In_Frame_Ins	INS	-	-	CTGCTGCTGCTG			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr1:154842230_154842231insCTGCTGCTGCTG	ENST00000271915.4	-	1	525_526	c.210_211insCAGCAGCAGCAG	c.(208-213)cagcag>cagCAGCAGCAGCAGcag	p.70_71QQ>QQQQQQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	70	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	tgctgctgctgctgctgctgct	0.698																																					p.Q71delinsQQQQQ		Atlas-INDEL	.											.	KCNN3	141	.	0			c.211_212insCAGCAGCAGCAG						.																																			SO:0001652	inframe_insertion	3782	exon1			.	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.199_210dupCAGCAGCAGCAG	chr1.hg19:g.154842230_154842231insCTGCTGCTGCTG	ENSP00000271915:p.Gln78_Gln79dup	78.0	0.0		66.0	18.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
CD81	975	hgsc.bcm.edu	37	11	2416714	2416715	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr11:2416714_2416715insAA	ENST00000263645.5	+	5	679_680	c.423_424insAA	c.(424-426)aacfs	p.N142fs	CD81_ENST00000492627.1_Frame_Shift_Ins_p.N71fs|CD81_ENST00000481687.1_Frame_Shift_Ins_p.N148fs|CD81_ENST00000524805.1_3'UTR|CD81_ENST00000381036.3_Frame_Shift_Ins_p.N180fs|CD81_ENST00000526072.1_Frame_Shift_Ins_p.N71fs	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	142					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		ATGACGCCAACAACGCCAAGGC	0.678																																					p.N141fs		Atlas-Indel,Pindel	.											.	CD81	11	.	0			c.423_424insAA						.																																			SO:0001589	frameshift_variant	975	exon5			.		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.424_425dupAA	chr11.hg19:g.2416715_2416716dupAA	ENSP00000263645:p.Asn142fs	82.0	0.0		57.0	30.0	NM_004356	P18582|Q5U0J6	Frame_Shift_Ins	INS	ENST00000263645.5	hg19	CCDS7734.1																																																																																			.	.		0.678	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027357.4	NM_004356	
MED29	55588	hgsc.bcm.edu	37	19	39883132	39883133	+	Frame_Shift_Ins	INS	-	-	GATTCAGAAC			TCGA-ED-A82E-01A-11D-A34Z-10	TCGA-ED-A82E-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	64aa69e5-4ab1-45b5-aca6-c2584ac511a3	6a4d2501-89d2-42d5-9182-f5eb7a368506	g.chr19:39883132_39883133insGATTCAGAAC	ENST00000599213.2	+	2	272_273	c.245_246insGATTCAGAAC	c.(244-249)ttgattfs	p.-83fs	PAF1_ENST00000595564.1_5'Flank|MED29_ENST00000594368.1_Frame_Shift_Ins_p.-83fs|PAF1_ENST00000221265.3_5'Flank|PAF1_ENST00000221266.7_5'Flank|MED29_ENST00000315588.5_Frame_Shift_Ins_p.-104fs			Q9NX70	MED29_HUMAN	mediator complex subunit 29						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)				lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GCCCAAAACTTGATTCAGAACA	0.426																																					p.L103fs		Pindel	.											.	MED29	13	.	0			c.308_309insGATTCAGAAC						.																																			SO:0001589	frameshift_variant	55588	exon2			.	AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70		ENST00000599213.2:c.246_255dupGATTCAGAAC	chr19.hg19:g.39883133_39883142dupGATTCAGAAC	ENSP00000471802:p.Ile83fs	86.0	0.0		52.0	13.0	NM_017592	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Frame_Shift_Ins	INS	ENST00000599213.2	hg19																																																																																				.	.		0.426	MED29-011	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470870.1	XM_290829	
