#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DIRAS3	9077	hgsc.bcm.edu	37	1	68512917	68512917	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr1:68512917C>T	ENST00000370981.1	-	4	700	c.64G>A	c.(64-66)Gcc>Acc	p.A22T	GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000413628.1_RNA|DIRAS3_ENST00000395201.1_Missense_Mutation_p.A22T			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	22					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ATAAGCAGGGCGGGCAGAAGC	0.587																																					p.A22T		Atlas-SNP	.											.	DIRAS3	31	.	0			c.G64A						.						28.0	33.0	31.0					1																	68512917		2199	4292	6491	SO:0001583	missense	9077	exon2			GCAGGGCGGGCAG	U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.64G>A	chr1.hg19:g.68512917C>T	ENSP00000360020:p.Ala22Thr	62.0	0.0		139.0	11.0	NM_004675	B3KMP3	Missense_Mutation	SNP	ENST00000370981.1	hg19	CCDS641.1	.	.	.	.	.	.	.	.	.	.	C	3.511	-0.099836	0.07010	.	.	ENSG00000162595	ENST00000370981;ENST00000395201	T;T	0.72725	-0.68;-0.68	4.15	-3.65	0.04502	.	.	.	.	.	T	0.15522	0.0374	N	0.12182	0.205	0.09310	N	1	B	0.17268	0.021	B	0.08055	0.003	T	0.14364	-1.0475	9	0.06365	T	0.9	.	1.4828	0.02441	0.1424:0.3543:0.1663:0.337	.	22	O95661	DIRA3_HUMAN	T	22	ENSP00000360020:A22T;ENSP00000378627:A22T	ENSP00000360020:A22T	A	-	1	0	DIRAS3	68285505	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.624000	0.00876	-0.273000	0.09246	0.467000	0.42956	GCC	.	.		0.587	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026354.2	NM_004675	
LCE3D	84648	hgsc.bcm.edu	37	1	152552238	152552238	+	Missense_Mutation	SNP	G	G	A	rs199832759		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr1:152552238G>A	ENST00000368787.3	-	2	231	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	59					keratinization (GO:0031424)					breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		CGGTGGTGGCGCCTGTGGTGG	0.687																																					p.R59C		Atlas-SNP	.											.	LCE3D	28	.	0			c.C175T						.						44.0	54.0	51.0					1																	152552238		2203	4300	6503	SO:0001583	missense	84648	exon2			GGTGGCGCCTGTG	BI670519	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202		"""Late cornified envelopes"""	16615	protein-coding gene	gene with protein product		612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A		11698679	Standard	NM_032563		Approved	LEP16	uc001fab.3	Q9BYE3	OTTHUMG00000012384	ENST00000368787.3:c.175C>T	chr1.hg19:g.152552238G>A	ENSP00000357776:p.Arg59Cys	159.0	0.0		248.0	63.0	NM_032563	Q3MIL1	Missense_Mutation	SNP	ENST00000368787.3	hg19	CCDS1014.1	.	.	.	.	.	.	.	.	.	.	G	6.013	0.370885	0.11409	.	.	ENSG00000163202	ENST00000368787	T	0.05447	3.44	3.8	2.88	0.33553	.	.	.	.	.	T	0.01905	0.0060	.	.	.	0.29920	N	0.822835	B	0.13145	0.007	B	0.08055	0.003	T	0.40021	-0.9585	8	0.87932	D	0	.	7.2783	0.26297	0.1248:0.0:0.8752:0.0	.	59	Q9BYE3	LCE3D_HUMAN	C	59	ENSP00000357776:R59C	ENSP00000357776:R59C	R	-	1	0	LCE3D	150818862	0.018000	0.18449	0.789000	0.31954	0.326000	0.28443	0.335000	0.19806	0.932000	0.37266	0.655000	0.94253	CGC	.	G|0.999;A|0.001		0.687	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1	NM_032563	
PMVK	10654	hgsc.bcm.edu	37	1	154898884	154898884	+	Missense_Mutation	SNP	G	G	A	rs150445298	byFrequency	TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr1:154898884G>A	ENST00000368467.3	-	4	693	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C		NM_006556.3	NP_006547.1	Q15126	PMVK_HUMAN	phosphomevalonate kinase	130					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|response to cholesterol (GO:0070723)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|phosphomevalonate kinase activity (GO:0004631)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCTACAACGCGGACCGTCTGC	0.622													G|||	35	0.00698882	0.0	0.0	5008	,	,		21146	0.0		0.0	False		,,,				2504	0.0358				p.R130C		Atlas-SNP	.											PMVK,NS,carcinoma,0,1	PMVK	17	.	0			c.C388T						.	G	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	81.0	62.0	68.0		388	4.6	0.9	1	dbSNP_134	68	0,8600		0,0,4300	no	missense	PMVK	NM_006556.3	180	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	130/193	154898884	2,13004	2203	4300	6503	SO:0001583	missense	10654	exon4			CAACGCGGACCGT	L77213	CCDS1073.1	1q21.3	2012-09-20			ENSG00000163344	ENSG00000163344	2.7.4.2		9141	protein-coding gene	gene with protein product		607622				8663599, 10191291	Standard	NM_006556		Approved	PMK, PMKA, HUMPMKI	uc001ffq.3	Q15126	OTTHUMG00000037415	ENST00000368467.3:c.388C>T	chr1.hg19:g.154898884G>A	ENSP00000357452:p.Arg130Cys	52.0	1.0		70.0	22.0	NM_006556	Q5TZW9	Missense_Mutation	SNP	ENST00000368467.3	hg19	CCDS1073.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117110	0.56505	4.54E-4	0.0	ENSG00000163344	ENST00000368467	T	0.41400	1.0	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72276	-0.4341	10	0.87932	D	0	-9.823	13.2686	0.60148	0.0:0.0:1.0:0.0	.	130	Q15126	PMVK_HUMAN	C	130	ENSP00000357452:R130C	ENSP00000357452:R130C	R	-	1	0	PMVK	153165508	1.000000	0.71417	0.892000	0.35008	0.053000	0.15095	4.037000	0.57311	2.266000	0.75297	0.561000	0.74099	CGC	.	G|1.000;A|0.000		0.622	PMVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091088.1	NM_006556	
BRINP2	57795	hgsc.bcm.edu	37	1	177250365	177250365	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr1:177250365G>T	ENST00000361539.4	+	8	2365	c.2053G>T	c.(2053-2055)Gtc>Ttc	p.V685F	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	685					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CACCTTGCAGGTCTTTGGCTA	0.478																																					p.V685F		Atlas-SNP	.											FAM5B,NS,carcinoma,0,1	FAM5B	191	.	0			c.G2053T						.						96.0	96.0	96.0					1																	177250365		2203	4300	6503	SO:0001583	missense	57795	exon8			TTGCAGGTCTTTG		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.2053G>T	chr1.hg19:g.177250365G>T	ENSP00000354481:p.Val685Phe	94.0	1.0		56.0	19.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	hg19	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088059	0.76642	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.20463	2.07	5.15	5.15	0.70609	.	0.062567	0.64402	D	0.000006	T	0.47266	0.1436	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.91635	0.999;0.879	T	0.48433	-0.9036	10	0.87932	D	0	-29.1056	18.2044	0.89850	0.0:0.0:1.0:0.0	.	580;685	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	F	438;685	ENSP00000354481:V685F	ENSP00000354481:V685F	V	+	1	0	FAM5B	175516988	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.393000	0.73217	2.386000	0.81285	0.305000	0.20034	GTC	.	.		0.478	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
TRAF3IP3	80342	hgsc.bcm.edu	37	1	209953899	209953899	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr1:209953899T>G	ENST00000367024.1	+	15	1913	c.1397T>G	c.(1396-1398)cTc>cGc	p.L466R	TRAF3IP3_ENST00000477431.1_Intron|TRAF3IP3_ENST00000010338.4_Missense_Mutation_p.L446R|TRAF3IP3_ENST00000367025.3_Missense_Mutation_p.L466R|TRAF3IP3_ENST00000367026.3_Missense_Mutation_p.L446R			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	466						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		GACTGGGATCTCAGAGACCAG	0.517																																					p.L466R		Atlas-SNP	.											.	TRAF3IP3	68	.	0			c.T1397G						.						92.0	92.0	92.0					1																	209953899		2203	4300	6503	SO:0001583	missense	80342	exon15			GGGATCTCAGAGA		CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.1397T>G	chr1.hg19:g.209953899T>G	ENSP00000355991:p.Leu466Arg	105.0	0.0		164.0	17.0	NM_025228	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	ENST00000367024.1	hg19	CCDS1490.2	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962599	0.53400	.	.	ENSG00000009790	ENST00000367025;ENST00000367026;ENST00000367024;ENST00000010338	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	5.24	4.11	0.48088	.	0.247494	0.28754	N	0.014253	T	0.78310	0.4263	L	0.34521	1.04	0.40786	D	0.983217	P;P	0.44429	0.835;0.835	P;P	0.46917	0.531;0.531	T	0.78409	-0.2215	10	0.87932	D	0	-0.0283	8.9403	0.35725	0.0:0.0841:0.0:0.9159	.	466;446	Q9Y228;Q9Y228-2	T3JAM_HUMAN;.	R	466;446;466;446	ENSP00000355992:L466R;ENSP00000355993:L446R;ENSP00000355991:L466R;ENSP00000010338:L446R	ENSP00000010338:L446R	L	+	2	0	TRAF3IP3	208020522	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.021000	0.49651	0.826000	0.34661	0.533000	0.62120	CTC	.	.		0.517	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088734.2		
NRXN1	9378	hgsc.bcm.edu	37	2	51254752	51254752	+	Silent	SNP	G	G	A	rs546508545		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:51254752G>A	ENST00000406316.2	-	2	2136	c.660C>T	c.(658-660)ggC>ggT	p.G220G	NRXN1_ENST00000404971.1_Silent_p.G220G|NRXN1_ENST00000405581.1_Silent_p.G220G|NRXN1_ENST00000406859.3_Silent_p.G220G|NRXN1_ENST00000401669.2_Silent_p.G220G|NRXN1_ENST00000402717.3_Silent_p.G220G|NRXN1_ENST00000405472.3_Silent_p.G220G	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	220	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CGCCCTCCTCGCCCGCCTCGC	0.711																																					p.G220G		Atlas-SNP	.											NRXN1_ENST00000536085,colon,carcinoma,0,3	NRXN1	1118	.	0			c.C660T						.						11.0	16.0	14.0					2																	51254752		2079	4162	6241	SO:0001819	synonymous_variant	9378	exon2			CTCCTCGCCCGCC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.660C>T	chr2.hg19:g.51254752G>A		118.0	0.0		136.0	23.0	NM_004801	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	hg19	CCDS54360.1																																																																																			.	.		0.711	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
DNAH6	1768	hgsc.bcm.edu	37	2	84861695	84861695	+	Missense_Mutation	SNP	G	G	T	rs267599477		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:84861695G>T	ENST00000237449.6	+	29	4591	c.4583G>T	c.(4582-4584)cGa>cTa	p.R1528L	DNAH6_ENST00000398278.2_Missense_Mutation_p.R1528L|DNAH6_ENST00000389394.3_Missense_Mutation_p.R1528L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1528	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GAATTTAATCGAATTGACATA	0.463																																					p.R1528L		Atlas-SNP	.											.	DNAH6	194	.	0			c.G4583T						.						97.0	82.0	86.0					2																	84861695		692	1591	2283	SO:0001583	missense	1768	exon30			TTAATCGAATTGA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.4583G>T	chr2.hg19:g.84861695G>T	ENSP00000237449:p.Arg1528Leu	92.0	0.0		100.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	35	5.471545	0.96274	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.14640	2.49;2.49;2.49	5.78	5.78	0.91487	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.51907	0.1702	H	0.94385	3.53	0.49687	D	0.999819	D	0.89917	1.0	D	0.97110	1.0	T	0.64719	-0.6341	9	0.87932	D	0	.	18.7696	0.91885	0.0:0.0:1.0:0.0	.	1528	Q9C0G6	DYH6_HUMAN	L	1528	ENSP00000374045:R1528L;ENSP00000381326:R1528L;ENSP00000237449:R1528L	ENSP00000237449:R1528L	R	+	2	0	DNAH6	84715206	1.000000	0.71417	0.933000	0.37362	0.937000	0.57800	7.784000	0.85713	2.733000	0.93635	0.561000	0.74099	CGA	.	.		0.463	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
INSIG2	51141	hgsc.bcm.edu	37	2	118865873	118865873	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:118865873T>A	ENST00000245787.4	+	6	859	c.653T>A	c.(652-654)aTc>aAc	p.I218N	INSIG2_ENST00000485520.1_3'UTR	NM_016133.2	NP_057217.2	Q9Y5U4	INSI2_HUMAN	insulin induced gene 2	218					cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						TGTAAAGTTATCGCAGAAAAA	0.299																																					p.I218N		Atlas-SNP	.											.	INSIG2	30	.	0			c.T653A						.						80.0	84.0	83.0					2																	118865873		2203	4300	6503	SO:0001583	missense	51141	exon6			AAGTTATCGCAGA	AF527632	CCDS2122.1	2q14.1	2008-02-05			ENSG00000125629	ENSG00000125629			20452	protein-coding gene	gene with protein product		608660				12242332	Standard	NM_016133		Approved		uc002tlk.3	Q9Y5U4	OTTHUMG00000058518	ENST00000245787.4:c.653T>A	chr2.hg19:g.118865873T>A	ENSP00000245787:p.Ile218Asn	401.0	0.0		571.0	91.0	NM_016133	A8K5W8|Q8TBI8	Missense_Mutation	SNP	ENST00000245787.4	hg19	CCDS2122.1	.	.	.	.	.	.	.	.	.	.	T	10.64	1.406081	0.25378	.	.	ENSG00000125629	ENST00000245787	.	.	.	5.18	2.78	0.32641	.	0.509373	0.21668	N	0.070914	T	0.30386	0.0763	N	0.19112	0.55	0.31013	N	0.71898	B	0.14438	0.01	B	0.09377	0.004	T	0.27606	-1.0069	9	0.54805	T	0.06	.	8.9186	0.35596	0.0:0.2217:0.0:0.7783	.	218	Q9Y5U4	INSI2_HUMAN	N	218	.	ENSP00000245787:I218N	I	+	2	0	INSIG2	118582343	0.911000	0.30947	0.878000	0.34440	0.975000	0.68041	1.421000	0.34815	0.990000	0.38787	0.533000	0.62120	ATC	.	.		0.299	INSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129624.1	NM_016133	
PTPN4	5775	hgsc.bcm.edu	37	2	120712792	120712792	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:120712792G>T	ENST00000263708.2	+	20	2644	c.1873G>T	c.(1873-1875)Gag>Tag	p.E625*	PTPN4_ENST00000544261.1_Nonsense_Mutation_p.E258*	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	625					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GTATATTCCTGAGAAAGCCCC	0.428																																					p.E625X		Atlas-SNP	.											.	PTPN4	89	.	0			c.G1873T						.						76.0	77.0	76.0					2																	120712792		2203	4300	6503	SO:0001587	stop_gained	5775	exon20			ATTCCTGAGAAAG		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1873G>T	chr2.hg19:g.120712792G>T	ENSP00000263708:p.Glu625*	45.0	0.0		68.0	15.0	NM_002830	B2RBV8|Q9UDA7	Nonsense_Mutation	SNP	ENST00000263708.2	hg19	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	G	37	6.525630	0.97637	.	.	ENSG00000088179	ENST00000263708;ENST00000544261	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.6657	0.95891	0.0:0.0:1.0:0.0	.	.	.	.	X	625;258	.	ENSP00000263708:E625X	E	+	1	0	PTPN4	120429262	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.756000	0.98918	2.642000	0.89623	0.555000	0.69702	GAG	.	.		0.428	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
NCKAP5	344148	hgsc.bcm.edu	37	2	133541516	133541516	+	Silent	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:133541516G>A	ENST00000409261.1	-	14	3241	c.2868C>T	c.(2866-2868)tcC>tcT	p.S956S	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Silent_p.S956S|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	956										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CCCTGGTTTCGGACTTGGTGG	0.572																																					p.S956S		Atlas-SNP	.											.	NCKAP5	322	.	0			c.C2868T						.						19.0	20.0	20.0					2																	133541516		1897	4071	5968	SO:0001819	synonymous_variant	344148	exon14			GGTTTCGGACTTG	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2868C>T	chr2.hg19:g.133541516G>A		127.0	0.0		128.0	23.0	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	ENST00000409261.1	hg19	CCDS46418.1																																																																																			.	.		0.572	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
CPS1	1373	hgsc.bcm.edu	37	2	211473186	211473186	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:211473186G>A	ENST00000233072.5	+	19	2490	c.2294G>A	c.(2293-2295)aGc>aAc	p.S765N	CPS1_ENST00000430249.2_Missense_Mutation_p.S771N|CPS1_ENST00000451903.2_Missense_Mutation_p.S314N	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	765					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTTGAACCTAGCCTGGATTAC	0.468																																					p.S771N		Atlas-SNP	.											.	CPS1	485	.	0			c.G2312A						.						142.0	134.0	137.0					2																	211473186		2203	4300	6503	SO:0001583	missense	1373	exon20			AACCTAGCCTGGA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2294G>A	chr2.hg19:g.211473186G>A	ENSP00000233072:p.Ser765Asn	104.0	0.0		163.0	39.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	hg19	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361828	0.82353	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.92397	-3.03;-3.03;-3.03	6.16	6.16	0.99307	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.94062	0.8097	M	0.90483	3.12	0.80722	D	1	B;B	0.24092	0.097;0.097	B;B	0.18871	0.023;0.023	D	0.91010	0.4849	10	0.87932	D	0	-9.1252	20.8598	0.99761	0.0:0.0:1.0:0.0	.	775;765	Q59HF8;P31327	.;CPSM_HUMAN	N	771;773;765;314	ENSP00000402608:S771N;ENSP00000233072:S765N;ENSP00000406136:S314N	ENSP00000233072:S765N	S	+	2	0	CPS1	211181431	1.000000	0.71417	0.939000	0.37840	0.966000	0.64601	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	AGC	.	.		0.468	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
UGT1A1	54658	hgsc.bcm.edu	37	2	234526724	234526724	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr2:234526724G>T	ENST00000373450.4	+	1	434	c.371G>T	c.(370-372)tGc>tTc	p.C124F		NM_019076.4	NP_061949.3	P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	127					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	TTTTCGCATTGCAGGAGTTTG	0.353																																					p.C124F		Atlas-SNP	.											.	UGT1A8	69	.	0			c.G371T						.						119.0	127.0	124.0					2																	234526724		2203	4300	6503	SO:0001583	missense	54576	exon1			CGCATTGCAGGAG	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000373450.4:c.371G>T	chr2.hg19:g.234526724G>T	ENSP00000362549:p.Cys124Phe	123.0	0.0		161.0	28.0	NM_019076	A6NJC3|B8K286	Missense_Mutation	SNP	ENST00000373450.4	hg19	CCDS33402.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.721590	0.30503	.	.	ENSG00000242366	ENST00000373450	T	0.79247	-1.25	3.78	3.78	0.43462	.	.	.	.	.	D	0.89227	0.6655	M	0.90019	3.08	0.42975	D	0.994448	D;D	0.61697	0.99;0.99	D;D	0.66602	0.945;0.945	D	0.92302	0.5850	9	0.87932	D	0	.	16.2097	0.82148	0.0:0.0:1.0:0.0	.	124;124	Q5DSZ6;Q9HAW9	.;UD18_HUMAN	F	124	ENSP00000362549:C124F	ENSP00000362549:C124F	C	+	2	0	UGT1A8	234191463	1.000000	0.71417	0.131000	0.22000	0.252000	0.25951	6.854000	0.75440	2.122000	0.65172	0.505000	0.49811	TGC	.	.		0.353	UGT1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130994.1		
CACNA1D	776	hgsc.bcm.edu	37	3	53804516	53804516	+	Silent	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr3:53804516G>A	ENST00000350061.5	+	32	4492	c.3981G>A	c.(3979-3981)gtG>gtA	p.V1327V	CACNA1D_ENST00000288139.4_Silent_p.V1347V|CACNA1D_ENST00000540742.1_Silent_p.V219V|CACNA1D_ENST00000422281.2_Silent_p.V1312V	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1327					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCGATTGGTGAAGCTTCTCA	0.468																																					p.V1347V		Atlas-SNP	.											.	CACNA1D	324	.	0			c.G4041A						.						103.0	104.0	104.0					3																	53804516		2203	4300	6503	SO:0001819	synonymous_variant	776	exon33			ATTGGTGAAGCTT	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.3981G>A	chr3.hg19:g.53804516G>A		67.0	0.0		74.0	27.0	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	ENST00000350061.5	hg19	CCDS46848.1																																																																																			.	.		0.468	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
FOXP1	27086	hgsc.bcm.edu	37	3	71064720	71064720	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr3:71064720T>A	ENST00000318789.4	-	12	1479	c.954A>T	c.(952-954)gaA>gaT	p.E318D	FOXP1_ENST00000498215.1_Missense_Mutation_p.E318D|FOXP1_ENST00000484350.1_Missense_Mutation_p.E242D|FOXP1_ENST00000493089.1_Missense_Mutation_p.E318D|FOXP1_ENST00000475937.1_Missense_Mutation_p.E318D|FOXP1_ENST00000468577.1_Missense_Mutation_p.E318D|FOXP1_ENST00000491238.1_Missense_Mutation_p.E320D	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	318					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		ATTGGAAATCTTCGCACACTG	0.423			T	PAX5	ALL																																p.E320D		Atlas-SNP	.		Dom	yes		3	3p14.1	27086	forkhead box P1		L	.	FOXP1	104	.	0			c.A960T						.						71.0	68.0	69.0					3																	71064720		2203	4300	6503	SO:0001583	missense	27086	exon7			GAAATCTTCGCAC	AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.954A>T	chr3.hg19:g.71064720T>A	ENSP00000318902:p.Glu318Asp	146.0	0.0		166.0	24.0	NM_001244815	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	ENST00000318789.4	hg19	CCDS2914.1	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928556	0.52759	.	.	ENSG00000114861	ENST00000318789;ENST00000358280;ENST00000318796;ENST00000475937;ENST00000339693;ENST00000497355;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000484350;ENST00000468577;ENST00000485326	T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	6.07	4.9	0.64082	Zinc finger, C2H2-like (1);	0.089636	0.85682	N	0.000000	T	0.39172	0.1068	L	0.33093	0.98	0.80722	D	1	B;B;B;B;B	0.21309	0.054;0.043;0.002;0.053;0.011	B;B;B;B;B	0.24848	0.028;0.021;0.005;0.056;0.02	T	0.13710	-1.0499	10	0.39692	T	0.17	.	13.2741	0.60178	0.0:0.0:0.1368:0.8632	.	318;317;318;242;318	B3KV70;A3KMG1;G5E9V8;Q8NAN6;Q9H334	.;.;.;.;FOXP1_HUMAN	D	318;130;218;318;318;214;320;318;318;242;318;218	ENSP00000318902:E318D;ENSP00000419393:E318D;ENSP00000418225:E214D;ENSP00000420736:E320D;ENSP00000418524:E318D;ENSP00000418102:E318D;ENSP00000417857:E242D;ENSP00000418883:E318D;ENSP00000417941:E218D	ENSP00000318902:E318D	E	-	3	2	FOXP1	71147410	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.852000	0.39348	1.099000	0.41499	0.528000	0.53228	GAA	.	.		0.423	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352250.1	NM_032682	
AFAP1	60312	hgsc.bcm.edu	37	4	7844908	7844908	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr4:7844908C>A	ENST00000360265.4	-	4	738	c.504G>T	c.(502-504)caG>caT	p.Q168H	AFAP1_ENST00000358461.2_Missense_Mutation_p.Q168H|AFAP1_ENST00000382543.3_Missense_Mutation_p.Q168H|AFAP1_ENST00000420658.1_Missense_Mutation_p.Q168H			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	168	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						ACTTGGTCCACTGGCCGAACC	0.542																																					p.Q168H		Atlas-SNP	.											.	AFAP1	93	.	0			c.G504T						.						102.0	92.0	95.0					4																	7844908		2203	4300	6503	SO:0001583	missense	60312	exon5			GGTCCACTGGCCG	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.504G>T	chr4.hg19:g.7844908C>A	ENSP00000353402:p.Gln168His	63.0	0.0		112.0	39.0	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	hg19	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131945	0.77662	.	.	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	4.38	4.38	0.52667	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.84151	0.5409	M	0.76170	2.325	0.58432	D	0.999998	D;P	0.89917	1.0;0.868	D;P	0.91635	0.999;0.755	D	0.85799	0.1372	10	0.87932	D	0	-34.9815	11.1318	0.48351	0.0:0.9004:0.0:0.0996	.	168;168	E9PDT7;Q8N556	.;AFAP1_HUMAN	H	168	ENSP00000353402:Q168H;ENSP00000410689:Q168H;ENSP00000351245:Q168H;ENSP00000371983:Q168H	ENSP00000351245:Q168H	Q	-	3	2	AFAP1	7895808	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.765000	0.47621	2.027000	0.59764	0.485000	0.47835	CAG	.	.		0.542	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
FAT4	79633	hgsc.bcm.edu	37	4	126370127	126370127	+	Silent	SNP	C	C	T	rs546465658		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr4:126370127C>T	ENST00000394329.3	+	9	7969	c.7956C>T	c.(7954-7956)taC>taT	p.Y2652Y	FAT4_ENST00000335110.5_Silent_p.Y950Y	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2652	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						tctCCTCTTACGAGAAACTTG	0.378																																					p.Y2652Y		Atlas-SNP	.											.	FAT4	1752	.	0			c.C7956T						.						54.0	57.0	56.0					4																	126370127		2203	4300	6503	SO:0001819	synonymous_variant	79633	exon9			CTCTTACGAGAAA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7956C>T	chr4.hg19:g.126370127C>T		96.0	0.0		107.0	36.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	hg19	CCDS3732.3																																																																																			.	.		0.378	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
NKD2	85409	hgsc.bcm.edu	37	5	1038444	1038444	+	Missense_Mutation	SNP	G	G	C	rs538650344	byFrequency	TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:1038444G>C	ENST00000296849.5	+	10	1541	c.1312G>C	c.(1312-1314)Gag>Cag	p.E438Q	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_Missense_Mutation_p.R77P	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	438	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)	p.E438delE(1)		breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccaccacgagcaccacca	0.687																																					p.E438Q		Atlas-SNP	.											.,1	NKD2	39	.	1	Deletion - In frame(1)	central_nervous_system(1)	c.G1312C						.						5.0	4.0	4.0					5																	1038444		1925	3790	5715	SO:0001583	missense	85409	exon10			CACCACGAGCACC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1312G>C	chr5.hg19:g.1038444G>C	ENSP00000296849:p.Glu438Gln	11.0	0.0		27.0	8.0	NM_033120	Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	hg19	CCDS3859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.31|12.31	1.899877|1.899877	0.33535|0.33535	.|.	.|.	ENSG00000145506|ENSG00000145506	ENST00000296849|ENST00000382730	T|T	0.57595|0.39229	0.39|1.09	3.7|3.7	2.81|2.81	0.32909|0.32909	.|.	0.000000|.	0.49305|.	U|.	0.000155|.	T|T	0.26593|0.26593	0.0650|0.0650	N|N	0.08118|0.08118	0|0	0.20489|0.20489	N|N	0.999897|0.999897	D|.	0.67145|.	0.996|.	P|.	0.61003|.	0.882|.	T|T	0.22626|0.22626	-1.0211|-1.0211	10|7	0.87932|0.87932	D|D	0|0	-20.2951|-20.2951	9.0625|9.0625	0.36442|0.36442	0.0:0.2264:0.7736:0.0|0.0:0.2264:0.7736:0.0	.|.	438|.	Q969F2|.	NKD2_HUMAN|.	Q|P	438|77	ENSP00000296849:E438Q|ENSP00000372177:R77P	ENSP00000296849:E438Q|ENSP00000372177:R77P	E|R	+|+	1|2	0|0	NKD2|NKD2	1091444|1091444	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.967000|0.967000	0.64934|0.64934	2.791000|2.791000	0.47829|0.47829	0.530000|0.530000	0.28619|0.28619	0.561000|0.561000	0.74099|0.74099	GAG|CGA	.	.		0.687	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
NKD2	85409	hgsc.bcm.edu	37	5	1038446	1038446	+	Missense_Mutation	SNP	G	G	C	rs3840989		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:1038446G>C	ENST00000296849.5	+	10	1543	c.1314G>C	c.(1312-1314)gaG>gaC	p.E438D	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_Missense_Mutation_p.A78P	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	438	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)	p.E438delE(1)		breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			accaccacgagcaccaccacc	0.692																																					p.E438D		Atlas-SNP	.											.	NKD2	39	.	1	Deletion - In frame(1)	central_nervous_system(1)	c.G1314C						.						5.0	4.0	4.0					5																	1038446		1924	3775	5699	SO:0001583	missense	85409	exon10			CCACGAGCACCAC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1314G>C	chr5.hg19:g.1038446G>C	ENSP00000296849:p.Glu438Asp	11.0	0.0		24.0	5.0	NM_033120	Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	hg19	CCDS3859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.11|10.11	1.260604|1.260604	0.23051|0.23051	.|.	.|.	ENSG00000145506|ENSG00000145506	ENST00000382730|ENST00000296849	T|T	0.38401|0.56776	1.14|0.44	3.7|3.7	-3.46|-3.46	0.04767|0.04767	.|.	.|0.000000	.|0.49305	.|U	.|0.000155	T|T	0.23926|0.23926	0.0579|0.0579	N|N	0.08118|0.08118	0|0	0.22199|0.22199	N|N	0.999295|0.999295	.|B	.|0.20052	.|0.041	.|B	.|0.17722	.|0.019	T|T	0.07731|0.07731	-1.0757|-1.0757	7|10	0.87932|0.87932	D|D	0|0	-20.2951|-20.2951	4.7821|4.7821	0.13208|0.13208	0.5785:0.1801:0.2414:0.0|0.5785:0.1801:0.2414:0.0	.|.	.|438	.|Q969F2	.|NKD2_HUMAN	P|D	78|438	ENSP00000372177:A78P|ENSP00000296849:E438D	ENSP00000372177:A78P|ENSP00000296849:E438D	A|E	+|+	1|3	0|2	NKD2|NKD2	1091446|1091446	0.727000|0.727000	0.28069|0.28069	0.928000|0.928000	0.36995|0.36995	0.965000|0.965000	0.64279|0.64279	-0.123000|-0.123000	0.10611|0.10611	-0.615000|-0.615000	0.05679|0.05679	-0.258000|-0.258000	0.10820|0.10820	GCA|GAG	.	.		0.692	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
ARSK	153642	hgsc.bcm.edu	37	5	94922268	94922268	+	Silent	SNP	G	G	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:94922268G>T	ENST00000380009.4	+	5	907	c.702G>T	c.(700-702)gtG>gtT	p.V234V		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	234					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		CTTTTTAGGTGTCTCATGATG	0.333																																					p.V234V		Atlas-SNP	.											.	ARSK	29	.	0			c.G702T						.						78.0	78.0	78.0					5																	94922268		2203	4300	6503	SO:0001819	synonymous_variant	153642	exon5			TTAGGTGTCTCAT		CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.702G>T	chr5.hg19:g.94922268G>T		288.0	0.0		355.0	57.0	NM_198150	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Silent	SNP	ENST00000380009.4	hg19	CCDS4073.1																																																																																			.	.		0.333	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150	
KCNN2	3781	hgsc.bcm.edu	37	5	113740180	113740180	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:113740180A>T	ENST00000512097.3	+	4	1646	c.628A>T	c.(628-630)Act>Tct	p.T210S	KCNN2_ENST00000264773.3_Missense_Mutation_p.T210S|KCNN2_ENST00000507750.1_Intron			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	210					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	AATAGCCATGACTTATGAGCG	0.428																																					p.T210S		Atlas-SNP	.											.	KCNN2	144	.	0			c.A628T						.						195.0	184.0	188.0					5																	113740180		2202	4300	6502	SO:0001583	missense	3781	exon3			GCCATGACTTATG	AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.628A>T	chr5.hg19:g.113740180A>T	ENSP00000427120:p.Thr210Ser	54.0	0.0		48.0	7.0	NM_021614	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	ENST00000512097.3	hg19	CCDS4114.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.928914	0.73327	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	D;D	0.98822	-5.16;-5.16	5.29	5.29	0.74685	Potassium channel, calcium-activated, SK, conserved region (1);	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	L	0.58302	1.8	0.80722	D	1	P	0.41475	0.751	P	0.50049	0.629	D	0.98126	1.0428	10	0.32370	T	0.25	.	14.8849	0.70560	1.0:0.0:0.0:0.0	.	210	Q9H2S1	KCNN2_HUMAN	S	210	ENSP00000427120:T210S;ENSP00000264773:T210S	ENSP00000264773:T210S	T	+	1	0	KCNN2	113768079	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.149000	0.94659	1.995000	0.58328	0.379000	0.24179	ACT	.	.		0.428	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614	
PCDHGB2	56103	hgsc.bcm.edu	37	5	140740865	140740865	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:140740865G>A	ENST00000522605.1	+	1	1163	c.1163G>A	c.(1162-1164)gGa>gAa	p.G388E	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	388	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGTGTTGGGAAATGCCAAG	0.468																																					p.G388E		Atlas-SNP	.											.	PCDHGB2	196	.	0			c.G1163A						.						65.0	71.0	69.0					5																	140740865		2019	4184	6203	SO:0001583	missense	56103	exon1			TGTTGGGAAATGC	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1163G>A	chr5.hg19:g.140740865G>A	ENSP00000429018:p.Gly388Glu	166.0	0.0		178.0	46.0	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	hg19	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.415317	0.00013	.	.	ENSG00000253910	ENST00000522605	T	0.01572	4.76	5.3	0.451	0.16629	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01421	0.0046	N	0.25380	0.74	0.09310	N	1	B;B	0.13594	0.004;0.008	B;B	0.20384	0.012;0.029	T	0.47959	-0.9076	9	0.07030	T	0.85	.	9.4943	0.38978	0.3565:0.0:0.6435:0.0	.	388;388	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	E	388	ENSP00000429018:G388E	ENSP00000429018:G388E	G	+	2	0	PCDHGB2	140721049	0.000000	0.05858	0.010000	0.14722	0.001000	0.01503	0.437000	0.21543	0.066000	0.16515	-0.768000	0.03414	GGA	.	.		0.468	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
SLC36A3	285641	hgsc.bcm.edu	37	5	150660677	150660677	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:150660677C>T	ENST00000335230.3	-	9	1453	c.1042G>A	c.(1042-1044)Gtc>Atc	p.V348I	SLC36A3_ENST00000377713.3_Missense_Mutation_p.V389I	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	348						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAGCTGGGACGTGGAACTGG	0.507																																					p.V389I		Atlas-SNP	.											.	SLC36A3	54	.	0			c.G1165A						.						223.0	172.0	189.0					5																	150660677		2203	4300	6503	SO:0001583	missense	285641	exon10			CTGGGACGTGGAA	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1042G>A	chr5.hg19:g.150660677C>T	ENSP00000334750:p.Val348Ile	89.0	0.0		119.0	13.0	NM_001145017	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	hg19	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853527	0.71719	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02552	4.25;4.25	3.82	2.95	0.34219	.	0.197168	0.42682	N	0.000670	T	0.14917	0.0360	M	0.88031	2.925	0.58432	D	0.999999	D;D;D	0.63046	0.992;0.987;0.984	P;D;P	0.64321	0.811;0.924;0.875	T	0.01036	-1.1473	10	0.59425	D	0.04	.	11.4437	0.50110	0.0:0.9115:0.0:0.0885	.	389;348;333	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	I	348;389	ENSP00000334750:V348I;ENSP00000366942:V389I	ENSP00000334750:V348I	V	-	1	0	SLC36A3	150640870	0.991000	0.36638	0.998000	0.56505	0.717000	0.41224	2.886000	0.48578	0.954000	0.37851	0.561000	0.74099	GTC	.	.		0.507	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
ZFP2	80108	hgsc.bcm.edu	37	5	178359427	178359427	+	Silent	SNP	G	G	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr5:178359427G>T	ENST00000361362.2	+	5	1643	c.1113G>T	c.(1111-1113)gtG>gtT	p.V371V	ZFP2_ENST00000523286.1_Silent_p.V371V|ZFP2_ENST00000520301.1_Silent_p.V371V|ZFP2_ENST00000503510.2_Silent_p.V371V	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		CCCTTACCGTGCATCAGGTCA	0.413																																					p.V371V		Atlas-SNP	.											.	ZFP2	70	.	0			c.G1113T						.						92.0	84.0	86.0					5																	178359427		2203	4300	6503	SO:0001819	synonymous_variant	80108	exon5			TACCGTGCATCAG	AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.1113G>T	chr5.hg19:g.178359427G>T		64.0	0.0		81.0	28.0	NM_030613	A5PLN5|B7ZM23|Q9H6Z6	Silent	SNP	ENST00000361362.2	hg19	CCDS4440.1																																																																																			.	.		0.413	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253470.2	NM_030613	
MOG	4340	hgsc.bcm.edu	37	6	29641328	29641328	+	IGR	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr6:29641328C>T	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Missense_Mutation_p.R167H|ZFP57_ENST00000488757.1_Missense_Mutation_p.R187H|ZFP57_ENST00000376881.3_Missense_Mutation_p.R167H	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GAGGTAGGAGCGCCTGCTGAA	0.547																																					p.R187H		Atlas-SNP	.											.	ZFP57	80	.	0			c.G560A						.						79.0	90.0	86.0					6																	29641328		1253	2543	3796	SO:0001628	intergenic_variant	346171	exon4			TAGGAGCGCCTGC		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		chr6.hg19:g.29641328C>T		117.0	0.0		161.0	41.0	NM_001109809	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	ENST00000376917.3	hg19	CCDS34370.1	.	.	.	.	.	.	.	.	.	.	C	3.774	-0.047003	0.07407	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.53206	0.63;0.63;0.63	3.73	1.9	0.25705	.	0.665558	0.13121	N	0.412196	T	0.17195	0.0413	L	0.42245	1.32	0.09310	N	1	B;B	0.25609	0.13;0.13	B;B	0.24394	0.053;0.031	T	0.19095	-1.0316	10	0.30078	T	0.28	-7.5558	7.5513	0.27798	0.0:0.7725:0.0:0.2275	.	187;167	Q9NU63-3;Q9NU63-2	.;.	H	187;167;167	ENSP00000418259:R187H;ENSP00000366078:R167H;ENSP00000366080:R167H	ENSP00000366078:R167H	R	-	2	0	ZFP57	29749307	0.000000	0.05858	0.018000	0.16275	0.030000	0.12068	-0.905000	0.04075	0.538000	0.28769	0.655000	0.94253	CGC	.	.		0.547	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433	
CMTR1	23070	hgsc.bcm.edu	37	6	37403498	37403498	+	Silent	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr6:37403498C>T	ENST00000373451.4	+	2	257	c.93C>T	c.(91-93)tcC>tcT	p.S31S		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	31					7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										GCTCCACGTCCGATGATGAAC	0.507																																					p.S31S		Atlas-SNP	.											.	FTSJD2	64	.	0			c.C93T						.						158.0	115.0	130.0					6																	37403498		2203	4300	6503	SO:0001819	synonymous_variant	23070	exon2			CACGTCCGATGAT	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.93C>T	chr6.hg19:g.37403498C>T		117.0	0.0		182.0	41.0	NM_015050	A8K949|Q14670|Q96FJ9	Silent	SNP	ENST00000373451.4	hg19	CCDS4835.1																																																																																			.	.		0.507	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
ZPBP	11055	hgsc.bcm.edu	37	7	50097728	50097728	+	Missense_Mutation	SNP	C	C	T	rs201273041	byFrequency	TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr7:50097728C>T	ENST00000046087.2	-	4	413	c.344G>A	c.(343-345)cGc>cAc	p.R115H	ZPBP_ENST00000419417.1_Missense_Mutation_p.R114H|ZPBP_ENST00000491129.1_5'Flank	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	115					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					TTGTGCAGTGCGGTTTTCTAC	0.343													C|||	2	0.000399361	0.0008	0.0	5008	,	,		18748	0.0		0.0	False		,,,				2504	0.001				p.R115H		Atlas-SNP	.											ZPBP,NS,carcinoma,0,1	ZPBP	65	.	0			c.G344A						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	99.0	100.0	100.0		341,344	0.3	0.9	7		100	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	ZPBP	NM_001159878.1,NM_007009.2	29,29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign	114/351,115/352	50097728	3,13003	2203	4300	6503	SO:0001583	missense	11055	exon4			GCAGTGCGGTTTT	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.344G>A	chr7.hg19:g.50097728C>T	ENSP00000046087:p.Arg115His	111.0	0.0		144.0	18.0	NM_007009	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	ENST00000046087.2	hg19	CCDS5509.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025357	0.35701	0.0	3.49E-4	ENSG00000042813	ENST00000046087;ENST00000419417	T;T	0.77229	-1.08;-1.08	5.66	0.302	0.15786	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.608760	0.16866	N	0.196303	T	0.49338	0.1551	N	0.08118	0	0.09310	N	1	B;B	0.27823	0.19;0.19	B;B	0.13407	0.009;0.009	T	0.31833	-0.9929	9	.	.	.	-4.0572	5.5251	0.16953	0.0:0.3303:0.395:0.2747	.	114;115	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	H	115;114	ENSP00000046087:R115H;ENSP00000402071:R114H	.	R	-	2	0	ZPBP	50068274	0.586000	0.26782	0.870000	0.34147	0.987000	0.75469	-0.386000	0.07370	0.299000	0.22661	0.591000	0.81541	CGC	.	.		0.343	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009	
DYNC1I1	1780	hgsc.bcm.edu	37	7	95442633	95442633	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr7:95442633C>A	ENST00000324972.6	+	4	542	c.349C>A	c.(349-351)Ctg>Atg	p.L117M	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.L117M|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.L100M|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.L100M|DYNC1I1_ENST00000413338.1_Missense_Mutation_p.L100M|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.L100M|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.L100M	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	117	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CTCAGGCGATCTGGGGCCATT	0.423																																					p.L117M		Atlas-SNP	.											.	DYNC1I1	111	.	0			c.C349A						.						68.0	66.0	67.0					7																	95442633		2203	4300	6503	SO:0001583	missense	1780	exon4			GGCGATCTGGGGC	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.349C>A	chr7.hg19:g.95442633C>A	ENSP00000320130:p.Leu117Met	95.0	0.0		149.0	47.0	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	hg19	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049075	0.36181	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000413338;ENST00000518089;ENST00000457059	T;T;T;T;T;T	0.74737	-0.65;-0.61;-0.87;-0.65;-0.65;-0.65	4.64	2.75	0.32379	.	0.255117	0.31897	N	0.006889	T	0.57344	0.2047	N	0.08118	0	0.33724	D	0.617323	P;P;P;P;P	0.47604	0.667;0.898;0.775;0.897;0.855	B;P;P;B;P	0.49140	0.285;0.601;0.477;0.375;0.579	T	0.64748	-0.6334	10	0.45353	T	0.12	-15.669	5.4198	0.16394	0.0:0.602:0.1456:0.2523	.	100;117;100;117;100	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	M	100;117;100;117;100;100;100;100	ENSP00000392337:L100M;ENSP00000320130:L117M;ENSP00000438377:L100M;ENSP00000398118:L117M;ENSP00000352348:L100M;ENSP00000412444:L100M	ENSP00000320130:L117M	L	+	1	2	DYNC1I1	95280569	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.241000	0.43097	0.816000	0.34421	-0.345000	0.07892	CTG	.	.		0.423	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
KEL	3792	hgsc.bcm.edu	37	7	142641785	142641785	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr7:142641785C>T	ENST00000355265.2	-	12	1832	c.1358G>A	c.(1357-1359)cGc>cAc	p.R453H	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	453					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GTTTCTGAGGCGAGTGATGAG	0.602																																					p.R453H		Atlas-SNP	.											.	KEL	128	.	0			c.G1358A						.						79.0	69.0	72.0					7																	142641785		2203	4300	6503	SO:0001583	missense	3792	exon12			CTGAGGCGAGTGA	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1358G>A	chr7.hg19:g.142641785C>T	ENSP00000347409:p.Arg453His	73.0	0.0		84.0	21.0	NM_000420	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	hg19	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	C	2.913	-0.225022	0.06022	.	.	ENSG00000197993	ENST00000355265	T	0.75477	-0.94	4.87	-1.61	0.08399	Peptidase M13 (1);	0.635593	0.14786	N	0.298483	T	0.53094	0.1775	N	0.22421	0.69	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.35076	-0.9803	10	0.14656	T	0.56	-0.0341	8.6076	0.33782	0.0:0.3935:0.0:0.6065	.	453	P23276	KELL_HUMAN	H	453	ENSP00000347409:R453H	ENSP00000347409:R453H	R	-	2	0	KEL	142351907	0.103000	0.21917	0.001000	0.08648	0.052000	0.14988	-0.542000	0.06091	-0.187000	0.10516	-0.444000	0.05651	CGC	.	.		0.602	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
CSMD1	64478	hgsc.bcm.edu	37	8	3015485	3015485	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr8:3015485G>A	ENST00000520002.1	-	40	6406	c.5851C>T	c.(5851-5853)Cgt>Tgt	p.R1951C	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1951C|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1950C|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1951C|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1950C|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1951C|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1950C			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1951	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATGTGGGAACGGCCCTGTTTA	0.403																																					p.R1950C		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C5848T						.						36.0	34.0	35.0					8																	3015485		1867	4036	5903	SO:0001583	missense	64478	exon39			GGGAACGGCCCTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5851C>T	chr8.hg19:g.3015485G>A	ENSP00000430733:p.Arg1951Cys	273.0	0.0		317.0	88.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.8|24.8	4.573582|4.573582	0.86542|0.86542	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.66995	.|-0.24;-0.24;-0.24;-0.24;-0.24	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.068629	.|0.64402	.|D	.|0.000014	T|T	0.73923|0.73923	0.3649|0.3649	L|L	0.38175|0.38175	1.15|1.15	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D	.|0.89917	.|1.0;0.991;0.998;0.987	.|D;P;P;P	.|0.63192	.|0.912;0.806;0.888;0.764	T|T	0.73266|0.73266	-0.4037|-0.4037	5|10	.|0.42905	.|T	.|0.14	.|.	18.8861|18.8861	0.92378|0.92378	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1951;1951;1950;1951	.|E5RIG2;Q96PZ7;F5H2I8;Q96PZ7-4	.|.;CSMD1_HUMAN;.;.	L|C	1430|1951;1951;1812;1950;1950;1950	.|ENSP00000383047:R1951C;ENSP00000430733:R1951C;ENSP00000441462:R1950C;ENSP00000446243:R1950C;ENSP00000441675:R1950C	.|ENSP00000320445:R1812C	P|R	-|-	2|1	0|0	CSMD1|CSMD1	3002892|3002892	1.000000|1.000000	0.71417|0.71417	0.963000|0.963000	0.40424|0.40424	0.959000|0.959000	0.62525|0.62525	5.780000|5.780000	0.68956|0.68956	2.538000|2.538000	0.85594|0.85594	0.655000|0.655000	0.94253|0.94253	CCG|CGT	.	.		0.403	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSMD1	64478	hgsc.bcm.edu	37	8	3216751	3216751	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr8:3216751C>T	ENST00000520002.1	-	22	3785	c.3230G>A	c.(3229-3231)cGt>cAt	p.R1077H	CSMD1_ENST00000602557.1_Missense_Mutation_p.R1077H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1076H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1077H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1076H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1077H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1076H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1077	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R1076H(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACCTTCTAAACGATATCCCAG	0.552																																					p.R1076H		Atlas-SNP	.											CSMD1_ENST00000537824,NS,carcinoma,-1,3	CSMD1	1469	.	1	Substitution - Missense(1)	kidney(1)	c.G3227A						.						72.0	78.0	76.0					8																	3216751		2203	4300	6503	SO:0001583	missense	64478	exon21			TCTAAACGATATC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3230G>A	chr8.hg19:g.3216751C>T	ENSP00000430733:p.Arg1077His	92.0	0.0		141.0	37.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	c	20.6	4.020740	0.75275	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.24	5.24	0.73138	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.78240	0.4252	M	0.66506	2.035	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	T	0.77180	-0.2682	10	0.40728	T	0.16	.	18.8469	0.92210	0.0:1.0:0.0:0.0	.	1077;1077;1077	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	H	1077;1077;939;1076;1076;1076	ENSP00000383047:R1077H;ENSP00000430733:R1077H;ENSP00000441462:R1076H;ENSP00000446243:R1076H;ENSP00000441675:R1076H	ENSP00000320445:R939H	R	-	2	0	CSMD1	3204158	1.000000	0.71417	0.925000	0.36789	0.217000	0.24651	7.612000	0.82975	2.432000	0.82394	0.550000	0.68814	CGT	.	.		0.552	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
LONRF1	91694	hgsc.bcm.edu	37	8	12580687	12580687	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr8:12580687A>G	ENST00000398246.3	-	12	2309	c.2240T>C	c.(2239-2241)gTt>gCt	p.V747A	LONRF1_ENST00000525024.1_Missense_Mutation_p.V173A|LONRF1_ENST00000533751.1_Missense_Mutation_p.V390A	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	747	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		CATTGACAAAACCGACAGCTG	0.433																																					p.V747A		Atlas-SNP	.											.	LONRF1	45	.	0			c.T2240C						.						138.0	143.0	141.0					8																	12580687		1930	4119	6049	SO:0001583	missense	91694	exon12			GACAAAACCGACA	AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.2240T>C	chr8.hg19:g.12580687A>G	ENSP00000381298:p.Val747Ala	102.0	0.0		147.0	33.0	NM_152271	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	hg19	CCDS5987.2	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003583	0.74932	.	.	ENSG00000154359	ENST00000398246;ENST00000525024;ENST00000533751;ENST00000524526	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.06	5.06	0.68205	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.62514	0.2434	M	0.63428	1.95	0.80722	D	1	P;D	0.55800	0.841;0.973	P;P	0.59288	0.774;0.855	T	0.66881	-0.5811	10	0.87932	D	0	-15.7019	15.5236	0.75885	1.0:0.0:0.0:0.0	.	736;747	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	A	747;173;390;350	ENSP00000381298:V747A;ENSP00000436770:V173A;ENSP00000432130:V390A;ENSP00000433327:V350A	ENSP00000381298:V747A	V	-	2	0	LONRF1	12625058	1.000000	0.71417	0.847000	0.33407	0.993000	0.82548	8.831000	0.92068	2.194000	0.70268	0.533000	0.62120	GTT	.	.		0.433	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271	
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	30.0	0.0		50.0	3.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
FOXE1	2304	hgsc.bcm.edu	37	9	100616728	100616728	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr9:100616728G>A	ENST00000375123.3	+	1	1193	c.532G>A	c.(532-534)Gcc>Acc	p.A178T		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	178	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				cgccgccgccgccgccATCTT	0.791																																					p.A178T		Atlas-SNP	.											.	FOXE1	19	.	0			c.G532A						.						2.0	2.0	2.0					9																	100616728		529	1359	1888	SO:0001583	missense	2304	exon1			GCCGCCGCCGCCA	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.532G>A	chr9.hg19:g.100616728G>A	ENSP00000364265:p.Ala178Thr	204.0	0.0		240.0	14.0	NM_004473	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	hg19	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930555	0.52866	.	.	ENSG00000178919	ENST00000375123	D	0.93953	-3.32	3.94	3.02	0.34903	.	0.612880	0.14474	U	0.317365	D	0.83087	0.5178	L	0.34521	1.04	0.22571	N	0.998979	P	0.47253	0.892	B	0.30251	0.113	T	0.72969	-0.4130	10	0.13108	T	0.6	.	6.9037	0.24297	0.0993:0.1791:0.7216:0.0	.	178	O00358	FOXE1_HUMAN	T	178	ENSP00000364265:A178T	ENSP00000364265:A178T	A	+	1	0	FOXE1	99656549	0.087000	0.21565	0.898000	0.35279	0.822000	0.46500	0.422000	0.21296	0.758000	0.33059	0.557000	0.71058	GCC	.	.		0.791	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1		
COL13A1	1305	hgsc.bcm.edu	37	10	71665571	71665571	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr10:71665571G>A	ENST00000398978.3	+	17	1436	c.944G>A	c.(943-945)gGc>gAc	p.G315D	COL13A1_ENST00000398974.3_Missense_Mutation_p.G303D|COL13A1_ENST00000522165.1_Missense_Mutation_p.G296D|COL13A1_ENST00000520267.1_Missense_Mutation_p.G258D|COL13A1_ENST00000357811.3_Missense_Mutation_p.G293D|COL13A1_ENST00000398973.3_Missense_Mutation_p.G315D|COL13A1_ENST00000517713.1_Missense_Mutation_p.G293D|COL13A1_ENST00000398971.3_Missense_Mutation_p.G315D|COL13A1_ENST00000520133.1_Missense_Mutation_p.G264D|COL13A1_ENST00000398968.3_Missense_Mutation_p.G296D|COL13A1_ENST00000354547.3_Missense_Mutation_p.G293D|COL13A1_ENST00000356340.3_Missense_Mutation_p.G315D|COL13A1_ENST00000398972.3_Missense_Mutation_p.G315D|COL13A1_ENST00000398966.3_Missense_Mutation_p.G293D|COL13A1_ENST00000398964.3_Missense_Mutation_p.G286D|COL13A1_ENST00000398969.3_Missense_Mutation_p.G258D	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GGCTACCACGGCCGGAAGGTA	0.552																																					p.G315D		Atlas-SNP	.											.	COL13A1	133	.	0			c.G944A						.						64.0	66.0	65.0					10																	71665571		1917	4109	6026	SO:0001583	missense	1305	exon17			ACCACGGCCGGAA	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.944G>A	chr10.hg19:g.71665571G>A	ENSP00000381949:p.Gly315Asp	164.0	0.0		148.0	56.0	NM_001130103		Missense_Mutation	SNP	ENST00000398978.3	hg19	CCDS44419.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100056	0.56183	.	.	ENSG00000197467	ENST00000398974;ENST00000398971;ENST00000398968;ENST00000398966;ENST00000398964;ENST00000398969;ENST00000356340;ENST00000398972;ENST00000398973;ENST00000398978;ENST00000354547;ENST00000357811;ENST00000520267;ENST00000517713;ENST00000522165;ENST00000520133	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99619	-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.99816	0.9919	H	0.98629	4.285	0.53688	D	0.999974	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;1.0;0.998;1.0;1.0;1.0;1.0;1.0;0.999;0.998;1.0;1.0;0.998;0.999;1.0;1.0	D	0.96819	0.9602	10	0.87932	D	0	-5.7723	16.6793	0.85288	0.0:0.0:1.0:0.0	.	258;315;315;315;315;293;296;315;303;315;264;293;293;324;315;296;293;286;315	B9EGD2;Q5TAT6;Q5TAT6-5;Q5TAT6-6;E9PEG9;E7ES55;E7ES51;E7ES47;E7ES46;E7ES49;E7EWL8;Q5TAT6-3;Q5TAT6-4;E7EX21;Q5TAT6-7;Q5TAT6-8;Q5TAT6-2;E7ES56;G5E987	.;CODA1_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	D	303;315;296;293;286;258;315;315;315;315;293;293;258;293;296;264	ENSP00000381946:G303D;ENSP00000381943:G315D;ENSP00000381940:G296D;ENSP00000381938:G293D;ENSP00000381936:G286D;ENSP00000381941:G258D;ENSP00000348695:G315D;ENSP00000381944:G315D;ENSP00000381945:G315D;ENSP00000381949:G315D;ENSP00000346553:G293D;ENSP00000350463:G293D;ENSP00000428057:G258D;ENSP00000430061:G293D;ENSP00000428342:G296D;ENSP00000430173:G264D	ENSP00000346553:G293D	G	+	2	0	COL13A1	71335577	1.000000	0.71417	0.996000	0.52242	0.846000	0.48090	5.579000	0.67457	2.688000	0.91661	0.563000	0.77884	GGC	.	.		0.552	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
SLIT1	6585	hgsc.bcm.edu	37	10	98766408	98766408	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr10:98766408C>A	ENST00000266058.4	-	32	3656	c.3411G>T	c.(3409-3411)caG>caT	p.Q1137H	SLIT1_ENST00000371070.4_Missense_Mutation_p.Q1137H|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1137	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TGGCCCCATTCTGGCACTCAG	0.597																																					p.Q1137H		Atlas-SNP	.											.	SLIT1	154	.	0			c.G3411T						.						42.0	37.0	39.0					10																	98766408		2203	4300	6503	SO:0001583	missense	6585	exon32			CCCATTCTGGCAC	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3411G>T	chr10.hg19:g.98766408C>A	ENSP00000266058:p.Gln1137His	153.0	0.0		143.0	55.0	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	hg19	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873831	0.91664	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	D;D	0.90788	-2.73;-2.73	5.19	5.19	0.71726	Follistatin-like, N-terminal (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.92967	0.7762	L	0.48986	1.54	0.80722	D	1	D	0.69078	0.997	P	0.58721	0.844	D	0.93532	0.6870	10	0.87932	D	0	.	18.9192	0.92518	0.0:1.0:0.0:0.0	.	1137	O75093	SLIT1_HUMAN	H	1137	ENSP00000266058:Q1137H;ENSP00000360109:Q1137H	ENSP00000266058:Q1137H	Q	-	3	2	SLIT1	98756398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.869000	0.69613	2.698000	0.92095	0.655000	0.94253	CAG	.	.		0.597	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
THRSP	7069	hgsc.bcm.edu	37	11	77775039	77775039	+	Missense_Mutation	SNP	C	C	T	rs147579530		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr11:77775039C>T	ENST00000281030.2	+	1	133	c.112C>T	c.(112-114)Cgg>Tgg	p.R38W	NDUFC2-KCTD14_ENST00000530054.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron	NM_003251.3	NP_003242.1	Q92748	THRSP_HUMAN	thyroid hormone responsive	38					lipid metabolic process (GO:0006629)|regulation of lipid biosynthetic process (GO:0046890)|regulation of transcription, DNA-templated (GO:0006355)|regulation of triglyceride biosynthetic process (GO:0010866)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.R38W(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			CAGCCTTCTGCGGGACGTGCA	0.607																																					p.R38W		Atlas-SNP	.											THRSP,NS,carcinoma,0,2	THRSP	18	.	1	Substitution - Missense(1)	lung(1)	c.C112T						.	C	,,,TRP/ARG	3,4397	6.2+/-15.9	0,3,2197	88.0	84.0	86.0		,,,112	-0.9	0.4	11	dbSNP_134	86	0,8584		0,0,4292	no	intron,intron,intron,missense	THRSP,NDUFC2-KCTD14	NM_001203260.1,NM_001203261.1,NM_001203262.1,NM_003251.3	,,,101	0,3,6489	TT,TC,CC		0.0,0.0682,0.0231	,,,probably-damaging	,,,38/147	77775039	3,12981	2200	4292	6492	SO:0001583	missense	7069	exon1			CTTCTGCGGGACG	Y08409	CCDS8256.1	11q14.1	2012-06-19	2010-06-25		ENSG00000151365	ENSG00000151365			11800	protein-coding gene	gene with protein product	"""SPOT14 homolog (rat)"""	601926	"""thyroid hormone responsive SPOT14 (rat) homolog"", ""lipogenic protein 1"""	LPGP1		9003802	Standard	NM_003251		Approved	SPOT14, Lpgp, S14, THRP	uc001oyx.3	Q92748	OTTHUMG00000166632	ENST00000281030.2:c.112C>T	chr11.hg19:g.77775039C>T	ENSP00000281030:p.Arg38Trp	69.0	0.0		90.0	9.0	NM_003251	B2R4W7	Missense_Mutation	SNP	ENST00000281030.2	hg19	CCDS8256.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.060281	0.55432	6.82E-4	0.0	ENSG00000151365	ENST00000281030	.	.	.	5.11	-0.846	0.10734	.	0.377447	0.25156	N	0.032720	T	0.39306	0.1073	.	.	.	0.40290	D	0.978496	P	0.37276	0.589	B	0.32980	0.156	T	0.35151	-0.9800	8	0.87932	D	0	-9.5659	9.5983	0.39587	0.468:0.4592:0.0:0.0728	.	38	Q92748	THRSP_HUMAN	W	38	.	ENSP00000281030:R38W	R	+	1	2	THRSP	77452687	0.999000	0.42202	0.424000	0.26647	0.463000	0.32649	0.630000	0.24553	0.025000	0.15241	-0.314000	0.08810	CGG	.	C|1.000;T|0.000		0.607	THRSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390939.1	NM_003251	
KRAS	3845	hgsc.bcm.edu	37	12	25362794	25362794	+	3'UTR	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr12:25362794C>T	ENST00000256078.4	-	0	689				KRAS_ENST00000311936.3_Missense_Mutation_p.E168K|KRAS_ENST00000557334.1_Missense_Mutation_p.E55K	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog						actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)		UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTCATCTTTTCTTTATGTTTT	0.284		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.E168K	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Atlas-SNP	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	.	KRAS	30930	.	0			c.G502A						.						62.0	60.0	61.0					12																	25362794		2201	4290	6491	SO:0001624	3_prime_UTR_variant	3845	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TCTTTTCTTTATG	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.*56G>A	chr12.hg19:g.25362794C>T		104.0	0.0		140.0	48.0	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	hg19	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847553	0.51164	.	.	ENSG00000133703	ENST00000311936;ENST00000557334	T;D	0.96136	-1.26;-3.92	5.79	5.79	0.91817	.	.	.	.	.	D	0.93501	0.7926	.	.	.	0.80722	D	1	P	0.37398	0.593	P	0.45577	0.486	D	0.90614	0.4554	8	0.06891	T	0.86	.	19.0037	0.92842	0.0:1.0:0.0:0.0	.	168	P01116-2	.	K	168;55	ENSP00000308495:E168K;ENSP00000452512:E55K	ENSP00000308495:E168K	E	-	1	0	KRAS	25254061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.443000	0.80521	2.742000	0.94016	0.591000	0.81541	GAA	.	.		0.284	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
PRICKLE1	144165	hgsc.bcm.edu	37	12	42858348	42858348	+	Silent	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr12:42858348C>T	ENST00000455697.1	-	7	1773	c.1488G>A	c.(1486-1488)agG>agA	p.R496R	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000345127.3_Silent_p.R496R|PRICKLE1_ENST00000445766.2_Silent_p.R496R|PRICKLE1_ENST00000552240.1_Silent_p.R496R|PRICKLE1_ENST00000548696.1_Silent_p.R496R	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	496					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		ATTCCTGAAGCCTTCTACTGC	0.488																																					p.R496R		Atlas-SNP	.											.	PRICKLE1	105	.	0			c.G1488A						.						65.0	62.0	63.0					12																	42858348		2203	4300	6503	SO:0001819	synonymous_variant	144165	exon7			CTGAAGCCTTCTA	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1488G>A	chr12.hg19:g.42858348C>T		123.0	0.0		108.0	26.0	NM_001144882	Q14C83|Q71QF8|Q96N00	Silent	SNP	ENST00000455697.1	hg19	CCDS8742.1																																																																																			.	.		0.488	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
KRT3	3850	hgsc.bcm.edu	37	12	53185086	53185086	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr12:53185086C>A	ENST00000417996.2	-	7	1513	c.1439G>T	c.(1438-1440)cGg>cTg	p.R480L	KRT3_ENST00000309505.3_Missense_Mutation_p.R480L	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	480	Coil 2.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R480Q(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						ACGTAGCAGCCGCGCCAGGTC	0.617																																					p.R480L		Atlas-SNP	.											KRT3,colon,carcinoma,0,2	KRT3	65	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1439T						.						97.0	91.0	93.0					12																	53185086		2203	4300	6503	SO:0001583	missense	3850	exon7			AGCAGCCGCGCCA		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1439G>T	chr12.hg19:g.53185086C>A	ENSP00000413479:p.Arg480Leu	59.0	0.0		69.0	3.0	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	hg19	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548780	0.65311	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.76060	-0.99;-0.99	4.71	4.71	0.59529	Filament (1);	0.000000	0.41396	D	0.000899	D	0.87569	0.6210	M	0.88031	2.925	0.38699	D	0.952947	D	0.59767	0.986	P	0.62740	0.906	D	0.90995	0.4838	10	0.87932	D	0	.	18.2151	0.89882	0.0:1.0:0.0:0.0	.	480	P12035	K2C3_HUMAN	L	480	ENSP00000413479:R480L;ENSP00000312206:R480L	ENSP00000312206:R480L	R	-	2	0	KRT3	51471353	0.023000	0.18921	1.000000	0.80357	0.295000	0.27426	0.826000	0.27407	2.619000	0.88677	0.561000	0.74099	CGG	.	.		0.617	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
ATP2B1	490	hgsc.bcm.edu	37	12	90015489	90015489	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr12:90015489T>G	ENST00000428670.3	-	10	1880	c.1424A>C	c.(1423-1425)gAt>gCt	p.D475A	ATP2B1_ENST00000359142.3_Missense_Mutation_p.D475A|ATP2B1_ENST00000348959.3_Missense_Mutation_p.D475A|ATP2B1_ENST00000393164.2_Missense_Mutation_p.D218A|ATP2B1_ENST00000261173.2_Missense_Mutation_p.D475A			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	475					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TCCTGTTTTATCTGAACAAAT	0.338																																					p.D475A		Atlas-SNP	.											.	ATP2B1	191	.	0			c.A1424C						.						113.0	111.0	112.0					12																	90015489		2203	4298	6501	SO:0001583	missense	490	exon9			GTTTTATCTGAAC	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1424A>C	chr12.hg19:g.90015489T>G	ENSP00000392043:p.Asp475Ala	60.0	0.0		62.0	26.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	hg19	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.658453	0.88154	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.99960	-9.1;-9.1;-9.1;-9.1;-9.1	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.99975	0.9992	H	0.99825	4.815	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.984;0.961	D	0.97470	1.0040	9	.	.	.	-28.7159	16.0337	0.80603	0.0:0.0:0.0:1.0	.	475;475;475	P20020-3;P20020-2;P20020-6	.;.;.	A	475;475;475;475;218	ENSP00000261173:D475A;ENSP00000343599:D475A;ENSP00000352054:D475A;ENSP00000392043:D475A;ENSP00000376869:D218A	.	D	-	2	0	ATP2B1	88539620	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.040000	0.89188	2.188000	0.69820	0.460000	0.39030	GAT	.	.		0.338	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
FANCM	57697	hgsc.bcm.edu	37	14	45605599	45605599	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr14:45605599C>T	ENST00000267430.5	+	1	450	c.365C>T	c.(364-366)gCc>gTc	p.A122V	FKBP3_ENST00000216330.3_5'Flank|FANCM_ENST00000556036.1_Missense_Mutation_p.A122V|FKBP3_ENST00000396062.3_5'Flank|FANCM_ENST00000542564.2_Missense_Mutation_p.A122V	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	122	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TTTATTGCCGCCGTGGTCATG	0.552								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.A122V		Atlas-SNP	.											.	FANCM	225	.	0			c.C365T						.						76.0	80.0	78.0					14																	45605599		2203	4300	6503	SO:0001583	missense	57697	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTGCCGCCGTGGT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.365C>T	chr14.hg19:g.45605599C>T	ENSP00000267430:p.Ala122Val	114.0	0.0		158.0	38.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	36	5.607087	0.96626	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.14391	2.51;2.51;2.51	5.65	5.65	0.86999	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.190452	0.45606	D	0.000347	T	0.30572	0.0769	L	0.58354	1.805	0.50632	D	0.999888	P;P;B	0.48407	0.815;0.91;0.369	P;P;B	0.56088	0.698;0.791;0.389	T	0.00436	-1.1740	10	0.87932	D	0	.	17.2295	0.86981	0.0:1.0:0.0:0.0	.	122;122;122	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	V	122	ENSP00000450596:A122V;ENSP00000267430:A122V;ENSP00000442493:A122V	ENSP00000267430:A122V	A	+	2	0	FANCM	44675349	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.360000	0.79487	2.662000	0.90505	0.563000	0.77884	GCC	.	.		0.552	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
C14orf39	317761	hgsc.bcm.edu	37	14	60950469	60950469	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr14:60950469G>A	ENST00000321731.3	-	4	332	c.173C>T	c.(172-174)aCa>aTa	p.T58I		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	58					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTCCTCATCTGTTGCATTTAT	0.284																																					p.T58I		Atlas-SNP	.											.	C14orf39	79	.	0			c.C173T						.						146.0	125.0	132.0					14																	60950469		2201	4297	6498	SO:0001583	missense	317761	exon4			TCATCTGTTGCAT	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.173C>T	chr14.hg19:g.60950469G>A	ENSP00000324920:p.Thr58Ile	99.0	0.0		127.0	10.0	NM_174978	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	hg19	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	G	7.964	0.747563	0.15710	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	T;T	0.41065	2.03;1.01	5.18	1.99	0.26369	.	0.424839	0.21808	N	0.068806	T	0.26122	0.0637	L	0.36672	1.1	0.22754	N	0.99877	B	0.09022	0.002	B	0.09377	0.004	T	0.11641	-1.0579	10	0.23302	T	0.38	-4.6557	4.5141	0.11926	0.2139:0.2382:0.5479:0.0	.	58	Q8N1H7	S6OS1_HUMAN	I	58;29;58	ENSP00000324920:T58I;ENSP00000451665:T29I	ENSP00000324920:T58I	T	-	2	0	C14orf39	60020222	1.000000	0.71417	0.997000	0.53966	0.835000	0.47333	0.936000	0.28938	0.659000	0.30945	-0.119000	0.15052	ACA	.	.		0.284	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
DAPK2	23604	hgsc.bcm.edu	37	15	64275864	64275864	+	Missense_Mutation	SNP	G	G	T	rs193279006	byFrequency	TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr15:64275864G>T	ENST00000457488.1	-	3	212	c.182C>A	c.(181-183)gCg>gAg	p.A61E	DAPK2_ENST00000558069.1_Missense_Mutation_p.A61E|DAPK2_ENST00000558482.1_5'UTR|DAPK2_ENST00000261891.3_Missense_Mutation_p.A61E	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	61	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		GCGCCGGCTCGCCCGGCTCTG	0.622																																					p.A61E		Atlas-SNP	.											.	DAPK2	31	.	0			c.C182A						.						39.0	38.0	38.0					15																	64275864		2203	4300	6503	SO:0001583	missense	23604	exon3			CGGCTCGCCCGGC	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.182C>A	chr15.hg19:g.64275864G>T	ENSP00000408277:p.Ala61Glu	50.0	0.0		60.0	28.0	NM_014326	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	hg19	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849082	0.71603	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.63417	-0.04;-0.04	5.35	4.43	0.53597	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.073847	0.52532	D	0.000078	T	0.62392	0.2424	N	0.12182	0.205	0.80722	D	1	D;D	0.67145	0.986;0.996	D;P	0.63703	0.917;0.89	T	0.70193	-0.4939	10	0.87932	D	0	.	15.2366	0.73436	0.0:0.1408:0.8592:0.0	.	61;61	E9JGM7;Q9UIK4	.;DAPK2_HUMAN	E	61	ENSP00000261891:A61E;ENSP00000408277:A61E	ENSP00000261891:A61E	A	-	2	0	DAPK2	62062917	1.000000	0.71417	0.987000	0.45799	0.121000	0.20230	7.952000	0.87827	1.244000	0.43870	0.555000	0.69702	GCG	.	G|1.000;A|0.000		0.622	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
DNAH3	55567	hgsc.bcm.edu	37	16	21123354	21123354	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr16:21123354G>A	ENST00000261383.3	-	13	1879	c.1880C>T	c.(1879-1881)gCg>gTg	p.A627V	DNAH3_ENST00000415178.1_Missense_Mutation_p.A627V	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	627	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTTCAGGAACGCAGCGATGTT	0.373																																					p.A627V		Atlas-SNP	.											.	DNAH3	1142	.	0			c.C1880T						.						111.0	92.0	98.0					16																	21123354		2201	4299	6500	SO:0001583	missense	55567	exon13			AGGAACGCAGCGA	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1880C>T	chr16.hg19:g.21123354G>A	ENSP00000261383:p.Ala627Val	56.0	0.0		73.0	16.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	4.561	0.104102	0.08731	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.22945	1.93;2.09	5.72	-1.56	0.08532	.	1.142170	0.06471	N	0.731175	T	0.13586	0.0329	N	0.12746	0.255	0.09310	N	1	B;B	0.21606	0.005;0.058	B;B	0.15870	0.001;0.014	T	0.31503	-0.9941	10	0.37606	T	0.19	.	7.6628	0.28413	0.1288:0.0:0.336:0.5352	.	627;567	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	V	627;627;567	ENSP00000261383:A627V;ENSP00000394245:A627V	ENSP00000261383:A627V	A	-	2	0	DNAH3	21030855	0.000000	0.05858	0.041000	0.18516	0.024000	0.10985	0.018000	0.13422	-0.202000	0.10268	-0.905000	0.02835	GCG	.	.		0.373	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
PAGR1	79447	hgsc.bcm.edu	37	16	29828159	29828159	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr16:29828159T>A	ENST00000320330.6	+	1	875	c.313T>A	c.(313-315)Tgg>Agg	p.W105R	AC009133.12_ENST00000564980.1_RNA|AC009133.12_ENST00000569809.1_RNA|PAGR1_ENST00000609618.1_Missense_Mutation_p.W105R|AC009133.20_ENST00000569039.1_RNA			Q9BTK6	PAGR1_HUMAN	PAXIP1 associated glutamate-rich protein 1	105	Glu-rich.					histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)											TGGGCAGCCCTGGATGCCCCC	0.697											OREG0023722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W105R		Atlas-SNP	.											.	.	.	.	0			c.T313A						.						8.0	8.0	8.0					16																	29828159		2164	4237	6401	SO:0001583	missense	79447	exon1			CAGCCCTGGATGC	BC003640	CCDS10655.1	16p11.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000185928	ENSG00000185928			28707	protein-coding gene	gene with protein product	"""glutamate-rich coactivator interacting with SRC1/NCOA1"", ""PTIP-associated 1 protein"", ""glutamate-rich coactivator associated with SRC1"""	612033	"""chromosome 16 open reading frame 53"""	C16orf53		17500065, 19039327	Standard	NM_024516		Approved	MGC4606, GAS, PA1	uc002dug.4	Q9BTK6	OTTHUMG00000132117	ENST00000320330.6:c.313T>A	chr16.hg19:g.29828159T>A	ENSP00000326519:p.Trp105Arg	85.0	0.0	812	95.0	15.0	NM_024516	A2ICR6	Missense_Mutation	SNP	ENST00000320330.6	hg19	CCDS10655.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.878795	0.91740	.	.	ENSG00000185928	ENST00000320330	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.77253	0.4103	M	0.69823	2.125	0.53688	D	0.99997	D	0.89917	1.0	D	0.91635	0.999	T	0.80072	-0.1535	9	0.87932	D	0	-7.1584	13.2408	0.59995	0.0:0.0:0.0:1.0	.	105	Q9BTK6	PA1_HUMAN	R	105	.	ENSP00000326519:W105R	W	+	1	0	C16orf53	29735660	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	5.308000	0.65768	2.088000	0.63022	0.533000	0.62120	TGG	.	.		0.697	PAGR1-002	PUTATIVE	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000473165.1	NM_024516	
GAS2L2	246176	hgsc.bcm.edu	37	17	34072620	34072620	+	Silent	SNP	G	G	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr17:34072620G>T	ENST00000254466.6	-	6	1923	c.1896C>A	c.(1894-1896)cgC>cgA	p.R632R	GAS2L2_ENST00000587565.1_Silent_p.R616R	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	632					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGACCCCACTGCGAGGGATGA	0.592																																					p.R632R		Atlas-SNP	.											.	GAS2L2	94	.	0			c.C1896A						.						102.0	109.0	106.0					17																	34072620		2203	4300	6503	SO:0001819	synonymous_variant	246176	exon6			CCCACTGCGAGGG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1896C>A	chr17.hg19:g.34072620G>T		72.0	0.0		96.0	4.0	NM_139285	Q8NHY4	Silent	SNP	ENST00000254466.6	hg19	CCDS11298.1																																																																																			.	.		0.592	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
KRT10	3858	hgsc.bcm.edu	37	17	38975315	38975315	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr17:38975315T>G	ENST00000269576.5	-	7	1481	c.1472A>C	c.(1471-1473)cAc>cCc	p.H491P	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	491	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 1; AAA60544). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				actgccgccgtggccgccgcc	0.806																																					p.H491P		Atlas-SNP	.											.	KRT10	56	.	0			c.A1472C						.						1.0	1.0	1.0					17																	38975315		210	489	699	SO:0001583	missense	3858	exon7			CCGCCGTGGCCGC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1472A>C	chr17.hg19:g.38975315T>G	ENSP00000269576:p.His491Pro	67.0	0.0		106.0	10.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.913887	0.52439	.	.	ENSG00000186395	ENST00000269576	D	0.83591	-1.74	5.21	1.74	0.24563	.	2.489830	0.01848	N	0.035767	T	0.68118	0.2966	N	0.08118	0	0.09310	N	1	B	0.22080	0.064	B	0.23018	0.043	T	0.56366	-0.7991	10	0.19147	T	0.46	.	6.4997	0.22162	0.0:0.4912:0.0:0.5088	.	491	P13645	K1C10_HUMAN	P	491	ENSP00000269576:H491P	ENSP00000269576:H491P	H	-	2	0	KRT10	36228841	0.000000	0.05858	0.003000	0.11579	0.038000	0.13279	-3.316000	0.00515	0.176000	0.19873	0.491000	0.48974	CAC	.	.		0.806	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	64.0	0.0		109.0	10.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
PRKCA	5578	hgsc.bcm.edu	37	17	64302214	64302214	+	Splice_Site	SNP	G	G	C			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr17:64302214G>C	ENST00000413366.3	+	2	200	c.174G>C	c.(172-174)tgG>tgC	p.W58C	PRKCA_ENST00000583361.1_3'UTR	NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	58					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	TGTTTTTCAGGGGGTTTGGGA	0.333																																					p.W58C		Atlas-SNP	.											.	PRKCA	82	.	0			c.G174C						.						142.0	139.0	140.0					17																	64302214		2203	4300	6503	SO:0001630	splice_region_variant	5578	exon2			TTTCAGGGGGTTT		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.174-1G>C	chr17.hg19:g.64302214G>C		56.0	0.0		75.0	10.0	NM_002737	B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	hg19	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937995	0.73557	.	.	ENSG00000154229	ENST00000413366	D	0.83673	-1.75	4.8	4.8	0.61643	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.53938	U	0.000041	D	0.93390	0.7892	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.95158	0.8279	9	.	.	.	.	17.794	0.88564	0.0:0.0:1.0:0.0	.	58	P17252	KPCA_HUMAN	C	58	ENSP00000408695:W58C	.	W	+	3	0	PRKCA	61732676	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.984000	0.93482	2.369000	0.80426	0.655000	0.94253	TGG	.	.		0.333	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		Missense_Mutation
RYR1	6261	hgsc.bcm.edu	37	19	39055854	39055854	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr19:39055854A>G	ENST00000359596.3	+	91	12880	c.12880A>G	c.(12880-12882)Acg>Gcg	p.T4294A	RYR1_ENST00000360985.3_Missense_Mutation_p.T4289A|RYR1_ENST00000355481.4_Missense_Mutation_p.T4289A			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4294					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ggcgggggcgacggcgCGGGT	0.846																																					p.T4294A		Atlas-SNP	.											.	RYR1	708	.	0			c.A12880G						.						1.0	1.0	1.0					19																	39055854		18	18	36	SO:0001583	missense	6261	exon91			GGGGCGACGGCGC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12880A>G	chr19.hg19:g.39055854A>G	ENSP00000352608:p.Thr4294Ala	6.0	0.0		13.0	5.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	A	9.104	1.004863	0.19199	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96427	-4.01;-4.01;-4.01	2.88	-1.87	0.07737	.	0.322035	0.24873	U	0.034918	D	0.86180	0.5871	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.74919	-0.3500	10	0.17832	T	0.49	.	0.7381	0.00969	0.4141:0.1519:0.1138:0.3202	.	4289;4289;4294	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	A	4294;4289;4289	ENSP00000352608:T4294A;ENSP00000347667:T4289A;ENSP00000354254:T4289A	ENSP00000347667:T4289A	T	+	1	0	RYR1	43747694	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.092000	0.11129	-0.236000	0.09753	0.156000	0.16432	ACG	.	.		0.846	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZBTB45	84878	hgsc.bcm.edu	37	19	59027809	59027809	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr19:59027809G>A	ENST00000594051.1	-	2	1712	c.1232C>T	c.(1231-1233)aCg>aTg	p.T411M	ZBTB45_ENST00000600990.1_Missense_Mutation_p.T411M|ZBTB45_ENST00000354590.3_Missense_Mutation_p.T411M			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		GGAGCTGAACGTCTTGCGACA	0.622																																					p.T411M	NSCLC(164;1383 2017 5233 27540 46677)	Atlas-SNP	.											.	ZBTB45	37	.	0			c.C1232T						.						79.0	76.0	77.0					19																	59027809		2203	4300	6503	SO:0001583	missense	84878	exon2			CTGAACGTCTTGC	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.1232C>T	chr19.hg19:g.59027809G>A	ENSP00000469089:p.Thr411Met	36.0	0.0		59.0	17.0	NM_032792		Missense_Mutation	SNP	ENST00000594051.1	hg19	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	g	18.74	3.688847	0.68271	.	.	ENSG00000119574	ENST00000354590	T	0.35048	1.33	3.41	3.41	0.39046	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.205916	0.29631	N	0.011608	T	0.50480	0.1618	L	0.47078	1.49	0.31546	N	0.65939	D	0.89917	1.0	D	0.74674	0.984	T	0.57516	-0.7798	10	0.87932	D	0	.	13.1018	0.59224	0.0:0.0:1.0:0.0	.	411	Q96K62	ZBT45_HUMAN	M	411	ENSP00000346603:T411M	ENSP00000346603:T411M	T	-	2	0	ZBTB45	63719621	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	2.835000	0.48175	2.221000	0.72209	0.467000	0.42956	ACG	.	.		0.622	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792	
RASSF2	9770	hgsc.bcm.edu	37	20	4771204	4771204	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr20:4771204G>A	ENST00000379400.3	-	7	625	c.430C>T	c.(430-432)Cgc>Tgc	p.R144C	RASSF2_ENST00000379376.2_Missense_Mutation_p.R144C|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	144			R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						ACATCACTGCGTGTGCGCATC	0.597																																					p.R144C	Melanoma(158;1891 3343 50738)	Atlas-SNP	.											.	RASSF2	75	.	0			c.C430T						.						76.0	60.0	65.0					20																	4771204		2203	4300	6503	SO:0001583	missense	9770	exon7			CACTGCGTGTGCG	D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.430C>T	chr20.hg19:g.4771204G>A	ENSP00000368710:p.Arg144Cys	48.0	0.0		57.0	19.0	NM_014737	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	hg19	CCDS13083.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532830	0.85812	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.10573	2.86;2.86	5.2	5.2	0.72013	.	0.102570	0.64402	D	0.000005	T	0.18964	0.0455	M	0.75264	2.295	0.58432	D	0.999999	D	0.58620	0.983	P	0.46208	0.507	T	0.00518	-1.1693	10	0.62326	D	0.03	.	12.5495	0.56218	0.0:0.0:0.8336:0.1664	.	144	P50749	RASF2_HUMAN	C	144	ENSP00000368710:R144C;ENSP00000368684:R144C	ENSP00000368684:R144C	R	-	1	0	RASSF2	4719204	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.623000	0.67757	2.706000	0.92434	0.563000	0.77884	CGC	.	.		0.597	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077828.1	NM_014737	
CDK5RAP1	51654	hgsc.bcm.edu	37	20	31973469	31973469	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr20:31973469T>C	ENST00000357886.4	-	7	1016	c.863A>G	c.(862-864)aAg>aGg	p.K288R	CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.K198R|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.K288R|CDK5RAP1_ENST00000477105.1_5'UTR|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.K288R|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.K288R			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	288					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						CTCAGAAAGCTTCTTCACTTC	0.498																																					p.K288R		Atlas-SNP	.											.	CDK5RAP1	62	.	0			c.A863G						.						109.0	103.0	105.0					20																	31973469		2203	4300	6503	SO:0001583	missense	51654	exon7			GAAAGCTTCTTCA	AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.863A>G	chr20.hg19:g.31973469T>C	ENSP00000350558:p.Lys288Arg	82.0	0.0		113.0	24.0	NM_016408	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	hg19		.	.	.	.	.	.	.	.	.	.	T	12.54	1.967991	0.34754	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000544843	T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38	4.82	4.82	0.62117	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.269001	0.44285	D	0.000467	T	0.52933	0.1765	N	0.01705	-0.755	0.29462	N	0.857665	B;B;B;B;B;B;B	0.27416	0.0;0.178;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.27380	0.004;0.079;0.004;0.004;0.004;0.002;0.001	T	0.50642	-0.8804	10	0.16420	T	0.52	-20.3103	7.8385	0.29384	0.1847:0.0:0.0:0.8153	.	288;288;288;288;288;288;198	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	.;.;CK5P1_HUMAN;.;.;.;.	R	288;288;288;198;288	ENSP00000217372:K288R;ENSP00000350558:K288R;ENSP00000341840:K288R;ENSP00000408133:K198R;ENSP00000439034:K288R	ENSP00000341840:K288R	K	-	2	0	CDK5RAP1	31437130	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	5.213000	0.65230	2.019000	0.59389	0.460000	0.39030	AAG	.	.		0.498	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408	
USP11	8237	hgsc.bcm.edu	37	X	47104422	47104422	+	Silent	SNP	G	G	A			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chrX:47104422G>A	ENST00000218348.3	+	16	2223	c.2223G>A	c.(2221-2223)ccG>ccA	p.P741P	USP11_ENST00000377107.2_Silent_p.P698P	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	741	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CAGCCCAGCCGTACATTGCTA	0.567																																					p.P741P		Atlas-SNP	.											.	USP11	93	.	0			c.G2223A						.						64.0	55.0	58.0					X																	47104422		2203	4300	6503	SO:0001819	synonymous_variant	8237	exon16			CCAGCCGTACATT	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2223G>A	chrX.hg19:g.47104422G>A		53.0	0.0		72.0	31.0	NM_004651	B2RTX1|Q8IUG6|Q9BWE1	Silent	SNP	ENST00000218348.3	hg19	CCDS14277.1																																																																																			.	.		0.567	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718491	142718491	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chrX:142718491T>C	ENST00000381779.4	-	2	659	c.434A>G	c.(433-435)tAt>tGt	p.Y145C	SLITRK4_ENST00000356928.1_Missense_Mutation_p.Y145C|SLITRK4_ENST00000338017.4_Missense_Mutation_p.Y145C	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	145						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TCGTTCAATATACTTGATTAA	0.373																																					p.Y145C		Atlas-SNP	.											.	SLITRK4	162	.	0			c.A434G						.						81.0	82.0	82.0					X																	142718491		2203	4300	6503	SO:0001583	missense	139065	exon2			TCAATATACTTGA	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.434A>G	chrX.hg19:g.142718491T>C	ENSP00000371198:p.Tyr145Cys	117.0	0.0		120.0	19.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	T	9.541	1.113419	0.20795	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.58506	0.33;0.33;0.33	5.37	5.37	0.77165	.	0.358748	0.29501	N	0.011971	T	0.59636	0.2208	L	0.39020	1.185	0.39439	D	0.96721	B	0.33022	0.394	P	0.49637	0.617	T	0.61327	-0.7085	10	0.36615	T	0.2	-9.3469	9.2396	0.37489	0.1637:0.0:0.0:0.8363	.	145	Q8IW52	SLIK4_HUMAN	C	145	ENSP00000371198:Y145C;ENSP00000349400:Y145C;ENSP00000336627:Y145C	ENSP00000336627:Y145C	Y	-	2	0	SLITRK4	142546157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.685000	0.37659	1.788000	0.52465	0.486000	0.48141	TAT	.	.		0.373	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
IGDCC4	57722	hgsc.bcm.edu	37	15	65681239	65681240	+	Frame_Shift_Ins	INS	-	-	G	rs142796011		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr15:65681239_65681240insG	ENST00000352385.2	-	15	2822_2823	c.2613_2614insC	c.(2611-2616)cccacafs	p.T872fs		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	872	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTGGGCTCTGTGGGGGGGCACC	0.663																																					p.T872fs		Atlas-INDEL	.											.,1	IGDCC4	95	.	0			c.2614_2615insC						.																																			SO:0001589	frameshift_variant	57722	exon15			.		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2614dupC	chr15.hg19:g.65681246_65681246dupG	ENSP00000319623:p.Thr872fs	82.0	0.0		81.0	18.0	NM_020962	Q9HCE4	Frame_Shift_Ins	INS	ENST00000352385.2	hg19	CCDS10206.1																																																																																			.	.		0.663	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
TGFBR2	7048	hgsc.bcm.edu	37	3	30713509	30713509	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr3:30713509delC	ENST00000295754.5	+	4	1216	c.834delC	c.(832-834)atcfs	p.I278fs	TGFBR2_ENST00000359013.4_Frame_Shift_Del_p.I303fs	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CAGTCAAGATCTTTCCCTATG	0.498																																					p.I303fs		Atlas-INDEL	.											.	TGFBR2	139	.	0			c.908delT						.						145.0	137.0	140.0					3																	30713509		2203	4300	6503	SO:0001589	frameshift_variant	7048	exon5			.		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.834delC	chr3.hg19:g.30713509delC	ENSP00000295754:p.Ile278fs	124.0	0.0		159.0	66.0	NM_001024847	B4DTV5|Q15580|Q6DKT6|Q99474	Frame_Shift_Del	DEL	ENST00000295754.5	hg19	CCDS2648.1																																																																																			.	.		0.498	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
KLF5	688	hgsc.bcm.edu	37	13	73649897	73649901	+	Frame_Shift_Del	DEL	GATCG	GATCG	-	rs151120175		TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	GATCG	GATCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr13:73649897_73649901delGATCG	ENST00000377687.4	+	4	1783_1787	c.1247_1251delGATCG	c.(1246-1251)cgatcgfs	p.RS416fs	KLF5_ENST00000539231.1_Frame_Shift_Del_p.RS325fs	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	416					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		AGGTTCGCGCGATCGGATGAGCTGA	0.595																																					p.416_417del		Atlas-INDEL	.											.	KLF5	59	.	0			c.1246_1250del						.																																			SO:0001589	frameshift_variant	688	exon4			.	D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.1247_1251delGATCG	chr13.hg19:g.73649897_73649901delGATCG	ENSP00000366915:p.Arg416fs	71.0	0.0		92.0	11.0	NM_001730	L0R3U5|L0R4T9|Q9UHP8	Frame_Shift_Del	DEL	ENST00000377687.4	hg19	CCDS9448.1																																																																																			.	.		0.595	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1		
NF1	4763	hgsc.bcm.edu	37	17	29587388	29587388	+	Splice_Site	DEL	T	T	-			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr17:29587388delT	ENST00000358273.4	+	34	4815	c.4432delT	c.(4432-4434)ttt>tt	p.F1479fs	NF1_ENST00000356175.3_Splice_Site_p.F1458fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1479					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTTTGAAGGTTTTTCCTTGA	0.333			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.R1477fs		Atlas-INDEL	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.4431delG						.						103.0	98.0	100.0					17																	29587388		2203	4300	6503	SO:0001630	splice_region_variant	4763	exon34	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4431-1T>-	chr17.hg19:g.29587388delT		49.0	0.0		45.0	13.0	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	hg19	CCDS42292.1																																																																																			.	.		0.333	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Frame_Shift_Del
PPP1R13B	23368	hgsc.bcm.edu	37	14	104216135	104216136	+	Frame_Shift_Ins	INS	-	-	T			TCGA-ED-A97K-01A-21D-A382-10	TCGA-ED-A97K-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0f0404ca-e297-4913-86a1-c140b47e98fd	228563d9-a759-4c83-93c8-8ceb4c9e0e9f	g.chr14:104216135_104216136insT	ENST00000202556.9	-	8	1246_1247	c.964_965insA	c.(964-966)attfs	p.I322fs		NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	322					intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				ACATGCCTGAATTTTTTTCCCA	0.426																																					p.I322fs		Atlas-INDEL	.											.	PPP1R13B	72	.	0			c.965_966insA						.																																			SO:0001589	frameshift_variant	23368	exon8			.	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.965dupA	chr14.hg19:g.104216142_104216142dupT	ENSP00000202556:p.Ile322fs	79.0	0.0		78.0	25.0	NM_015316	B2RMX5|O94870	Frame_Shift_Ins	INS	ENST00000202556.9	hg19	CCDS41997.1																																																																																			.	.		0.426	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
