#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SSU72	29101	hgsc.bcm.edu	37	1	1509930	1509930	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:1509930G>A	ENST00000291386.3	-	1	319	c.8C>T	c.(7-9)tCg>tTg	p.S3L	SSU72_ENST00000359060.4_Missense_Mutation_p.S3L|AL645728.1_ENST00000366221.2_5'Flank	NM_014188.2	NP_054907.1	Q9NP77	SSU72_HUMAN	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	3					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|mRNA polyadenylation (GO:0006378)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)	p.S3L(1)		large_intestine(2)|lung(5)	7	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CAGCGGGGACGACGGCATGGC	0.706																																					p.S3L		Atlas-SNP	.											SSU72_ENST00000359060,NS,carcinoma,0,2	SSU72	15	.	1	Substitution - Missense(1)	lung(1)	c.C8T						.						37.0	25.0	29.0					1																	1509930		2195	4299	6494	SO:0001583	missense	29101	exon1			GGGGACGACGGCA	AJ276409	CCDS32.1	1p36	2010-03-24	2006-04-04		ENSG00000160075	ENSG00000160075			25016	protein-coding gene	gene with protein product			"""Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)"""			15125841, 15659578	Standard	NM_014188		Approved	HSPC182	uc001agd.3	Q9NP77	OTTHUMG00000000576	ENST00000291386.3:c.8C>T	chr1.hg19:g.1509930G>A	ENSP00000291386:p.Ser3Leu	184.0	0.0		60.0	3.0	NM_014188	Q9BZS6|Q9H933	Missense_Mutation	SNP	ENST00000291386.3	hg19	CCDS32.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.526432	0.64860	.	.	ENSG00000160075	ENST00000291386;ENST00000378725;ENST00000359060	T;T	0.16897	2.31;2.31	3.95	3.95	0.45737	.	0.350330	0.27294	N	0.020022	T	0.11452	0.0279	N	0.19112	0.55	0.45837	D	0.9987	B;B;B	0.26935	0.004;0.164;0.0	B;B;B	0.18263	0.009;0.021;0.001	T	0.12837	-1.0532	10	0.32370	T	0.25	-3.9771	14.7173	0.69280	0.0:0.0:1.0:0.0	.	3;3;3	B4DMK6;Q9NP77-2;Q9NP77	.;.;SSU72_HUMAN	L	3	ENSP00000291386:S3L;ENSP00000351955:S3L	ENSP00000291386:S3L	S	-	2	0	SSU72	1499793	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	2.977000	0.49297	2.051000	0.60960	0.313000	0.20887	TCG	.	.		0.706	SSU72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001366.1	NM_014188	
DFFB	1677	hgsc.bcm.edu	37	1	3775365	3775365	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:3775365C>T	ENST00000378209.3	+	2	521	c.198C>T	c.(196-198)aaC>aaT	p.N66N	DFFB_ENST00000378212.2_Silent_p.N66N|DFFB_ENST00000341385.3_Silent_p.N66N|CEP104_ENST00000378230.3_5'Flank|DFFB_ENST00000338895.3_Silent_p.N66N|CEP104_ENST00000378223.3_5'Flank	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	66	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.N66N(1)		endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TTCCCGACAACGCCGAGCTGG	0.652																																					p.N66N		Atlas-SNP	.											DFFB,NS,carcinoma,0,2	DFFB	30	.	1	Substitution - coding silent(1)	endometrium(1)	c.C198T						.						63.0	58.0	60.0					1																	3775365		2203	4300	6503	SO:0001819	synonymous_variant	1677	exon2			CGACAACGCCGAG		CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.198C>T	chr1.hg19:g.3775365C>T		104.0	0.0		94.0	4.0	NM_004402	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000378209.3	hg19	CCDS52.1																																																																																			.	.		0.652	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009821.2	NM_001282669	
TAS1R1	80835	hgsc.bcm.edu	37	1	6638906	6638906	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:6638906G>A	ENST00000333172.6	+	6	1981	c.1788G>A	c.(1786-1788)gtG>gtA	p.V596V	TAS1R1_ENST00000351136.3_Silent_p.V342V|ZBTB48_ENST00000377674.4_5'Flank|TAS1R1_ENST00000328191.4_3'UTR	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	596					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		ACACCCCTGTGGTGAGGTCAG	0.622																																					p.V596V		Atlas-SNP	.											.	TAS1R1	76	.	0			c.G1788A						.						41.0	39.0	40.0					1																	6638906		2203	4300	6503	SO:0001819	synonymous_variant	80835	exon6			CCCTGTGGTGAGG		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1788G>A	chr1.hg19:g.6638906G>A		107.0	0.0		100.0	5.0	NM_138697	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	hg19	CCDS81.1																																																																																			.	.		0.622	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
UBE4B	10277	hgsc.bcm.edu	37	1	10166449	10166449	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:10166449T>C	ENST00000343090.6	+	7	1079	c.1004T>C	c.(1003-1005)gTc>gCc	p.V335A	UBE4B_ENST00000253251.8_Intron|UBE4B_ENST00000377157.3_Intron	NM_001105562.2	NP_001099032.1			ubiquitination factor E4B									p.V335A(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CCCTACACTGTCACTCACCCA	0.647																																					p.V335A		Atlas-SNP	.											UBE4B_ENST00000343090,NS,carcinoma,0,1	UBE4B	233	.	1	Substitution - Missense(1)	endometrium(1)	c.T1004C						.						78.0	87.0	84.0					1																	10166449		2089	4204	6293	SO:0001583	missense	10277	exon7			ACACTGTCACTCA	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000343090.6:c.1004T>C	chr1.hg19:g.10166449T>C	ENSP00000343001:p.Val335Ala	102.0	0.0		60.0	3.0	NM_001105562		Missense_Mutation	SNP	ENST00000343090.6	hg19	CCDS41245.1	.	.	.	.	.	.	.	.	.	.	T	17.18	3.324437	0.60634	.	.	ENSG00000130939	ENST00000343090	T	0.53857	0.6	5.49	5.49	0.81192	.	0.357378	0.25405	N	0.030915	T	0.39545	0.1082	N	0.22421	0.69	0.80722	D	1	B	0.14438	0.01	B	0.14023	0.01	T	0.20042	-1.0287	10	0.18276	T	0.48	-4.8631	15.9029	0.79397	0.0:0.0:0.0:1.0	.	335	O95155	UBE4B_HUMAN	A	335	ENSP00000343001:V335A	ENSP00000343001:V335A	V	+	2	0	UBE4B	10089036	0.997000	0.39634	0.992000	0.48379	0.631000	0.37964	6.385000	0.73182	2.217000	0.71921	0.482000	0.46254	GTC	.	.		0.647	UBE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005016.1	NM_006048	
SPEN	23013	hgsc.bcm.edu	37	1	16263967	16263967	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:16263967T>C	ENST00000375759.3	+	12	10540	c.10336T>C	c.(10336-10338)Tct>Cct	p.S3446P		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3446	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCTTCCAGTCTCTCTTCCCAC	0.577																																					p.S3446P		Atlas-SNP	.											.	SPEN	374	.	0			c.T10336C						.						87.0	79.0	81.0					1																	16263967		2203	4300	6503	SO:0001583	missense	23013	exon12			CCAGTCTCTCTTC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10336T>C	chr1.hg19:g.16263967T>C	ENSP00000364912:p.Ser3446Pro	50.0	0.0		74.0	6.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	T	6.856	0.527276	0.13066	.	.	ENSG00000065526	ENST00000375759	T	0.07908	3.15	5.23	4.32	0.51571	.	.	.	.	.	T	0.02494	0.0076	N	0.00926	-1.1	0.22479	N	0.999069	B	0.02656	0.0	B	0.01281	0.0	T	0.35674	-0.9779	9	0.02654	T	1	-9.4211	10.649	0.45636	0.0:0.8513:0.0:0.1487	.	3446	Q96T58	MINT_HUMAN	P	3446	ENSP00000364912:S3446P	ENSP00000364912:S3446P	S	+	1	0	SPEN	16136554	0.397000	0.25270	0.890000	0.34922	0.338000	0.28826	1.080000	0.30779	1.318000	0.45170	-0.146000	0.13790	TCT	.	.		0.577	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
EPHB2	2048	hgsc.bcm.edu	37	1	23232489	23232489	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:23232489G>T	ENST00000400191.3	+	10	1793	c.1775G>T	c.(1774-1776)gGc>gTc	p.G592V	EPHB2_ENST00000374627.1_Missense_Mutation_p.G587V|EPHB2_ENST00000374630.3_Missense_Mutation_p.G592V|EPHB2_ENST00000374632.3_Missense_Mutation_p.G593V	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	592					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GTGACCCCAGGCATGAAGATC	0.522																																					p.G593V		Atlas-SNP	.											.	EPHB2	257	.	0			c.G1778T						.						85.0	79.0	81.0					1																	23232489		2203	4300	6503	SO:0001583	missense	2048	exon10			CCCCAGGCATGAA	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1775G>T	chr1.hg19:g.23232489G>T	ENSP00000383053:p.Gly592Val	99.0	0.0		89.0	38.0	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	hg19		.	.	.	.	.	.	.	.	.	.	G	21.6	4.180541	0.78677	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.12465	2.68;2.68;2.68;2.68	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	M	0.90542	3.125	0.80722	D	1	B;D;D;D	0.76494	0.035;0.999;0.998;0.995	B;D;D;D	0.76575	0.026;0.988;0.98;0.985	T	0.54417	-0.8297	10	0.66056	D	0.02	.	17.4757	0.87658	0.0:0.0:1.0:0.0	.	534;592;610;593	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	V	534;592;592;593;587	ENSP00000363761:G592V;ENSP00000383053:G592V;ENSP00000363763:G593V;ENSP00000363758:G587V	ENSP00000363755:G534V	G	+	2	0	EPHB2	23105076	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.774000	0.95407	0.644000	0.83932	GGC	.	.		0.522	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
ASAP3	55616	hgsc.bcm.edu	37	1	23759640	23759640	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:23759640A>G	ENST00000336689.3	-	22	2297	c.2253T>C	c.(2251-2253)tgT>tgC	p.C751C	ASAP3_ENST00000495646.1_Silent_p.C255C|ASAP3_ENST00000437606.2_Silent_p.C742C	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	751					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						AGGGCGGGGGACAGTCCTCAC	0.582																																					p.C751C		Atlas-SNP	.											.	ASAP3	65	.	0			c.T2253C						.						98.0	102.0	100.0					1																	23759640		2203	4300	6503	SO:0001819	synonymous_variant	55616	exon22			CGGGGGACAGTCC	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2253T>C	chr1.hg19:g.23759640A>G		118.0	0.0		164.0	7.0	NM_017707	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	ENST00000336689.3	hg19	CCDS235.1																																																																																			.	.		0.582	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
GMEB1	10691	hgsc.bcm.edu	37	1	29040628	29040628	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:29040628T>C	ENST00000294409.2	+	10	1155	c.1065T>C	c.(1063-1065)gaT>gaC	p.D355D	GMEB1_ENST00000373816.1_Silent_p.D345D|GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000361872.4_Silent_p.D345D	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	355					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		AAGGCCAGGATCACAGGCTGA	0.493																																					p.D355D		Atlas-SNP	.											.	GMEB1	28	.	0			c.T1065C						.						89.0	96.0	94.0					1																	29040628		2203	4300	6503	SO:0001819	synonymous_variant	10691	exon10			CCAGGATCACAGG	AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.1065T>C	chr1.hg19:g.29040628T>C		88.0	0.0		89.0	4.0	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Silent	SNP	ENST00000294409.2	hg19	CCDS327.1																																																																																			.	.		0.493	GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
SFPQ	6421	hgsc.bcm.edu	37	1	35656352	35656352	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:35656352T>G	ENST00000357214.5	-	3	1360	c.1262A>C	c.(1261-1263)aAg>aCg	p.K421T		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	421	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TGCTGCTGGCTTAGAAGCAAA	0.383			T	TFE3	papillary renal cell																																p.K421T		Atlas-SNP	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51	.	0			c.A1262C						.						139.0	135.0	137.0					1																	35656352		2203	4300	6503	SO:0001583	missense	6421	exon3			GCTGGCTTAGAAG	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1262A>C	chr1.hg19:g.35656352T>G	ENSP00000349748:p.Lys421Thr	137.0	0.0		155.0	57.0	NM_005066	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	hg19	CCDS388.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.481314	0.84747	.	.	ENSG00000116560	ENST00000357214	T	0.18016	2.24	5.52	5.52	0.82312	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.138027	0.64402	D	0.000004	T	0.35158	0.0922	L	0.45698	1.435	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	T	0.05468	-1.0883	10	0.72032	D	0.01	-13.1554	15.6879	0.77426	0.0:0.0:0.0:1.0	.	421	P23246	SFPQ_HUMAN	T	421	ENSP00000349748:K421T	ENSP00000349748:K421T	K	-	2	0	SFPQ	35428939	1.000000	0.71417	0.986000	0.45419	0.986000	0.74619	4.867000	0.63013	2.102000	0.63906	0.451000	0.29950	AAG	.	.		0.383	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
KIAA0319L	79932	hgsc.bcm.edu	37	1	35928258	35928258	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:35928258A>G	ENST00000325722.3	-	8	1492	c.1258T>C	c.(1258-1260)Tct>Cct	p.S420P	KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	420	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GTTGGCAAAGAGATCTCCTGG	0.448																																					p.S420P		Atlas-SNP	.											.	KIAA0319L	156	.	0			c.T1258C						.						89.0	82.0	84.0					1																	35928258		2203	4300	6503	SO:0001583	missense	79932	exon8			GCAAAGAGATCTC	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1258T>C	chr1.hg19:g.35928258A>G	ENSP00000318406:p.Ser420Pro	54.0	0.0		63.0	4.0	NM_024874	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	hg19	CCDS390.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.9|22.9	4.349505|4.349505	0.82132|0.82132	.|.	.|.	ENSG00000142687|ENSG00000142687	ENST00000431916|ENST00000325722;ENST00000426982;ENST00000440579	.|T;T;T	.|0.13657	.|2.57;2.57;2.57	5.54|5.54	4.38|4.38	0.52667|0.52667	.|PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (1);	.|0.183165	.|0.48767	.|D	.|0.000163	T|T	0.36608|0.36608	0.0973|0.0973	M|M	0.78223|0.78223	2.4|2.4	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.76575	.|0.988;0.972	T|T	0.10894|0.10894	-1.0610|-1.0610	5|10	.|0.59425	.|D	.|0.04	-6.7581|-6.7581	11.7978|11.7978	0.52110|0.52110	0.853:0.147:0.0:0.0|0.853:0.147:0.0:0.0	.|.	.|420;420	.|Q8IZA0-2;Q8IZA0	.|.;K319L_HUMAN	P|P	249|420	.|ENSP00000318406:S420P;ENSP00000395883:S420P;ENSP00000407576:S420P	.|ENSP00000318406:S420P	L|S	-|-	2|1	0|0	KIAA0319L|KIAA0319L	35700845|35700845	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.869000|5.869000	0.69613|0.69613	0.893000|0.893000	0.36288|0.36288	0.533000|0.533000	0.62120|0.62120	CTC|TCT	.	.		0.448	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874	
MYCL	4610	hgsc.bcm.edu	37	1	40363211	40363211	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:40363211T>C	ENST00000372816.2	-	2	1375	c.928A>G	c.(928-930)Acc>Gcc	p.T310A	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Missense_Mutation_p.T340A			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	310	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTGGCCAGGGTGGGCACCTGG	0.572																																					p.T340A		Atlas-SNP	.											MYCL1_ENST00000397332,NS,carcinoma,0,1	MYCL1	36	.	0			c.A1018G						.						59.0	61.0	61.0					1																	40363211		2203	4300	6503	SO:0001583	missense	4610	exon3			CCAGGGTGGGCAC		CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.928A>G	chr1.hg19:g.40363211T>C	ENSP00000361903:p.Thr310Ala	101.0	0.0		108.0	5.0	NM_001033082	A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Missense_Mutation	SNP	ENST00000372816.2	hg19	CCDS30682.1	.	.	.	.	.	.	.	.	.	.	T	1.501	-0.552160	0.03996	.	.	ENSG00000116990	ENST00000397332;ENST00000372816	D;D	0.98012	-4.66;-4.66	5.75	3.43	0.39272	Helix-loop-helix DNA-binding (5);	0.276577	0.41194	N	0.000926	D	0.90448	0.7009	N	0.05031	-0.125	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	D	0.83398	0.0021	10	0.18276	T	0.48	-28.1252	5.5714	0.17198	0.0:0.3228:0.0:0.6772	.	310	P12524	MYCL1_HUMAN	A	340;310	ENSP00000380494:T340A;ENSP00000361903:T310A	ENSP00000361903:T310A	T	-	1	0	MYCL1	40135798	0.996000	0.38824	1.000000	0.80357	0.994000	0.84299	2.211000	0.42825	1.017000	0.39495	0.533000	0.62120	ACC	.	.		0.572	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277004.1	NM_001033082	
ZNF691	51058	hgsc.bcm.edu	37	1	43316763	43316763	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:43316763T>C	ENST00000372506.1	+	4	474	c.134T>C	c.(133-135)cTg>cCg	p.L45P	ZNF691_ENST00000372508.3_Missense_Mutation_p.L45P|ZNF691_ENST00000372504.1_Missense_Mutation_p.L67P|ZNF691_ENST00000372507.1_Missense_Mutation_p.L45P|ZNF691_ENST00000397044.3_Missense_Mutation_p.L76P|ZNF691_ENST00000372502.1_Missense_Mutation_p.L67P	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	76						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAAGAGAGCCTGTCGGATGAA	0.562																																					p.L76P		Atlas-SNP	.											.	ZNF691	30	.	0			c.T227C						.						99.0	100.0	100.0					1																	43316763		2203	4300	6503	SO:0001583	missense	51058	exon4			AGAGCCTGTCGGA		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.134T>C	chr1.hg19:g.43316763T>C	ENSP00000361584:p.Leu45Pro	67.0	0.0		95.0	4.0	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	hg19	CCDS476.1	.	.	.	.	.	.	.	.	.	.	T	6.624	0.483629	0.12581	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000397034;ENST00000372503;ENST00000372502	T;T;T;T;T;T;T	0.09817	2.97;2.97;2.97;2.98;2.94;4.43;2.94	5.21	-5.05	0.02955	.	0.712288	0.12256	N	0.485209	T	0.03564	0.0102	N	0.08118	0	0.38060	D	0.936037	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.33650	-0.9860	10	0.56958	D	0.05	0.1626	1.018	0.01512	0.2198:0.2679:0.1125:0.3998	.	76;76	B4DJR7;Q5VV52	.;ZN691_HUMAN	P	45;45;45;76;67;76;76;67	ENSP00000361586:L45P;ENSP00000361585:L45P;ENSP00000361584:L45P;ENSP00000380237:L76P;ENSP00000361582:L67P;ENSP00000380228:L76P;ENSP00000361580:L67P	ENSP00000361580:L67P	L	+	2	0	ZNF691	43089350	0.000000	0.05858	0.031000	0.17742	0.546000	0.35178	-0.661000	0.05311	-0.648000	0.05437	0.533000	0.62120	CTG	.	.		0.562	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
ERI3	79033	hgsc.bcm.edu	37	1	44778868	44778868	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:44778868A>G	ENST00000372257.2	-	5	820	c.639T>C	c.(637-639)ggT>ggC	p.G213G	ERI3_ENST00000495828.1_5'UTR|ERI3_ENST00000537474.1_Silent_p.G36G|ERI3_ENST00000372259.5_Silent_p.G98G	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	213	Exonuclease.						exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGCTTGGCTGACCATCCACCA	0.532																																					p.G213G		Atlas-SNP	.											.	ERI3	39	.	0			c.T639C						.						91.0	89.0	90.0					1																	44778868		2203	4300	6503	SO:0001819	synonymous_variant	79033	exon5			TGGCTGACCATCC	AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.639T>C	chr1.hg19:g.44778868A>G		126.0	0.0		154.0	7.0	NM_024066	B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Silent	SNP	ENST00000372257.2	hg19	CCDS30696.1																																																																																			.	.		0.532	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020243.1	NM_024066	
NRD1	4898	hgsc.bcm.edu	37	1	52306079	52306079	+	Missense_Mutation	SNP	T	T	A	rs62648104		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:52306079T>A	ENST00000354831.7	-	2	638	c.449A>T	c.(448-450)gAg>gTg	p.E150V	NRD1_ENST00000544028.1_Missense_Mutation_p.E18V|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000539524.1_Missense_Mutation_p.E18V|NRD1_ENST00000352171.7_Missense_Mutation_p.E150V	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						ttcttcttcctccacctcctc	0.378																																					p.E150V		Atlas-SNP	.											.	NRD1	89	.	0			c.A449T						.						163.0	138.0	146.0					1																	52306079		2203	4300	6503	SO:0001583	missense	4898	exon2			TCTTCCTCCACCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.449A>T	chr1.hg19:g.52306079T>A	ENSP00000346890:p.Glu150Val	239.0	0.0		261.0	44.0	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.056	-0.194350	0.06259	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.38240	1.31;3.15;1.15;1.22	5.25	2.92	0.33932	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.525899	0.19688	N	0.108344	T	0.18341	0.0440	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23650	0.062;0.089;0.01	B;B;B	0.17098	0.017;0.007;0.007	T	0.14755	-1.0461	10	0.38643	T	0.18	-0.0317	5.1939	0.15225	0.0:0.1704:0.2022:0.6274	rs62648104	150;150;150	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	V	150;150;18;150;18	ENSP00000262679:E150V;ENSP00000346890:E150V;ENSP00000444416:E18V;ENSP00000442262:E18V	ENSP00000262679:E150V	E	-	2	0	NRD1	52078667	0.129000	0.22400	0.012000	0.15200	0.145000	0.21501	0.870000	0.28010	0.317000	0.23160	0.454000	0.30748	GAG	.	T|0.024;A|0.976		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
AK4	205	hgsc.bcm.edu	37	1	65690526	65690526	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:65690526T>C	ENST00000327299.7	+	4	735	c.530T>C	c.(529-531)gTg>gCg	p.V177A	AK4_ENST00000545314.1_Missense_Mutation_p.V177A|AK4_ENST00000546702.1_Missense_Mutation_p.V125A|AK4_ENST00000395334.2_Missense_Mutation_p.V177A	NM_013410.3	NP_037542.1			adenylate kinase 4											breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	9						TACAAAGACGTGGCAAAGCCA	0.473																																					p.V177A		Atlas-SNP	.											.	AK4	22	.	0			c.T530C						.						87.0	85.0	85.0					1																	65690526		2203	4300	6503	SO:0001583	missense	205	exon5			AAGACGTGGCAAA	AK025926	CCDS629.1	1p31.3	2012-10-02	2010-06-15	2010-06-15	ENSG00000162433	ENSG00000162433	2.7.4.3	"""Adenylate kinases"""	363	protein-coding gene	gene with protein product		103030	"""adenylate kinase 3"", ""adenylate kinase 3-like 1"""	AK3, AK3L1		11485571	Standard	NM_203464		Approved		uc001dby.3	P27144	OTTHUMG00000009033	ENST00000327299.7:c.530T>C	chr1.hg19:g.65690526T>C	ENSP00000322175:p.Val177Ala	108.0	0.0		122.0	6.0	NM_203464		Missense_Mutation	SNP	ENST00000327299.7	hg19	CCDS629.1	.	.	.	.	.	.	.	.	.	.	T	1.968	-0.437108	0.04636	.	.	ENSG00000162433	ENST00000545314;ENST00000546702;ENST00000395334;ENST00000327299	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.15	2.75	0.32379	.	0.253398	0.39146	N	0.001454	T	0.10035	0.0246	N	0.17631	0.505	0.38865	D	0.956569	B	0.06786	0.001	B	0.09377	0.004	T	0.08086	-1.0739	10	0.46703	T	0.11	-10.7039	3.1857	0.06599	0.1777:0.3235:0.0:0.4989	.	177	P27144	KAD4_HUMAN	A	177;125;177;177	ENSP00000445912:V177A;ENSP00000448458:V125A;ENSP00000378743:V177A;ENSP00000322175:V177A	ENSP00000322175:V177A	V	+	2	0	AK4	65463114	0.999000	0.42202	0.063000	0.19743	0.402000	0.30811	3.429000	0.52800	0.374000	0.24650	0.528000	0.53228	GTG	.	.		0.473	AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025040.2	NM_013410	
TCTEX1D1	200132	hgsc.bcm.edu	37	1	67241997	67241997	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:67241997C>G	ENST00000282670.2	+	4	375	c.247C>G	c.(247-249)Cat>Gat	p.H83D		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	83										large_intestine(2)|lung(10)|skin(1)	13						CACCGTCAATCATATTTTGAA	0.378																																					p.H83D		Atlas-SNP	.											.	TCTEX1D1	27	.	0			c.C247G						.						104.0	102.0	103.0					1																	67241997		2203	4300	6503	SO:0001583	missense	200132	exon4			GTCAATCATATTT	AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.247C>G	chr1.hg19:g.67241997C>G	ENSP00000282670:p.His83Asp	174.0	0.0		231.0	95.0	NM_152665	Q06YR9|Q5VYE1	Missense_Mutation	SNP	ENST00000282670.2	hg19	CCDS633.1	.	.	.	.	.	.	.	.	.	.	C	5.556	0.287404	0.10513	.	.	ENSG00000152760	ENST00000282670	T	0.27890	1.64	5.92	4.99	0.66335	.	0.452764	0.25971	N	0.027123	T	0.04497	0.0123	N	0.04787	-0.16	0.24258	N	0.99529	B	0.02656	0.0	B	0.04013	0.001	T	0.36504	-0.9745	10	0.13853	T	0.58	-18.0728	9.3461	0.38109	0.2651:0.5979:0.137:0.0	.	83	Q8N7M0	TC1D1_HUMAN	D	83	ENSP00000282670:H83D	ENSP00000282670:H83D	H	+	1	0	TCTEX1D1	67014585	0.714000	0.27936	0.988000	0.46212	0.894000	0.52154	2.053000	0.41326	1.452000	0.47756	0.655000	0.94253	CAT	.	.		0.378	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025399.2	NM_152665	
SLC35D1	23169	hgsc.bcm.edu	37	1	67512974	67512974	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:67512974A>G	ENST00000235345.5	-	7	695	c.610T>C	c.(610-612)Tac>Cac	p.Y204H	SLC35D1_ENST00000506472.2_Missense_Mutation_p.Y125H	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	204					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TGTTTTACGTATGCACCATTT	0.358																																					p.Y204H		Atlas-SNP	.											.	SLC35D1	22	.	0			c.T610C						.						170.0	156.0	161.0					1																	67512974		2203	4300	6503	SO:0001583	missense	23169	exon7			TTACGTATGCACC	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.610T>C	chr1.hg19:g.67512974A>G	ENSP00000235345:p.Tyr204His	61.0	0.0		75.0	4.0	NM_015139	A8K185|B7Z3X2|Q52LU5|Q92548	Missense_Mutation	SNP	ENST00000235345.5	hg19	CCDS636.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.336122	0.81801	.	.	ENSG00000116704	ENST00000235345;ENST00000506472	T;T	0.68624	-0.34;0.13	5.15	5.15	0.70609	Domain of unknown function DUF250 (1);	0.293349	0.39544	N	0.001333	T	0.75428	0.3848	M	0.76574	2.34	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.70016	0.967;0.928	T	0.77525	-0.2555	10	0.48119	T	0.1	-7.5711	14.2723	0.66159	1.0:0.0:0.0:0.0	.	125;204	B7Z3X2;Q9NTN3	.;S35D1_HUMAN	H	204;125	ENSP00000235345:Y204H;ENSP00000445189:Y125H	ENSP00000235345:Y204H	Y	-	1	0	SLC35D1	67285562	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	8.864000	0.92294	2.076000	0.62316	0.533000	0.62120	TAC	.	.		0.358	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
PTGER3	5733	hgsc.bcm.edu	37	1	71478142	71478142	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:71478142T>A	ENST00000306666.5	-	2	1133	c.923A>T	c.(922-924)aAt>aTt	p.N308I	PTGER3_ENST00000370932.2_Missense_Mutation_p.N308I|PTGER3_ENST00000370924.4_Missense_Mutation_p.N308I|PTGER3_ENST00000370931.3_Missense_Mutation_p.N308I|PTGER3_ENST00000356595.4_Missense_Mutation_p.N308I|PTGER3_ENST00000351052.5_Missense_Mutation_p.N308I|PTGER3_ENST00000414819.1_Missense_Mutation_p.N308I|PTGER3_ENST00000460330.1_Missense_Mutation_p.N308I|PTGER3_ENST00000354608.5_Missense_Mutation_p.N308I	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	308					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TGATGTCTGATTGAAGATCAT	0.393																																					p.N308I		Atlas-SNP	.											.	PTGER3	246	.	0			c.A923T						.						103.0	98.0	100.0					1																	71478142		2203	4300	6503	SO:0001583	missense	5733	exon2			GTCTGATTGAAGA	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.923A>T	chr1.hg19:g.71478142T>A	ENSP00000302313:p.Asn308Ile	65.0	0.0		99.0	35.0	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	hg19	CCDS657.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.877568	0.51801	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.64	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.309163	0.32134	N	0.006525	T	0.70360	0.3215	M	0.72353	2.195	0.36597	D	0.874467	D;D;D;D;D;D;D;D	0.71674	0.996;0.991;0.995;0.996;0.998;0.989;0.995;0.996	D;P;D;D;D;P;D;D	0.66602	0.945;0.903;0.909;0.945;0.945;0.843;0.909;0.945	T	0.69064	-0.5244	10	0.23302	T	0.38	-12.724	9.8856	0.41260	0.0:0.1424:0.0:0.8576	.	308;308;308;308;308;308;308;308	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	I	308	ENSP00000359969:N308I;ENSP00000359970:N308I;ENSP00000280208:N308I;ENSP00000418073:N308I;ENSP00000346624:N308I;ENSP00000349003:N308I;ENSP00000401423:N308I;ENSP00000302313:N308I;ENSP00000359962:N308I	ENSP00000302313:N308I	N	-	2	0	PTGER3	71250730	0.997000	0.39634	1.000000	0.80357	0.764000	0.43329	0.270000	0.18607	0.982000	0.38575	-0.425000	0.05940	AAT	.	.		0.393	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
FAM73A	374986	hgsc.bcm.edu	37	1	78309009	78309009	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:78309009A>G	ENST00000370791.3	+	8	945	c.913A>G	c.(913-915)Acc>Gcc	p.T305A	FAM73A_ENST00000443751.2_Missense_Mutation_p.T267A	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	305						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TACAGATATCACCATGAAGGG	0.398																																					p.T305A		Atlas-SNP	.											.	FAM73A	56	.	0			c.A913G						.						115.0	112.0	113.0					1																	78309009		2203	4300	6503	SO:0001583	missense	374986	exon8			GATATCACCATGA		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.913A>G	chr1.hg19:g.78309009A>G	ENSP00000359827:p.Thr305Ala	47.0	0.0		63.0	4.0	NM_001270384	Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	hg19	CCDS681.1	.	.	.	.	.	.	.	.	.	.	A	0.371	-0.934047	0.02340	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.22336	1.96;1.96	5.98	5.98	0.97165	.	0.236711	0.44097	D	0.000493	T	0.08980	0.0222	L	0.50333	1.59	0.28238	N	0.925799	B;B;P;B	0.37207	0.167;0.201;0.587;0.201	B;B;B;B	0.38156	0.077;0.197;0.266;0.197	T	0.26292	-1.0107	10	0.07990	T	0.79	-11.2822	15.0333	0.71725	1.0:0.0:0.0:0.0	.	267;305;305;305	F8W7S1;B7ZLZ8;Q8NAN2-2;Q8NAN2	.;.;.;FA73A_HUMAN	A	305;267	ENSP00000359827:T305A;ENSP00000393675:T267A	ENSP00000359827:T305A	T	+	1	0	FAM73A	78081597	0.998000	0.40836	0.041000	0.18516	0.293000	0.27360	4.990000	0.63876	2.289000	0.77006	0.533000	0.62120	ACC	.	.		0.398	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
RPAP2	79871	hgsc.bcm.edu	37	1	92789250	92789250	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:92789250C>G	ENST00000610020.1	+	8	882	c.773C>G	c.(772-774)tCc>tGc	p.S258C	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	258					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		AAAGCTAACTCCAAACACAAA	0.393																																					p.S258C		Atlas-SNP	.											.	RPAP2	48	.	0			c.C773G						.						117.0	111.0	113.0					1																	92789250		2203	4300	6503	SO:0001583	missense	79871	exon8			CTAACTCCAAACA	AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.773C>G	chr1.hg19:g.92789250C>G	ENSP00000476948:p.Ser258Cys	125.0	0.0		149.0	73.0	NM_024813	C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	ENST00000610020.1	hg19	CCDS740.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026453	0.54683	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	6.07	5.11	0.69529	.	0.457271	0.24613	N	0.037021	T	0.60637	0.2284	M	0.69823	2.125	0.31756	N	0.633972	D	0.64830	0.994	P	0.57371	0.819	T	0.64740	-0.6336	8	0.39692	T	0.17	-2.6866	14.1725	0.65519	0.0:0.923:0.0:0.077	.	258	Q8IXW5	RPAP2_HUMAN	C	258	.	ENSP00000359368:S258C	S	+	2	0	RPAP2	92561838	0.729000	0.28090	0.430000	0.26722	0.397000	0.30659	2.250000	0.43178	1.443000	0.47586	0.655000	0.94253	TCC	.	.		0.393	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028368.2	NM_024813	
MTF2	22823	hgsc.bcm.edu	37	1	93575851	93575851	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:93575851A>G	ENST00000370298.4	+	2	359	c.70A>G	c.(70-72)Acc>Gcc	p.T24A	MTF2_ENST00000370303.4_Missense_Mutation_p.T24A|MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000545708.1_Intron|MTF2_ENST00000540243.1_Intron	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	24					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		AAACCAAAAGACCCCAACATC	0.443																																					p.T24A		Atlas-SNP	.											.	MTF2	51	.	0			c.A70G						.						129.0	126.0	127.0					1																	93575851		2203	4300	6503	SO:0001583	missense	22823	exon2			CAAAAGACCCCAA	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.70A>G	chr1.hg19:g.93575851A>G	ENSP00000359321:p.Thr24Ala	120.0	0.0		140.0	8.0	NM_001164392	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	ENST00000370298.4	hg19	CCDS742.1	.	.	.	.	.	.	.	.	.	.	A	9.529	1.110349	0.20714	.	.	ENSG00000143033	ENST00000370298;ENST00000370303	T;T	0.21191	2.02;2.02	5.44	1.77	0.24775	.	0.480152	0.25183	N	0.032512	T	0.02230	0.0069	N	0.03115	-0.41	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40346	-0.9568	10	0.15499	T	0.54	1.5123	6.5706	0.22537	0.5173:0.1268:0.3559:0.0	.	24;24	B1AKT6;Q9Y483	.;MTF2_HUMAN	A	24	ENSP00000359321:T24A;ENSP00000359326:T24A	ENSP00000359321:T24A	T	+	1	0	MTF2	93348439	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.961000	0.29267	0.065000	0.16485	0.455000	0.32223	ACC	.	.		0.443	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358	
F3	2152	hgsc.bcm.edu	37	1	95001634	95001634	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:95001634T>C	ENST00000334047.7	-	3	462	c.299A>G	c.(298-300)aAg>aGg	p.K100R	F3_ENST00000480356.1_5'UTR|F3_ENST00000370207.4_Missense_Mutation_p.K100R	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	100					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	GTACGTCTGCTTCACATCCTT	0.493																																					p.K100R	Melanoma(40;358 1339 15970 39161)	Atlas-SNP	.											.	F3	21	.	0			c.A299G						.						257.0	229.0	239.0					1																	95001634		2203	4300	6503	SO:0001583	missense	2152	exon3			GTCTGCTTCACAT	BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.299A>G	chr1.hg19:g.95001634T>C	ENSP00000334145:p.Lys100Arg	108.0	0.0		121.0	5.0	NM_001993	D3DT47|Q6FHG2|Q86WH4	Missense_Mutation	SNP	ENST00000334047.7	hg19	CCDS750.1	.	.	.	.	.	.	.	.	.	.	T	8.932	0.963624	0.18583	.	.	ENSG00000117525	ENST00000334047;ENST00000370207	T;T	0.74737	-0.87;-0.87	5.48	-5.38	0.02673	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.429860	0.04043	N	0.303347	T	0.28830	0.0715	N	0.21097	0.63	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.05767	-1.0865	10	0.23302	T	0.38	.	1.8111	0.03090	0.128:0.3306:0.2626:0.2788	.	100;100	P13726-2;P13726	.;TF_HUMAN	R	100	ENSP00000334145:K100R;ENSP00000359226:K100R	ENSP00000334145:K100R	K	-	2	0	F3	94774222	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.596000	0.05720	-0.867000	0.04063	-0.479000	0.04858	AAG	.	.		0.493	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029593.1	NM_001993	
GPSM2	29899	hgsc.bcm.edu	37	1	109465167	109465168	+	Missense_Mutation	DNP	TT	TT	AA	rs374875864|rs79761186|rs35029887|rs201481482	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:109465167_109465168TT>AA	ENST00000406462.2	+	14	2342_2343	c.1569_1570TT>AA	c.(1567-1572)acTTct>acAAct	p.S524T	GPSM2_ENST00000264126.3_Missense_Mutation_p.S524T|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	524					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		CAACAACAACTTCTTCCACTCC	0.371																																					p.T523T|p.S524T		Atlas-SNP	.											.	GPSM2	56	.	0			c.T1569A|c.T1570A						.																																			SO:0001583	missense	29899	exon13			AACAACTTCTTCC|ACAACTTCTTCCA	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	Exception_encountered	chr1.hg19:g.109465167_109465168delinsAA	ENSP00000385510:p.Ser524Thr	10.0|7.0	0.0		25.0	8.0	NM_013296	Q5T1N8|Q6IBL7|Q8N0Z5	Silent|Missense_Mutation	SNP	ENST00000406462.2	hg19	CCDS792.2																																																																																			.	.		0.371	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032400.3	NM_013296	
RSBN1	54665	hgsc.bcm.edu	37	1	114354478	114354478	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:114354478T>C	ENST00000261441.5	-	1	620	c.557A>G	c.(556-558)aAg>aGg	p.K186R	RP5-1073O3.2_ENST00000429398.1_RNA|RP5-1073O3.2_ENST00000418238.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	186	His-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGTGGCCCTTATGCTTGGG	0.677																																					p.K186R		Atlas-SNP	.											.	RSBN1	71	.	0			c.A557G						.						57.0	49.0	52.0					1																	114354478		2203	4300	6503	SO:0001583	missense	54665	exon1			TGGCCCTTATGCT	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.557A>G	chr1.hg19:g.114354478T>C	ENSP00000261441:p.Lys186Arg	77.0	0.0		74.0	4.0	NM_018364	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	ENST00000261441.5	hg19	CCDS862.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403479	0.62288	.	.	ENSG00000081019	ENST00000261441	.	.	.	4.23	4.23	0.50019	.	0.172694	0.37483	N	0.002073	T	0.16214	0.0390	N	0.08118	0	0.25420	N	0.988274	P	0.49696	0.927	P	0.56563	0.801	T	0.05582	-1.0876	9	0.33940	T	0.23	-7.2464	9.6322	0.39787	0.0:0.0:0.0:1.0	.	186	Q5VWQ0	RSBN1_HUMAN	R	186	.	ENSP00000261441:K186R	K	-	2	0	RSBN1	114156001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.294000	0.51787	1.775000	0.52247	0.533000	0.62120	AAG	.	.		0.677	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
PTPN22	26191	hgsc.bcm.edu	37	1	114380814	114380814	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:114380814G>A	ENST00000359785.5	-	13	1343	c.1208C>T	c.(1207-1209)cCa>cTa	p.P403L	PTPN22_ENST00000538253.1_Missense_Mutation_p.P159L|PTPN22_ENST00000525799.1_Missense_Mutation_p.P276L|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000528414.1_Missense_Mutation_p.P348L|PTPN22_ENST00000420377.2_Missense_Mutation_p.P403L	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	403					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCAACTATTGGAAATGCCTT	0.403																																					p.P403L		Atlas-SNP	.											.	PTPN22	90	.	0			c.C1208T						.						86.0	88.0	87.0					1																	114380814		2203	4300	6503	SO:0001583	missense	26191	exon13			ACTATTGGAAATG	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1208C>T	chr1.hg19:g.114380814G>A	ENSP00000352833:p.Pro403Leu	126.0	0.0		124.0	45.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	hg19	CCDS863.1	.	.	.	.	.	.	.	.	.	.	G	7.931	0.740675	0.15642	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.58	2.66	0.31614	.	0.342816	0.25546	N	0.029933	T	0.13286	0.0322	L	0.55103	1.725	0.09310	N	0.999998	B;B;B;B;B;B	0.24043	0.096;0.034;0.004;0.005;0.008;0.004	B;B;B;B;B;B	0.27608	0.081;0.012;0.005;0.005;0.008;0.005	T	0.17806	-1.0357	10	0.38643	T	0.18	.	4.8974	0.13757	0.2456:0.1581:0.5963:0.0	.	159;276;403;348;403;403	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	L	403;348;159;403;276;403	ENSP00000352833:P403L;ENSP00000435176:P348L;ENSP00000439372:P159L;ENSP00000388229:P403L;ENSP00000432674:P276L	ENSP00000346621:P403L	P	-	2	0	PTPN22	114182337	0.026000	0.19158	0.011000	0.14972	0.413000	0.31143	1.052000	0.30429	0.702000	0.31825	0.655000	0.94253	CCA	.	.		0.403	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
AMPD1	270	hgsc.bcm.edu	37	1	115215782	115215782	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:115215782A>G	ENST00000520113.2	-	16	2311	c.2296T>C	c.(2296-2298)Tgt>Cgt	p.C766R	AMPD1_ENST00000369538.3_Missense_Mutation_p.C762R|AMPD1_ENST00000353928.6_Missense_Mutation_p.C733R			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	766					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	AGTTCATAACACCAGGTTTCA	0.383																																					p.C766R		Atlas-SNP	.											.	AMPD1	223	.	0			c.T2296C						.						82.0	77.0	79.0					1																	115215782		2203	4300	6503	SO:0001583	missense	270	exon16			CATAACACCAGGT	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.2296T>C	chr1.hg19:g.115215782A>G	ENSP00000430075:p.Cys766Arg	164.0	0.0		149.0	6.0	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	hg19	CCDS876.2	.	.	.	.	.	.	.	.	.	.	A	17.54	3.414061	0.62511	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.82081	-1.57;-1.57;-1.57	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.83871	0.5348	L	0.48362	1.52	0.80722	D	1	D;D	0.76494	0.999;0.992	D;D	0.83275	0.996;0.923	T	0.81123	-0.1076	10	0.18710	T	0.47	-18.2802	15.9461	0.79796	1.0:0.0:0.0:0.0	.	762;733	Q5TF02;P23109	.;AMPD1_HUMAN	R	766;762;733	ENSP00000430075:C766R;ENSP00000358551:C762R;ENSP00000316520:C733R	ENSP00000316520:C733R	C	-	1	0	AMPD1	115017305	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.229000	0.72834	0.482000	0.46254	TGT	.	.		0.383	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
IGSF3	3321	hgsc.bcm.edu	37	1	117122269	117122269	+	Missense_Mutation	SNP	G	G	C	rs531457319|rs562520690	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:117122269G>C	ENST00000369486.3	-	10	3844	c.3079C>G	c.(3079-3081)Cca>Gca	p.P1027A	IGSF3_ENST00000369483.1_Missense_Mutation_p.P1047A|IGSF3_ENST00000318837.6_Missense_Mutation_p.P1047A	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1027	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CGCTCTGTTGGgtcgtcgtcg	0.642																																					p.P1047A		Atlas-SNP	.											.	IGSF3	294	.	0			c.C3139G						.						31.0	31.0	31.0					1																	117122269		2202	4300	6502	SO:0001583	missense	3321	exon11			CTGTTGGGTCGTC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3079C>G	chr1.hg19:g.117122269G>C	ENSP00000358498:p.Pro1027Ala	93.0	0.0		89.0	5.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	G	2.924	-0.222631	0.06061	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.21031	2.03;2.03;2.03	3.81	2.91	0.33838	Immunoglobulin subtype (1);Immunoglobulin-like (1);	1.010950	0.07921	N	0.975860	T	0.04003	0.0112	N	0.08118	0	0.09310	N	1	B;B	0.15141	0.012;0.001	B;B	0.15870	0.014;0.004	T	0.41680	-0.9495	10	0.35671	T	0.21	-3.6628	9.9136	0.41421	0.1033:0.0:0.8967:0.0	.	1027;1047	O75054;A6NJZ6	IGSF3_HUMAN;.	A	1027;1047;1047	ENSP00000358498:P1027A;ENSP00000358495:P1047A;ENSP00000321184:P1047A	ENSP00000321184:P1047A	P	-	1	0	IGSF3	116923792	0.000000	0.05858	0.013000	0.15412	0.133000	0.20885	0.089000	0.15002	1.190000	0.43042	-0.448000	0.05591	CCA	.	.		0.642	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
TTF2	8458	hgsc.bcm.edu	37	1	117634026	117634026	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:117634026A>G	ENST00000369466.4	+	16	2709	c.2665A>G	c.(2665-2667)Agt>Ggt	p.S889G		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	889					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TAATCCATTCAGTAGAGGTAA	0.378																																					p.S889G		Atlas-SNP	.											.	TTF2	92	.	0			c.A2665G						.						120.0	124.0	123.0					1																	117634026		2203	4300	6503	SO:0001583	missense	8458	exon16			CCATTCAGTAGAG	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.2665A>G	chr1.hg19:g.117634026A>G	ENSP00000358478:p.Ser889Gly	46.0	0.0		71.0	4.0	NM_003594	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	ENST00000369466.4	hg19	CCDS892.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.465640	0.43839	.	.	ENSG00000116830	ENST00000369466	D	0.87412	-2.25	5.74	2.05	0.26809	SNF2-related (1);	0.646821	0.13731	N	0.366662	T	0.66752	0.2821	L	0.38175	1.15	0.27843	N	0.941049	P	0.35527	0.507	B	0.40702	0.338	T	0.56505	-0.7968	10	0.24483	T	0.36	0.2758	4.4553	0.11640	0.5082:0.3358:0.156:0.0	.	889	Q9UNY4	TTF2_HUMAN	G	889	ENSP00000358478:S889G	ENSP00000358478:S889G	S	+	1	0	TTF2	117435549	0.914000	0.31030	0.678000	0.29963	0.767000	0.43475	1.130000	0.31393	0.400000	0.25396	0.496000	0.49642	AGT	.	.		0.378	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3		
CHD1L	9557	hgsc.bcm.edu	37	1	146737617	146737617	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:146737617C>G	ENST00000369258.4	+	8	786	c.766C>G	c.(766-768)Cca>Gca	p.P256A	CHD1L_ENST00000431239.1_Missense_Mutation_p.P256A|CHD1L_ENST00000361293.5_5'UTR|CHD1L_ENST00000369259.3_Missense_Mutation_p.P52A|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	256					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					ACTCTTGCAGCCATTTCTGCT	0.413																																					p.P256A		Atlas-SNP	.											.	CHD1L	72	.	0			c.C766G						.						74.0	69.0	71.0					1																	146737617		2203	4300	6503	SO:0001583	missense	9557	exon8			TTGCAGCCATTTC	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.766C>G	chr1.hg19:g.146737617C>G	ENSP00000358262:p.Pro256Ala	109.0	0.0		94.0	4.0	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	hg19	CCDS927.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.8|20.8	4.043725|4.043725	0.75732|0.75732	.|.	.|.	ENSG00000131778|ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000436230|ENST00000254086	D;D;D|.	0.94687|.	-3.49;-3.21;-3.49|.	5.48|5.48	5.48|5.48	0.80851|0.80851	SNF2-related (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75539|0.75539	0.3863|0.3863	M|M	0.84511|0.84511	2.7|2.7	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.997;1.0;0.996|.	T|T	0.78283|0.78283	-0.2264|-0.2264	10|6	0.25106|0.54805	T|T	0.35|0.06	.|.	16.8472|16.8472	0.85984|0.85984	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	256;52;256|.	Q86WJ1-2;Q86WJ1-3;Q86WJ1|.	.;.;CHD1L_HUMAN|.	A|R	256;52;256;156|216	ENSP00000389031:P256A;ENSP00000358263:P52A;ENSP00000358262:P256A|.	ENSP00000358262:P256A|ENSP00000254086:S216R	P|S	+|+	1|3	0|2	CHD1L|CHD1L	145204241|145204241	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.951000|0.951000	0.60555|0.60555	7.302000|7.302000	0.78861|0.78861	2.588000|2.588000	0.87417|0.87417	0.563000|0.563000	0.77884|0.77884	CCA|AGC	.	.		0.413	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
MCL1	4170	hgsc.bcm.edu	37	1	150551951	150551951	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:150551951G>A	ENST00000369026.2	-	1	115	c.56C>T	c.(55-57)gCc>gTc	p.A19V	MCL1_ENST00000464132.1_5'Flank|MCL1_ENST00000307940.3_Missense_Mutation_p.A19V	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	19					apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCCCAAGCCGGCCCCCCCACA	0.682																																					p.A19V		Atlas-SNP	.											.	MCL1	27	.	0			c.C56T						.						9.0	13.0	12.0					1																	150551951		1246	2578	3824	SO:0001583	missense	4170	exon1			AAGCCGGCCCCCC	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.56C>T	chr1.hg19:g.150551951G>A	ENSP00000358022:p.Ala19Val	82.0	0.0		138.0	33.0	NM_182763	B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Missense_Mutation	SNP	ENST00000369026.2	hg19	CCDS957.1	.	.	.	.	.	.	.	.	.	.	g	17.64	3.440387	0.63067	.	.	ENSG00000143384	ENST00000369026;ENST00000307940;ENST00000439749	T;T	0.35421	2.42;1.31	4.72	4.72	0.59763	.	0.633271	0.13115	N	0.412699	T	0.26448	0.0646	L	0.29908	0.895	0.09310	N	0.999999	D;P	0.53619	0.961;0.476	P;B	0.52909	0.713;0.225	T	0.08576	-1.0715	10	0.66056	D	0.02	-4.2208	13.0603	0.59003	0.0:0.0:1.0:0.0	.	19;19	Q07820-2;Q07820	.;MCL1_HUMAN	V	19	ENSP00000358022:A19V;ENSP00000309973:A19V	ENSP00000309973:A19V	A	-	2	0	MCL1	148818575	0.744000	0.28250	0.162000	0.22713	0.008000	0.06430	3.040000	0.49799	2.459000	0.83118	0.556000	0.70494	GCC	.	.		0.682	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084402.1	NM_021960	
THEM4	117145	hgsc.bcm.edu	37	1	151867506	151867506	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:151867506T>G	ENST00000368814.3	-	2	613	c.264A>C	c.(262-264)caA>caC	p.Q88H	THEM4_ENST00000489410.1_Missense_Mutation_p.Q88H	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	88					epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTTGAAGTCTTGAATCCATT	0.373																																					p.Q88H		Atlas-SNP	.											.	THEM4	19	.	0			c.A264C						.						119.0	119.0	119.0					1																	151867506		2203	4300	6503	SO:0001583	missense	117145	exon2			GAAGTCTTGAATC	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.264A>C	chr1.hg19:g.151867506T>G	ENSP00000357804:p.Gln88His	97.0	0.0		241.0	11.0	NM_053055	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	hg19	CCDS1006.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.332748	0.41297	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.36340	2.4;1.26	3.67	0.0402	0.14208	.	0.876505	0.10037	N	0.723986	T	0.13628	0.0330	L	0.59436	1.845	0.09310	N	1	P	0.41041	0.736	B	0.38712	0.28	T	0.15723	-1.0427	10	0.51188	T	0.08	0.114	3.3509	0.07151	0.0:0.2256:0.2073:0.5671	.	88	Q5T1C6	THEM4_HUMAN	H	88	ENSP00000357804:Q88H;ENSP00000433304:Q88H	ENSP00000357804:Q88H	Q	-	3	2	THEM4	150134130	0.002000	0.14202	0.000000	0.03702	0.015000	0.08874	0.470000	0.22084	-0.013000	0.14199	-0.280000	0.10049	CAA	.	.		0.373	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
DENND4B	9909	hgsc.bcm.edu	37	1	153907287	153907287	+	Missense_Mutation	SNP	G	G	C	rs3835302|rs199597671		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:153907287G>C	ENST00000361217.4	-	18	3140	c.2722C>G	c.(2722-2724)Cag>Gag	p.Q908E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			tcctgctgctgctgctgctgc	0.632																																					p.Q908E		Atlas-SNP	.											.	DENND4B	210	.	0			c.C2722G						.						23.0	27.0	26.0					1																	153907287		2184	4281	6465	SO:0001583	missense	9909	exon18			GCTGCTGCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722C>G	chr1.hg19:g.153907287G>C	ENSP00000354597:p.Gln908Glu	14.0	0.0		143.0	48.0	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	hg19	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	1.785	-0.481073	0.04383	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06294	3.33;3.32	2.67	0.673	0.17941	.	5.053470	0.00166	N	0.000001	T	0.00815	0.0027	N	0.14661	0.345	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.26573	-1.0099	10	0.02654	T	1	-2.4288	3.3651	0.07201	0.1454:0.0:0.5849:0.2697	.	908	O75064	DEN4B_HUMAN	E	908;919	ENSP00000354597:Q908E;ENSP00000357635:Q919E	ENSP00000354597:Q908E	Q	-	1	0	DENND4B	152173911	0.943000	0.32029	0.986000	0.45419	0.760000	0.43138	0.537000	0.23144	0.194000	0.20326	0.271000	0.19318	CAG	.	.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
DENND4B	9909	hgsc.bcm.edu	37	1	153907315	153907315	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:153907315C>T	ENST00000361217.4	-	18	3112	c.2694G>A	c.(2692-2694)caG>caA	p.Q898Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	898	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gttgctgctgctgctgctgtt	0.647																																					p.Q898Q		Atlas-SNP	.											.	DENND4B	210	.	0			c.G2694A						.						37.0	46.0	43.0					1																	153907315		2194	4286	6480	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2694G>A	chr1.hg19:g.153907315C>T		86.0	0.0		182.0	14.0	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	hg19	CCDS44228.1																																																																																			.	.		0.647	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
ASH1L	55870	hgsc.bcm.edu	37	1	155448559	155448559	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:155448559T>C	ENST00000368346.3	-	3	4741	c.4102A>G	c.(4102-4104)Agc>Ggc	p.S1368G	ASH1L_ENST00000392403.3_Missense_Mutation_p.S1368G			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1368					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AAACTAAGGCTGTGCATAAAA	0.433																																					p.S1368G		Atlas-SNP	.											.	ASH1L	279	.	0			c.A4102G						.						79.0	71.0	74.0					1																	155448559		2203	4300	6503	SO:0001583	missense	55870	exon3			TAAGGCTGTGCAT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.4102A>G	chr1.hg19:g.155448559T>C	ENSP00000357330:p.Ser1368Gly	50.0	0.0		146.0	6.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	T	7.800	0.713437	0.15306	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.92752	-3.1;-3.1	4.92	4.92	0.64577	.	0.053086	0.85682	D	0.000000	T	0.56834	0.2012	N	0.01352	-0.895	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.13407	0.004;0.009	T	0.61501	-0.7050	10	0.02654	T	1	.	9.007	0.36117	0.0:0.0834:0.0:0.9166	.	1368;1368	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	G	1368	ENSP00000357330:S1368G;ENSP00000376204:S1368G	ENSP00000357330:S1368G	S	-	1	0	ASH1L	153715183	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.843000	0.62838	2.061000	0.61500	0.482000	0.46254	AGC	.	.		0.433	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
YY1AP1	55249	hgsc.bcm.edu	37	1	155630158	155630158	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:155630158A>G	ENST00000295566.4	-	11	1704	c.1681T>C	c.(1681-1683)Tcc>Ccc	p.S561P	YY1AP1_ENST00000368340.5_Missense_Mutation_p.S633P|YY1AP1_ENST00000359205.5_Missense_Mutation_p.S504P|YY1AP1_ENST00000368339.5_Missense_Mutation_p.S653P|YY1AP1_ENST00000404643.1_Missense_Mutation_p.S495P|YY1AP1_ENST00000535662.1_Missense_Mutation_p.S361P|YY1AP1_ENST00000368330.2_Missense_Mutation_p.S515P|YY1AP1_ENST00000361831.5_Missense_Mutation_p.S504P|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000355499.4_Missense_Mutation_p.S515P|YY1AP1_ENST00000407221.1_Missense_Mutation_p.S484P|YY1AP1_ENST00000311573.5_Missense_Mutation_p.S484P|MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000347088.5_Missense_Mutation_p.S515P	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	561					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					GAGGCAGGGGAGGGCATCATT	0.557																																					p.S653P		Atlas-SNP	.											.	YY1AP1	104	.	0			c.T1957C						.						73.0	70.0	71.0					1																	155630158		2203	4300	6503	SO:0001583	missense	55249	exon10			CAGGGGAGGGCAT	BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.1681T>C	chr1.hg19:g.155630158A>G	ENSP00000295566:p.Ser561Pro	82.0	0.0		247.0	14.0	NM_001198903	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	hg19	CCDS1115.1	.	.	.	.	.	.	.	.	.	.	a	11.77	1.739015	0.30774	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662	T;T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	2.53	2.53	0.30540	.	0.420404	0.20424	N	0.092611	T	0.44286	0.1286	L	0.51422	1.61	0.27856	N	0.940571	D;D;P;D;D	0.76494	0.982;0.999;0.914;0.998;0.999	P;D;P;D;D	0.80764	0.737;0.994;0.838;0.917;0.994	T	0.16867	-1.0388	10	0.62326	D	0.03	.	7.4814	0.27406	0.5407:0.4593:0.0:0.0	.	653;495;561;515;633	B4DMP2;Q9H869-4;Q9H869;Q9H869-2;Q5VYZ1	.;.;YYAP1_HUMAN;.;.	P	504;515;484;515;504;633;561;515;484;495;653;361	ENSP00000352134:S504P;ENSP00000347686:S515P;ENSP00000311138:S484P;ENSP00000316079:S515P;ENSP00000355298:S504P;ENSP00000357324:S633P;ENSP00000295566:S561P;ENSP00000357314:S515P;ENSP00000385791:S484P;ENSP00000385390:S495P;ENSP00000357323:S653P;ENSP00000437926:S361P	ENSP00000295566:S561P	S	-	1	0	YY1AP1	153896782	0.732000	0.28121	0.958000	0.39756	0.373000	0.29922	0.986000	0.29590	1.165000	0.42670	0.254000	0.18369	TCC	.	.		0.557	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
IFI16	3428	hgsc.bcm.edu	37	1	158988074	158988074	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:158988074A>T	ENST00000295809.7	+	5	860	c.605A>T	c.(604-606)aAa>aTa	p.K202I	IFI16_ENST00000368131.4_Missense_Mutation_p.K202I|IFI16_ENST00000368132.3_Missense_Mutation_p.K202I|IFI16_ENST00000448393.2_Missense_Mutation_p.K202I|IFI16_ENST00000340979.6_Missense_Mutation_p.K202I|IFI16_ENST00000430894.2_Missense_Mutation_p.K150I|IFI16_ENST00000359709.3_Missense_Mutation_p.K146I			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	202	HIN-200 1. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 C-terminus.		K -> E (in dbSNP:rs11585341).		activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GTTCTCCAAAAACGCCCAGTG	0.398																																					p.K202I		Atlas-SNP	.											.	IFI16	111	.	0			c.A605T						.						86.0	81.0	82.0					1																	158988074		2203	4300	6503	SO:0001583	missense	3428	exon5			TCCAAAAACGCCC	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.605A>T	chr1.hg19:g.158988074A>T	ENSP00000295809:p.Lys202Ile	128.0	0.0		364.0	120.0	NM_005531	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.97|13.97	2.396697|2.396697	0.42512|0.42512	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894|ENST00000448393	T;T;T;T;T|.	0.15952|.	2.38;2.38;2.38;2.38;2.38|.	2.78|2.78	-4.66|-4.66	0.03329|0.03329	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.22936|0.22936	0.0554|0.0554	M|M	0.69358|0.69358	2.11|2.11	0.09310|0.09310	N|N	1|1	B;B;B|.	0.29508|.	0.139;0.114;0.246|.	P;B;P|.	0.45428|.	0.48;0.348;0.48|.	T|T	0.42682|0.42682	-0.9437|-0.9437	9|5	0.72032|.	D|.	0.01|.	.|.	5.6331|5.6331	0.17522|0.17522	0.2787:0.5828:0.1384:0.0|0.2787:0.5828:0.1384:0.0	.|.	150;202;202|.	E7EPR3;Q16666-2;Q16666|.	.;.;IF16_HUMAN|.	I|Y	202;202;202;202;202;150|23	ENSP00000295809:K202I;ENSP00000342741:K202I;ENSP00000357113:K202I;ENSP00000357114:K202I;ENSP00000394935:K150I|.	ENSP00000295809:K202I|.	K|N	+|+	2|1	0|0	IFI16|IFI16	157254698|157254698	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.797000|-0.797000	0.04570|0.04570	-0.568000|-0.568000	0.06038|0.06038	0.379000|0.379000	0.24179|0.24179	AAA|AAC	.	.		0.398	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
ATP1A4	480	hgsc.bcm.edu	37	1	160151564	160151564	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:160151564T>C	ENST00000368081.4	+	19	3298	c.2827T>C	c.(2827-2829)Tcc>Ccc	p.S943P	ATP1A4_ENST00000470705.1_Missense_Mutation_p.S79P|ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	943					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCTCATCATCTCCAAGACTCG	0.522																																					p.S943P		Atlas-SNP	.											.	ATP1A4	167	.	0			c.T2827C						.						164.0	166.0	165.0					1																	160151564		2203	4300	6503	SO:0001583	missense	480	exon19			ATCATCTCCAAGA	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2827T>C	chr1.hg19:g.160151564T>C	ENSP00000357060:p.Ser943Pro	175.0	0.0		447.0	18.0	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	hg19	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	T	13.59	2.283604	0.40394	.	.	ENSG00000132681	ENST00000368081;ENST00000470705	D;D	0.96104	-3.91;-3.91	4.16	4.16	0.48862	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.050605	0.85682	D	0.000000	D	0.94255	0.8155	M	0.83483	2.645	0.32463	N	0.543875	P	0.44659	0.84	P	0.49477	0.612	D	0.93747	0.7055	10	0.87932	D	0	.	6.3642	0.21445	0.0:0.11:0.0:0.89	.	943	Q13733	AT1A4_HUMAN	P	943;79	ENSP00000357060:S943P;ENSP00000433094:S79P	ENSP00000357060:S943P	S	+	1	0	ATP1A4	158418188	1.000000	0.71417	1.000000	0.80357	0.085000	0.17905	4.947000	0.63583	1.877000	0.54381	0.374000	0.22700	TCC	.	.		0.522	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
F5	2153	hgsc.bcm.edu	37	1	169555549	169555549	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:169555549T>C	ENST00000367797.3	-	1	277	c.76A>G	c.(76-78)Aca>Gca	p.T26A	F5_ENST00000367796.3_Missense_Mutation_p.T26A|F5_ENST00000546081.1_5'UTR	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	26					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GCCGCTTCTGTCCCTTGGCTC	0.612																																					p.T26A		Atlas-SNP	.											.	F5	301	.	0			c.A76G						.						73.0	55.0	61.0					1																	169555549		2203	4300	6503	SO:0001583	missense	2153	exon1			CTTCTGTCCCTTG	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.76A>G	chr1.hg19:g.169555549T>C	ENSP00000356771:p.Thr26Ala	96.0	0.0		220.0	10.0	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	hg19	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.109576	0.00353	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.97959	-4.63;-4.63	5.38	3.43	0.39272	Cupredoxin (1);	1.249000	0.05648	N	0.584627	T	0.82056	0.4954	N	0.02916	-0.46	0.27738	N	0.944598	B	0.02656	0.0	B	0.01281	0.0	T	0.77713	-0.2485	10	0.09084	T	0.74	-0.9191	6.8045	0.23770	0.0:0.7709:0.0:0.2291	.	26	P12259	FA5_HUMAN	A	26	ENSP00000356771:T26A;ENSP00000356770:T26A	ENSP00000356770:T26A	T	-	1	0	F5	167822173	0.025000	0.19082	0.026000	0.17262	0.059000	0.15707	0.509000	0.22707	0.563000	0.29222	-0.366000	0.07423	ACA	.	.		0.612	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
PRRC2C	23215	hgsc.bcm.edu	37	1	171510373	171510373	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:171510373C>T	ENST00000338920.4	+	16	3999	c.3762C>T	c.(3760-3762)gtC>gtT	p.V1254V	PRRC2C_ENST00000426496.2_Silent_p.V1254V|PRRC2C_ENST00000367742.3_Silent_p.V1256V|PRRC2C_ENST00000392078.3_Silent_p.V1256V	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1254					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TTGAAGTTGTCCCCAAAAGAA	0.458																																					p.V1254V		Atlas-SNP	.											.	.	.	.	0			c.C3762T						.						51.0	51.0	51.0					1																	171510373		2203	4300	6503	SO:0001819	synonymous_variant	23215	exon16			AGTTGTCCCCAAA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.3762C>T	chr1.hg19:g.171510373C>T		157.0	0.0		431.0	29.0	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	ENST00000338920.4	hg19	CCDS1296.2																																																																																			.	.		0.458	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
TDRD5	163589	hgsc.bcm.edu	37	1	179564922	179564922	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:179564922C>G	ENST00000367614.1	+	4	1159	c.800C>G	c.(799-801)tCa>tGa	p.S267*	TDRD5_ENST00000444136.1_Nonsense_Mutation_p.S267*|TDRD5_ENST00000294848.8_Nonsense_Mutation_p.S267*	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	267					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						GTGGAGACTTCAAGACTGAAT	0.358																																					p.S267X		Atlas-SNP	.											.	TDRD5	149	.	0			c.C800G						.						75.0	77.0	76.0					1																	179564922		2203	4300	6503	SO:0001587	stop_gained	163589	exon4			AGACTTCAAGACT	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.800C>G	chr1.hg19:g.179564922C>G	ENSP00000356586:p.Ser267*	102.0	0.0		259.0	42.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Nonsense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	C	40	8.082449	0.98646	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	.	.	.	5.69	4.78	0.61160	.	0.232509	0.30126	N	0.010349	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-14.4089	10.5493	0.45079	0.0:0.9112:0.0:0.0888	.	.	.	.	X	267	.	ENSP00000294848:S267X	S	+	2	0	TDRD5	177831545	0.998000	0.40836	0.982000	0.44146	0.711000	0.40976	1.278000	0.33179	1.404000	0.46819	0.585000	0.79938	TCA	.	.		0.358	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
CACNA1E	777	hgsc.bcm.edu	37	1	181452881	181452881	+	Start_Codon_SNP	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:181452881A>G	ENST00000367573.2	+	1	1	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CACNA1E_ENST00000358338.5_5'UTR|CACNA1E_ENST00000360108.3_Start_Codon_SNP_p.M1V|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000357570.5_5'UTR|CACNA1E_ENST00000367570.1_Start_Codon_SNP_p.M1V|CACNA1E_ENST00000526775.1_Start_Codon_SNP_p.M1V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AAACCTCAGGATGGCTCGCTT	0.632																																					p.M1V		Atlas-SNP	.											.	CACNA1E	778	.	0			c.A1G						.						27.0	29.0	29.0					1																	181452881		1958	4135	6093	SO:0001582	initiator_codon_variant	777	exon1			CTCAGGATGGCTC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1A>G	chr1.hg19:g.181452881A>G	ENSP00000356545:p.Met1Val	39.0	0.0		75.0	4.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.746730	0.49257	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000360108;ENST00000367573	D;D;D;D;D	0.97811	-4.55;-4.23;-4.24;-4.27;-4.25	5.28	5.28	0.74379	.	0.703262	0.12976	N	0.423714	D	0.98523	0.9507	.	.	.	0.80722	D	1	P	0.43578	0.811	P	0.60789	0.879	D	0.98072	1.0399	9	0.87932	D	0	.	14.195	0.65664	1.0:0.0:0.0:0.0	.	1	Q15878-3	.	V	1	ENSP00000432038:M1V;ENSP00000356542:M1V;ENSP00000434814:M1V;ENSP00000353222:M1V;ENSP00000356545:M1V	ENSP00000353222:M1V	M	+	1	0	CACNA1E	179719504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.115000	0.94336	2.003000	0.58678	0.459000	0.35465	ATG	.	.		0.632	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Missense_Mutation
NVL	4931	hgsc.bcm.edu	37	1	224514099	224514099	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:224514099A>G	ENST00000281701.6	-	2	384	c.125T>C	c.(124-126)gTg>gCg	p.V42A	NVL_ENST00000391875.2_Intron|NVL_ENST00000361463.3_Intron|NVL_ENST00000340871.4_Intron|NVL_ENST00000468673.1_5'UTR|NVL_ENST00000482491.1_Intron|NVL_ENST00000469075.1_Missense_Mutation_p.V42A	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	42						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TTACCTGTACACTCTTTGTAA	0.323																																					p.V42A		Atlas-SNP	.											.	NVL	74	.	0			c.T125C						.						98.0	100.0	99.0					1																	224514099		2203	4300	6503	SO:0001583	missense	4931	exon2			CTGTACACTCTTT	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.125T>C	chr1.hg19:g.224514099A>G	ENSP00000281701:p.Val42Ala	50.0	0.0		110.0	5.0	NM_001243147	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	hg19	CCDS1541.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.743239	0.49151	.	.	ENSG00000143748	ENST00000281701;ENST00000469075;ENST00000488718;ENST00000461546	D;D	0.94497	-3.38;-3.44	5.91	5.91	0.95273	.	0.394021	0.28176	N	0.016315	D	0.87605	0.6219	N	0.22421	0.69	0.80722	D	1	B;B;B	0.11235	0.004;0.002;0.0	B;B;B	0.11329	0.006;0.006;0.0	T	0.81037	-0.1114	10	0.17369	T	0.5	-11.8838	7.2743	0.26275	0.8794:0.0:0.1206:0.0	.	42;42;42	B4DF43;B4DP98;O15381	.;.;NVL_HUMAN	A	42	ENSP00000281701:V42A;ENSP00000417826:V42A	ENSP00000281701:V42A	V	-	2	0	NVL	222580722	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.943000	0.49026	2.261000	0.74972	0.533000	0.62120	GTG	.	.		0.323	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
JMJD4	65094	hgsc.bcm.edu	37	1	227922402	227922402	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:227922402G>A	ENST00000366758.3	-	2	515	c.516C>T	c.(514-516)ggC>ggT	p.G172G	JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000366760.1_Intron|JMJD4_ENST00000438896.2_Silent_p.G172G|SNAP47_ENST00000366759.4_5'Flank|SNAP47_ENST00000315781.5_5'Flank	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	172										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				GAGAGGAGTAGCCCGCCTGTA	0.562																																					p.G172G		Atlas-SNP	.											.	JMJD4	28	.	0			c.C516T						.						221.0	184.0	197.0					1																	227922402		2203	4300	6503	SO:0001819	synonymous_variant	65094	exon2			GGAGTAGCCCGCC	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.516C>T	chr1.hg19:g.227922402G>A		287.0	0.0		562.0	285.0	NM_023007	Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	ENST00000366758.3	hg19	CCDS1561.1	.	.	.	.	.	.	.	.	.	.	.	11.00	1.509531	0.27036	.	.	ENSG00000081692	ENST00000438896	.	.	.	4.55	2.44	0.29823	.	.	.	.	.	T	0.56077	0.1961	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50898	-0.8773	4	.	.	.	-12.0369	7.9626	0.30081	0.0945:0.1617:0.7439:0.0	.	.	.	.	V	165	.	.	A	-	2	0	JMJD4	225989025	0.720000	0.27996	0.755000	0.31263	0.903000	0.53119	0.932000	0.28884	0.991000	0.38814	0.555000	0.69702	GCT	.	.		0.562	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
HEATR1	55127	hgsc.bcm.edu	37	1	236749177	236749177	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:236749177C>G	ENST00000366582.3	-	16	2106	c.1992G>C	c.(1990-1992)atG>atC	p.M664I	HEATR1_ENST00000366581.2_Missense_Mutation_p.M664I	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	664					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACAACTCAATCATCTTCTGAT	0.353																																					p.M664I		Atlas-SNP	.											.	HEATR1	197	.	0			c.G1992C						.						104.0	96.0	99.0					1																	236749177		2203	4300	6503	SO:0001583	missense	55127	exon16			CTCAATCATCTTC	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1992G>C	chr1.hg19:g.236749177C>G	ENSP00000355541:p.Met664Ile	149.0	0.0		274.0	17.0	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	hg19	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554774	0.65425	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.61510	0.1;0.72	5.76	5.76	0.90799	Armadillo-type fold (1);	0.049130	0.85682	D	0.000000	T	0.55386	0.1917	M	0.64997	1.995	0.80722	D	1	B	0.16396	0.017	B	0.08055	0.003	T	0.49380	-0.8946	10	0.25106	T	0.35	.	16.2348	0.82365	0.1333:0.8667:0.0:0.0	.	664	Q9H583	HEAT1_HUMAN	I	664	ENSP00000355541:M664I;ENSP00000355540:M664I	ENSP00000355540:M664I	M	-	3	0	HEATR1	234815800	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	1.585000	0.36600	2.721000	0.93114	0.591000	0.81541	ATG	.	.		0.353	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
MTR	4548	hgsc.bcm.edu	37	1	237038042	237038042	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:237038042A>G	ENST00000366577.5	+	24	2884	c.2490A>G	c.(2488-2490)tcA>tcG	p.S830S	MTR_ENST00000535889.1_Silent_p.S779S	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	830	B12-binding. {ECO:0000255|PROSITE- ProRule:PRU00666}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	ttGGCCTGTCAGGACTCATCA	0.348																																					p.S830S		Atlas-SNP	.											.	MTR	127	.	0			c.A2490G						.						91.0	82.0	85.0					1																	237038042		2203	4300	6503	SO:0001819	synonymous_variant	4548	exon24			CCTGTCAGGACTC	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2490A>G	chr1.hg19:g.237038042A>G		31.0	0.0		75.0	4.0	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	ENST00000366577.5	hg19	CCDS1614.1																																																																																			.	.		0.348	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
PXDN	7837	hgsc.bcm.edu	37	2	1677567	1677567	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:1677567T>C	ENST00000252804.4	-	9	916	c.866A>G	c.(865-867)aAg>aGg	p.K289R	PXDN_ENST00000483018.1_5'UTR	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	289	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGAATCTGTCTTCATGCTCAG	0.502																																					p.K289R		Atlas-SNP	.											.	PXDN	255	.	0			c.A866G						.						111.0	113.0	112.0					2																	1677567		2053	4195	6248	SO:0001583	missense	7837	exon9			TCTGTCTTCATGC	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.866A>G	chr2.hg19:g.1677567T>C	ENSP00000252804:p.Lys289Arg	108.0	0.0		121.0	5.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	hg19	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.02|10.02	1.235324|1.235324	0.22626|0.22626	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000252804|ENST00000433670	T|.	0.60672|.	0.17|.	5.25|5.25	4.07|4.07	0.47477|0.47477	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.349867|.	0.31051|.	N|.	0.008342|.	T|T	0.28896|0.28896	0.0717|0.0717	N|N	0.16098|0.16098	0.37|0.37	0.26878|0.26878	N|N	0.967596|0.967596	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.11329|.	0.002;0.006|.	T|T	0.18681|0.18681	-1.0329|-1.0329	10|5	0.19147|.	T|.	0.46|.	-33.4981|-33.4981	11.3246|11.3246	0.49442|0.49442	0.0:0.0:0.1522:0.8478|0.0:0.0:0.1522:0.8478	.|.	289;289|.	Q92626-2;Q92626|.	.;PXDN_HUMAN|.	R|G	289|285	ENSP00000252804:K289R|.	ENSP00000252804:K289R|.	K|R	-|-	2|1	0|2	PXDN|PXDN	1656574|1656574	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.760000|0.760000	0.43138|0.43138	3.210000|3.210000	0.51129|0.51129	0.902000|0.902000	0.36520|0.36520	-0.488000|-0.488000	0.04728|0.04728	AAG|AGA	.	.		0.502	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
ALLC	55821	hgsc.bcm.edu	37	2	3729256	3729256	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:3729256A>G	ENST00000252505.3	+	6	493	c.331A>G	c.(331-333)Agg>Ggg	p.R111G		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	130					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		AAGAGGAACCAGGACAGGAGC	0.443										HNSCC(21;0.051)																											p.R111G		Atlas-SNP	.											.	ALLC	61	.	0			c.A331G						.						52.0	56.0	55.0					2																	3729256		1897	4116	6013	SO:0001583	missense	55821	exon6			GGAACCAGGACAG	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.331A>G	chr2.hg19:g.3729256A>G	ENSP00000252505:p.Arg111Gly	79.0	0.0		79.0	4.0	NM_018436	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	hg19	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	A	8.448	0.852473	0.17106	.	.	ENSG00000151360	ENST00000252505	.	.	.	4.98	3.8	0.43715	Allantoicase domain (1);Galactose-binding domain-like (1);	0.215393	0.49305	D	0.000158	T	0.40015	0.1100	M	0.61703	1.905	0.09310	N	1	P	0.37594	0.601	B	0.40506	0.331	T	0.19745	-1.0296	9	0.26408	T	0.33	-5.3742	8.8671	0.35294	0.8105:0.1895:0.0:0.0	.	130	Q8N6M5	ALLC_HUMAN	G	111	.	ENSP00000252505:R111G	R	+	1	2	ALLC	3707131	0.735000	0.28153	0.215000	0.23724	0.016000	0.09150	1.735000	0.38176	0.994000	0.38892	0.528000	0.53228	AGG	.	.		0.443	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
HS1BP3	64342	hgsc.bcm.edu	37	2	20823705	20823705	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:20823705C>A	ENST00000304031.3	-	6	896	c.871G>T	c.(871-873)Ggg>Tgg	p.G291W		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	291							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGTGGGCCCTCCACTCTCA	0.642																																					p.G291W		Atlas-SNP	.											.	HS1BP3	33	.	0			c.G871T						.						29.0	31.0	31.0					2																	20823705		2203	4299	6502	SO:0001583	missense	64342	exon6			TGGGCCCTCCACT		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.871G>T	chr2.hg19:g.20823705C>A	ENSP00000305193:p.Gly291Trp	84.0	0.0		103.0	33.0	NM_022460	B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	ENST00000304031.3	hg19	CCDS1700.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.96|13.96|13.96	2.391889|2.391889|2.391889	0.42410|0.42410|0.42410	.|.|.	.|.|.	ENSG00000118960|ENSG00000118960|ENSG00000118960	ENST00000415264|ENST00000304031;ENST00000458740|ENST00000445102	.|T;T|.	.|0.34072|.	.|2.16;1.38|.	4.16|4.16|4.16	-0.339|-0.339|-0.339	0.12647|0.12647|0.12647	.|.|.	.|0.574784|.	.|0.17430|.	.|N|.	.|0.174509|.	T|T|T	0.39253|0.39253|0.39253	0.1071|0.1071|0.1071	L|L|L	0.60455|0.60455|0.60455	1.87|1.87|1.87	0.09310|0.09310|0.09310	N|N|N	0.99999|0.99999|0.99999	.|D|.	.|0.63046|.	.|0.992|.	.|P|.	.|0.54499|.	.|0.754|.	T|T|T	0.35201|0.35201|0.35201	-0.9798|-0.9798|-0.9798	5|10|5	.|0.72032|.	.|D|.	.|0.01|.	-4.5709|-4.5709|-4.5709	4.1741|4.1741|4.1741	0.10343|0.10343|0.10343	0.0:0.468:0.2176:0.3144|0.0:0.468:0.2176:0.3144|0.0:0.468:0.2176:0.3144	.|.|.	.|291|.	.|Q53T59|.	.|H1BP3_HUMAN|.	D|W|M	43|291;110|83	.|ENSP00000305193:G291W;ENSP00000392203:G110W|.	.|ENSP00000305193:G291W|.	E|G|R	-|-|-	3|1|2	2|0|0	HS1BP3|HS1BP3|HS1BP3	20687186|20687186|20687186	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.039000|0.039000|0.039000	0.13416|0.13416|0.13416	-0.176000|-0.176000|-0.176000	0.09811|0.09811|0.09811	-0.155000|-0.155000|-0.155000	0.11098|0.11098|0.11098	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAG|GGG|AGG	.	.		0.642	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
ALK	238	hgsc.bcm.edu	37	2	29451807	29451807	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:29451807C>A	ENST00000389048.3	-	16	3664	c.2758G>T	c.(2758-2760)Ggt>Tgt	p.G920C	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	920	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CCTCCGAAACCCCCTCTTGTC	0.587			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.G920C		Atlas-SNP	.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	533	.	0			c.G2758T						.						34.0	35.0	35.0					2																	29451807		2203	4300	6503	SO:0001583	missense	238	exon16	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CGAAACCCCCTCT	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2758G>T	chr2.hg19:g.29451807C>A	ENSP00000373700:p.Gly920Cys	331.0	1.0		385.0	164.0	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	hg19	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691038	0.88735	.	.	ENSG00000171094	ENST00000389048	T	0.72835	-0.69	5.22	5.22	0.72569	.	0.000000	0.49305	D	0.000158	D	0.87904	0.6295	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90362	0.4374	9	.	.	.	.	18.7875	0.91961	0.0:1.0:0.0:0.0	.	920	Q9UM73	ALK_HUMAN	C	920	ENSP00000373700:G920C	.	G	-	1	0	ALK	29305311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.263000	0.78421	2.420000	0.82092	0.561000	0.74099	GGT	.	.		0.587	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
CEP68	23177	hgsc.bcm.edu	37	2	65296913	65296913	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:65296913T>C	ENST00000377990.2	+	2	538	c.335T>C	c.(334-336)cTt>cCt	p.L112P	CEP68_ENST00000546106.1_Missense_Mutation_p.L112P|CEP68_ENST00000260569.4_Missense_Mutation_p.L112P|RAB1A_ENST00000494188.1_5'Flank|CEP68_ENST00000537589.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	112					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						TCTGGAGACCTTCTGCTCTCC	0.572																																					p.L112P		Atlas-SNP	.											.	CEP68	69	.	0			c.T335C						.						61.0	66.0	64.0					2																	65296913		2203	4300	6503	SO:0001583	missense	23177	exon2			GAGACCTTCTGCT	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.335T>C	chr2.hg19:g.65296913T>C	ENSP00000367229:p.Leu112Pro	54.0	0.0		57.0	4.0	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	hg19	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	T	9.975	1.226460	0.22542	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000260569;ENST00000545501	T;T;T	0.36340	1.26;1.26;1.26	4.04	0.163	0.14986	.	1.507680	0.03866	N	0.274817	T	0.28499	0.0705	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B	0.27013	0.02;0.02;0.087;0.166;0.02	B;B;B;B;B	0.27796	0.022;0.014;0.063;0.083;0.022	T	0.24190	-1.0167	10	0.38643	T	0.18	0.0386	6.3232	0.21229	0.0:0.3242:0.0:0.6758	.	100;112;112;112;112	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	P	112;112;112;100	ENSP00000367229:L112P;ENSP00000438306:L112P;ENSP00000260569:L112P	ENSP00000260569:L112P	L	+	2	0	CEP68	65150417	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.494000	0.22467	0.034000	0.15491	0.533000	0.62120	CTT	.	.		0.572	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
REV1	51455	hgsc.bcm.edu	37	2	100029414	100029414	+	Splice_Site	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:100029414C>T	ENST00000258428.3	-	13	2180		c.e13-1		REV1_ENST00000393445.3_Splice_Site|REV1_ENST00000465835.1_Splice_Site	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)						DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGTCCAACTCCTAGGAAAGGG	0.333								Direct reversal of damage																													.		Atlas-SNP	.											.	REV1	100	.	0			c.1952-1G>A						.						56.0	56.0	56.0					2																	100029414		2203	4300	6503	SO:0001630	splice_region_variant	51455	exon14			CAACTCCTAGGAA	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1952-1G>A	chr2.hg19:g.100029414C>T		120.0	0.0		117.0	46.0	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Splice_Site	SNP	ENST00000258428.3	hg19	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	9.216	1.032067	0.19590	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	.	.	.	5.21	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.806	0.63233	0.0:0.9256:0.0:0.0744	.	.	.	.	.	-1	.	.	.	-	.	.	REV1	99395846	1.000000	0.71417	0.979000	0.43373	0.171000	0.22731	7.107000	0.77047	1.317000	0.45149	0.563000	0.77884	.	.	.		0.333	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	Intron
ARHGEF4	50649	hgsc.bcm.edu	37	2	131801915	131801915	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:131801915A>G	ENST00000326016.5	+	12	2162	c.1643A>G	c.(1642-1644)gAc>gGc	p.D548G	ARHGEF4_ENST00000355771.3_Missense_Mutation_p.D477G|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000409303.1_Missense_Mutation_p.D488G|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.D548G|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.D548G	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	548	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GGCCGGCTGGACATGGACGGC	0.652																																					p.D548G		Atlas-SNP	.											.	ARHGEF4	89	.	0			c.A1643G						.						58.0	46.0	50.0					2																	131801915		2199	4300	6499	SO:0001583	missense	50649	exon12			GGCTGGACATGGA	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1643A>G	chr2.hg19:g.131801915A>G	ENSP00000316845:p.Asp548Gly	162.0	0.0		209.0	9.0	NM_032995	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	hg19	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880876	0.72294	.	.	ENSG00000136002	ENST00000326016;ENST00000392953;ENST00000525839;ENST00000409303;ENST00000355771	T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03	5.2	2.77	0.32553	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.283692	0.37577	N	0.002021	D	0.83580	0.5285	M	0.83603	2.65	0.49051	D	0.99974	P;P;P	0.50943	0.94;0.854;0.94	P;P;P	0.60173	0.87;0.735;0.87	T	0.79087	-0.1947	10	0.36615	T	0.2	.	5.3104	0.15828	0.756:0.0:0.0871:0.1569	.	488;548;548	E9PEM0;Q9NR80-4;Q9NR80	.;.;ARHG4_HUMAN	G	548;548;548;488;477	ENSP00000316845:D548G;ENSP00000376680:D548G;ENSP00000432267:D548G;ENSP00000387285:D488G;ENSP00000348017:D477G	ENSP00000316845:D548G	D	+	2	0	ARHGEF4	131518385	1.000000	0.71417	0.997000	0.53966	0.867000	0.49689	3.424000	0.52764	0.295000	0.22570	0.459000	0.35465	GAC	.	.		0.652	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
LRP1B	53353	hgsc.bcm.edu	37	2	141819744	141819744	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:141819744T>G	ENST00000389484.3	-	8	2083	c.1112A>C	c.(1111-1113)cAg>cCg	p.Q371P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	371					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCAGCTGGCTGCTCTGTCTT	0.423										TSP Lung(27;0.18)																											p.Q371P	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A1112C						.						174.0	153.0	160.0					2																	141819744		2203	4300	6503	SO:0001583	missense	53353	exon8			GCTGGCTGCTCTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1112A>C	chr2.hg19:g.141819744T>G	ENSP00000374135:p.Gln371Pro	163.0	0.0		173.0	62.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.847611	0.32606	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94184	-3.37	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.153604	0.44688	D	0.000436	D	0.92535	0.7629	M	0.71036	2.16	0.34714	D	0.728065	P	0.51653	0.947	B	0.41374	0.355	D	0.96039	0.9023	10	0.62326	D	0.03	.	16.1307	0.81436	0.0:0.0:0.0:1.0	.	371	Q9NZR2	LRP1B_HUMAN	P	371;309	ENSP00000374135:Q371P	ENSP00000374135:Q371P	Q	-	2	0	LRP1B	141536214	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.529000	0.45632	2.263000	0.75096	0.533000	0.62120	CAG	.	.		0.423	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LY75	4065	hgsc.bcm.edu	37	2	160676430	160676430	+	Splice_Site	SNP	A	A	G	rs386652068		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:160676430A>G	ENST00000263636.4	-	29	3987	c.3960T>C	c.(3958-3960)aaT>aaC	p.N1320N	LY75-CD302_ENST00000505052.1_Splice_Site_p.N1320N|LY75-CD302_ENST00000504764.1_Splice_Site_p.N1320N|LY75_ENST00000554112.1_Splice_Site_p.N1320N|LY75_ENST00000553424.1_Splice_Site_p.N1320N	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1320	C-type lectin 8. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TAAGAGACTTATCTAGAGAAG	0.318																																					p.N1320N		Atlas-SNP	.											.	LY75	151	.	0			c.T3960C						.						47.0	49.0	49.0					2																	160676430		2200	4300	6500	SO:0001630	splice_region_variant	4065	exon29			AGACTTATCTAGA	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.3959-1T>C	chr2.hg19:g.160676430A>G		64.0	0.0		98.0	4.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	ENST00000263636.4	hg19	CCDS2211.1																																																																																			.	.		0.318	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		Silent
SCN3A	6328	hgsc.bcm.edu	37	2	166032778	166032779	+	Missense_Mutation	DNP	TA	TA	CT	rs34236036|rs72471101	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:166032778_166032779TA>CT	ENST00000360093.3	-	3	617_618	c.126_127TA>AG	c.(124-129)gaTAat>gaAGat	p.42_43DN>ED	SCN3A_ENST00000283254.7_Missense_Mutation_p.42_43DN>ED|SCN3A_ENST00000409101.3_Missense_Mutation_p.42_43DN>ED	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	42			Missing. {ECO:0000269|PubMed:12610651}.		membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCATCATCATTATCTTGTTCCT	0.431																																					p.N43D|p.D42E		Atlas-SNP	.											.	SCN3A	544	.	0			c.A127G|c.T126A						.																																			SO:0001583	missense	6328	exon3			CATCATTATCTTG|ATCATTATCTTGT	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.126_127delinsCT	chr2.hg19:g.166032778_166032779delinsCT	ENSP00000353206:p.D42_N43delinsED	119.0|121.0	0.0		170.0	22.0|9.0	NM_001081676	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	hg19																																																																																				.	.		0.431	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
PDE11A	50940	hgsc.bcm.edu	37	2	178545631	178545631	+	Splice_Site	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:178545631C>A	ENST00000286063.6	-	16	2663	c.2346G>T	c.(2344-2346)gaG>gaT	p.E782D	PDE11A_ENST00000449286.2_Splice_Site_p.E424D|PDE11A_ENST00000358450.4_Splice_Site_p.E532D|PDE11A_ENST00000409504.1_Splice_Site_p.E424D|PDE11A_ENST00000389683.3_Splice_Site_p.E338D	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	782	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CAGTTCTCCTCCTGCAGGAAA	0.348									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.E782D		Atlas-SNP	.											PDE11A_ENST00000358450,NS,carcinoma,0,2	PDE11A	283	.	0			c.G2346T						.						86.0	83.0	84.0					2																	178545631		2201	4297	6498	SO:0001630	splice_region_variant	50940	exon16	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	TCTCCTCCTGCAG	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.2346-1G>T	chr2.hg19:g.178545631C>A		38.0	0.0		24.0	10.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	hg19	CCDS33334.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.72|14.72	2.618248|2.618248	0.46736|0.46736	.|.	.|.	ENSG00000128655|ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286|ENST00000433879	T;T;T;T;T|.	0.78246|.	-1.16;-1.16;-1.16;-1.16;-1.16|.	5.61|5.61	3.8|3.8	0.43715|0.43715	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);|.	0.143299|.	0.64402|.	D|.	0.000008|.	T|T	0.53948|0.53948	0.1828|0.1828	L|L	0.41492|0.41492	1.28|1.28	0.80722|0.80722	D|D	1|1	B;B|.	0.16166|.	0.004;0.016|.	B;B|.	0.16722|.	0.004;0.016|.	T|T	0.49753|0.49753	-0.8906|-0.8906	10|5	0.87932|.	D|.	0|.	.|.	9.3756|9.3756	0.38281|0.38281	0.0:0.7845:0.0:0.2155|0.0:0.7845:0.0:0.2155	.|.	532;782|.	Q9HCR9-2;Q9HCR9|.	.;PDE11_HUMAN|.	D|I	782;532;424;338;424|390	ENSP00000286063:E782D;ENSP00000351232:E532D;ENSP00000386539:E424D;ENSP00000374333:E338D;ENSP00000390599:E424D|.	ENSP00000286063:E782D|.	E|R	-|-	3|2	2|0	PDE11A|PDE11A	178253877|178253877	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.659000|1.659000	0.37387|0.37387	1.516000|1.516000	0.48900|0.48900	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.	.		0.348	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		Missense_Mutation
TTN	7273	hgsc.bcm.edu	37	2	179659759	179659759	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:179659759T>C	ENST00000591111.1	-	7	1359	c.1135A>G	c.(1135-1137)Aga>Gga	p.R379G	TTN_ENST00000460472.2_Missense_Mutation_p.R379G|TTN_ENST00000359218.5_Missense_Mutation_p.R379G|TTN_ENST00000360870.5_Missense_Mutation_p.R379G|TTN_ENST00000342175.6_Missense_Mutation_p.R379G|TTN_ENST00000342992.6_Missense_Mutation_p.R379G|TTN_ENST00000589042.1_Missense_Mutation_p.R379G			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACCGTATCTCCCTTCCCAT	0.582																																					p.R379G		Atlas-SNP	.											.	TTN	18412	.	0			c.A1135G						.						142.0	127.0	132.0					2																	179659759		2203	4300	6503	SO:0001583	missense	7273	exon7			CGTATCTCCCTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1135A>G	chr2.hg19:g.179659759T>C	ENSP00000465570:p.Arg379Gly	31.0	0.0		57.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.33	2.204673	0.38905	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67698	-0.28;-0.06;-0.07;-0.08;0.06	5.96	4.78	0.61160	.	.	.	.	.	T	0.61899	0.2384	L	0.47716	1.5	0.22975	N	0.998481	B;B;B;B;P	0.42296	0.1;0.1;0.1;0.1;0.775	B;B;B;B;B	0.39660	0.036;0.036;0.036;0.036;0.306	T	0.55995	-0.8052	9	0.87932	D	0	.	12.9235	0.58245	0.0:0.0:0.2543:0.7457	.	379;379;379;379;379	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	G	379	ENSP00000343764:R379G;ENSP00000434586:R379G;ENSP00000340554:R379G;ENSP00000352154:R379G;ENSP00000354117:R379G	ENSP00000340554:R379G	R	-	1	2	TTN	179368004	0.977000	0.34250	1.000000	0.80357	0.985000	0.73830	1.142000	0.31540	1.047000	0.40274	0.528000	0.53228	AGA	.	.		0.582	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SSFA2	6744	hgsc.bcm.edu	37	2	182781149	182781149	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:182781149T>C	ENST00000431877.2	+	11	2961	c.2782T>C	c.(2782-2784)Tca>Cca	p.S928P	SSFA2_ENST00000409001.1_Missense_Mutation_p.S928P|SSFA2_ENST00000320370.7_Missense_Mutation_p.S928P|SSFA2_ENST00000428267.2_Missense_Mutation_p.S775P|SSFA2_ENST00000409136.1_Missense_Mutation_p.S437P	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	928						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S928A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GCAGAATCTTTCACAGGTATG	0.383																																					p.S928P		Atlas-SNP	.											SSFA2,NS,carcinoma,0,1	SSFA2	130	.	1	Substitution - Missense(1)	lung(1)	c.T2782C						.						62.0	62.0	62.0					2																	182781149		2203	4300	6503	SO:0001583	missense	6744	exon11			AATCTTTCACAGG	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.2782T>C	chr2.hg19:g.182781149T>C	ENSP00000388731:p.Ser928Pro	65.0	0.0		70.0	3.0	NM_001130445	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	hg19	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.428048	0.62844	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.95	4.78	0.61160	.	0.376195	0.30159	N	0.010279	T	0.59824	0.2222	M	0.73598	2.24	0.45541	D	0.998499	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.997;0.997;0.997;0.997	T	0.63314	-0.6665	10	0.72032	D	0.01	-6.451	13.3688	0.60701	0.0:0.0:0.1316:0.8684	.	775;437;928;928;928	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	P	928;928;928;775;437	ENSP00000388731:S928P;ENSP00000314669:S928P;ENSP00000387319:S928P;ENSP00000409867:S775P;ENSP00000386916:S437P	ENSP00000314669:S928P	S	+	1	0	SSFA2	182489394	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.233000	0.51311	1.055000	0.40461	-0.316000	0.08728	TCA	.	.		0.383	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
COL5A2	1290	hgsc.bcm.edu	37	2	189922082	189922082	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:189922082T>C	ENST00000374866.3	-	34	2575	c.2301A>G	c.(2299-2301)agA>agG	p.R767R		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	767					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CTGCAATTCCTCTTTCTCCCG	0.438																																					p.R767R		Atlas-SNP	.											.	COL5A2	230	.	0			c.A2301G						.						70.0	69.0	69.0					2																	189922082		2203	4300	6503	SO:0001819	synonymous_variant	1290	exon34			AATTCCTCTTTCT	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2301A>G	chr2.hg19:g.189922082T>C		86.0	0.0		90.0	5.0	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	hg19	CCDS33350.1																																																																																			.	.		0.438	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
FN1	2335	hgsc.bcm.edu	37	2	216239959	216239959	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:216239959A>G	ENST00000359671.1	-	37	6127	c.5862T>C	c.(5860-5862)ggT>ggC	p.G1954G	FN1_ENST00000421182.1_Silent_p.G1864G|FN1_ENST00000323926.6_Silent_p.G2045G|FN1_ENST00000345488.5_Silent_p.G1954G|FN1_ENST00000357867.4_Silent_p.G1864G|FN1_ENST00000446046.1_Silent_p.G1954G|FN1_ENST00000443816.1_Silent_p.G1864G|FN1_ENST00000356005.4_Silent_p.G1864G|FN1_ENST00000336916.4_Silent_p.G1954G|FN1_ENST00000354785.4_Silent_p.G2045G|FN1_ENST00000432072.2_Silent_p.G1955G|FN1_ENST00000346544.3_Silent_p.G1954G|FN1_ENST00000357009.2_Silent_p.G1954G			P02751	FINC_HUMAN	fibronectin 1	1954	Binds to FBLN1.|Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCTCTGTGACACCAGGGCGGG	0.532																																					p.G2045G		Atlas-SNP	.											.	FN1	521	.	0			c.T6135C						.						82.0	87.0	85.0					2																	216239959		2203	4300	6503	SO:0001819	synonymous_variant	2335	exon38			TGTGACACCAGGG		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5862T>C	chr2.hg19:g.216239959A>G		110.0	0.0		116.0	5.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	hg19																																																																																				.	.		0.532	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
CCDC108	255101	hgsc.bcm.edu	37	2	219892384	219892384	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:219892384G>A	ENST00000341552.5	-	13	2282	c.2199C>T	c.(2197-2199)ttC>ttT	p.F733F	CCDC108_ENST00000410037.1_Silent_p.F668F|CCDC108_ENST00000453220.1_Silent_p.F733F|CCDC108_ENST00000441968.1_Silent_p.F733F|CCDC108_ENST00000409865.3_Silent_p.F722F	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	733						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATAGATGGCGAAGGCTTCGA	0.617																																					p.F733F		Atlas-SNP	.											.	CCDC108	208	.	0			c.C2199T						.						82.0	84.0	84.0					2																	219892384		2203	4300	6503	SO:0001819	synonymous_variant	255101	exon13			GATGGCGAAGGCT	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2199C>T	chr2.hg19:g.219892384G>A		185.0	0.0		255.0	84.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	hg19	CCDS2430.2																																																																																			.	.		0.617	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
COL6A3	1293	hgsc.bcm.edu	37	2	238244875	238244875	+	Silent	SNP	A	A	G	rs398102314		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:238244875A>G	ENST00000295550.4	-	40	9320	c.8868T>C	c.(8866-8868)gcT>gcC	p.A2956A	COL6A3_ENST00000347401.3_Silent_p.A2755A|COL6A3_ENST00000353578.4_Silent_p.A2750A|COL6A3_ENST00000472056.1_Silent_p.A2349A|COL6A3_ENST00000409809.1_Silent_p.A2750A|COL6A3_ENST00000346358.4_Silent_p.A2756A	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2956	Ala-rich.|Nonhelical region.			Missing (in Ref. 1; CAA36267). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGCAGCAGCAGCGGGGGGTC	0.617																																					p.A2956A		Atlas-SNP	.											.,7	COL6A3	608	.	0			c.T8868C						.						37.0	41.0	40.0					2																	238244875		2199	4298	6497	SO:0001819	synonymous_variant	1293	exon40			AGCAGCAGCGGGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8868T>C	chr2.hg19:g.238244875A>G		39.0	1.0		47.0	5.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	hg19	CCDS33412.1																																																																																			.	.		0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
COL6A3	1293	hgsc.bcm.edu	37	2	238244877	238244877	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:238244877C>G	ENST00000295550.4	-	40	9318	c.8866G>C	c.(8866-8868)Gct>Cct	p.A2956P	COL6A3_ENST00000347401.3_Missense_Mutation_p.A2755P|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2750P|COL6A3_ENST00000472056.1_Missense_Mutation_p.A2349P|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2750P|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2756P	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2956	Ala-rich.|Nonhelical region.			Missing (in Ref. 1; CAA36267). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCAGCAGCAGCGGGGGGTCTT	0.622																																					p.A2956P		Atlas-SNP	.											.	COL6A3	608	.	0			c.G8866C						.						37.0	41.0	40.0					2																	238244877		2199	4299	6498	SO:0001583	missense	1293	exon40			CAGCAGCGGGGGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8866G>C	chr2.hg19:g.238244877C>G	ENSP00000295550:p.Ala2956Pro	40.0	0.0		46.0	4.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	3.672	-0.067344	0.07273	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.90844	-2.74;-2.71;-2.7;-2.69;-2.7;-2.68	0.158	0.158	0.14942	.	2.351570	0.03169	U	0.170515	D	0.90899	0.7140	L	0.36672	1.1	0.09310	N	1	D;D;D	0.56968	0.962;0.978;0.962	P;P;P	0.61800	0.787;0.894;0.787	T	0.79799	-0.1651	9	0.25751	T	0.34	.	.	.	.	.	2349;2750;2956	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	P	2956;2755;2750;2349;2750;2756	ENSP00000295550:A2956P;ENSP00000315609:A2755P;ENSP00000315873:A2750P;ENSP00000418285:A2349P;ENSP00000386844:A2750P;ENSP00000295546:A2756P	ENSP00000295550:A2956P	A	-	1	0	COL6A3	237909616	0.002000	0.14202	0.017000	0.16124	0.231000	0.25187	0.465000	0.22004	0.202000	0.20498	0.205000	0.17691	GCT	.	.		0.622	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
PER2	8864	hgsc.bcm.edu	37	2	239165617	239165617	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:239165617T>C	ENST00000254657.3	-	17	2290	c.2011A>G	c.(2011-2013)Agc>Ggc	p.S671G	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	671	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CTGCTGTAGCTGCACTGGCTG	0.592											OREG0015336	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S671G		Atlas-SNP	.											.	PER2	85	.	0			c.A2011G						.						90.0	91.0	90.0					2																	239165617		2203	4300	6503	SO:0001583	missense	8864	exon17			TGTAGCTGCACTG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2011A>G	chr2.hg19:g.239165617T>C	ENSP00000254657:p.Ser671Gly	78.0	0.0	2409	113.0	6.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	hg19	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.932103	0.92389	.	.	ENSG00000132326	ENST00000254657	T	0.24908	1.83	4.75	4.75	0.60458	.	0.082585	0.85682	D	0.000000	T	0.52869	0.1761	M	0.83852	2.665	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.994;0.998	T	0.59573	-0.7429	10	0.72032	D	0.01	-29.9714	12.5438	0.56186	0.0:0.0:0.0:1.0	.	671;671	B4DH14;O15055	.;PER2_HUMAN	G	671	ENSP00000254657:S671G	ENSP00000254657:S671G	S	-	1	0	PER2	238830356	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.404000	0.79996	1.907000	0.55213	0.533000	0.62120	AGC	.	.		0.592	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
TMEM43	79188	hgsc.bcm.edu	37	3	14180787	14180787	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:14180787C>T	ENST00000306077.4	+	11	1244	c.990C>T	c.(988-990)ctC>ctT	p.L330L	RP11-434D12.1_ENST00000601399.1_3'UTR|RP11-434D12.1_ENST00000608606.1_Silent_p.L76L	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	330					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						CACGGATCCTCTACACCTTGG	0.582																																					p.L330L		Atlas-SNP	.											.	TMEM43	33	.	0			c.C990T						.						125.0	109.0	114.0					3																	14180787		2203	4300	6503	SO:0001819	synonymous_variant	79188	exon11			GATCCTCTACACC	BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.990C>T	chr3.hg19:g.14180787C>T		109.0	0.0		174.0	72.0	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Silent	SNP	ENST00000306077.4	hg19	CCDS2618.1																																																																																			.	.		0.582	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
GOLGA4	2803	hgsc.bcm.edu	37	3	37367411	37367411	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:37367411A>G	ENST00000361924.2	+	14	4408	c.4034A>G	c.(4033-4035)aAg>aGg	p.K1345R	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.K1367R	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1345	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						ACACAGTTGAAGAAAGAGTTA	0.353																																					p.K1367R		Atlas-SNP	.											.	GOLGA4	173	.	0			c.A4100G						.						36.0	35.0	36.0					3																	37367411		2203	4299	6502	SO:0001583	missense	2803	exon15			AGTTGAAGAAAGA	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.4034A>G	chr3.hg19:g.37367411A>G	ENSP00000354486:p.Lys1345Arg	54.0	0.0		76.0	4.0	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	10.56	1.385287	0.25031	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.26067	1.76;1.76;1.76	5.53	3.12	0.35913	.	0.000000	0.38217	N	0.001765	T	0.20047	0.0482	L	0.52266	1.64	0.23920	N	0.996462	B;B;B;B	0.17465	0.01;0.01;0.01;0.022	B;B;B;B	0.14578	0.009;0.006;0.006;0.011	T	0.21759	-1.0236	10	0.16420	T	0.52	.	8.6536	0.34049	0.7766:0.0:0.2234:0.0	.	1345;1345;1367;1345	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	R	1345;1367;1216	ENSP00000354486:K1345R;ENSP00000349305:K1367R;ENSP00000405842:K1216R	ENSP00000349305:K1367R	K	+	2	0	GOLGA4	37342415	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	1.195000	0.32186	0.899000	0.36444	0.460000	0.39030	AAG	.	.		0.353	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
DHX30	22907	hgsc.bcm.edu	37	3	47882442	47882442	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:47882442T>C	ENST00000445061.1	+	7	849	c.442T>C	c.(442-444)Tcc>Ccc	p.S148P	DHX30_ENST00000348968.4_Missense_Mutation_p.S120P|DHX30_ENST00000457607.1_Missense_Mutation_p.S176P|DHX30_ENST00000446256.2_Missense_Mutation_p.S109P	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	148						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TCGCTTTGGCTCCCCTGCCGA	0.602																																					p.S148P		Atlas-SNP	.											.	DHX30	101	.	0			c.T442C						.						53.0	48.0	50.0					3																	47882442		2203	4300	6503	SO:0001583	missense	22907	exon7			TTTGGCTCCCCTG	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.442T>C	chr3.hg19:g.47882442T>C	ENSP00000405620:p.Ser148Pro	112.0	0.0		161.0	8.0	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	hg19	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	T	16.03	3.007590	0.54361	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03635	3.9;3.87;3.89;3.86	4.89	4.89	0.63831	.	0.410909	0.25222	N	0.032224	T	0.04497	0.0123	L	0.36672	1.1	0.44227	D	0.997066	B;B;B	0.28933	0.228;0.148;0.148	B;B;B	0.30316	0.106;0.114;0.114	T	0.46952	-0.9154	10	0.44086	T	0.13	.	12.2716	0.54710	0.0:0.0:0.0:1.0	.	148;109;176	Q7L2E3;Q7L2E3-3;Q7L2E3-2	DHX30_HUMAN;.;.	P	109;148;120;176	ENSP00000392601:S109P;ENSP00000405620:S148P;ENSP00000343442:S120P;ENSP00000394682:S176P	ENSP00000343442:S120P	S	+	1	0	DHX30	47857446	1.000000	0.71417	0.997000	0.53966	0.911000	0.54048	4.753000	0.62183	1.821000	0.53095	0.533000	0.62120	TCC	.	.		0.602	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
CELSR3	1951	hgsc.bcm.edu	37	3	48697030	48697030	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:48697030T>C	ENST00000164024.4	-	1	3318	c.3038A>G	c.(3037-3039)gAg>gGg	p.E1013G	CELSR3_ENST00000544264.1_Missense_Mutation_p.E1013G	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1013	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGAGGTGGGCTCAATGGTAAA	0.552																																					p.E1013G		Atlas-SNP	.											.	CELSR3	237	.	0			c.A3038G						.						75.0	72.0	73.0					3																	48697030		2203	4300	6503	SO:0001583	missense	1951	exon1			GTGGGCTCAATGG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3038A>G	chr3.hg19:g.48697030T>C	ENSP00000164024:p.Glu1013Gly	68.0	0.0		86.0	4.0	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	hg19	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.314376	0.60414	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.61040	0.14;0.14	5.78	5.78	0.91487	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.66944	0.2841	L	0.28694	0.88	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.986	T	0.70454	-0.4867	9	0.72032	D	0.01	.	16.0993	0.81158	0.0:0.0:0.0:1.0	.	1013;1083	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	G	1013	ENSP00000164024:E1013G;ENSP00000445694:E1013G	ENSP00000164024:E1013G	E	-	2	0	CELSR3	48672034	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.186000	0.72026	2.207000	0.71202	0.459000	0.35465	GAG	.	.		0.552	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
CCDC66	285331	hgsc.bcm.edu	37	3	56650051	56650051	+	Missense_Mutation	SNP	A	A	T	rs77152637|rs74463118	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:56650051A>T	ENST00000394672.3	+	13	1883	c.1813A>T	c.(1813-1815)Act>Tct	p.T605S	CCDC66_ENST00000436465.2_Missense_Mutation_p.T605S|CCDC66_ENST00000326595.7_Missense_Mutation_p.T571S	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	605				T -> TS (in Ref. 3; AAI32828). {ECO:0000305}.	post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		GAATTCTACGACTTCTAAGAA	0.289																																					p.T605S		Atlas-SNP	.											.	CCDC66	145	.	0			c.A1813T						.						83.0	96.0	92.0					3																	56650051		2203	4291	6494	SO:0001583	missense	285331	exon13			TCTACGACTTCTA	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1813A>T	chr3.hg19:g.56650051A>T	ENSP00000378167:p.Thr605Ser	96.0	0.0		99.0	5.0	NM_001141947	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	hg19	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.687010	0.00738	.	.	ENSG00000180376	ENST00000422222;ENST00000394672;ENST00000326595;ENST00000436465	T;T;T;T	0.17370	2.28;2.31;2.3;2.31	5.59	1.92	0.25849	.	0.882722	0.10049	N	0.722482	T	0.12774	0.0310	L	0.54323	1.7	0.09310	N	1	B	0.25272	0.122	B	0.25291	0.059	T	0.42816	-0.9429	10	0.02654	T	1	0.5859	4.5617	0.12163	0.5839:0.1576:0.2585:0.0	.	605	A2RUB6	CCD66_HUMAN	S	561;605;571;605	ENSP00000401451:T561S;ENSP00000378167:T605S;ENSP00000326050:T571S;ENSP00000404320:T605S	ENSP00000326050:T571S	T	+	1	0	CCDC66	56625091	0.000000	0.05858	0.003000	0.11579	0.045000	0.14185	-0.099000	0.11007	0.161000	0.19458	0.482000	0.46254	ACT	.	.		0.289	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
PDHB	5162	hgsc.bcm.edu	37	3	58415861	58415861	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:58415861T>C	ENST00000302746.6	-	7	736	c.694A>G	c.(694-696)Agg>Ggg	p.R232G	PDHB_ENST00000474765.1_Missense_Mutation_p.R214G|PDHB_ENST00000485460.1_Missense_Mutation_p.R214G|RP11-802O23.3_ENST00000607214.1_RNA	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	232					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	TTACCTTGCCTTTCTATTTTG	0.338																																					p.R232G		Atlas-SNP	.											.	PDHB	19	.	0			c.A694G						.						108.0	110.0	109.0					3																	58415861		2203	4300	6503	SO:0001583	missense	5162	exon7			CTTGCCTTTCTAT		CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.694A>G	chr3.hg19:g.58415861T>C	ENSP00000307241:p.Arg232Gly	79.0	0.0		98.0	4.0	NM_000925	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Missense_Mutation	SNP	ENST00000302746.6	hg19	CCDS2890.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039994	0.75732	.	.	ENSG00000168291	ENST00000302746;ENST00000383714;ENST00000485460;ENST00000474765	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	6.17	4.98	0.66077	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97579	0.9207	H	0.98754	4.32	0.80722	D	1	P;D;D;D	0.76494	0.727;0.999;0.996;0.996	P;D;D;D	0.72075	0.622;0.976;0.97;0.958	D	0.98298	1.0517	10	0.87932	D	0	-21.8434	12.4693	0.55777	0.0:0.0:0.261:0.739	.	214;214;214;232	B4DDD7;C9J634;P11177-2;P11177	.;.;.;ODPB_HUMAN	G	232;214;214;214	ENSP00000307241:R232G;ENSP00000373220:R214G;ENSP00000417267:R214G;ENSP00000418448:R214G	ENSP00000307241:R232G	R	-	1	2	PDHB	58390901	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.961000	0.49168	2.371000	0.80710	0.533000	0.62120	AGG	.	.		0.338	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353558.1		
MITF	4286	hgsc.bcm.edu	37	3	69813025	69813025	+	Intron	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:69813025C>T	ENST00000448226.2	+	1	231				MITF_ENST00000352241.4_Intron|MITF_ENST00000472437.1_Intron|MITF_ENST00000328528.6_Silent_p.F11F			O75030	MITF_HUMAN	microphthalmia-associated transcription factor						bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CAGTGGTTTTCCCACGAGCTA	0.398			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.F11F	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	156	.	0			c.C33T						.						53.0	51.0	51.0					3																	69813025		1824	4083	5907	SO:0001627	intron_variant	4286	exon1			GGTTTTCCCACGA		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.104+24173C>T	chr3.hg19:g.69813025C>T		81.0	0.0		94.0	37.0	NM_006722	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	hg19																																																																																				.	.		0.398	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
DRD3	1814	hgsc.bcm.edu	37	3	113850192	113850192	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:113850192T>G	ENST00000460779.1	-	7	1068	c.779A>C	c.(778-780)cAg>cCg	p.Q260P	DRD3_ENST00000295881.7_Missense_Mutation_p.Q260P|DRD3_ENST00000467632.1_Missense_Mutation_p.Q260P|DRD3_ENST00000383673.2_Missense_Mutation_p.Q260P	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	260					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGCAGTGTCCTGGCAGATGCT	0.542																																					p.Q260P		Atlas-SNP	.											.	DRD3	76	.	0			c.A779C						.						136.0	139.0	138.0					3																	113850192		2203	4300	6503	SO:0001583	missense	1814	exon6			GTGTCCTGGCAGA		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.779A>C	chr3.hg19:g.113850192T>G	ENSP00000419402:p.Gln260Pro	120.0	0.0		195.0	67.0	NM_033663	A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	hg19	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.772316	0.31411	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.65	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.229185	0.41605	D	0.000856	T	0.58133	0.2101	L	0.33668	1.02	0.47153	D	0.999332	B;B;B;B	0.12630	0.006;0.0;0.0;0.001	B;B;B;B	0.15870	0.014;0.004;0.004;0.009	T	0.53690	-0.8403	10	0.27785	T	0.31	.	10.8001	0.46483	0.0:0.0736:0.0:0.9264	.	260;260;260;260	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	P	260	ENSP00000419402:Q260P;ENSP00000420662:Q260P;ENSP00000373169:Q260P;ENSP00000295881:Q260P	ENSP00000281274:Q260P	Q	-	2	0	DRD3	115332882	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	5.399000	0.66314	2.367000	0.80283	0.528000	0.53228	CAG	.	.		0.542	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3	
POLQ	10721	hgsc.bcm.edu	37	3	121186373	121186373	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:121186373A>G	ENST00000264233.5	-	24	7088	c.6960T>C	c.(6958-6960)ccT>ccC	p.P2320P		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2320					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TACCTGGGAAAGGCACAAAGG	0.458								DNA polymerases (catalytic subunits)																													p.P2320P	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.T6960C						.						160.0	143.0	149.0					3																	121186373		2203	4300	6503	SO:0001819	synonymous_variant	10721	exon24			TGGGAAAGGCACA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.6960T>C	chr3.hg19:g.121186373A>G		84.0	0.0		89.0	4.0	NM_199420	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	hg19	CCDS33833.1																																																																																			.	.		0.458	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
PARP14	54625	hgsc.bcm.edu	37	3	122419294	122419294	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:122419294T>C	ENST00000474629.2	+	6	2159	c.1893T>C	c.(1891-1893)acT>acC	p.T631T		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	631					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CCCCAAACACTGTAATCATCA	0.358																																					p.T631T		Atlas-SNP	.											.	PARP14	242	.	0			c.T1893C						.						31.0	30.0	30.0					3																	122419294		1841	4102	5943	SO:0001819	synonymous_variant	54625	exon6			AAACACTGTAATC	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1893T>C	chr3.hg19:g.122419294T>C		85.0	0.0		77.0	4.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	hg19	CCDS46894.1																																																																																			.	.		0.358	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
ITGB5	3693	hgsc.bcm.edu	37	3	124515576	124515576	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:124515576T>C	ENST00000296181.4	-	10	1648	c.1352A>G	c.(1351-1353)gAc>gGc	p.D451G		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	451					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		CTCCAGGCTGTCCCGGAATCC	0.632																																					p.D451G		Atlas-SNP	.											.	ITGB5	66	.	0			c.A1352G						.						29.0	30.0	30.0					3																	124515576		2203	4300	6503	SO:0001583	missense	3693	exon10			AGGCTGTCCCGGA	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1352A>G	chr3.hg19:g.124515576T>C	ENSP00000296181:p.Asp451Gly	119.0	0.0		106.0	6.0	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	hg19	CCDS3030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.0|28.0	4.882517|4.882517	0.91740|0.91740	.|.	.|.	ENSG00000082781|ENSG00000082781	ENST00000296181|ENST00000481591	T|.	0.69685|.	-0.42|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Integrin beta subunit, N-terminal (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71221|0.71221	0.3314|0.3314	M|M	0.63169|0.63169	1.94|1.94	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.70502|0.70502	-0.4854|-0.4854	10|5	0.87932|.	D|.	0|.	.|.	15.3487|15.3487	0.74363|0.74363	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	451|.	P18084|.	ITB5_HUMAN|.	G|A	451|141	ENSP00000296181:D451G|.	ENSP00000296181:D451G|.	D|T	-|-	2|1	0|0	ITGB5|ITGB5	125998266|125998266	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.792000|7.792000	0.85828|0.85828	2.208000|2.208000	0.71279|0.71279	0.460000|0.460000	0.39030|0.39030	GAC|ACA	.	.		0.632	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
SEC61A1	29927	hgsc.bcm.edu	37	3	127775642	127775642	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:127775642A>G	ENST00000243253.3	+	5	495	c.311A>G	c.(310-312)gAc>gGc	p.D104G	SEC61A1_ENST00000464451.1_Missense_Mutation_p.D110G|SEC61A1_ENST00000424880.2_Intron	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	104					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						GAAGTTGGTGACACCCCAAAA	0.423																																					p.D104G		Atlas-SNP	.											.	SEC61A1	39	.	0			c.A311G						.						82.0	80.0	81.0					3																	127775642		2203	4300	6503	SO:0001583	missense	29927	exon5			TTGGTGACACCCC	AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.311A>G	chr3.hg19:g.127775642A>G	ENSP00000243253:p.Asp104Gly	82.0	0.0		105.0	6.0	NM_013336	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	ENST00000243253.3	hg19	CCDS3046.1	.	.	.	.	.	.	.	.	.	.	A	17.00	3.275904	0.59649	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000481210	.	.	.	5.79	5.79	0.91817	SecY subunit domain (2);	0.000000	0.85682	D	0.000000	T	0.68970	0.3059	M	0.65975	2.015	0.80722	D	1	B	0.17038	0.02	B	0.30646	0.118	T	0.65162	-0.6235	9	0.37606	T	0.19	.	16.1388	0.81509	1.0:0.0:0.0:0.0	.	104	P61619	S61A1_HUMAN	G	110;104;51	.	ENSP00000243253:D104G	D	+	2	0	SEC61A1	129258332	1.000000	0.71417	0.967000	0.41034	0.554000	0.35429	9.339000	0.96797	2.205000	0.71048	0.528000	0.53228	GAC	.	.		0.423	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336	
KIAA1257	57501	hgsc.bcm.edu	37	3	128694728	128694728	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:128694728T>C	ENST00000265068.5	-	7	1082	c.915A>G	c.(913-915)acA>acG	p.T305T	KIAA1257_ENST00000510149.1_5'Flank|KIAA1257_ENST00000515659.1_Silent_p.T193T|KIAA1257_ENST00000511438.1_Silent_p.T305T	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	305										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						AAATGGTTGGTGTTCTTGAAA	0.363																																					p.T305T		Atlas-SNP	.											.	KIAA1257	33	.	0			c.A915G						.						92.0	79.0	83.0					3																	128694728		1834	4094	5928	SO:0001819	synonymous_variant	57501	exon7			GGTTGGTGTTCTT	AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.915A>G	chr3.hg19:g.128694728T>C		64.0	0.0		90.0	4.0	NM_020741	Q8IXY7|Q8N5T4	Silent	SNP	ENST00000265068.5	hg19	CCDS46905.1																																																																																			.	.		0.363	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000358430.1	NM_020741	
TMCC1	23023	hgsc.bcm.edu	37	3	129547013	129547013	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:129547013A>G	ENST00000393238.3	-	3	549	c.209T>C	c.(208-210)gTg>gCg	p.V70A	TMCC1_ENST00000426664.2_Intron	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	70						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						AATTTGCTGCACATCATGTGG	0.507																																					p.V70A		Atlas-SNP	.											.	TMCC1	105	.	0			c.T209C						.						88.0	73.0	78.0					3																	129547013		2203	4300	6503	SO:0001583	missense	23023	exon3			TGCTGCACATCAT	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.209T>C	chr3.hg19:g.129547013A>G	ENSP00000376930:p.Val70Ala	69.0	0.0		93.0	4.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	hg19	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	A	6.728	0.503118	0.12822	.	.	ENSG00000172765	ENST00000393238	T	0.32023	1.47	5.68	4.53	0.55603	.	0.419391	0.23977	N	0.042709	T	0.15912	0.0383	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06058	-1.0848	10	0.22109	T	0.4	-9.5469	11.7828	0.52023	0.9312:0.0:0.0688:0.0	.	70	O94876	TMCC1_HUMAN	A	70	ENSP00000376930:V70A	ENSP00000376930:V70A	V	-	2	0	TMCC1	131029703	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.550000	0.67268	1.094000	0.41399	0.482000	0.46254	GTG	.	.		0.507	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
P2RY12	64805	hgsc.bcm.edu	37	3	151055763	151055763	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:151055763C>A	ENST00000302632.3	-	3	1170	c.871G>T	c.(871-873)Gca>Tca	p.A291S	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron|MED12L_ENST00000273432.4_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	291					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TCCAGGCATGCATTTAAGGAA	0.438																																					p.A291S		Atlas-SNP	.											.	P2RY12	36	.	0			c.G871T						.						116.0	113.0	114.0					3																	151055763		2203	4300	6503	SO:0001583	missense	64805	exon3			GGCATGCATTTAA	AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.871G>T	chr3.hg19:g.151055763C>A	ENSP00000307259:p.Ala291Ser	111.0	0.0		66.0	46.0	NM_022788	D3DNJ5|Q546J7	Missense_Mutation	SNP	ENST00000302632.3	hg19	CCDS3159.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.355428	0.41700	.	.	ENSG00000169313	ENST00000302632;ENST00000455408	T	0.62788	-0.0	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.158495	0.56097	D	0.000028	T	0.26011	0.0634	N	0.00382	-1.575	0.49213	D	0.999766	B	0.24258	0.1	B	0.25405	0.06	T	0.49031	-0.8981	10	0.02654	T	1	-20.4475	16.3945	0.83586	0.0:0.8686:0.1314:0.0	.	291	Q9H244	P2Y12_HUMAN	S	291;194	ENSP00000307259:A291S	ENSP00000307259:A291S	A	-	1	0	P2RY12	152538453	1.000000	0.71417	0.330000	0.25442	0.972000	0.66771	4.726000	0.61986	2.654000	0.90174	0.655000	0.94253	GCA	.	.		0.438	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357796.1		
ARHGEF26	26084	hgsc.bcm.edu	37	3	153847474	153847474	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:153847474A>G	ENST00000356448.4	+	4	1519	c.1235A>G	c.(1234-1236)aAg>aGg	p.K412R	ARHGEF26_ENST00000465817.1_Missense_Mutation_p.K412R|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.K412R	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	412					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						ATTCACCATAAGCCATTGAGA	0.388																																					p.K412R	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	Atlas-SNP	.											.	ARHGEF26	158	.	0			c.A1235G						.						105.0	96.0	99.0					3																	153847474		1855	4126	5981	SO:0001583	missense	26084	exon4			ACCATAAGCCATT	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1235A>G	chr3.hg19:g.153847474A>G	ENSP00000348828:p.Lys412Arg	198.0	0.0		93.0	4.0	NM_001251962	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	ENST00000356448.4	hg19	CCDS46938.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.196935	0.38806	.	.	ENSG00000114790	ENST00000356448;ENST00000465093;ENST00000465817	T;T;T	0.55760	0.5;0.5;2.68	5.91	5.91	0.95273	.	0.045615	0.85682	D	0.000000	T	0.29716	0.0742	N	0.10809	0.05	0.44547	D	0.9975	B;B	0.32071	0.355;0.355	B;B	0.24974	0.057;0.057	T	0.28396	-1.0045	10	0.05620	T	0.96	-29.7627	16.3483	0.83171	1.0:0.0:0.0:0.0	.	412;412	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	R	412	ENSP00000348828:K412R;ENSP00000423418:K412R;ENSP00000423295:K412R	ENSP00000348828:K412R	K	+	2	0	ARHGEF26	155330164	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.183000	0.58317	2.254000	0.74563	0.533000	0.62120	AAG	.	.		0.388	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	
KCNAB1	7881	hgsc.bcm.edu	37	3	156183439	156183439	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:156183439A>G	ENST00000490337.1	+	7	599	c.535A>G	c.(535-537)Aca>Gca	p.T179A	KCNAB1_ENST00000471742.1_Missense_Mutation_p.T168A|KCNAB1_ENST00000389636.5_Missense_Mutation_p.T179A|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Missense_Mutation_p.T161A|KCNAB1_ENST00000302490.8_Missense_Mutation_p.T161A	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	179					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CAGAGCTGAAACAGAAAGAGG	0.388																																					p.T179A		Atlas-SNP	.											.	KCNAB1	176	.	0			c.A535G						.						105.0	103.0	104.0					3																	156183439		2203	4300	6503	SO:0001583	missense	7881	exon7			GCTGAAACAGAAA	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.535A>G	chr3.hg19:g.156183439A>G	ENSP00000419952:p.Thr179Ala	86.0	0.0		100.0	4.0	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	hg19	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555449	0.86231	.	.	ENSG00000169282	ENST00000472028;ENST00000490337;ENST00000389636;ENST00000471742;ENST00000475456;ENST00000302490;ENST00000389634	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.66	5.66	0.87406	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	L	0.54323	1.7	0.58432	D	0.999999	D;D;P;P;P	0.71674	0.979;0.998;0.887;0.862;0.887	D;D;P;P;P	0.68192	0.956;0.956;0.808;0.709;0.808	T	0.40496	-0.9560	10	0.66056	D	0.02	-7.6788	14.8633	0.70397	1.0:0.0:0.0:0.0	.	179;161;161;168;179	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	A	97;179;179;168;122;161;161	ENSP00000420755:T97A;ENSP00000419952:T179A;ENSP00000374287:T179A;ENSP00000418956:T168A;ENSP00000420221:T122A;ENSP00000305858:T161A;ENSP00000374285:T161A	ENSP00000305858:T161A	T	+	1	0	KCNAB1	157666133	1.000000	0.71417	0.990000	0.47175	0.923000	0.55619	7.767000	0.85331	2.151000	0.67156	0.533000	0.62120	ACA	.	.		0.388	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
MFSD1	64747	hgsc.bcm.edu	37	3	158527010	158527010	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:158527010T>C	ENST00000264266.8	+	6	545	c.483T>C	c.(481-483)gcT>gcC	p.A161A	MFSD1_ENST00000415822.2_Silent_p.A210A|MFSD1_ENST00000392813.4_Silent_p.A171A			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1	161					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATACATATGCTGTGAGCTGGT	0.358																																					p.A210A	Pancreas(62;1186 1654 36636 37908)	Atlas-SNP	.											.	MFSD1	88	.	0			c.T630C						.						119.0	120.0	120.0					3																	158527010		2203	4300	6503	SO:0001819	synonymous_variant	64747	exon6			ATATGCTGTGAGC	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.483T>C	chr3.hg19:g.158527010T>C		58.0	0.0		74.0	4.0	NM_022736	B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Silent	SNP	ENST00000264266.8	hg19																																																																																				.	.		0.358	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470730.1	NM_022736	
ABCF3	55324	hgsc.bcm.edu	37	3	183907218	183907218	+	Missense_Mutation	SNP	A	A	G	rs200262122		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:183907218A>G	ENST00000429586.2	+	12	1285	c.1100A>G	c.(1099-1101)gAg>gGg	p.E367G	ABCF3_ENST00000292808.5_Missense_Mutation_p.E361G|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	367	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E367G(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGTGGCTGGAGAATTACCTG	0.572																																					p.E367G		Atlas-SNP	.											ABCF3,colon,carcinoma,0,1	ABCF3	72	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1100G						.						82.0	77.0	79.0					3																	183907218		2203	4300	6503	SO:0001583	missense	55324	exon12			GGCTGGAGAATTA	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1100A>G	chr3.hg19:g.183907218A>G	ENSP00000411471:p.Glu367Gly	115.0	1.0		164.0	18.0	NM_018358	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	hg19	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731904	0.69189	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.93604	-3.25;-3.25	4.77	4.77	0.60923	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96750	0.8939	M	0.86573	2.825	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.984	D	0.97318	0.9942	10	0.72032	D	0.01	-23.6493	13.4779	0.61318	1.0:0.0:0.0:0.0	.	361;367	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	G	367;361	ENSP00000411471:E367G;ENSP00000292808:E361G	ENSP00000292808:E361G	E	+	2	0	ABCF3	185389912	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.444000	0.90323	1.790000	0.52503	0.383000	0.25322	GAG	.	.		0.572	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358	
ABCF3	55324	hgsc.bcm.edu	37	3	183907370	183907370	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:183907370T>C	ENST00000429586.2	+	13	1324	c.1139T>C	c.(1138-1140)gTc>gCc	p.V380A	ABCF3_ENST00000292808.5_Missense_Mutation_p.V374A|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	380	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATCCTAGTCGTCTCCCACGAC	0.602																																					p.V380A		Atlas-SNP	.											.	ABCF3	72	.	0			c.T1139C						.						74.0	64.0	68.0					3																	183907370		2203	4300	6503	SO:0001583	missense	55324	exon13			TAGTCGTCTCCCA	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1139T>C	chr3.hg19:g.183907370T>C	ENSP00000411471:p.Val380Ala	124.0	0.0		151.0	8.0	NM_018358	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	hg19	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076336	0.76415	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.95724	-3.79;-3.78	4.2	4.2	0.49525	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.97424	0.9157	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.78314	0.991;0.979	D	0.97957	1.0335	10	0.87932	D	0	-21.3595	12.6127	0.56560	0.0:0.0:0.0:1.0	.	374;380	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	A	380;374	ENSP00000411471:V380A;ENSP00000292808:V374A	ENSP00000292808:V374A	V	+	2	0	ABCF3	185390064	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.283000	0.78640	1.775000	0.52247	0.460000	0.39030	GTC	.	.		0.602	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358	
SST	6750	hgsc.bcm.edu	37	3	187388043	187388043	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:187388043G>A	ENST00000287641.3	-	1	144	c.37C>T	c.(37-39)Ctg>Ttg	p.L13L		NM_001048.3	NP_001039.1	P61278	SMS_HUMAN	somatostatin	13					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hyperosmotic response (GO:0006972)|negative regulation of cell proliferation (GO:0008285)|regulation of cell migration (GO:0030334)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to heat (GO:0009408)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)			kidney(1)|large_intestine(1)|lung(6)|pancreas(1)	9	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Cysteamine(DB00847)	ACGATGGACAGCGCAGCCAGC	0.677											OREG0004470	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=SST|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L13L		Atlas-SNP	.											.	SST	20	.	0			c.C37T						.						18.0	17.0	17.0					3																	187388043		2194	4294	6488	SO:0001819	synonymous_variant	6750	exon1			TGGACAGCGCAGC		CCDS3288.1	3q28	2013-02-28			ENSG00000157005	ENSG00000157005		"""Endogenous ligands"""	11329	protein-coding gene	gene with protein product	"""somatostatin-14"", ""somatostatin-28"", ""prepro-somatostatin"""	182450				6126875, 6142531	Standard	NM_001048		Approved	SMST	uc003frn.3	P61278	OTTHUMG00000156462	ENST00000287641.3:c.37C>T	chr3.hg19:g.187388043G>A		131.0	0.0	2014	108.0	50.0	NM_001048	B2R5G3|P01166	Silent	SNP	ENST00000287641.3	hg19	CCDS3288.1																																																																																			.	.		0.677	SST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344278.1	NM_001048	
MUC4	4585	hgsc.bcm.edu	37	3	195513683	195513683	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:195513683T>C	ENST00000463781.3	-	2	5227	c.4768A>G	c.(4768-4770)Act>Gct	p.T1590A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T1590A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.577																																					p.T1590A		Atlas-SNP	.											.	MUC4	1505	.	0			c.A4768G						.						27.0	22.0	23.0					3																	195513683		672	1578	2250	SO:0001583	missense	4585	exon2			AGGAAGTGTCGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4768A>G	chr3.hg19:g.195513683T>C	ENSP00000417498:p.Thr1590Ala	157.0	0.0		193.0	9.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.034	-0.680921	0.03353	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.53	0.312	-0.624	0.11552	.	.	.	.	.	T	0.15046	0.0363	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.22730	-1.0208	8	.	.	.	.	2.5717	0.04796	0.2449:0.4353:0.0:0.3198	.	1590	E7ESK3	.	A	1590	ENSP00000417498:T1590A;ENSP00000420243:T1590A	.	T	-	1	0	MUC4	196998078	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-3.857000	0.00349	-4.029000	0.00080	-4.215000	0.00009	ACT	.	.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
UVSSA	57654	hgsc.bcm.edu	37	4	1377635	1377635	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:1377635G>A	ENST00000389851.4	+	13	2390	c.1943G>A	c.(1942-1944)gGc>gAc	p.G648D	UVSSA_ENST00000512728.1_Missense_Mutation_p.G199D|UVSSA_ENST00000511563.1_Missense_Mutation_p.G199D|UVSSA_ENST00000507531.1_Missense_Mutation_p.G648D|UVSSA_ENST00000511216.1_Missense_Mutation_p.G648D	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	648					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)	p.G648V(1)									AGCGGGAAAGGCAGGGGGAAG	0.572																																					p.G648D		Atlas-SNP	.											KIAA1530,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.G1943A						.						113.0	98.0	103.0					4																	1377635		2203	4300	6503	SO:0001583	missense	57654	exon13			GGAAAGGCAGGGG	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.1943G>A	chr4.hg19:g.1377635G>A	ENSP00000374501:p.Gly648Asp	64.0	0.0		48.0	24.0	NM_020894	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	ENST00000389851.4	hg19	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268830	0.23136	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531;ENST00000511563;ENST00000512728	T;T;T;T;T	0.48201	1.38;1.38;1.38;0.82;0.82	5.04	4.2	0.49525	.	0.259729	0.43110	D	0.000620	T	0.44286	0.1286	L	0.52905	1.665	0.48975	D	0.999737	B	0.24768	0.111	B	0.22386	0.039	T	0.40251	-0.9573	10	0.48119	T	0.1	.	14.0277	0.64594	0.0743:0.0:0.9257:0.0	.	648	Q2YD98	K1530_HUMAN	D	648;648;648;199;199	ENSP00000425130:G648D;ENSP00000374501:G648D;ENSP00000421741:G648D;ENSP00000423340:G199D;ENSP00000427701:G199D	ENSP00000374501:G648D	G	+	2	0	KIAA1530	1367635	1.000000	0.71417	0.351000	0.25721	0.057000	0.15508	4.383000	0.59600	1.255000	0.44051	-0.272000	0.10252	GGC	.	.		0.572	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894	
RAB28	9364	hgsc.bcm.edu	37	4	13462450	13462450	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:13462450T>C	ENST00000330852.5	-	4	478	c.264A>G	c.(262-264)ggA>ggG	p.G88G	RAB28_ENST00000288723.4_Silent_p.G88G|RAB28_ENST00000338176.4_Silent_p.G88G	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	88					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						CCAAGAGGACTCCCTGTCACA	0.333																																					p.G88G		Atlas-SNP	.											.	RAB28	56	.	0			c.A264G						.						50.0	53.0	52.0					4																	13462450		2203	4299	6502	SO:0001819	synonymous_variant	9364	exon4			GAGGACTCCCTGT	X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.264A>G	chr4.hg19:g.13462450T>C		63.0	0.0		104.0	5.0	NM_004249	G8JLC5|Q8IYR8|Q8NI05	Silent	SNP	ENST00000330852.5	hg19	CCDS33961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.96|10.96	1.498836|1.498836	0.26861|0.26861	.|.	.|.	ENSG00000157869|ENSG00000157869	ENST00000510528|ENST00000511649	.|.	.|.	.|.	6.01|6.01	0.932|0.932	0.19466|0.19466	.|.	.|.	.|.	.|.	.|.	T|T	0.51193|0.51193	0.1660|0.1660	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.34625|0.34625	-0.9821|-0.9821	4|4	.|.	.|.	.|.	.|.	5.2801|5.2801	0.15670|0.15670	0.1447:0.278:0.0:0.5773|0.1447:0.278:0.0:0.5773	.|.	.|.	.|.	.|.	G|G	3|11	.|.	.|.	E|S	-|-	2|1	0|0	RAB28|RAB28	13071548|13071548	0.935000|0.935000	0.31712|0.31712	0.846000|0.846000	0.33378|0.33378	0.939000|0.939000	0.58152|0.58152	0.234000|0.234000	0.17930|0.17930	-0.037000|-0.037000	0.13646|0.13646	-0.263000|-0.263000	0.10527|0.10527	GAG|AGT	.	.		0.333	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979	
RBM47	54502	hgsc.bcm.edu	37	4	40440472	40440472	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:40440472T>C	ENST00000381793.2	-	3	835	c.439A>G	c.(439-441)Agc>Ggc	p.S147G	RBM47_ENST00000381795.6_Missense_Mutation_p.S147G|RBM47_ENST00000514014.1_Missense_Mutation_p.S109G|RBM47_ENST00000295971.7_Missense_Mutation_p.S147G|RBM47_ENST00000319592.4_Missense_Mutation_p.S147G|RBM47_ENST00000515809.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	147	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						TTGTCCACGCTGCAGCACACG	0.632																																					p.S147G		Atlas-SNP	.											.	RBM47	146	.	0			c.A439G						.						43.0	39.0	40.0					4																	40440472		2203	4298	6501	SO:0001583	missense	54502	exon4			CCACGCTGCAGCA	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.439A>G	chr4.hg19:g.40440472T>C	ENSP00000371212:p.Ser147Gly	96.0	0.0		95.0	4.0	NM_001098634	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	ENST00000381793.2	hg19	CCDS43223.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.052161	0.55218	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014;ENST00000515053;ENST00000513473;ENST00000505414	T;T;T;T;T;T;T;T	0.29397	3.25;1.86;3.25;1.86;1.9;3.25;1.57;1.66	5.47	5.47	0.80525	.	0.079254	0.85682	D	0.000000	T	0.59155	0.2173	M	0.82323	2.585	0.80722	D	1	P;D	0.58268	0.937;0.982	D;D	0.70227	0.931;0.968	T	0.65734	-0.6096	10	0.87932	D	0	-29.2544	15.5455	0.76097	0.0:0.0:0.0:1.0	.	147;147	A0AV96-2;A0AV96	.;RBM47_HUMAN	G	147;147;147;147;109;147;147;147	ENSP00000320108:S147G;ENSP00000371212:S147G;ENSP00000371214:S147G;ENSP00000295971:S147G;ENSP00000423243:S109G;ENSP00000422564:S147G;ENSP00000421589:S147G;ENSP00000423527:S147G	ENSP00000295971:S147G	S	-	1	0	RBM47	40135229	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	4.286000	0.58995	2.080000	0.62538	0.260000	0.18958	AGC	.	.		0.632	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
NFXL1	152518	hgsc.bcm.edu	37	4	47916121	47916121	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:47916121C>T	ENST00000507489.1	-	2	276	c.100G>A	c.(100-102)Gga>Aga	p.G34R	NFXL1_ENST00000381538.3_Missense_Mutation_p.G34R|NFXL1_ENST00000329043.3_Missense_Mutation_p.G34R	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	34						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CGCCCTCCTCCGGCGCCGCGG	0.726																																					p.G34R		Atlas-SNP	.											.	NFXL1	79	.	0			c.G100A						.						7.0	10.0	9.0					4																	47916121		2141	4184	6325	SO:0001583	missense	152518	exon2			CTCCTCCGGCGCC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.100G>A	chr4.hg19:g.47916121C>T	ENSP00000422037:p.Gly34Arg	89.0	0.0		37.0	15.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705928	0.89018	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.23950	1.9;1.9;1.88	4.32	4.32	0.51571	.	0.382466	0.19009	N	0.125132	T	0.29684	0.0741	L	0.50333	1.59	0.39457	D	0.967506	P	0.49862	0.929	P	0.45971	0.499	T	0.10917	-1.0609	10	0.45353	T	0.12	-13.028	13.5399	0.61668	0.0:1.0:0.0:0.0	.	34	Q6ZNB6	NFXL1_HUMAN	R	34	ENSP00000370949:G34R;ENSP00000422037:G34R;ENSP00000333113:G34R	ENSP00000333113:G34R	G	-	1	0	NFXL1	47610878	0.903000	0.30736	0.988000	0.46212	0.969000	0.65631	1.368000	0.34216	1.949000	0.56562	0.484000	0.47621	GGA	.	.		0.726	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
SRP72	6731	hgsc.bcm.edu	37	4	57340277	57340277	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:57340277A>G	ENST00000342756.5	+	4	1133	c.412A>G	c.(412-414)Aac>Gac	p.N138D	SRP72_ENST00000510663.1_Missense_Mutation_p.N138D|SRP72_ENST00000504757.1_Missense_Mutation_p.N138D	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	138					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					TCTCGTCCGAAACTCCCAAGA	0.383																																					p.N138D		Atlas-SNP	.											.	SRP72	59	.	0			c.A412G						.						96.0	92.0	93.0					4																	57340277		2203	4300	6503	SO:0001583	missense	6731	exon4			GTCCGAAACTCCC	AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.412A>G	chr4.hg19:g.57340277A>G	ENSP00000342181:p.Asn138Asp	128.0	0.0		106.0	13.0	NM_006947	G5E9Z8|Q7Z3C0	Missense_Mutation	SNP	ENST00000342756.5	hg19	CCDS3506.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.687896	0.88639	.	.	ENSG00000174780	ENST00000342756;ENST00000537129;ENST00000510663	T;T	0.37584	1.19;1.19	5.35	5.35	0.76521	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	L	0.55017	1.72	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.76071	0.987;0.89	T	0.43212	-0.9405	10	0.12103	T	0.63	.	13.2961	0.60298	1.0:0.0:0.0:0.0	.	138;138	G5E9Z8;O76094	.;SRP72_HUMAN	D	138;144;138	ENSP00000342181:N138D;ENSP00000424576:N138D	ENSP00000342181:N138D	N	+	1	0	SRP72	57035034	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.339000	0.96797	2.023000	0.59567	0.528000	0.53228	AAC	.	.		0.383	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7		
FRAS1	80144	hgsc.bcm.edu	37	4	79367953	79367953	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:79367953A>C	ENST00000264895.6	+	43	6369	c.5929A>C	c.(5929-5931)Agc>Cgc	p.S1977R		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1977					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGTGGTGATAAGCAATTCTTC	0.478																																					p.S1977R		Atlas-SNP	.											.	FRAS1	779	.	0			c.A5929C						.						69.0	72.0	71.0					4																	79367953		1972	4174	6146	SO:0001583	missense	80144	exon43			GTGATAAGCAATT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.5929A>C	chr4.hg19:g.79367953A>C	ENSP00000264895:p.Ser1977Arg	108.0	0.0		125.0	5.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	hg19	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.38|10.38	1.334963|1.334963	0.24253|0.24253	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.30182	.|1.54	5.57|5.57	4.32|4.32	0.51571|0.51571	.|.	.|0.182279	.|0.49916	.|D	.|0.000121	T|T	0.20047|0.20047	0.0482|0.0482	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|B	.|0.13145	.|0.007	.|B	.|0.09377	.|0.004	T|T	0.04579|0.04579	-1.0941|-1.0941	5|10	.|0.31617	.|T	.|0.26	.|.	11.306|11.306	0.49336|0.49336	0.7198:0.2802:0.0:0.0|0.7198:0.2802:0.0:0.0	.|.	.|1977	.|E9PHH6	.|.	T|R	205|1977	.|ENSP00000264895:S1977R	.|ENSP00000264895:S1977R	K|S	+|+	2|1	0|0	FRAS1|FRAS1	79586977|79586977	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.049000|0.049000	0.14656|0.14656	4.511000|4.511000	0.60462|0.60462	2.133000|2.133000	0.65898|0.65898	0.528000|0.528000	0.53228|0.53228	AAG|AGC	.	.		0.478	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PKD2	5311	hgsc.bcm.edu	37	4	88940628	88940628	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:88940628T>C	ENST00000237596.2	+	2	680	c.614T>C	c.(613-615)cTc>cCc	p.L205P		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GGAACAAGACTCATGGAGGAA	0.353																																					p.L205P		Atlas-SNP	.											.	PKD2	82	.	0			c.T614C						.						85.0	82.0	83.0					4																	88940628		2203	4300	6503	SO:0001583	missense	5311	exon2			CAAGACTCATGGA	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.614T>C	chr4.hg19:g.88940628T>C	ENSP00000237596:p.Leu205Pro	44.0	0.0		61.0	4.0	NM_000297	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000237596.2	hg19	CCDS3627.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175702	0.78564	.	.	ENSG00000118762	ENST00000237596	T	0.71103	-0.54	5.9	5.9	0.94986	.	0.146176	0.47852	D	0.000220	T	0.79299	0.4422	M	0.77103	2.36	0.80722	D	1	D	0.60575	0.988	P	0.52514	0.701	T	0.82123	-0.0613	10	0.62326	D	0.03	-12.3317	14.562	0.68148	0.0:0.0:0.0:1.0	.	205	Q13563	PKD2_HUMAN	P	205	ENSP00000237596:L205P	ENSP00000237596:L205P	L	+	2	0	PKD2	89159652	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.669000	0.68081	2.251000	0.74343	0.528000	0.53228	CTC	.	.		0.353	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253042.4	NM_000297	
GPRIN3	285513	hgsc.bcm.edu	37	4	90170576	90170576	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:90170576T>C	ENST00000609438.1	-	2	1204	c.686A>G	c.(685-687)gAc>gGc	p.D229G	GPRIN3_ENST00000333209.4_Missense_Mutation_p.D229G	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	229										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CATTTCAGAGTCACAGATGGC	0.547																																					p.D229G		Atlas-SNP	.											.	GPRIN3	90	.	0			c.A686G						.						50.0	53.0	52.0					4																	90170576		2203	4300	6503	SO:0001583	missense	285513	exon2			TCAGAGTCACAGA	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.686A>G	chr4.hg19:g.90170576T>C	ENSP00000476603:p.Asp229Gly	65.0	0.0		78.0	4.0	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	hg19	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.438998	0.25900	.	.	ENSG00000185477	ENST00000333209	T	0.12147	2.71	4.93	-0.481	0.12082	.	1.634920	0.04032	N	0.301571	T	0.06826	0.0174	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.31724	-0.9933	10	0.13108	T	0.6	-5.0277	1.5259	0.02525	0.129:0.2131:0.1336:0.5243	.	229	Q6ZVF9	GRIN3_HUMAN	G	229	ENSP00000328672:D229G	ENSP00000328672:D229G	D	-	2	0	GPRIN3	90389599	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.156000	0.16382	-0.119000	0.11830	0.528000	0.53228	GAC	.	.		0.547	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
PPP3CA	5530	hgsc.bcm.edu	37	4	101982264	101982264	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:101982264G>A	ENST00000394854.3	-	10	1819	c.1136C>T	c.(1135-1137)tCa>tTa	p.S379L	PPP3CA_ENST00000323055.6_Missense_Mutation_p.S337L|PPP3CA_ENST00000523694.2_Missense_Mutation_p.S312L|PPP3CA_ENST00000507176.1_Missense_Mutation_p.S281L|PPP3CA_ENST00000394853.4_Missense_Mutation_p.S379L|PPP3CA_ENST00000512215.1_Missense_Mutation_p.S147L	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	379					calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		ATCTTCTTCTGACCCTAGTTC	0.368																																					p.S379L		Atlas-SNP	.											.	PPP3CA	51	.	0			c.C1136T						.						128.0	121.0	123.0					4																	101982264		2203	4300	6503	SO:0001583	missense	5530	exon10			TCTTCTGACCCTA		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1136C>T	chr4.hg19:g.101982264G>A	ENSP00000378323:p.Ser379Leu	424.0	0.0		405.0	86.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	hg19	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222758	0.79464	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4;3.4	5.34	5.34	0.76211	.	0.312988	0.31031	N	0.008391	T	0.06005	0.0156	N	0.17474	0.49	0.58432	D	0.999998	B;B;B;B;B;B	0.23058	0.0;0.079;0.001;0.001;0.0;0.0	B;B;B;B;B;B	0.18263	0.001;0.021;0.002;0.005;0.001;0.001	T	0.44329	-0.9335	10	0.38643	T	0.18	-10.1385	19.0616	0.93095	0.0:0.0:1.0:0.0	.	379;147;337;379;281;312	Q08209;A8W6Z8;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.;.	L	147;379;337;379;281;312	ENSP00000422781:S147L;ENSP00000378323:S379L;ENSP00000320580:S337L;ENSP00000378322:S379L;ENSP00000422990:S281L;ENSP00000429350:S312L	ENSP00000320580:S337L	S	-	2	0	PPP3CA	102201287	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.327000	0.72910	2.499000	0.84300	0.591000	0.81541	TCA	.	.		0.368	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
PPP3CA	5530	hgsc.bcm.edu	37	4	102030182	102030182	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:102030182C>T	ENST00000394854.3	-	3	996	c.313G>A	c.(313-315)Ggg>Agg	p.G105R	PPP3CA_ENST00000323055.6_Missense_Mutation_p.G105R|PPP3CA_ENST00000523694.2_Missense_Mutation_p.G38R|PPP3CA_ENST00000507176.1_Missense_Mutation_p.G7R|PPP3CA_ENST00000394853.4_Missense_Mutation_p.G105R|PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000510292.1_5'UTR	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	105	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GGAGATCCCCCGACTTCAAAG	0.393																																					p.G105R		Atlas-SNP	.											.	PPP3CA	51	.	0			c.G313A						.						87.0	82.0	83.0					4																	102030182		2203	4300	6503	SO:0001583	missense	5530	exon3			ATCCCCCGACTTC		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.313G>A	chr4.hg19:g.102030182C>T	ENSP00000378323:p.Gly105Arg	76.0	0.0		86.0	4.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	hg19	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935218	0.92458	.	.	ENSG00000138814	ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694;ENST00000529324;ENST00000525819	T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;3.39;3.39;-0.35;-0.35	4.93	4.93	0.64822	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.88009	0.6322	H	0.96460	3.825	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;P;D;D	0.97110	0.999;1.0;0.825;1.0;0.998	D	0.92027	0.5630	10	0.87932	D	0	-13.7346	18.5379	0.91017	0.0:1.0:0.0:0.0	.	105;105;105;7;38	Q08209;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.	R	105;105;105;7;38;55;55	ENSP00000378323:G105R;ENSP00000320580:G105R;ENSP00000378322:G105R;ENSP00000422990:G7R;ENSP00000429350:G38R;ENSP00000431619:G55R;ENSP00000434599:G55R	ENSP00000320580:G105R	G	-	1	0	PPP3CA	102249205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.538000	0.82048	2.423000	0.82170	0.650000	0.86243	GGG	.	.		0.393	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
BANK1	55024	hgsc.bcm.edu	37	4	102783739	102783739	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:102783739G>T	ENST00000322953.4	+	4	955	c.681G>T	c.(679-681)gaG>gaT	p.E227D	BANK1_ENST00000444316.2_Missense_Mutation_p.E197D|BANK1_ENST00000428908.1_Missense_Mutation_p.E94D|BANK1_ENST00000508653.1_Missense_Mutation_p.E94D|BANK1_ENST00000504592.1_Missense_Mutation_p.E212D	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	227	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		ATACTGTAGAGGTTGAATTTA	0.338																																					p.E227D		Atlas-SNP	.											.	BANK1	95	.	0			c.G681T						.						80.0	80.0	80.0					4																	102783739		2203	4299	6502	SO:0001583	missense	55024	exon4			TGTAGAGGTTGAA	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.681G>T	chr4.hg19:g.102783739G>T	ENSP00000320509:p.Glu227Asp	144.0	0.0		187.0	73.0	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	hg19	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980235	0.53827	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.27104	2.41;2.41;1.69;1.69;2.42	5.14	1.94	0.25998	DBB domain (1);	0.000000	0.64402	D	0.000005	T	0.42291	0.1196	M	0.65975	2.015	0.25299	N	0.989295	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.991;0.991	T	0.11397	-1.0589	10	0.49607	T	0.09	.	7.3529	0.26703	0.3815:0.0:0.6185:0.0	.	94;227;212	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	D	212;227;94;94;197	ENSP00000421443:E212D;ENSP00000320509:E227D;ENSP00000412748:E94D;ENSP00000422314:E94D;ENSP00000388817:E197D	ENSP00000320509:E227D	E	+	3	2	BANK1	103002762	0.926000	0.31397	0.984000	0.44739	0.689000	0.40095	-0.093000	0.11111	0.527000	0.28560	0.585000	0.79938	GAG	.	.		0.338	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
SYNPO2	171024	hgsc.bcm.edu	37	4	119947966	119947966	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:119947966A>G	ENST00000429713.2	+	3	624	c.442A>G	c.(442-444)Agt>Ggt	p.S148G	SYNPO2_ENST00000307142.4_Missense_Mutation_p.S148G|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Missense_Mutation_p.S148G	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	148						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GAACCAAAGAAGTGGTCCCGA	0.552																																					p.S148G		Atlas-SNP	.											.	SYNPO2	353	.	0			c.A442G						.						42.0	43.0	43.0					4																	119947966		2203	4300	6503	SO:0001583	missense	171024	exon3			CAAAGAAGTGGTC	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.442A>G	chr4.hg19:g.119947966A>G	ENSP00000395143:p.Ser148Gly	77.0	0.0		77.0	6.0	NM_001128934	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	hg19	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.306|9.306	1.054287|1.054287	0.19907|0.19907	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|T;T;T	.|0.09538	.|2.97;2.99;2.98	5.51|5.51	4.31|4.31	0.51392|0.51392	.|.	.|0.197914	.|0.35349	.|N	.|0.003278	T|T	0.12561|0.12561	0.0305|0.0305	L|L	0.54323|0.54323	1.7|1.7	0.25522|0.25522	N|N	0.987354|0.987354	.|B;B;B;B	.|0.20261	.|0.043;0.003;0.043;0.043	.|B;B;B;B	.|0.19391	.|0.025;0.006;0.025;0.025	T|T	0.13176|0.13176	-1.0519|-1.0519	5|10	.|0.49607	.|T	.|0.09	-0.5522|-0.5522	11.3767|11.3767	0.49733|0.49733	0.8483:0.1517:0.0:0.0|0.8483:0.1517:0.0:0.0	.|.	.|148;148;148;148	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	R|G	99|148	.|ENSP00000306015:S148G;ENSP00000395143:S148G;ENSP00000390965:S148G	.|ENSP00000306015:S148G	K|S	+|+	2|1	0|0	SYNPO2|SYNPO2	120167414|120167414	0.005000|0.005000	0.15991|0.15991	0.001000|0.001000	0.08648|0.08648	0.328000|0.328000	0.28507|0.28507	0.963000|0.963000	0.29293|0.29293	0.897000|0.897000	0.36392|0.36392	0.455000|0.455000	0.32223|0.32223	AAG|AGT	.	.		0.552	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
HSPA4L	22824	hgsc.bcm.edu	37	4	128724944	128724944	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:128724944A>G	ENST00000296464.4	+	7	1235	c.824A>G	c.(823-825)aAg>aGg	p.K275R	HSPA4L_ENST00000505726.1_Missense_Mutation_p.K249R|HSPA4L_ENST00000508776.1_Missense_Mutation_p.K275R|HSPA4L_ENST00000439123.2_Missense_Mutation_p.K306R	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	275					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AAACTAAAGAAGCTAATGAGT	0.353																																					p.K275R		Atlas-SNP	.											.	HSPA4L	82	.	0			c.A824G						.						82.0	85.0	84.0					4																	128724944		2203	4300	6503	SO:0001583	missense	22824	exon7			TAAAGAAGCTAAT	AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.824A>G	chr4.hg19:g.128724944A>G	ENSP00000296464:p.Lys275Arg	111.0	0.0		99.0	4.0	NM_014278	A2ICT2|Q4W5M5|Q8IWA2	Missense_Mutation	SNP	ENST00000296464.4	hg19	CCDS3734.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.869552	0.91587	.	.	ENSG00000164070	ENST00000508776;ENST00000439123;ENST00000296464;ENST00000508549;ENST00000505726	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.36441	0.0967	N	0.12422	0.21	0.58432	D	0.999999	P;D;D	0.76494	0.584;0.999;0.999	P;D;D	0.81914	0.539;0.995;0.995	T	0.32079	-0.9920	10	0.40728	T	0.16	.	14.6317	0.68660	1.0:0.0:0.0:0.0	.	249;275;275	E9PDE8;A2ICT2;O95757	.;.;HS74L_HUMAN	R	275;306;275;234;249	ENSP00000422482:K275R;ENSP00000393926:K306R;ENSP00000296464:K275R;ENSP00000427305:K234R;ENSP00000425645:K249R	ENSP00000296464:K275R	K	+	2	0	HSPA4L	128944394	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.313000	0.89978	2.055000	0.61198	0.477000	0.44152	AAG	.	.		0.353	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3	NM_014278	
INPP4B	8821	hgsc.bcm.edu	37	4	143029265	143029265	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:143029265C>T	ENST00000513000.1	-	24	2788	c.2355G>A	c.(2353-2355)atG>atA	p.M785I	INPP4B_ENST00000508116.1_Missense_Mutation_p.M785I|INPP4B_ENST00000509777.1_Missense_Mutation_p.M785I|INPP4B_ENST00000262992.4_Missense_Mutation_p.M785I|INPP4B_ENST00000308502.4_Missense_Mutation_p.M785I	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	785					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.M785I(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					GCATCTTTTCCATAAATATCT	0.328																																					p.M785I		Atlas-SNP	.											INPP4B,NS,carcinoma,0,1	INPP4B	132	.	1	Substitution - Missense(1)	lung(1)	c.G2355A						.						80.0	83.0	82.0					4																	143029265		2201	4299	6500	SO:0001583	missense	8821	exon24			CTTTTCCATAAAT	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2355G>A	chr4.hg19:g.143029265C>T	ENSP00000425487:p.Met785Ile	80.0	0.0		70.0	3.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	hg19	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980441	0.34942	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.29397	2.0;2.0;2.0;2.0;2.0;1.99;1.57;1.57	5.63	3.75	0.43078	.	0.160134	0.53938	D	0.000053	T	0.14356	0.0347	N	0.12182	0.205	0.31020	N	0.718235	B	0.13145	0.007	B	0.08055	0.003	T	0.03463	-1.1034	10	0.34782	T	0.22	.	5.4425	0.16517	0.2198:0.5893:0.1137:0.0772	.	785	O15327	INP4B_HUMAN	I	785;785;785;656;785;785;600;600;785;656	ENSP00000425487:M785I;ENSP00000262992:M785I;ENSP00000308441:M785I;ENSP00000423954:M785I;ENSP00000422793:M785I;ENSP00000426207:M600I;ENSP00000427250:M785I;ENSP00000421065:M656I	ENSP00000262992:M785I	M	-	3	0	INPP4B	143248715	0.995000	0.38212	1.000000	0.80357	0.987000	0.75469	0.432000	0.21461	2.641000	0.89580	0.650000	0.86243	ATG	.	.		0.328	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
SH3D19	152503	hgsc.bcm.edu	37	4	152095911	152095911	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:152095911T>C	ENST00000409252.2	-	6	1312	c.605A>G	c.(604-606)gAc>gGc	p.D202G	SH3D19_ENST00000604030.1_5'Flank|SH3D19_ENST00000455740.1_Missense_Mutation_p.D202G|SH3D19_ENST00000427414.2_Missense_Mutation_p.D202G|SH3D19_ENST00000514152.1_Missense_Mutation_p.D202G|SH3D19_ENST00000409598.4_Missense_Mutation_p.D202G|SH3D19_ENST00000304527.4_Missense_Mutation_p.D202G|SH3D19_ENST00000424281.1_Missense_Mutation_p.D202G			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	202	Pro-rich.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				GAGATCGATGTCCACCAAGGG	0.537																																					p.D202G		Atlas-SNP	.											.	SH3D19	54	.	0			c.A605G						.						160.0	176.0	171.0					4																	152095911		2203	4300	6503	SO:0001583	missense	152503	exon1			TCGATGTCCACCA	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.605A>G	chr4.hg19:g.152095911T>C	ENSP00000386848:p.Asp202Gly	96.0	0.0		125.0	5.0	NM_001128924	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	hg19	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	T	7.098	0.573582	0.13623	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.71579	-0.55;0.13;-0.55;-0.58;-0.58;0.13;-0.55	5.4	5.4	0.78164	.	1.211440	0.05680	N	0.590239	T	0.67988	0.2952	L	0.46157	1.445	0.29947	N	0.820543	B;B;B	0.26318	0.034;0.146;0.146	B;B;B	0.25140	0.015;0.034;0.058	T	0.58651	-0.7599	10	0.46703	T	0.11	-11.4643	11.4179	0.49962	0.0:0.073:0.0:0.927	.	202;202;202	Q5HYK7;Q5HYK7-2;Q5HYK7-3	SH319_HUMAN;.;.	G	202	ENSP00000387030:D202G;ENSP00000302913:D202G;ENSP00000416708:D202G;ENSP00000404542:D202G;ENSP00000415694:D202G;ENSP00000386848:D202G;ENSP00000423449:D202G	ENSP00000302913:D202G	D	-	2	0	SH3D19	152315361	1.000000	0.71417	0.986000	0.45419	0.030000	0.12068	3.918000	0.56432	2.046000	0.60703	0.368000	0.22195	GAC	.	.		0.537	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
FHDC1	85462	hgsc.bcm.edu	37	4	153864458	153864458	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:153864458T>C	ENST00000511601.1	+	2	437	c.249T>C	c.(247-249)acT>acC	p.T83T	FHDC1_ENST00000260008.3_Silent_p.T83T			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	83									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					CCCCAACTACTCACATGAACG	0.552																																					p.T83T		Atlas-SNP	.											.	FHDC1	102	.	0			c.T249C						.						59.0	66.0	63.0					4																	153864458		2202	4292	6494	SO:0001819	synonymous_variant	85462	exon1			AACTACTCACATG	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.249T>C	chr4.hg19:g.153864458T>C		96.0	0.0		108.0	5.0	NM_033393		Silent	SNP	ENST00000511601.1	hg19	CCDS34081.1																																																																																			.	.		0.552	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
C4orf46	201725	hgsc.bcm.edu	37	4	159592902	159592902	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:159592902A>G	ENST00000379205.4	-	1	296	c.52T>C	c.(52-54)Tct>Cct	p.S18P	ETFDH_ENST00000307738.5_5'Flank|ETFDH_ENST00000511912.1_5'Flank|C4orf46_ENST00000508836.1_Intron|C4orf46_ENST00000508457.1_Missense_Mutation_p.S18P	NM_001008393.2	NP_001008394.1	Q504U0	CD046_HUMAN	chromosome 4 open reading frame 46	18										kidney(1)|lung(3)|skin(1)	5						GAGGGAGAAGAGGGAGGCGGC	0.672																																					p.S18P		Atlas-SNP	.											.	C4orf46	11	.	0			c.T52C						.						13.0	15.0	14.0					4																	159592902		2190	4270	6460	SO:0001583	missense	201725	exon1			GAGAAGAGGGAGG		CCDS34088.1	4q32.1	2014-07-30			ENSG00000205208	ENSG00000205208			27320	protein-coding gene	gene with protein product	"""renal cancer differentiation gene 1"""						Standard	NM_001008393		Approved	LOC201725, RCDG1	uc003iqa.3	Q504U0	OTTHUMG00000161919	ENST00000379205.4:c.52T>C	chr4.hg19:g.159592902A>G	ENSP00000368503:p.Ser18Pro	174.0	0.0		125.0	9.0	NM_001008393	B3KNH7	Missense_Mutation	SNP	ENST00000379205.4	hg19	CCDS34088.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.990088	0.35131	.	.	ENSG00000205208	ENST00000379205;ENST00000508457	.	.	.	4.11	2.9	0.33743	.	0.160078	0.29806	N	0.011151	T	0.16385	0.0394	N	0.24115	0.695	0.09310	N	1	P	0.41848	0.763	B	0.40285	0.325	T	0.11717	-1.0576	9	0.09590	T	0.72	.	6.4111	0.21692	0.8862:0.0:0.1138:0.0	.	18	Q504U0	CD046_HUMAN	P	18	.	ENSP00000368503:S18P	S	-	1	0	C4orf46	159812352	0.393000	0.25237	0.001000	0.08648	0.004000	0.04260	3.458000	0.53014	0.722000	0.32252	0.460000	0.39030	TCT	.	.		0.672	C4orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366378.1	NM_001008393	
CEP44	80817	hgsc.bcm.edu	37	4	175225512	175225512	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:175225512T>C	ENST00000503780.1	+	6	913	c.499T>C	c.(499-501)Tca>Cca	p.S167P	CEP44_ENST00000426172.1_Missense_Mutation_p.S167P|CEP44_ENST00000457424.2_Missense_Mutation_p.S167P|CEP44_ENST00000296519.4_Missense_Mutation_p.S167P	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	167						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						GTTTATGACCTCAGGAAAGGT	0.368																																					p.S167P		Atlas-SNP	.											.	CEP44	35	.	0			c.T499C						.						61.0	64.0	63.0					4																	175225512		2203	4300	6503	SO:0001583	missense	80817	exon6			ATGACCTCAGGAA	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.499T>C	chr4.hg19:g.175225512T>C	ENSP00000423153:p.Ser167Pro	146.0	0.0		166.0	12.0	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	hg19	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527136	0.44969	.	.	ENSG00000164118	ENST00000503780;ENST00000457424;ENST00000515299;ENST00000426172;ENST00000296519	T;T;T;T;T	0.54279	0.62;0.58;0.7;0.58;0.62	5.02	5.02	0.67125	.	0.299367	0.28420	N	0.015409	T	0.69424	0.3109	M	0.70595	2.14	0.33950	D	0.644319	D;D	0.76494	0.999;0.999	D;D	0.85130	0.996;0.997	T	0.79405	-0.1817	10	0.62326	D	0.03	.	11.418	0.49965	0.0:0.0:0.0:1.0	.	167;167	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	P	167	ENSP00000423153:S167P;ENSP00000389427:S167P;ENSP00000421128:S167P;ENSP00000408221:S167P;ENSP00000296519:S167P	ENSP00000296519:S167P	S	+	1	0	CEP44	175462087	1.000000	0.71417	0.973000	0.42090	0.039000	0.13416	3.892000	0.56235	2.002000	0.58637	0.383000	0.25322	TCA	.	.		0.368	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
SNX25	83891	hgsc.bcm.edu	37	4	186185597	186185597	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:186185597A>G	ENST00000504273.1	+	4	539	c.245A>G	c.(244-246)gAa>gGa	p.E82G	SNX25_ENST00000264694.8_Missense_Mutation_p.E82G			Q9H3E2	SNX25_HUMAN	sorting nexin 25	82	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TTTAGACATGAAGAACAGCCA	0.343																																					p.E82G		Atlas-SNP	.											.	SNX25	100	.	0			c.A245G						.						126.0	120.0	122.0					4																	186185597		2203	4300	6503	SO:0001583	missense	83891	exon4			GACATGAAGAACA	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.245A>G	chr4.hg19:g.186185597A>G	ENSP00000426255:p.Glu82Gly	104.0	0.0		60.0	4.0	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	hg19	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.663181	0.47572	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.11277	2.79;2.79	5.15	5.15	0.70609	Phox-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.11024	0.0269	L	0.28740	0.885	0.53688	D	0.999975	B	0.31752	0.338	B	0.37015	0.239	T	0.26087	-1.0113	10	0.25106	T	0.35	-19.9126	15.1313	0.72527	1.0:0.0:0.0:0.0	.	82	Q9H3E2	SNX25_HUMAN	G	82	ENSP00000426255:E82G;ENSP00000264694:E82G	ENSP00000264694:E82G	E	+	2	0	SNX25	186422591	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.845000	0.86875	2.163000	0.67991	0.533000	0.62120	GAA	.	.		0.343	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
SLC9A3	6550	hgsc.bcm.edu	37	5	477525	477525	+	Missense_Mutation	SNP	G	G	T	rs371187218		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:477525G>T	ENST00000264938.3	-	11	1691	c.1682C>A	c.(1681-1683)tCc>tAc	p.S561Y	CTD-2228K2.7_ENST00000606319.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.S552Y|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	561					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GGTGCTGGGGGAGCGGATGAA	0.642																																					p.S561Y		Atlas-SNP	.											.	SLC9A3	89	.	0			c.C1682A						.	G	TYR/SER	0,4406		0,0,2203	84.0	63.0	70.0		1682	4.9	1.0	5		70	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC9A3	NM_004174.2	144	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	561/835	477525	1,13005	2203	4300	6503	SO:0001583	missense	6550	exon11			CTGGGGGAGCGGA		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1682C>A	chr5.hg19:g.477525G>T	ENSP00000264938:p.Ser561Tyr	106.0	0.0		189.0	44.0	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	hg19	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764383	0.89932	0.0	1.16E-4	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.76839	-1.05;-1.05	4.88	4.88	0.63580	.	0.114937	0.64402	D	0.000011	D	0.88062	0.6336	M	0.77103	2.36	0.41372	D	0.987493	D;D	0.76494	0.997;0.999	D;D	0.83275	0.931;0.996	D	0.88561	0.3123	10	0.45353	T	0.12	.	17.6513	0.88164	0.0:0.0:1.0:0.0	.	552;561	E9PF67;P48764	.;SL9A3_HUMAN	Y	561;552	ENSP00000264938:S561Y;ENSP00000422983:S552Y	ENSP00000264938:S561Y	S	-	2	0	SLC9A3	530525	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.478000	0.73596	2.251000	0.74343	0.561000	0.74099	TCC	.	.		0.642	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
ROPN1L	83853	hgsc.bcm.edu	37	5	10450066	10450066	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:10450066T>C	ENST00000503804.1	+	4	779	c.258T>C	c.(256-258)tgT>tgC	p.C86C	ROPN1L_ENST00000274134.4_Silent_p.C86C|ROPN1L_ENST00000510520.1_3'UTR			Q96C74	ROP1L_HUMAN	rhophilin associated tail protein 1-like	86					epithelial cilium movement (GO:0003351)|regulation of protein phosphorylation (GO:0001932)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)	14						CCAAACAGTGTCACCACAAGC	0.418																																					p.C86C		Atlas-SNP	.											.	ROPN1L	33	.	0			c.T258C						.						86.0	79.0	81.0					5																	10450066		2203	4300	6503	SO:0001819	synonymous_variant	83853	exon3			ACAGTGTCACCAC	AF239723	CCDS3879.1	5p15	2011-01-20	2011-01-20		ENSG00000145491	ENSG00000145491			24060	protein-coding gene	gene with protein product	"""radial spoke head 11 homolog (Chlamydomonas)"""	611756	"""ropporin 1-like"""			11278869	Standard	NM_031916		Approved	ASP, FLJ25776, RSPH11	uc021xwo.1	Q96C74	OTTHUMG00000090507	ENST00000503804.1:c.258T>C	chr5.hg19:g.10450066T>C		71.0	0.0		96.0	4.0	NM_031916	D3DTC9|Q9BZX0	Silent	SNP	ENST00000503804.1	hg19	CCDS3879.1																																																																																			.	.		0.418	ROPN1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367033.1	NM_031916	
MYO10	4651	hgsc.bcm.edu	37	5	16783454	16783454	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:16783454G>T	ENST00000513610.1	-	5	1046	c.592C>A	c.(592-594)Ctt>Att	p.L198I		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	198	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CTGCTTTCAAGAATAGCTCGT	0.358																																					p.L198I		Atlas-SNP	.											.	MYO10	198	.	0			c.C592A						.						81.0	74.0	76.0					5																	16783454		1848	4103	5951	SO:0001583	missense	4651	exon5			TTTCAAGAATAGC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.592C>A	chr5.hg19:g.16783454G>T	ENSP00000421280:p.Leu198Ile	54.0	0.0		105.0	20.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	hg19	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596256	0.46318	.	.	ENSG00000145555	ENST00000513610;ENST00000513882;ENST00000502436	D;D;D	0.89270	-2.49;-2.49;-2.49	5.52	5.52	0.82312	Myosin head, motor domain (2);	.	.	.	.	D	0.91023	0.7176	M	0.73430	2.235	0.80722	D	1	P;D	0.55605	0.868;0.972	P;P	0.52672	0.706;0.528	D	0.91402	0.5144	9	0.72032	D	0.01	.	9.9945	0.41891	0.1488:0.0:0.8512:0.0	.	165;198	E9PCN3;Q9HD67	.;MYO10_HUMAN	I	198;209;165	ENSP00000421280:L198I;ENSP00000421309:L209I;ENSP00000426783:L165I	ENSP00000426783:L165I	L	-	1	0	MYO10	16836454	1.000000	0.71417	0.904000	0.35570	0.346000	0.29079	2.650000	0.46665	2.595000	0.87683	0.655000	0.94253	CTT	.	.		0.358	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
NIPBL	25836	hgsc.bcm.edu	37	5	37063996	37063996	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:37063996A>G	ENST00000282516.8	+	46	8464	c.7965A>G	c.(7963-7965)ggA>ggG	p.G2655G	NIPBL_ENST00000448238.2_Silent_p.G2655G	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2655					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CACTGCTTGGAGGAGGCAGCC	0.493																																					p.G2655G		Atlas-SNP	.											.	NIPBL	513	.	0			c.A7965G						.						104.0	102.0	103.0					5																	37063996		2203	4300	6503	SO:0001819	synonymous_variant	25836	exon46			GCTTGGAGGAGGC	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.7965A>G	chr5.hg19:g.37063996A>G		64.0	0.0		99.0	4.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	hg19	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.114178	0.37339	.	.	ENSG00000164190	ENST00000513819;ENST00000507919	T	0.80738	-1.41	5.5	4.31	0.51392	.	.	.	.	.	D	0.83427	0.5252	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.81040	-0.1113	5	.	.	.	-13.6719	12.4483	0.55664	0.8597:0.1402:0.0:0.0	.	.	.	.	G	123;161	ENSP00000421504:E123G	.	E	+	2	0	NIPBL	37099753	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.834000	0.69361	0.871000	0.35750	0.482000	0.46254	GAG	.	.		0.493	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ITGA2	3673	hgsc.bcm.edu	37	5	52356813	52356813	+	Silent	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:52356813A>T	ENST00000296585.5	+	12	1538	c.1395A>T	c.(1393-1395)atA>atT	p.I465I		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	465					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CCGGCCAGATAGTGCTATATA	0.438																																					p.I465I		Atlas-SNP	.											.	ITGA2	211	.	0			c.A1395T						.						111.0	104.0	106.0					5																	52356813		2203	4300	6503	SO:0001819	synonymous_variant	3673	exon12			CCAGATAGTGCTA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1395A>T	chr5.hg19:g.52356813A>T		189.0	0.0		194.0	73.0	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	hg19	CCDS3957.1																																																																																			.	.		0.438	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54635841	54635841	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:54635841T>C	ENST00000230640.5	+	6	773	c.519T>C	c.(517-519)taT>taC	p.Y173Y	SKIV2L2_ENST00000545714.1_Silent_p.Y72Y	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	173	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTTGTAGGTATGCCATTGCAT	0.308																																					p.Y173Y	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											.	SKIV2L2	104	.	0			c.T519C						.						92.0	88.0	89.0					5																	54635841		2203	4300	6503	SO:0001819	synonymous_variant	23517	exon6			TAGGTATGCCATT	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.519T>C	chr5.hg19:g.54635841T>C		73.0	0.0		93.0	5.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	hg19	CCDS3967.1																																																																																			.	.		0.308	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
IL31RA	133396	hgsc.bcm.edu	37	5	55206415	55206415	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:55206415G>T	ENST00000447346.2	+	12	1622	c.1557G>T	c.(1555-1557)aaG>aaT	p.K519N	IL31RA_ENST00000490985.1_Missense_Mutation_p.K377N|IL31RA_ENST00000354961.4_Missense_Mutation_p.K500N|IL31RA_ENST00000359040.5_Missense_Mutation_p.K519N|IL31RA_ENST00000396834.1_Missense_Mutation_p.K500N	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	487					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TGAAACGAAAGACCTCTTACA	0.468																																					p.K519N		Atlas-SNP	.											.	IL31RA	84	.	0			c.G1557T						.						156.0	135.0	142.0					5																	55206415		2203	4300	6503	SO:0001583	missense	133396	exon12			ACGAAAGACCTCT	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1557G>T	chr5.hg19:g.55206415G>T	ENSP00000415900:p.Lys519Asn	233.0	0.0		267.0	105.0	NM_001242637	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	hg19	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	G	7.502	0.652814	0.14580	.	.	ENSG00000164509	ENST00000396834;ENST00000447346;ENST00000359040;ENST00000490985;ENST00000354961	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	5.01	2.27	0.28462	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.713450	0.14220	N	0.333513	T	0.29389	0.0732	N	0.17082	0.46	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.08055	0.003;0.003;0.002;0.003	T	0.07252	-1.0782	10	0.22109	T	0.4	-3.1832	3.2914	0.06950	0.1018:0.3087:0.4529:0.1366	.	487;519;500;519	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2	IL31R_HUMAN;.;.;.	N	500;519;519;377;500	ENSP00000380046:K500N;ENSP00000415900:K519N;ENSP00000351935:K519N;ENSP00000427533:K377N;ENSP00000347047:K500N	ENSP00000347047:K500N	K	+	3	2	IL31RA	55242172	0.932000	0.31603	0.868000	0.34077	0.953000	0.61014	0.524000	0.22940	0.380000	0.24823	0.557000	0.71058	AAG	.	.		0.468	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017	
SETD9	133383	hgsc.bcm.edu	37	5	56205565	56205565	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:56205565C>T	ENST00000285947.2	+	1	479	c.93C>T	c.(91-93)aaC>aaT	p.N31N	AC008937.3_ENST00000453721.1_RNA|SETD9_ENST00000475908.1_Intron|SETD9_ENST00000541720.1_Silent_p.N31N	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	31							methyltransferase activity (GO:0008168)										TAAGCCACAACCCGAGGTGAG	0.677																																					p.N31N		Atlas-SNP	.											.	.	.	.	0			c.C93T						.						47.0	31.0	37.0					5																	56205565		2203	4300	6503	SO:0001819	synonymous_variant	133383	exon1			CCACAACCCGAGG	BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.93C>T	chr5.hg19:g.56205565C>T		131.0	0.0		132.0	52.0	NM_153706	F5H713	Silent	SNP	ENST00000285947.2	hg19	CCDS3972.1																																																																																			.	.		0.677	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132304.2	NM_153706	
KIF2A	3796	hgsc.bcm.edu	37	5	61659121	61659121	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:61659121A>G	ENST00000401507.3	+	13	1547	c.1236A>G	c.(1234-1236)aaA>aaG	p.K412K	KIF2A_ENST00000381103.2_Silent_p.K392K|KIF2A_ENST00000407818.3_Silent_p.K412K|KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000506857.1_Silent_p.K366K	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	412	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		ATGTACTGAAACTCATTGACA	0.368																																					p.K412K		Atlas-SNP	.											.	KIF2A	69	.	0			c.A1236G						.						84.0	80.0	82.0					5																	61659121		2203	4300	6503	SO:0001819	synonymous_variant	3796	exon13			ACTGAAACTCATT	BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1236A>G	chr5.hg19:g.61659121A>G		45.0	0.0		92.0	6.0	NM_001098511	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Silent	SNP	ENST00000401507.3	hg19	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	A	10.40	1.339866	0.24339	.	.	ENSG00000068796	ENST00000512006	.	.	.	5.56	1.99	0.26369	.	.	.	.	.	T	0.54191	0.1843	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44298	-0.9337	4	.	.	.	.	6.5643	0.22503	0.3959:0.0:0.6041:0.0	.	.	.	.	S	48	.	.	N	+	2	0	KIF2A	61694878	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.439000	0.44846	0.437000	0.26423	0.533000	0.62120	AAC	.	.		0.368	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520	
TNPO1	3842	hgsc.bcm.edu	37	5	72168546	72168546	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:72168546A>G	ENST00000337273.5	+	7	1103	c.677A>G	c.(676-678)gAg>gGg	p.E226G	TNPO1_ENST00000447967.2_3'UTR|TNPO1_ENST00000454282.1_Splice_Site_p.E176G|TNPO1_ENST00000523768.1_Splice_Site_p.E176G|TNPO1_ENST00000506351.2_Splice_Site_p.E218G	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	226					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TCTTTTATTGAGGTAAGACTT	0.373																																					p.E226G		Atlas-SNP	.											.	TNPO1	90	.	0			c.A677G						.						142.0	123.0	130.0					5																	72168546		2203	4300	6503	SO:0001630	splice_region_variant	3842	exon7			TTATTGAGGTAAG	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.678+1A>G	chr5.hg19:g.72168546A>G		117.0	0.0		133.0	6.0	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	hg19	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.076948	0.76415	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67581	0.2908	M	0.67397	2.05	0.80722	D	1	B;B	0.19073	0.033;0.01	B;B	0.21151	0.033;0.015	T	0.65919	-0.6051	10	0.66056	D	0.02	-15.7147	16.4053	0.83662	1.0:0.0:0.0:0.0	.	176;226	Q92973-3;Q92973	.;TNPO1_HUMAN	G	226;176;176;218	ENSP00000336712:E226G;ENSP00000398524:E176G;ENSP00000428899:E176G;ENSP00000425118:E218G	ENSP00000336712:E226G	E	+	2	0	TNPO1	72204302	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.822000	0.92013	2.333000	0.79357	0.482000	0.46254	GAG	.	.		0.373	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	Missense_Mutation
VCAN	1462	hgsc.bcm.edu	37	5	82835029	82835029	+	Silent	SNP	G	G	A	rs563628544		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:82835029G>A	ENST00000265077.3	+	8	6772	c.6207G>A	c.(6205-6207)acG>acA	p.T2069T	VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000343200.5_Silent_p.T1082T|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2069	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TGGAAGGTACGAAAGCTCCAG	0.443																																					p.T2069T		Atlas-SNP	.											.	VCAN	498	.	0			c.G6207A						.						68.0	65.0	66.0					5																	82835029		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon8			AGGTACGAAAGCT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6207G>A	chr5.hg19:g.82835029G>A		66.0	0.0		91.0	36.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	hg19	CCDS4060.1																																																																																			.	.		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
GPR98	84059	hgsc.bcm.edu	37	5	89954088	89954088	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:89954088T>C	ENST00000405460.2	+	21	4841	c.4745T>C	c.(4744-4746)aTa>aCa	p.I1582T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1582	Calx-beta 11. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGAGCTTGTATACCAGAGGTA	0.368																																					p.I1582T		Atlas-SNP	.											GPR98,NS,NS,0,1	GPR98	605	.	0			c.T4745C						.						66.0	63.0	64.0					5																	89954088		1814	4080	5894	SO:0001583	missense	84059	exon21			CTTGTATACCAGA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4745T>C	chr5.hg19:g.89954088T>C	ENSP00000384582:p.Ile1582Thr	165.0	0.0		189.0	73.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.559747	0.86335	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.30182	1.54	5.75	5.75	0.90469	Na-Ca exchanger/integrin-beta4 (1);	0.000000	0.85682	D	0.000000	T	0.46171	0.1379	L	0.38838	1.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.27971	-1.0058	10	0.35671	T	0.21	.	16.0573	0.80814	0.0:0.0:0.0:1.0	.	1582	Q8WXG9	GPR98_HUMAN	T	1582	ENSP00000384582:I1582T	ENSP00000296619:I1582T	I	+	2	0	GPR98	89989844	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.777000	0.85628	2.191000	0.70037	0.528000	0.53228	ATA	.	.		0.368	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
ERAP2	64167	hgsc.bcm.edu	37	5	96215717	96215717	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:96215717T>C	ENST00000437043.3	+	2	1039	c.328T>C	c.(328-330)Ttg>Ctg	p.L110L	ERAP2_ENST00000379904.4_Silent_p.L110L|CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000510309.1_Silent_p.L110L	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	110					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		GTTTATCATCTTGCACAGCAA	0.433																																					p.L110L		Atlas-SNP	.											.	ERAP2	77	.	0			c.T328C						.						77.0	68.0	71.0					5																	96215717		2203	4300	6503	SO:0001819	synonymous_variant	64167	exon2			ATCATCTTGCACA	AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.328T>C	chr5.hg19:g.96215717T>C		125.0	0.0		100.0	4.0	NM_001130140	Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Silent	SNP	ENST00000437043.3	hg19	CCDS4086.1																																																																																			.	.		0.433	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250623.2	NM_022350	
AP3S1	1176	hgsc.bcm.edu	37	5	115249174	115249174	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:115249174C>A	ENST00000316788.7	+	6	1126	c.569C>A	c.(568-570)cCc>cAc	p.P190H	AP3S1_ENST00000505423.1_3'UTR	NM_001284.2	NP_001275.1	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1 subunit	190					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|AP-type membrane coat adaptor complex (GO:0030119)|Golgi apparatus (GO:0005794)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	12		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		CCAAACCTGCCCTCTTTTAAA	0.403																																					p.P190H		Atlas-SNP	.											.	AP3S1	25	.	0			c.C569A						.						69.0	73.0	72.0					5																	115249174		2202	4300	6502	SO:0001583	missense	1176	exon6			ACCTGCCCTCTTT	D63643	CCDS4123.1	5q22	2010-06-29			ENSG00000177879	ENSG00000177879			2013	protein-coding gene	gene with protein product		601507		CLAPS3		8697810, 9118953	Standard	NM_001284		Approved		uc003krl.3	Q92572	OTTHUMG00000128887	ENST00000316788.7:c.569C>A	chr5.hg19:g.115249174C>A	ENSP00000325369:p.Pro190His	225.0	0.0		231.0	40.0	NM_001284	O00647|O00676|O00721|O00727|Q53XL4|Q6ICQ2	Missense_Mutation	SNP	ENST00000316788.7	hg19	CCDS4123.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.847210	0.71603	.	.	ENSG00000177879	ENST00000316788	T	0.44881	0.91	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.37571	0.1008	N	0.22421	0.69	0.80722	D	1	P;P	0.43885	0.72;0.82	B;B	0.42112	0.376;0.376	T	0.29671	-1.0004	10	0.87932	D	0	6.6671	19.8996	0.96980	0.0:1.0:0.0:0.0	.	190;190	B2R4I8;Q92572	.;AP3S1_HUMAN	H	190	ENSP00000325369:P190H	ENSP00000325369:P190H	P	+	2	0	AP3S1	115277073	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.686000	0.84128	2.878000	0.98634	0.650000	0.86243	CCC	.	.		0.403	AP3S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250847.2		
SLC12A2	6558	hgsc.bcm.edu	37	5	127484452	127484452	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:127484452T>C	ENST00000262461.2	+	12	2077	c.1888T>C	c.(1888-1890)Tgt>Cgt	p.C630R	SLC12A2_ENST00000343225.4_Missense_Mutation_p.C630R	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	630					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TTAGGCTCTATGTAAGGACAA	0.328																																					p.C630R		Atlas-SNP	.											.	SLC12A2	119	.	0			c.T1888C						.						136.0	137.0	137.0					5																	127484452		2203	4298	6501	SO:0001583	missense	6558	exon12			GCTCTATGTAAGG		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1888T>C	chr5.hg19:g.127484452T>C	ENSP00000262461:p.Cys630Arg	66.0	0.0		97.0	4.0	NM_001046	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	hg19	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.879696	0.72294	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98901	-5.22;-5.22	4.95	4.95	0.65309	Amino acid permease domain (1);	0.107305	0.64402	D	0.000002	D	0.99227	0.9731	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99177	1.0866	10	0.87932	D	0	.	15.0598	0.71944	0.0:0.0:0.0:1.0	.	630;630	P55011-3;P55011	.;S12A2_HUMAN	R	630	ENSP00000262461:C630R;ENSP00000340878:C630R	ENSP00000262461:C630R	C	+	1	0	SLC12A2	127512351	1.000000	0.71417	0.989000	0.46669	0.834000	0.47266	7.798000	0.85924	2.202000	0.70862	0.477000	0.44152	TGT	.	.		0.328	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
IRF1	3659	hgsc.bcm.edu	37	5	131825125	131825125	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:131825125T>G	ENST00000245414.4	-	2	304	c.46A>C	c.(46-48)Att>Ctt	p.I16L	IRF1_ENST00000405885.2_Missense_Mutation_p.I16L|IRF1_ENST00000463784.1_Intron	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	16					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		TTGGAATTAATCTGCATCTCT	0.473																																					p.I16L		Atlas-SNP	.											.	IRF1	26	.	0			c.A46C						.						110.0	109.0	110.0					5																	131825125		2203	4300	6503	SO:0001583	missense	3659	exon2			AATTAATCTGCAT		CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.46A>C	chr5.hg19:g.131825125T>G	ENSP00000245414:p.Ile16Leu	114.0	0.0		128.0	41.0	NM_002198	Q96GG7	Missense_Mutation	SNP	ENST00000245414.4	hg19	CCDS4155.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.544270	0.86022	.	.	ENSG00000125347	ENST00000245414;ENST00000405885;ENST00000437654;ENST00000458069	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.59	5.59	0.84812	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	L	0.60845	1.875	0.80722	D	1	P;D	0.55385	0.924;0.971	D;D	0.76575	0.972;0.988	D	0.99891	1.1134	10	0.87932	D	0	-14.9777	16.0664	0.80878	0.0:0.0:0.0:1.0	.	16;16	Q5FBX3;P10914	.;IRF1_HUMAN	L	16	ENSP00000245414:I16L;ENSP00000384406:I16L;ENSP00000405655:I16L;ENSP00000396318:I16L	ENSP00000245414:I16L	I	-	1	0	IRF1	131853024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.905000	0.87416	2.254000	0.74563	0.459000	0.35465	ATT	.	.		0.473	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132340.1	NM_002198	
ZCCHC10	54819	hgsc.bcm.edu	37	5	132334321	132334321	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:132334321T>C	ENST00000509437.1	-	5	540	c.533A>G	c.(532-534)gAt>gGt	p.D178G	ZCCHC10_ENST00000513541.1_3'UTR|ZCCHC10_ENST00000508080.1_5'UTR|ZCCHC10_ENST00000355372.2_Missense_Mutation_p.D172G|ZCCHC10_ENST00000509008.1_3'UTR|ZCCHC10_ENST00000513848.1_Missense_Mutation_p.D142G|ZCCHC10_ENST00000324170.3_Missense_Mutation_p.D156G			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10	178	Ser-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAGCTGCTATCTGTGCTGGT	0.453																																					p.D156G		Atlas-SNP	.											.	ZCCHC10	7	.	0			c.A467G						.						74.0	77.0	76.0					5																	132334321		2203	4300	6503	SO:0001583	missense	54819	exon4			CTGCTATCTGTGC	BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.533A>G	chr5.hg19:g.132334321T>C	ENSP00000423276:p.Asp178Gly	82.0	0.0		100.0	36.0	NM_017665	Q9NXR4	Missense_Mutation	SNP	ENST00000509437.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.00	1.806386	0.31961	.	.	ENSG00000155329	ENST00000324170;ENST00000355372;ENST00000509437;ENST00000513848	.	.	.	4.82	2.4	0.29515	.	0.427167	0.24242	N	0.040252	T	0.46678	0.1405	.	.	.	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38993	-0.9635	8	0.72032	D	0.01	.	8.8543	0.35219	0.0:0.1573:0.0:0.8427	.	142;178;156	G3XAM1;Q8TBK6;Q8TBK6-2	.;ZCH10_HUMAN;.	G	156;172;178;142	.	ENSP00000324274:D156G	D	-	2	0	ZCCHC10	132362220	0.350000	0.24878	0.029000	0.17559	0.718000	0.41266	1.131000	0.31406	0.298000	0.22638	0.460000	0.39030	GAT	.	.		0.453	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000370163.1	NM_017665	
PCDHA3	56145	hgsc.bcm.edu	37	5	140181074	140181074	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:140181074C>T	ENST00000522353.2	+	1	292	c.292C>T	c.(292-294)Cgg>Tgg	p.R98W	PCDHA3_ENST00000532566.2_Missense_Mutation_p.R98W|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	98	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R98W(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGTGCGGGCGGAGCGCGGA	0.567																																					p.R98W		Atlas-SNP	.											PCDHA3_ENST00000522353,rectum,carcinoma,0,2	PCDHA3	396	.	2	Substitution - Missense(2)	large_intestine(2)	c.C292T						.						127.0	142.0	137.0					5																	140181074		2203	4300	6503	SO:0001583	missense	56145	exon1			TGCGGGCGGAGCG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.292C>T	chr5.hg19:g.140181074C>T	ENSP00000429808:p.Arg98Trp	59.0	0.0		71.0	3.0	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	hg19	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	N	3.113	-0.182174	0.06340	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.28666	1.6;1.6	4.51	1.59	0.23543	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.38005	U	0.001845	T	0.27594	0.0678	M	0.66378	2.025	0.09310	N	1	P;B	0.35226	0.491;0.091	B;B	0.35039	0.194;0.106	T	0.18335	-1.0340	10	0.59425	D	0.04	.	5.4105	0.16346	0.3787:0.4499:0.0978:0.0737	.	98;98	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	W	98	ENSP00000429808:R98W;ENSP00000434086:R98W	ENSP00000429808:R98W	R	+	1	2	PCDHA3	140161258	0.000000	0.05858	0.664000	0.29753	0.048000	0.14542	-1.633000	0.02022	-0.140000	0.11394	-1.595000	0.00837	CGG	.	.		0.567	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
ARAP3	64411	hgsc.bcm.edu	37	5	141038204	141038204	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:141038204T>C	ENST00000239440.4	-	24	3418	c.3353A>G	c.(3352-3354)gAc>gGc	p.D1118G	ARAP3_ENST00000513878.1_Missense_Mutation_p.D780G|ARAP3_ENST00000508305.1_Missense_Mutation_p.D949G|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1118	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CATGATGAGGTCTCCAGCCTG	0.498																																					p.D1118G		Atlas-SNP	.											.	ARAP3	139	.	0			c.A3353G						.						44.0	43.0	43.0					5																	141038204		2203	4300	6503	SO:0001583	missense	64411	exon24			ATGAGGTCTCCAG	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3353A>G	chr5.hg19:g.141038204T>C	ENSP00000239440:p.Asp1118Gly	81.0	0.0		87.0	6.0	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	hg19	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.823844	0.90873	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.20738	2.05;2.75;2.63	5.99	5.99	0.97316	Ras-association (1);	0.047372	0.85682	D	0.000000	T	0.45955	0.1368	M	0.75777	2.31	0.80722	D	1	D;D;P	0.67145	0.992;0.996;0.885	D;P;P	0.63113	0.911;0.825;0.492	T	0.46034	-0.9220	10	0.87932	D	0	.	16.126	0.81395	0.0:0.0:0.0:1.0	.	780;949;1118	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	G	949;1118;780	ENSP00000421826:D949G;ENSP00000239440:D1118G;ENSP00000421468:D780G	ENSP00000239440:D1118G	D	-	2	0	ARAP3	141018388	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.544000	0.82117	2.292000	0.77174	0.533000	0.62120	GAC	.	.		0.498	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
FBXO38	81545	hgsc.bcm.edu	37	5	147807217	147807217	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:147807217G>A	ENST00000340253.5	+	15	2528	c.2360G>A	c.(2359-2361)aGa>aAa	p.R787K	FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000394370.3_Missense_Mutation_p.R787K|CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000296701.6_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	787					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCAAAGGAGAACTAGCAGG	0.572																																					p.R787K		Atlas-SNP	.											.	FBXO38	115	.	0			c.G2360A						.						56.0	51.0	53.0					5																	147807217		2203	4300	6503	SO:0001583	missense	81545	exon15			AAAGGAGAACTAG	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2360G>A	chr5.hg19:g.147807217G>A	ENSP00000342023:p.Arg787Lys	82.0	0.0		100.0	33.0	NM_030793	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	hg19		.	.	.	.	.	.	.	.	.	.	G	13.21	2.169095	0.38315	.	.	ENSG00000145868	ENST00000340253;ENST00000394370	T;T	0.32988	1.51;1.43	6.04	6.04	0.98038	.	0.233362	0.46145	D	0.000307	T	0.23171	0.0560	N	0.24115	0.695	0.80722	D	1	B;P	0.36837	0.206;0.571	B;B	0.33392	0.124;0.163	T	0.02411	-1.1163	10	0.24483	T	0.36	-16.3308	19.1586	0.93522	0.0:0.0:1.0:0.0	.	787;787	Q6PIJ6-2;Q6PIJ6	.;FBX38_HUMAN	K	787	ENSP00000342023:R787K;ENSP00000377895:R787K	ENSP00000342023:R787K	R	+	2	0	FBXO38	147787410	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.698000	0.68302	2.873000	0.98535	0.563000	0.77884	AGA	.	.		0.572	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
ZNF300	91975	hgsc.bcm.edu	37	5	150275250	150275250	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:150275250T>C	ENST00000274599.5	-	6	1971	c.1551A>G	c.(1549-1551)ggA>ggG	p.G517G	ZNF300_ENST00000418587.2_Silent_p.G481G|ZNF300_ENST00000446148.2_Silent_p.G533G|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Silent_p.G517G	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGGTTTTTCTCCTGTGTGAA	0.423																																					p.G533G		Atlas-SNP	.											.	ZNF300	69	.	0			c.A1599G						.						48.0	50.0	49.0					5																	150275250		2203	4298	6501	SO:0001819	synonymous_variant	91975	exon7			TTTTTCTCCTGTG	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.1551A>G	chr5.hg19:g.150275250T>C		62.0	0.0		73.0	4.0	NM_001172831	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Silent	SNP	ENST00000274599.5	hg19	CCDS4311.2																																																																																			.	.		0.423	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860	
FAT2	2196	hgsc.bcm.edu	37	5	150908876	150908876	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:150908876T>C	ENST00000261800.5	-	14	9901	c.9889A>G	c.(9889-9891)Agc>Ggc	p.S3297G		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3297	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.|Poly-Ser.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGAGGAGCTCTTCCGGCTG	0.522																																					p.S3297G		Atlas-SNP	.											.	FAT2	465	.	0			c.A9889G						.						148.0	137.0	141.0					5																	150908876		2203	4300	6503	SO:0001583	missense	2196	exon14			AGGAGCTCTTCCG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9889A>G	chr5.hg19:g.150908876T>C	ENSP00000261800:p.Ser3297Gly	106.0	0.0		122.0	44.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.941|3.941	-0.014242|-0.014242	0.07681|0.07681	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.29917	.|1.55	5.58|5.58	1.56|1.56	0.23342|0.23342	.|Cadherin (4);Cadherin-like (1);	.|0.268112	.|0.32416	.|N	.|0.006121	T|T	0.05547|0.05547	0.0146|0.0146	N|N	0.00204|0.00204	-1.855|-1.855	0.26777|0.26777	N|N	0.96967|0.96967	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.42447|0.42447	-0.9451|-0.9451	5|10	.|0.02654	.|T	.|1	.|.	9.0585|9.0585	0.36421|0.36421	0.0:0.5909:0.0:0.4091|0.0:0.5909:0.0:0.4091	.|.	.|3297	.|Q9NYQ8	.|FAT2_HUMAN	G|G	155|3297	.|ENSP00000261800:S3297G	.|ENSP00000261800:S3297G	E|S	-|-	2|1	0|0	FAT2|FAT2	150889069|150889069	0.036000|0.036000	0.19791|0.19791	0.999000|0.999000	0.59377|0.59377	0.968000|0.968000	0.65278|0.65278	0.598000|0.598000	0.24074|0.24074	0.246000|0.246000	0.21394|0.21394	0.519000|0.519000	0.50382|0.50382	GAG|AGC	.	.		0.522	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
UBLCP1	134510	hgsc.bcm.edu	37	5	158705274	158705274	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:158705274A>G	ENST00000296786.6	+	9	1039	c.713A>G	c.(712-714)aAg>aGg	p.K238R		NM_145049.3	NP_659486.2	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase 1	238	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.|Phosphatase.					nucleolus (GO:0005730)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|kidney(3)|large_intestine(4)|ovary(1)	9	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATATGGGGAAAGTTTTCGGAG	0.328																																					p.K238R		Atlas-SNP	.											.	UBLCP1	27	.	0			c.A713G						.						97.0	97.0	97.0					5																	158705274		2203	4300	6503	SO:0001583	missense	134510	exon9			GGGGAAAGTTTTC	AK057996	CCDS4345.1	5q33.3	2010-06-21			ENSG00000164332	ENSG00000164332	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	28110	protein-coding gene	gene with protein product	"""CTD phosphatase-like with ubiquitin domain 1"""	609867				15883030	Standard	NM_145049		Approved	MGC10067, CPUB1	uc003lxq.2	Q8WVY7	OTTHUMG00000130305	ENST00000296786.6:c.713A>G	chr5.hg19:g.158705274A>G	ENSP00000296786:p.Lys238Arg	46.0	0.0		74.0	4.0	NM_145049	D3DQJ7|Q96DK5	Missense_Mutation	SNP	ENST00000296786.6	hg19	CCDS4345.1	.	.	.	.	.	.	.	.	.	.	A	18.87	3.715111	0.68844	.	.	ENSG00000164332	ENST00000296786	.	.	.	5.44	4.27	0.50696	HAD-superfamily hydrolase, subfamily IIID (1);NLI interacting factor (3);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.77150	0.4088	M	0.82716	2.605	0.51767	D	0.999936	D	0.89917	1.0	D	0.74023	0.982	T	0.75833	-0.3178	9	0.33141	T	0.24	-10.282	10.2956	0.43623	0.9245:0.0:0.0755:0.0	.	238	Q8WVY7	UBCP1_HUMAN	R	238	.	ENSP00000296786:K238R	K	+	2	0	UBLCP1	158637852	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.905000	0.92613	0.987000	0.38709	-0.290000	0.09829	AAG	.	.		0.328	UBLCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252650.2	NM_145049	
SPDL1	54908	hgsc.bcm.edu	37	5	169031187	169031187	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:169031187A>G	ENST00000265295.4	+	12	2073	c.1794A>G	c.(1792-1794)ccA>ccG	p.P598P		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		AATCTACTCCAGAGACCCAGT	0.363																																					p.P598P		Atlas-SNP	.											.	.	.	.	0			c.A1794G						.						77.0	83.0	81.0					5																	169031187		2203	4300	6503	SO:0001819	synonymous_variant	54908	exon12			TACTCCAGAGACC	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.1794A>G	chr5.hg19:g.169031187A>G		69.0	0.0		97.0	4.0	NM_017785		Silent	SNP	ENST00000265295.4	hg19	CCDS4370.1																																																																																			.	.		0.363	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
RNF44	22838	hgsc.bcm.edu	37	5	175958000	175958000	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:175958000T>C	ENST00000274811.4	-	5	1012	c.488A>G	c.(487-489)cAg>cGg	p.Q163R	RNF44_ENST00000509404.1_5'Flank|RNF44_ENST00000537487.1_Missense_Mutation_p.Q82R	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	163	Pro-rich.						zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGCAGCTGCTGCATGGTGCA	0.657																																					p.Q163R		Atlas-SNP	.											.	RNF44	33	.	0			c.A488G						.						15.0	18.0	17.0					5																	175958000		2197	4277	6474	SO:0001583	missense	22838	exon5			AGCTGCTGCATGG	AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.488A>G	chr5.hg19:g.175958000T>C	ENSP00000274811:p.Gln163Arg	57.0	0.0		91.0	4.0	NM_014901	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	ENST00000274811.4	hg19	CCDS4404.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696638	0.88830	.	.	ENSG00000146083	ENST00000274811;ENST00000537487	T;T	0.43294	0.95;0.95	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.59918	0.2229	M	0.65498	2.005	0.43550	D	0.995856	D	0.69078	0.997	D	0.81914	0.995	T	0.56360	-0.7992	10	0.14656	T	0.56	-20.6712	15.378	0.74630	0.0:0.0:0.0:1.0	.	163	Q7L0R7	RNF44_HUMAN	R	163;82	ENSP00000274811:Q163R;ENSP00000440352:Q82R	ENSP00000274811:Q163R	Q	-	2	0	RNF44	175890606	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.866000	0.69590	2.051000	0.60960	0.459000	0.35465	CAG	.	.		0.657	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253156.2		
FLT4	2324	hgsc.bcm.edu	37	5	180036905	180036905	+	Splice_Site	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:180036905C>A	ENST00000261937.6	-	28	3885	c.3807G>T	c.(3805-3807)gtG>gtT	p.V1269V	FLT4_ENST00000502649.1_Splice_Site_p.V1269V|FLT4_ENST00000393347.3_Splice_Site_p.V1269V	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1269					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGTGAAGTACCACAGAGCCTT	0.607																																					p.V1269V	Colon(97;1075 1466 27033 27547 35871)	Atlas-SNP	.											.	FLT4	356	.	0			c.G3807T						.						135.0	127.0	129.0					5																	180036905		2203	4300	6503	SO:0001630	splice_region_variant	2324	exon28			AAGTACCACAGAG	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3807+1G>T	chr5.hg19:g.180036905C>A		109.0	0.0		124.0	49.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	hg19	CCDS4457.1																																																																																			.	.		0.607	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		Silent
MAS1L	116511	hgsc.bcm.edu	37	6	29454972	29454972	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:29454972T>C	ENST00000377127.3	-	1	766	c.708A>G	c.(706-708)tcA>tcG	p.S236S		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	236					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						ACATCACAAGTGAAAGGATAG	0.453																																					p.S236S	NSCLC(153;755 1987 3859 11251 32945)	Atlas-SNP	.											.	MAS1L	66	.	0			c.A708G						.						45.0	47.0	46.0					6																	29454972		2203	4300	6503	SO:0001819	synonymous_variant	116511	exon1			CACAAGTGAAAGG	S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.708A>G	chr6.hg19:g.29454972T>C		53.0	0.0		83.0	4.0	NM_052967	Q5SUN5	Silent	SNP	ENST00000377127.3	hg19	CCDS4661.1																																																																																			.	.		0.453	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967	
HLA-E	3133	hgsc.bcm.edu	37	6	30458995	30458995	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:30458995C>G	ENST00000376630.4	+	4	757	c.692C>G	c.(691-693)cCt>cGt	p.P231R		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	231	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						GGCTTCTACCCTGCGGAGATC	0.622																																					p.P231R		Atlas-SNP	.											.	HLA-E	35	.	0			c.C692G						.						112.0	124.0	120.0					6																	30458995		1511	2708	4219	SO:0001583	missense	3133	exon4			TCTACCCTGCGGA	M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.692C>G	chr6.hg19:g.30458995C>G	ENSP00000365817:p.Pro231Arg	130.0	0.0		166.0	58.0	NM_005516	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	ENST00000376630.4	hg19	CCDS34379.1	.	.	.	.	.	.	.	.	.	.	.	15.63	2.890421	0.52014	.	.	ENSG00000204592	ENST00000376630	T	0.57907	0.37	1.67	1.67	0.24075	.	0.000000	0.41712	U	0.000826	T	0.75781	0.3896	H	0.99682	4.7	0.27796	N	0.942642	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66056	-0.6018	10	0.87932	D	0	.	6.7735	0.23607	0.0:1.0:0.0:0.0	.	272;231	E7ENN9;Q6DU44	.;.	R	231	ENSP00000365817:P231R	ENSP00000365817:P231R	P	+	2	0	HLA-E	30566974	0.989000	0.36119	1.000000	0.80357	0.989000	0.77384	3.777000	0.55364	1.235000	0.43724	0.462000	0.41574	CCT	.	.		0.622	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516	
MDC1	9656	hgsc.bcm.edu	37	6	30679231	30679231	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:30679231G>A	ENST00000376406.3	-	7	2826	c.2179C>T	c.(2179-2181)Ccc>Tcc	p.P727S	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Missense_Mutation_p.P727S	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	727				Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						AGCTCTTGGGGTGGAGTCAAC	0.493								Other conserved DNA damage response genes																													p.P727S		Atlas-SNP	.											.	MDC1	218	.	0			c.C2179T						.						168.0	124.0	140.0					6																	30679231		1511	2709	4220	SO:0001583	missense	9656	exon7			CTTGGGGTGGAGT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.2179C>T	chr6.hg19:g.30679231G>A	ENSP00000365588:p.Pro727Ser	184.0	0.0		228.0	83.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.15|13.15	2.151893|2.151893	0.38021|0.38021	.|.	.|.	ENSG00000137337|ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104|ENST00000417033	T;T|.	0.09538|.	3.12;2.97|.	5.1|5.1	4.23|4.23	0.50019|0.50019	.|.	0.000000|.	0.37906|.	N|.	0.001891|.	T|T	0.31071|0.31071	0.0785|0.0785	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	1|1	P;B;P|.	0.50943|.	0.94;0.259;0.886|.	P;B;B|.	0.47015|.	0.534;0.103;0.381|.	T|T	0.17745|0.17745	-1.0359|-1.0359	10|5	0.72032|.	D|.	0.01|.	0.1256|0.1256	9.6749|9.6749	0.40034|0.40034	0.097:0.0:0.903:0.0|0.097:0.0:0.903:0.0	.|.	727;727;727|.	Q14676-2;Q14676;Q14676-4|.	.;MDC1_HUMAN;.|.	S|I	727;727;727;598|51	ENSP00000365588:P727S;ENSP00000365587:P727S|.	ENSP00000365587:P727S|.	P|T	-|-	1|2	0|0	MDC1|MDC1	30787210|30787210	0.139000|0.139000	0.22563|0.22563	0.026000|0.026000	0.17262|0.17262	0.178000|0.178000	0.23041|0.23041	1.202000|1.202000	0.32271|0.32271	1.280000|1.280000	0.44463|0.44463	0.549000|0.549000	0.68633|0.68633	CCC|ACC	.	.		0.493	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
PRRC2A	7916	hgsc.bcm.edu	37	6	31594920	31594920	+	Missense_Mutation	SNP	T	T	A	rs563072458	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:31594920T>A	ENST00000376033.2	+	11	1469	c.1235T>A	c.(1234-1236)cTa>cAa	p.L412Q	PRRC2A_ENST00000376007.4_Missense_Mutation_p.L412Q	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	412	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AAGCCTCCCCTACCCCCACCT	0.652													T|||	2	0.000399361	0.0	0.0	5008	,	,		12301	0.0		0.0	False		,,,				2504	0.002				p.L412Q		Atlas-SNP	.											.	PRRC2A	152	.	0			c.T1235A						.						17.0	19.0	18.0					6																	31594920		2202	4296	6498	SO:0001583	missense	7916	exon11			CTCCCCTACCCCC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1235T>A	chr6.hg19:g.31594920T>A	ENSP00000365201:p.Leu412Gln	78.0	0.0		86.0	4.0	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	hg19	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.468575	0.26335	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.03889	3.77;3.77	4.7	3.79	0.43588	.	0.135480	0.34245	N	0.004132	T	0.01222	0.0040	N	0.08118	0	0.43279	D	0.995246	B	0.22604	0.072	B	0.21708	0.036	T	0.45862	-0.9232	10	0.87932	D	0	-1.9103	10.3471	0.43911	0.0:0.9054:0.0:0.0946	.	412	P48634	PRC2A_HUMAN	Q	412	ENSP00000365175:L412Q;ENSP00000365201:L412Q	ENSP00000365175:L412Q	L	+	2	0	PRRC2A	31702899	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	2.958000	0.49145	1.329000	0.45376	-0.177000	0.13119	CTA	.	.		0.652	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
ABHD16A	7920	hgsc.bcm.edu	37	6	31669898	31669898	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:31669898A>G	ENST00000395952.3	-	2	304	c.142T>C	c.(142-144)Tat>Cat	p.Y48H	ABHD16A_ENST00000538874.1_5'UTR|ABHD16A_ENST00000375842.4_5'UTR|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|MIR4646_ENST00000580775.1_RNA|ABHD16A_ENST00000440843.2_Intron	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	48						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CGGGGCTGATAGTACGTATCC	0.562																																					p.Y48H		Atlas-SNP	.											.	ABHD16A	34	.	0			c.T142C						.						140.0	94.0	110.0					6																	31669898		1511	2709	4220	SO:0001583	missense	7920	exon2			GCTGATAGTACGT	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.142T>C	chr6.hg19:g.31669898A>G	ENSP00000379282:p.Tyr48His	77.0	0.0		93.0	4.0	NM_021160	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	ENST00000395952.3	hg19	CCDS4713.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.410599	0.83340	.	.	ENSG00000204427	ENST00000395952	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.61048	0.2316	M	0.78456	2.415	0.80722	D	1	D	0.61697	0.99	P	0.53313	0.723	T	0.69525	-0.5122	9	0.87932	D	0	-1.4182	12.2692	0.54695	1.0:0.0:0.0:0.0	.	48	O95870	ABHGA_HUMAN	H	48	.	ENSP00000379282:Y48H	Y	-	1	0	ABHD16A	31777877	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	4.574000	0.60900	2.155000	0.67459	0.459000	0.35465	TAT	.	.		0.562	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4		
COL11A2	1302	hgsc.bcm.edu	37	6	33137627	33137627	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:33137627T>C	ENST00000374708.4	-	48	3671	c.3413A>G	c.(3412-3414)cAg>cGg	p.Q1138R	COL11A2_ENST00000395197.1_Missense_Mutation_p.Q1164R|COL11A2_ENST00000374714.1_Missense_Mutation_p.Q1198R|COL11A2_ENST00000374713.1_Missense_Mutation_p.Q1177R|COL11A2_ENST00000357486.1_Missense_Mutation_p.Q1203R|COL11A2_ENST00000361917.1_Missense_Mutation_p.Q1117R|COL11A2_ENST00000374712.1_Missense_Mutation_p.Q1143R|COL11A2_ENST00000341947.2_Missense_Mutation_p.Q1224R|COL11A2_ENST00000477772.1_Intron	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1224	Collagen-like 6.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TGGCTCGCCCTGGATCCCTGG	0.557																																					p.Q1224R	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											COL11A2,NS,carcinoma,0,1	COL11A2	124	.	0			c.A3671G						.						119.0	103.0	108.0					6																	33137627		2203	4300	6503	SO:0001583	missense	1302	exon50			TCGCCCTGGATCC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.3413A>G	chr6.hg19:g.33137627T>C	ENSP00000363840:p.Gln1138Arg	67.0	1.0		86.0	8.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	hg19	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268174	0.40095	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	4.52	3.35	0.38373	.	0.525252	0.17997	N	0.155038	T	0.71542	0.3352	N	0.03304	-0.355	0.26544	N	0.974033	B;B;B	0.19331	0.034;0.034;0.035	B;B;B	0.17098	0.017;0.017;0.011	T	0.64896	-0.6299	10	0.39692	T	0.17	.	9.4239	0.38567	0.0:0.0:0.1908:0.8092	.	1117;1138;1224	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	R	1138;1224;1203;1198;1177;1164;1143;1117	ENSP00000363840:Q1138R;ENSP00000339915:Q1224R;ENSP00000350079:Q1203R;ENSP00000363846:Q1198R;ENSP00000363845:Q1177R;ENSP00000378623:Q1164R;ENSP00000363844:Q1143R;ENSP00000355123:Q1117R	ENSP00000339915:Q1224R	Q	-	2	0	COL11A2	33245605	0.996000	0.38824	1.000000	0.80357	0.995000	0.86356	0.685000	0.25378	1.908000	0.55244	0.448000	0.29417	CAG	.	.		0.557	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
SYNGAP1	8831	hgsc.bcm.edu	37	6	33405455	33405455	+	Missense_Mutation	SNP	G	G	A	rs538281267		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:33405455G>A	ENST00000418600.2	+	8	874	c.773G>A	c.(772-774)cGc>cAc	p.R258H	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.R199H|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.R258H|MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	258	C2.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GACAACAGCCGCCGGGTAGAC	0.542													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13786	0.0		0.0	False		,,,				2504	0.0				p.R258H		Atlas-SNP	.											.	SYNGAP1	202	.	0			c.G773A						.						160.0	180.0	173.0					6																	33405455		2203	4300	6503	SO:0001583	missense	8831	exon8			ACAGCCGCCGGGT	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.773G>A	chr6.hg19:g.33405455G>A	ENSP00000403636:p.Arg258His	59.0	0.0		64.0	24.0	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	hg19	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041630	0.75732	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	D;D;D	0.93488	-3.23;-3.23;-3.23	4.51	4.51	0.55191	SynGAP C2 domain, N-terminal (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000001	D	0.96097	0.8728	M	0.80028	2.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.83275	0.991;0.996;0.842	D	0.96595	0.9440	10	0.87932	D	0	.	14.7891	0.69827	0.0:0.0:1.0:0.0	.	258;258;258	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	H	258;258;258;199	ENSP00000293748:R258H;ENSP00000403636:R258H;ENSP00000412475:R199H	ENSP00000293748:R258H	R	+	2	0	SYNGAP1	33513433	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.860000	0.86993	2.341000	0.79615	0.655000	0.94253	CGC	.	.		0.542	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
IP6K3	117283	hgsc.bcm.edu	37	6	33696059	33696059	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:33696059A>G	ENST00000293756.4	-	3	544	c.218T>C	c.(217-219)cTc>cCc	p.L73P	IP6K3_ENST00000451316.1_Missense_Mutation_p.L73P	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	73					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GTCTTTCCAGAGGTGCACTGT	0.597																																					p.L73P		Atlas-SNP	.											.	IP6K3	52	.	0			c.T218C						.						69.0	63.0	65.0					6																	33696059		2203	4300	6503	SO:0001583	missense	117283	exon4			TTCCAGAGGTGCA	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.218T>C	chr6.hg19:g.33696059A>G	ENSP00000293756:p.Leu73Pro	89.0	0.0		113.0	6.0	NM_001142883	Q96MQ9	Missense_Mutation	SNP	ENST00000293756.4	hg19	CCDS34435.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198304	0.79015	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	T;T	0.13778	2.56;2.56	5.69	5.69	0.88448	.	0.000000	0.56097	D	0.000039	T	0.28896	0.0717	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04467	-1.0949	10	0.72032	D	0.01	-37.138	14.1824	0.65583	1.0:0.0:0.0:0.0	.	73	Q96PC2	IP6K3_HUMAN	P	73	ENSP00000398861:L73P;ENSP00000293756:L73P	ENSP00000293756:L73P	L	-	2	0	IP6K3	33804037	1.000000	0.71417	0.990000	0.47175	0.960000	0.62799	6.743000	0.74848	2.168000	0.68352	0.533000	0.62120	CTC	.	.		0.597	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
TEAD3	7005	hgsc.bcm.edu	37	6	35443341	35443341	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:35443341A>G	ENST00000402886.3	-	9	1015		c.e9+1		TEAD3_ENST00000338863.7_Splice_Site			Q99594	TEAD3_HUMAN	TEA domain family member 3						female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						GCCCCCACTCACCTCCACCTT	0.582																																					.		Atlas-SNP	.											.	TEAD3	52	.	0			c.1041+2T>C						.						56.0	70.0	65.0					6																	35443341		2186	4289	6475	SO:0001630	splice_region_variant	7005	exon12			CCACTCACCTCCA	X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.861+1T>C	chr6.hg19:g.35443341A>G		95.0	0.0		131.0	6.0	NM_003214	O95910|Q5BJG7|Q8N6Y4	Splice_Site	SNP	ENST00000402886.3	hg19		.	.	.	.	.	.	.	.	.	.	A	19.64	3.866026	0.71949	.	.	ENSG00000007866	ENST00000338863;ENST00000402886;ENST00000373905	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7159	0.62695	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEAD3	35551319	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.992000	0.93519	2.023000	0.59567	0.374000	0.22700	.	.	.		0.582	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316961.2		Intron
GPR111	222611	hgsc.bcm.edu	37	6	47649351	47649351	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:47649351A>G	ENST00000296862.1	+	6	1056	c.1056A>G	c.(1054-1056)gaA>gaG	p.E352E	GPR111_ENST00000507065.1_Silent_p.E284E|GPR111_ENST00000398742.2_Silent_p.E284E			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	352					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						CTATTTTGGAAGCCAGTCTTT	0.433																																					p.E284E		Atlas-SNP	.											.	GPR111	123	.	0			c.A852G						.						128.0	123.0	124.0					6																	47649351		1866	4103	5969	SO:0001819	synonymous_variant	222611	exon7			TTTGGAAGCCAGT	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.1056A>G	chr6.hg19:g.47649351A>G		71.0	0.0		96.0	4.0	NM_153839	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Silent	SNP	ENST00000296862.1	hg19																																																																																				.	.		0.433	GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839	
DST	667	hgsc.bcm.edu	37	6	56443682	56443682	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:56443682T>C	ENST00000361203.3	-	46	12331	c.12324A>G	c.(12322-12324)aaA>aaG	p.K4108K	DST_ENST00000244364.6_Silent_p.K1696K|DST_ENST00000370788.2_Silent_p.K2022K|DST_ENST00000421834.2_Silent_p.K2022K|DST_ENST00000446842.2_Silent_p.K3784K|DST_ENST00000370754.5_Silent_p.K4288K|DST_ENST00000312431.6_Silent_p.K4108K|DST_ENST00000370769.4_Silent_p.K4110K			Q03001	DYST_HUMAN	dystonin	4108					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTCAGCCGTTTTCTTCAGTT	0.403																																					p.K1696K		Atlas-SNP	.											.	DST	1427	.	0			c.A5088G						.						76.0	77.0	77.0					6																	56443682		1839	4086	5925	SO:0001819	synonymous_variant	667	exon31			AGCCGTTTTCTTC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.12324A>G	chr6.hg19:g.56443682T>C		85.0	0.0		118.0	5.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	hg19																																																																																				.	.		0.403	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
COL12A1	1303	hgsc.bcm.edu	37	6	75806978	75806978	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:75806978T>C	ENST00000322507.8	-	59	8877	c.8568A>G	c.(8566-8568)ccA>ccG	p.P2856P	COL12A1_ENST00000511023.1_5'UTR|COL12A1_ENST00000483888.2_Silent_p.P2856P|COL12A1_ENST00000416123.2_Silent_p.P2780P|COL12A1_ENST00000345356.6_Silent_p.P1692P	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2856	Collagen-like 3.|Triple-helical region (COL2) with 1 imperfection.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CCGGCGGCCCTGGTGGGCCCC	0.468																																					p.P2856P		Atlas-SNP	.											.	COL12A1	385	.	0			c.A8568G						.						106.0	109.0	108.0					6																	75806978		1826	4084	5910	SO:0001819	synonymous_variant	1303	exon59			CGGCCCTGGTGGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8568A>G	chr6.hg19:g.75806978T>C		110.0	0.0		72.0	4.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.468	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
COL12A1	1303	hgsc.bcm.edu	37	6	75864133	75864133	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:75864133A>G	ENST00000322507.8	-	17	3873	c.3564T>C	c.(3562-3564)tcT>tcC	p.S1188S	COL12A1_ENST00000483888.2_Splice_Site_p.S1188S|COL12A1_ENST00000416123.2_Splice_Site_p.S1188S|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1188					cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ATTTCTTACCAGAAGATAAAA	0.343																																					p.S1188S		Atlas-SNP	.											.	COL12A1	385	.	0			c.T3564C						.						107.0	104.0	105.0					6																	75864133		1834	4087	5921	SO:0001630	splice_region_variant	1303	exon17			CTTACCAGAAGAT	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3565+1T>C	chr6.hg19:g.75864133A>G		87.0	0.0		95.0	4.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.343	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	Silent
SENP6	26054	hgsc.bcm.edu	37	6	76405605	76405605	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:76405605A>G	ENST00000447266.2	+	17	2639	c.2161A>G	c.(2161-2163)Aga>Gga	p.R721G	SENP6_ENST00000370014.3_Missense_Mutation_p.R721G|SENP6_ENST00000370010.2_Missense_Mutation_p.R714G|SENP6_ENST00000541192.1_Missense_Mutation_p.R317G	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	721	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				CCTTAATCAGAGAGAGAGGAG	0.323																																					p.R721G		Atlas-SNP	.											.	SENP6	189	.	0			c.A2161G						.						73.0	73.0	73.0					6																	76405605		1824	4080	5904	SO:0001583	missense	26054	exon17			AATCAGAGAGAGA		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.2161A>G	chr6.hg19:g.76405605A>G	ENSP00000402527:p.Arg721Gly	154.0	0.0		97.0	4.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	hg19	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	A	16.22	3.060324	0.55432	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000447266;ENST00000541192	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.94	4.75	0.60458	.	0.040834	0.85682	D	0.000000	T	0.29458	0.0734	L	0.35414	1.06	0.52099	D	0.99994	B;D	0.60575	0.167;0.988	B;D	0.66979	0.196;0.948	T	0.05566	-1.0877	10	0.41790	T	0.15	-22.3027	13.1509	0.59488	0.8664:0.1335:0.0:0.0	.	714;721	Q9GZR1-2;Q9GZR1	.;SENP6_HUMAN	G	714;721;721;317	ENSP00000359027:R714G;ENSP00000359031:R721G;ENSP00000402527:R721G;ENSP00000441715:R317G	ENSP00000359027:R714G	R	+	1	2	SENP6	76462325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.746000	0.62133	1.034000	0.39945	0.455000	0.32223	AGA	.	.		0.323	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
CGA	1081	hgsc.bcm.edu	37	6	87795550	87795550	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:87795550A>G	ENST00000369582.2	-	4	375	c.275T>C	c.(274-276)gTc>gCc	p.V92A	RN7SKP209_ENST00000516888.1_RNA	NM_000735.3	NP_000726.1	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	92					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|developmental growth (GO:0048589)|follicle-stimulating hormone secretion (GO:0046884)|gonad development (GO:0008406)|luteinizing hormone secretion (GO:0032275)|negative regulation of organ growth (GO:0046621)|peptide hormone processing (GO:0016486)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)	15		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		CATTACTGTGACCTAAAGGGG	0.348																																					p.V123A		Atlas-SNP	.											CGA,colon,carcinoma,0,1	CGA	22	.	0			c.T368C						.						52.0	51.0	51.0					6																	87795550		2203	4300	6503	SO:0001630	splice_region_variant	1081	exon5			ACTGTGACCTAAA	V00518	CCDS5007.1, CCDS75492.1	6q14-q21	2013-02-26			ENSG00000135346	ENSG00000135346		"""Endogenous ligands"""	1885	protein-coding gene	gene with protein product	"""follicle-stimulating hormone alpha subunit"", ""chorionic gonadotropin, alpha polypeptide"", ""luteinizing hormone alpha chain"", ""lutropin alpha chain"", ""thyroid-stimulating hormone alpha chain"", ""glycoprotein hormones alpha chain"""	118850				6286817	Standard	NM_000735		Approved	HCG, GPHa, GPHA1, FSHA, LHA, TSHA	uc021zci.1	P01215	OTTHUMG00000015161	ENST00000369582.2:c.274-1T>C	chr6.hg19:g.87795550A>G		89.0	2.0		64.0	3.0	NM_001252383		Missense_Mutation	SNP	ENST00000369582.2	hg19	CCDS5007.1	.	.	.	.	.	.	.	.	.	.	A	3.929	-0.016529	0.07681	.	.	ENSG00000135346	ENST00000369582	.	.	.	5.73	1.89	0.25635	.	0.510013	0.19481	N	0.113210	T	0.16514	0.0397	L	0.31371	0.925	0.32973	D	0.522561	B	0.13594	0.008	B	0.16289	0.015	T	0.07404	-1.0774	9	0.22706	T	0.39	-26.6509	7.1256	0.25469	0.5016:0.0:0.4984:0.0	.	92	P01215	GLHA_HUMAN	A	92	.	ENSP00000358595:V92A	V	-	2	0	CGA	87852269	0.993000	0.37304	0.958000	0.39756	0.069000	0.16628	1.617000	0.36943	0.356000	0.24157	-0.182000	0.12963	GTC	.	.		0.348	CGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041425.1	NM_000735	Missense_Mutation
ANKRD6	22881	hgsc.bcm.edu	37	6	90340295	90340295	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:90340295T>C	ENST00000522441.1	+	16	2397	c.1756T>C	c.(1756-1758)Tcc>Ccc	p.S586P	ANKRD6_ENST00000339746.4_Missense_Mutation_p.S586P|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000369408.5_Missense_Mutation_p.S551P|ANKRD6_ENST00000520793.1_Missense_Mutation_p.S522P|ANKRD6_ENST00000447838.2_Missense_Mutation_p.S581P	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	586					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CTGTACAGGCTCCCGACTGAG	0.582																																					p.S586P		Atlas-SNP	.											.	ANKRD6	51	.	0			c.T1756C						.						30.0	31.0	31.0					6																	90340295		1975	4151	6126	SO:0001583	missense	22881	exon16			ACAGGCTCCCGAC	AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1756T>C	chr6.hg19:g.90340295T>C	ENSP00000430985:p.Ser586Pro	130.0	0.0		99.0	5.0	NM_001242809	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	ENST00000522441.1	hg19	CCDS56441.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.130650	0.37630	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000520793	T;T;T;T;T	0.72615	0.56;0.58;0.82;0.58;-0.67	4.9	3.71	0.42584	.	0.000000	0.56097	D	0.000022	T	0.66356	0.2781	L	0.57536	1.79	0.80722	D	1	B;P;P;P	0.49862	0.31;0.811;0.929;0.811	B;B;P;B	0.52424	0.177;0.403;0.698;0.35	T	0.70680	-0.4805	10	0.66056	D	0.02	-3.9454	12.2295	0.54480	0.0:0.0:0.1421:0.8579	.	522;586;551;581	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	P	551;586;581;586;522	ENSP00000358416:S551P;ENSP00000345767:S586P;ENSP00000396771:S581P;ENSP00000430985:S586P;ENSP00000429782:S522P	ENSP00000345767:S586P	S	+	1	0	ANKRD6	90397016	0.999000	0.42202	0.711000	0.30485	0.221000	0.24807	3.487000	0.53222	0.963000	0.38082	0.460000	0.39030	TCC	.	.		0.582	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1		
MDN1	23195	hgsc.bcm.edu	37	6	90411385	90411385	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:90411385T>C	ENST00000369393.3	-	55	8434	c.8319A>G	c.(8317-8319)gaA>gaG	p.E2773E	MDN1_ENST00000428876.1_Silent_p.E2773E			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2773					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAGTCTGAACTTCTTTGTAAT	0.423																																					p.E2773E		Atlas-SNP	.											.	MDN1	478	.	0			c.A8319G						.						41.0	42.0	41.0					6																	90411385		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon55			CTGAACTTCTTTG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.8319A>G	chr6.hg19:g.90411385T>C		59.0	0.0		46.0	4.0	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.		0.423	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
BACH2	60468	hgsc.bcm.edu	37	6	90661367	90661367	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:90661367T>C	ENST00000257749.4	-	7	1165	c.458A>G	c.(457-459)cAc>cGc	p.H153R	RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.H153R|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000343122.3_Missense_Mutation_p.H153R	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	153						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GCAGTCCTCGTGTGGGCGCTG	0.592																																					p.H153R		Atlas-SNP	.											.	BACH2	224	.	0			c.A458G						.						89.0	85.0	86.0					6																	90661367		2203	4300	6503	SO:0001583	missense	60468	exon5			TCCTCGTGTGGGC	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.458A>G	chr6.hg19:g.90661367T>C	ENSP00000257749:p.His153Arg	79.0	0.0		46.0	4.0	NM_001170794	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	hg19	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	T	7.081	0.570218	0.13560	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.37584	1.19;1.19;1.19	5.68	3.23	0.37069	.	0.270736	0.35262	N	0.003322	T	0.07188	0.0182	N	0.24115	0.695	0.27078	N	0.963169	B	0.20052	0.041	B	0.24155	0.051	T	0.40289	-0.9571	10	0.09590	T	0.72	-11.3991	8.2679	0.31827	0.0:0.0693:0.1342:0.7965	.	153	Q9BYV9	BACH2_HUMAN	R	153	ENSP00000257749:H153R;ENSP00000437473:H153R;ENSP00000345642:H153R	ENSP00000257749:H153R	H	-	2	0	BACH2	90718088	0.366000	0.25014	0.367000	0.25926	0.466000	0.32739	0.643000	0.24750	0.404000	0.25506	0.460000	0.39030	CAC	.	.		0.592	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
PNISR	25957	hgsc.bcm.edu	37	6	99862518	99862518	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:99862518T>C	ENST00000369239.5	-	3	222	c.18A>G	c.(16-18)ggA>ggG	p.G6G	PNISR_ENST00000438806.1_Silent_p.G6G|PNISR_ENST00000466057.1_5'UTR	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	6	Gln-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						GCCAAGGCTGTCCTCCTTGAT	0.363																																					p.G6G		Atlas-SNP	.											.	PNISR	74	.	0			c.A18G						.						136.0	125.0	129.0					6																	99862518		2203	4300	6503	SO:0001819	synonymous_variant	25957	exon2			AGGCTGTCCTCCT	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.18A>G	chr6.hg19:g.99862518T>C		106.0	0.0		76.0	4.0	NM_015491	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Silent	SNP	ENST00000369239.5	hg19	CCDS5043.1																																																																																			.	.		0.363	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
AIM1	202	hgsc.bcm.edu	37	6	106967048	106967048	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:106967048T>C	ENST00000369066.3	+	2	1228	c.741T>C	c.(739-741)ccT>ccC	p.P247P		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.P247P(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTAAAACCCCTAAGAATCTTG	0.403																																					p.P247P		Atlas-SNP	.											AIM1,NS,carcinoma,0,1	AIM1	161	.	1	Substitution - coding silent(1)	breast(1)	c.T741C						.						53.0	54.0	54.0					6																	106967048		2203	4300	6503	SO:0001819	synonymous_variant	202	exon2			AACCCCTAAGAAT	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.741T>C	chr6.hg19:g.106967048T>C		51.0	0.0		36.0	3.0	NM_001624	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	hg19	CCDS34506.1																																																																																			.	.		0.403	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
TRAPPC3L	100128327	hgsc.bcm.edu	37	6	116866643	116866643	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:116866643T>C	ENST00000368602.3	-	1	130	c.35A>G	c.(34-36)cAt>cGt	p.H12R	FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000405399.1_Intron|FAM26D_ENST00000368597.2_Intron	NM_001139444.2	NP_001132916.1	Q5T215	TPC3L_HUMAN	trafficking protein particle complex 3-like	12					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)											TACTATTTTATGGTATTCTGG	0.328																																					p.H12R		Atlas-SNP	.											.	BET3L	18	.	0			c.A35G						.						265.0	230.0	241.0					6																	116866643		692	1591	2283	SO:0001583	missense	100128327	exon1			ATTTTATGGTATT	AK002042	CCDS47468.1	6q22.31	2013-05-01	2013-05-01	2013-05-01	ENSG00000173626	ENSG00000173626			21090	protein-coding gene	gene with protein product		614137	"""BET3 like (S. cerevisiae)"""	BET3L		21525244	Standard	NM_001139444		Approved	bA259P20.2, FLJ11180		Q5T215	OTTHUMG00000015440	ENST00000368602.3:c.35A>G	chr6.hg19:g.116866643T>C	ENSP00000357591:p.His12Arg	188.0	0.0		98.0	4.0	NM_001139444	Q5T213|Q5T214	Missense_Mutation	SNP	ENST00000368602.3	hg19	CCDS47468.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.163927	0.38217	.	.	ENSG00000173626	ENST00000368602	.	.	.	5.77	-0.932	0.10435	NO signalling/Golgi transport  ligand-binding domain (1);	0.592256	0.16782	N	0.199733	T	0.23014	0.0556	L	0.38531	1.155	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08638	-1.0712	9	0.49607	T	0.09	-9.5315	6.003	0.19531	0.0:0.2724:0.1252:0.6025	.	12	Q5T215	TPC3L_HUMAN	R	12	.	ENSP00000357591:H12R	H	-	2	0	BET3L	116973336	0.927000	0.31430	0.889000	0.34880	0.995000	0.86356	0.873000	0.28052	-0.369000	0.08028	0.533000	0.62120	CAT	.	.		0.328	TRAPPC3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101701.1	XM_166322	
HEY2	23493	hgsc.bcm.edu	37	6	126080600	126080600	+	Silent	SNP	C	C	T	rs376521140		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:126080600C>T	ENST00000368364.3	+	5	863	c.666C>T	c.(664-666)caC>caT	p.H222H	HEY2_ENST00000368365.1_Silent_p.H176H	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	222					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.H222H(1)		breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		CTCCTGCCCACGGCTCTGCTC	0.657																																					p.H222H		Atlas-SNP	.											HEY2,NS,carcinoma,0,1	HEY2	44	.	1	Substitution - coding silent(1)	prostate(1)	c.C666T						.	C		1,4405		0,1,2202	160.0	152.0	155.0		666	-2.8	1.0	6		155	0,8600		0,0,4300	no	coding-synonymous	HEY2	NM_012259.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		222/338	126080600	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23493	exon5			TGCCCACGGCTCT	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.666C>T	chr6.hg19:g.126080600C>T		80.0	0.0		48.0	32.0	NM_012259		Silent	SNP	ENST00000368364.3	hg19	CCDS5131.1																																																																																			.	.		0.657	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1		
PPIL4	85313	hgsc.bcm.edu	37	6	149867088	149867088	+	Silent	SNP	G	G	A	rs200555722		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:149867088G>A	ENST00000253329.2	-	1	86	c.54C>T	c.(52-54)acC>acT	p.T18T		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	18	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		GCCGTTCTTCGGTGTACAAGT	0.647																																					p.T18T		Atlas-SNP	.											.	PPIL4	36	.	0			c.C54T						.						34.0	28.0	30.0					6																	149867088		2199	4290	6489	SO:0001819	synonymous_variant	85313	exon1			TTCTTCGGTGTAC		CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.54C>T	chr6.hg19:g.149867088G>A		86.0	0.0		49.0	4.0	NM_139126	B2RD34|Q7Z3Q5	Silent	SNP	ENST00000253329.2	hg19	CCDS34550.1																																																																																			.	G|0.997;C|0.003		0.647	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042642.1		
PLEKHG1	57480	hgsc.bcm.edu	37	6	151121959	151121959	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:151121959T>C	ENST00000358517.2	+	6	945	c.734T>C	c.(733-735)cTc>cCc	p.L245P	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.L245P			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	245	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GGGTCCTATCTCTTGAAACCA	0.483																																					p.L245P		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.T734C						.						120.0	117.0	118.0					6																	151121959		2203	4300	6503	SO:0001583	missense	57480	exon7			CCTATCTCTTGAA	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.734T>C	chr6.hg19:g.151121959T>C	ENSP00000351318:p.Leu245Pro	105.0	0.0		93.0	4.0	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	hg19	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.900260	0.92035	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	D;D	0.84298	-1.83;-1.83	6.16	6.16	0.99307	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.95799	0.8633	H	0.99090	4.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97705	1.0187	10	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	52;245;245	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	P	245	ENSP00000356297:L245P;ENSP00000351318:L245P	ENSP00000351318:L245P	L	+	2	0	PLEKHG1	151163652	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.040000	0.89188	2.367000	0.80283	0.528000	0.53228	CTC	.	.		0.483	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152623096	152623096	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:152623096T>C	ENST00000367255.5	-	92	18050	c.17449A>G	c.(17449-17451)Acg>Gcg	p.T5817A	SYNE1_ENST00000341594.5_Missense_Mutation_p.T5429A|SYNE1_ENST00000356820.4_Missense_Mutation_p.T341A|SYNE1_ENST00000448038.1_Missense_Mutation_p.T5746A|SYNE1_ENST00000423061.1_Missense_Mutation_p.T5746A|SYNE1_ENST00000265368.4_Missense_Mutation_p.T5817A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5817					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCGGTCACCGTCAGCAGCATG	0.592										HNSCC(10;0.0054)																											p.T5817A		Atlas-SNP	.											.	SYNE1	3227	.	0			c.A17449G						.						78.0	74.0	75.0					6																	152623096		2203	4300	6503	SO:0001583	missense	23345	exon92			TCACCGTCAGCAG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.17449A>G	chr6.hg19:g.152623096T>C	ENSP00000356224:p.Thr5817Ala	105.0	0.0		88.0	4.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.878561	0.91740	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000540663;ENST00000537033	T;T;T;T;T;T;T	0.55588	0.68;0.68;0.68;0.68;0.68;0.68;0.51	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000008	T	0.52370	0.1730	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.52786	-0.8529	10	0.35671	T	0.21	.	16.101	0.81172	0.0:0.0:0.0:1.0	.	232;5817;5817;5746	B7ZBD0;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	A	5817;5746;5817;5746;5429;341;39;39	ENSP00000356224:T5817A;ENSP00000396024:T5746A;ENSP00000265368:T5817A;ENSP00000390975:T5746A;ENSP00000341887:T5429A;ENSP00000349276:T341A;ENSP00000437411:T39A	ENSP00000265368:T5817A	T	-	1	0	SYNE1	152664789	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.628000	0.83189	2.263000	0.75096	0.528000	0.53228	ACG	.	.		0.592	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu	37	6	152647436	152647436	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:152647436C>T	ENST00000367255.5	-	79	15889	c.15288G>A	c.(15286-15288)ttG>ttA	p.L5096L	SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000448038.1_Silent_p.L5025L|SYNE1_ENST00000423061.1_Silent_p.L5025L|SYNE1_ENST00000265368.4_Silent_p.L5096L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5096					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L5096F(2)|p.L5025F(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATACCTCTGCAAGAGATCCA	0.428										HNSCC(10;0.0054)																											p.L5096L		Atlas-SNP	.											SYNE1_ENST00000423061,NS,carcinoma,0,3	SYNE1	3227	.	3	Substitution - Missense(3)	lung(3)	c.G15288A						.						72.0	76.0	75.0					6																	152647436		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon79			CCTCTGCAAGAGA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15288G>A	chr6.hg19:g.152647436C>T		63.0	0.0		45.0	2.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	hg19	CCDS5236.2																																																																																			.	.		0.428	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TMEM181	57583	hgsc.bcm.edu	37	6	159005001	159005001	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:159005001A>G	ENST00000367090.3	+	4	606	c.595A>G	c.(595-597)Ata>Gta	p.I199V		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	199					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		GCCAATTCAAATACTTTCAAA	0.348																																					p.I199V		Atlas-SNP	.											.	TMEM181	47	.	0			c.A595G						.						118.0	104.0	109.0					6																	159005001		1861	4099	5960	SO:0001583	missense	57583	exon4			ATTCAAATACTTT	AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.595A>G	chr6.hg19:g.159005001A>G	ENSP00000356057:p.Ile199Val	65.0	0.0		48.0	4.0	NM_020823	Q5VTU1	Missense_Mutation	SNP	ENST00000367090.3	hg19	CCDS43520.1	.	.	.	.	.	.	.	.	.	.	A	7.991	0.753328	0.15778	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	5.62	0.334	0.15948	.	0.235735	0.43747	D	0.000534	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	1	B;B	0.17268	0.007;0.021	B;B	0.13407	0.009;0.006	T	0.37150	-0.9718	9	0.23891	T	0.37	.	5.1626	0.15070	0.3299:0.2924:0.0:0.3777	.	199;110	Q9P2C4;Q8N4V6	TM181_HUMAN;.	V	106;199	.	ENSP00000323755:I106V	I	+	1	0	TMEM181	158924989	0.159000	0.22864	0.617000	0.29091	0.995000	0.86356	0.689000	0.25437	0.363000	0.24346	0.528000	0.53228	ATA	.	.		0.348	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823	
PMS2	5395	hgsc.bcm.edu	37	7	6026652	6026652	+	Missense_Mutation	SNP	C	C	G	rs63750739		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:6026652C>G	ENST00000265849.7	-	11	1849	c.1744G>C	c.(1744-1746)Gaa>Caa	p.E582Q	PMS2_ENST00000406569.3_Intron|PMS2_ENST00000441476.2_Missense_Mutation_p.E476Q|PMS2_ENST00000382321.4_Intron|PMS2_ENST00000469652.1_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	582					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AGAATTTCTTCTTTTTTAAAA	0.383			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.E582Q		Atlas-SNP	.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2	88	.	0			c.G1744C						.						102.0	111.0	108.0					7																	6026652		2203	4300	6503	SO:0001583	missense	5395	exon11	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	TTTCTTCTTTTTT		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1744G>C	chr7.hg19:g.6026652C>G	ENSP00000265849:p.Glu582Gln	77.0	0.0		86.0	41.0	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	hg19	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	c	13.74	2.328625	0.41197	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476	T;T	0.46063	0.88;0.88	5.49	3.68	0.42216	.	0.158719	0.53938	D	0.000045	T	0.50463	0.1617	M	0.68952	2.095	0.09310	N	1	D;D	0.62365	0.977;0.991	P;P	0.58331	0.611;0.837	T	0.37056	-0.9722	10	0.33940	T	0.23	-7.4577	5.998	0.19505	0.0:0.6986:0.0:0.3014	.	582;476	P54278;C9J167	PMS2_HUMAN;.	Q	582;535;476	ENSP00000265849:E582Q;ENSP00000392843:E476Q	ENSP00000265849:E582Q	E	-	1	0	PMS2	5993178	0.929000	0.31497	0.018000	0.16275	0.083000	0.17756	3.430000	0.52807	1.337000	0.45525	-0.384000	0.06662	GAA	.	.		0.383	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
ITGB8	3696	hgsc.bcm.edu	37	7	20438493	20438493	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:20438493C>A	ENST00000222573.4	+	9	1841	c.1157C>A	c.(1156-1158)tCa>tAa	p.S386*	ITGB8_ENST00000537992.1_Nonsense_Mutation_p.S251*	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	386					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						AAGCTCATTTCAGAAGTGAAA	0.388																																					p.S386X		Atlas-SNP	.											.	ITGB8	159	.	0			c.C1157A						.						83.0	84.0	83.0					7																	20438493		2203	4300	6503	SO:0001587	stop_gained	3696	exon9			TCATTTCAGAAGT		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.1157C>A	chr7.hg19:g.20438493C>A	ENSP00000222573:p.Ser386*	127.0	0.0		159.0	60.0	NM_002214	A4D133|B4DHD4	Nonsense_Mutation	SNP	ENST00000222573.4	hg19	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	C	43	10.295639	0.99378	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4084	0.94658	0.0:1.0:0.0:0.0	.	.	.	.	X	251;386	.	ENSP00000222573:S386X	S	+	2	0	ITGB8	20405018	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.010000	0.70753	2.593000	0.87608	0.655000	0.94253	TCA	.	.		0.388	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
HOXA11	3207	hgsc.bcm.edu	37	7	27224736	27224736	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:27224736A>G	ENST00000006015.3	-	1	99	c.28T>C	c.(28-30)Tcc>Ccc	p.S10P	HOXA11-AS_ENST00000479766.1_RNA|RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000522674.1_RNA|HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000520360.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	10					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						ATGTTAGAGGAGCAGGGACCA	0.522			T	NUP98	CML						OREG0003747	type=REGULATORY REGION|Gene=BC025338|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.S10P		Atlas-SNP	.		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	.	HOXA11	29	.	0			c.T28C						.						67.0	70.0	69.0					7																	27224736		2202	4300	6502	SO:0001583	missense	3207	exon1			TAGAGGAGCAGGG		CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.28T>C	chr7.hg19:g.27224736A>G	ENSP00000006015:p.Ser10Pro	45.0	0.0	792	95.0	4.0	NM_005523	A4D190	Missense_Mutation	SNP	ENST00000006015.3	hg19	CCDS5411.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154163	0.38021	.	.	ENSG00000005073	ENST00000006015	D	0.91521	-2.86	5.61	4.45	0.53987	.	0.127561	0.53938	D	0.000048	D	0.85405	0.5689	L	0.29908	0.895	0.46437	D	0.999042	P	0.50943	0.94	P	0.44860	0.462	T	0.82512	-0.0420	9	.	.	.	.	11.3758	0.49726	0.9292:0.0:0.0708:0.0	.	10	P31270	HXA11_HUMAN	P	10	ENSP00000006015:S10P	.	S	-	1	0	HOXA11	27191261	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.441000	0.66569	0.951000	0.37770	0.533000	0.62120	TCC	.	.		0.522	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1		
EVX1	2128	hgsc.bcm.edu	37	7	27285511	27285511	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:27285511T>C	ENST00000496902.4	+	3	1177	c.691T>C	c.(691-693)Ttc>Ctc	p.F231L	EVX1-AS_ENST00000519050.1_RNA|EVX1-AS_ENST00000517726.1_RNA|EVX1_ENST00000222761.3_3'UTR|EVX1_ENST00000535619.1_Missense_Mutation_p.F49L|EVX1-AS_ENST00000519218.1_RNA			P49640	EVX1_HUMAN	even-skipped homeobox 1	231					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						CCAGGTGTGGTTCCAGAACCG	0.652																																					p.F231L		Atlas-SNP	.											.	EVX1	23	.	0			c.T691C						.						25.0	24.0	24.0					7																	27285511		2199	4274	6473	SO:0001583	missense	2128	exon3			GTGTGGTTCCAGA		CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.691T>C	chr7.hg19:g.27285511T>C	ENSP00000419266:p.Phe231Leu	113.0	0.0		100.0	4.0	NM_001989	A4D199|B4DQJ0	Missense_Mutation	SNP	ENST00000496902.4	hg19	CCDS5413.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.854868	0.91355	.	.	ENSG00000106038	ENST00000496902;ENST00000535619	D;D	0.99741	-6.6;-6.6	5.22	5.22	0.72569	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	H	0.96239	3.79	0.80722	D	1	D	0.60575	0.988	D	0.67382	0.951	D	0.97274	0.9913	10	0.66056	D	0.02	-16.1599	12.2557	0.54623	0.0:0.0:0.1415:0.8585	.	231	P49640	EVX1_HUMAN	L	231;49	ENSP00000419266:F231L;ENSP00000446458:F49L	ENSP00000419266:F231L	F	+	1	0	EVX1	27252036	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.583000	0.82559	1.968000	0.57251	0.459000	0.35465	TTC	.	.		0.652	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358750.3		
NPC1L1	29881	hgsc.bcm.edu	37	7	44555505	44555505	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:44555505C>T	ENST00000289547.4	-	19	3829	c.3774G>A	c.(3772-3774)aaG>aaA	p.K1258K	NPC1L1_ENST00000381160.3_Silent_p.K1231K|NPC1L1_ENST00000546276.1_Silent_p.K1185K	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1258					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	TGAGCTGGGCCTTGGCGAGGC	0.612																																					p.K1258K		Atlas-SNP	.											.	NPC1L1	141	.	0			c.G3774A						.						61.0	63.0	62.0					7																	44555505		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon19			CTGGGCCTTGGCG		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3774G>A	chr7.hg19:g.44555505C>T		68.0	0.0		93.0	38.0	NM_013389	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	hg19	CCDS5491.1																																																																																			.	.		0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
ABCA13	154664	hgsc.bcm.edu	37	7	48312769	48312769	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:48312769T>C	ENST00000435803.1	+	17	3530	c.3506T>C	c.(3505-3507)aTg>aCg	p.M1169T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1169					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AAGTTTGACATGAATGTTTTC	0.383																																					p.M1169T		Atlas-SNP	.											.	ABCA13	1192	.	0			c.T3506C						.						94.0	90.0	92.0					7																	48312769		1841	4090	5931	SO:0001583	missense	154664	exon17			TTGACATGAATGT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3506T>C	chr7.hg19:g.48312769T>C	ENSP00000411096:p.Met1169Thr	70.0	0.0		97.0	4.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.737869	0.00088	.	.	ENSG00000179869	ENST00000435803	D	0.84730	-1.89	5.64	-9.06	0.00727	.	1.722330	0.03242	N	0.180484	T	0.67832	0.2935	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53344	-0.8452	9	.	.	.	.	2.7457	0.05267	0.1976:0.4092:0.1999:0.1933	.	1169	Q86UQ4	ABCAD_HUMAN	T	1169	ENSP00000411096:M1169T	.	M	+	2	0	ABCA13	48283315	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.817000	0.04472	-1.192000	0.02691	-0.460000	0.05396	ATG	.	.		0.383	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
MLXIPL	51085	hgsc.bcm.edu	37	7	73010987	73010987	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:73010987A>G	ENST00000313375.3	-	11	1851	c.1804T>C	c.(1804-1806)Tca>Cca	p.S602P	MLXIPL_ENST00000354613.1_Missense_Mutation_p.S602P|MLXIPL_ENST00000429400.2_Missense_Mutation_p.S602P|MLXIPL_ENST00000414749.2_Missense_Mutation_p.S602P|MLXIPL_ENST00000395189.1_Missense_Mutation_p.S509P|MLXIPL_ENST00000434326.1_Missense_Mutation_p.S508P	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	602					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCTGGGGGTGAGAGCCGCTCC	0.687																																					p.S602P		Atlas-SNP	.											.	MLXIPL	54	.	0			c.T1804C						.						6.0	7.0	7.0					7																	73010987		2118	4155	6273	SO:0001583	missense	51085	exon11			GGGGTGAGAGCCG	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.1804T>C	chr7.hg19:g.73010987A>G	ENSP00000320886:p.Ser602Pro	85.0	0.0		129.0	6.0	NM_032954	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	hg19	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	a	15.85	2.954943	0.53293	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326	T;T;T;T;T;T	0.28666	2.16;2.25;2.25;2.18;1.63;1.6	3.95	3.95	0.45737	.	0.000000	0.50627	U	0.000109	T	0.45776	0.1359	L	0.53249	1.67	0.35335	D	0.785927	D;D;D;D;D	0.89917	1.0;0.967;0.981;0.998;0.999	D;D;D;D;D	0.87578	0.998;0.939;0.972;0.992;0.993	T	0.54153	-0.8336	10	0.35671	T	0.21	-10.1367	9.4089	0.38480	1.0:0.0:0.0:0.0	.	509;602;602;602;602	Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;MLXPL_HUMAN;.;.;.	P	602;602;602;602;509;508	ENSP00000412330:S602P;ENSP00000406296:S602P;ENSP00000320886:S602P;ENSP00000346629:S602P;ENSP00000378616:S509P;ENSP00000392636:S508P	ENSP00000320886:S602P	S	-	1	0	MLXIPL	72648923	0.982000	0.34865	0.959000	0.39883	0.796000	0.44982	5.910000	0.69931	1.792000	0.52537	0.434000	0.28630	TCA	.	.		0.687	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
SEMA3A	10371	hgsc.bcm.edu	37	7	83590840	83590840	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:83590840G>T	ENST00000265362.4	-	17	2477	c.2163C>A	c.(2161-2163)ttC>ttA	p.F721L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.F721L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	721					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.F721F(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CTTGTTCACAGAACTCATCCA	0.453																																					p.F721L		Atlas-SNP	.											SEMA3A,pharynx,carcinoma,0,1	SEMA3A	121	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C2163A						.						195.0	170.0	178.0					7																	83590840		2203	4300	6503	SO:0001583	missense	10371	exon17			TTCACAGAACTCA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.2163C>A	chr7.hg19:g.83590840G>T	ENSP00000265362:p.Phe721Leu	238.0	0.0		549.0	109.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469099	0.43839	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.25749	1.78;1.78	5.78	3.03	0.35002	.	0.043033	0.85682	D	0.000000	T	0.17023	0.0409	N	0.22421	0.69	0.58432	D	0.999997	B	0.09022	0.002	B	0.09377	0.004	T	0.04103	-1.0977	10	0.42905	T	0.14	.	11.115	0.48256	0.1987:0.0:0.8013:0.0	.	721	Q14563	SEM3A_HUMAN	L	721	ENSP00000265362:F721L;ENSP00000415260:F721L	ENSP00000265362:F721L	F	-	3	2	SEMA3A	83428776	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.253000	0.51469	0.473000	0.27368	-0.140000	0.14226	TTC	.	.		0.453	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
LMTK2	22853	hgsc.bcm.edu	37	7	97821985	97821985	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:97821985G>A	ENST00000297293.5	+	11	2501	c.2208G>A	c.(2206-2208)ttG>ttA	p.L736L		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	736					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					AAGGCTCATTGTCCAGCAAAG	0.313																																					p.L736L		Atlas-SNP	.											LMTK2_ENST00000297293,NS,carcinoma,0,2	LMTK2	228	.	0			c.G2208A						.						45.0	49.0	47.0					7																	97821985		2202	4300	6502	SO:0001819	synonymous_variant	22853	exon11			CTCATTGTCCAGC	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.2208G>A	chr7.hg19:g.97821985G>A		30.0	0.0		40.0	3.0	NM_014916	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	hg19	CCDS5654.1																																																																																			.	.		0.313	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
PILRB	29990	hgsc.bcm.edu	37	7	99957138	99957139	+	Silent	DNP	CC	CC	GT	rs369458364		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:99957138_99957139CC>GT	ENST00000452089.1	+	8	1692_1693	c.633_634CC>GT	c.(631-636)ctCCtg>ctGTtg	p.211_212LL>LL	STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|PILRB_ENST00000610247.1_Silent_p.211_212LL>LL|PILRB_ENST00000448382.1_Missense_Mutation_p.P264V|PILRB_ENST00000444073.1_Silent_p.211_212LL>LL|PILRB_ENST00000609309.1_Silent_p.211_212LL>LL			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	211				Missing (in Ref. 2; CAC19193). {ECO:0000305}.	activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCTCCTCCTCCTGTGGTGGAG	0.55																																					p.L211L|p.L212L		Atlas-SNP	.											.	PILRB	26	.	0			c.C633G|c.C634T						.																																			SO:0001819	synonymous_variant	29990	exon3			CCTCCTCCTGTGG|CTCCTCCTGTGGT	AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	Exception_encountered	chr7.hg19:g.99957138_99957139delinsGT		84.0	0.0		126.0|120.0	16.0|9.0	NM_178238	Q69YF9|Q9HBS0	Silent	SNP	ENST00000452089.1	hg19	CCDS43622.1																																																																																			.	.		0.550	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339923.2	NM_178238	
IFRD1	3475	hgsc.bcm.edu	37	7	112095823	112095823	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:112095823C>T	ENST00000403825.3	+	2	361	c.100C>T	c.(100-102)Cag>Tag	p.Q34*	IFRD1_ENST00000005558.4_Nonsense_Mutation_p.Q34*|IFRD1_ENST00000429071.1_Nonsense_Mutation_p.Q34*|IFRD1_ENST00000535603.1_5'UTR	NM_001550.3	NP_001541.2	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	34					adult somatic muscle development (GO:0007527)|multicellular organismal development (GO:0007275)|myoblast fate determination (GO:0007518)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|urinary_tract(1)	15						AATAGGTGGCCAGCATCGAAA	0.343																																					p.Q34X		Atlas-SNP	.											IFRD1,NS,carcinoma,0,1	IFRD1	46	.	0			c.C100T						.						121.0	116.0	118.0					7																	112095823		2203	4300	6503	SO:0001587	stop_gained	3475	exon3			GGTGGCCAGCATC	Y10313	CCDS34736.1, CCDS56504.1	7q31.1	2005-10-17			ENSG00000006652	ENSG00000006652			5456	protein-coding gene	gene with protein product		603502				9722946	Standard	NM_001550		Approved	PC4, TIS7	uc003vgh.3	O00458	OTTHUMG00000155124	ENST00000403825.3:c.100C>T	chr7.hg19:g.112095823C>T	ENSP00000384477:p.Gln34*	37.0	0.0		39.0	2.0	NM_001007245	B7Z5G1|O75234|Q5U013|Q9BVE4	Nonsense_Mutation	SNP	ENST00000403825.3	hg19	CCDS34736.1	.	.	.	.	.	.	.	.	.	.	C	37	6.138153	0.97315	.	.	ENSG00000006652	ENST00000005558;ENST00000445335;ENST00000403825;ENST00000429071	.	.	.	5.06	5.06	0.68205	.	0.220196	0.47455	D	0.000237	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-10.1224	18.7821	0.91937	0.0:1.0:0.0:0.0	.	.	.	.	X	34	.	ENSP00000005558:Q34X	Q	+	1	0	IFRD1	111883059	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.207000	0.77899	2.506000	0.84524	0.460000	0.39030	CAG	.	.		0.343	IFRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338700.1	NM_001550	
GRM8	2918	hgsc.bcm.edu	37	7	126079220	126079220	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:126079220A>G	ENST00000339582.2	-	11	3488	c.2680T>C	c.(2680-2682)Tcc>Ccc	p.S894P	GRM8_ENST00000358373.3_3'UTR|GRM8_ENST00000444921.2_Missense_Mutation_p.S894P			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	894					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TTGGTAGAGGAAGCTGTTAAG	0.284										HNSCC(24;0.065)																											p.S894P		Atlas-SNP	.											.	GRM8	377	.	0			c.T2680C						.						177.0	178.0	177.0					7																	126079220		2203	4300	6503	SO:0001583	missense	2918	exon10			TAGAGGAAGCTGT		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2680T>C	chr7.hg19:g.126079220A>G	ENSP00000344173:p.Ser894Pro	50.0	0.0		63.0	4.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	hg19	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.504844	0.26949	.	.	ENSG00000179603	ENST00000339582;ENST00000444921	D;D	0.88277	-2.36;-2.36	4.75	4.75	0.60458	.	1.030880	0.07662	N	0.933914	T	0.74374	0.3708	N	0.02539	-0.55	0.80722	D	1	P	0.47350	0.894	B	0.35413	0.202	T	0.69266	-0.5190	10	0.37606	T	0.19	.	13.4167	0.60972	1.0:0.0:0.0:0.0	.	894	O00222	GRM8_HUMAN	P	894	ENSP00000344173:S894P;ENSP00000409790:S894P	ENSP00000344173:S894P	S	-	1	0	GRM8	125866456	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.675000	0.61619	1.760000	0.52011	0.402000	0.26972	TCC	.	.		0.284	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
PAX4	5078	hgsc.bcm.edu	37	7	127252032	127252032	+	Silent	SNP	T	T	C	rs370406503		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:127252032T>C	ENST00000341640.2	-	7	919	c.714A>G	c.(712-714)gtA>gtG	p.V238V	PAX4_ENST00000338516.3_Intron|PAX4_ENST00000378740.2_Silent_p.V238V|PAX4_ENST00000463946.1_Silent_p.V236V	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	246					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CAACCCTTGGTACAGTCAGCC	0.557																																					p.V238V	Ovarian(113;737 1605 7858 27720 34092)	Atlas-SNP	.											.	PAX4	66	.	0			c.A714G						.	T		1,4405	2.1+/-5.4	0,1,2202	65.0	59.0	61.0		714	-2.5	0.0	7		61	0,8600		0,0,4300	no	coding-synonymous	PAX4	NM_006193.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		238/344	127252032	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5078	exon7			CCTTGGTACAGTC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.714A>G	chr7.hg19:g.127252032T>C		59.0	0.0		75.0	4.0	NM_006193	O95161|Q6B0H0	Silent	SNP	ENST00000341640.2	hg19	CCDS5797.1																																																																																			.	.		0.557	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1		
WEE2	494551	hgsc.bcm.edu	37	7	141420771	141420771	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:141420771G>A	ENST00000397541.2	+	5	1201	c.795G>A	c.(793-795)gtG>gtA	p.V265V	WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000459753.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					CTCACGCAGTGCTTGGGCATC	0.393																																					p.V265V		Atlas-SNP	.											.	WEE2	59	.	0			c.G795A						.						151.0	142.0	145.0					7																	141420771		1900	4114	6014	SO:0001819	synonymous_variant	494551	exon5			CGCAGTGCTTGGG	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.795G>A	chr7.hg19:g.141420771G>A		75.0	0.0		96.0	4.0	NM_001105558		Silent	SNP	ENST00000397541.2	hg19	CCDS43660.1																																																																																			.	.		0.393	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	
SSBP1	6742	hgsc.bcm.edu	37	7	141441987	141441987	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:141441987A>G	ENST00000481508.1	+	3	478	c.43A>G	c.(43-45)Aga>Gga	p.R15G	SSBP1_ENST00000265304.6_Missense_Mutation_p.R15G|SSBP1_ENST00000484178.1_Missense_Mutation_p.R15G|SSBP1_ENST00000465582.1_Missense_Mutation_p.R15G|SSBP1_ENST00000498107.1_Missense_Mutation_p.R15G|SSBP1_ENST00000469123.1_3'UTR	NM_001256510.1	NP_001243439.1	Q04837	SSBP_HUMAN	single-stranded DNA binding protein 1, mitochondrial	15					DNA replication (GO:0006260)|mitochondrion morphogenesis (GO:0070584)|positive regulation of helicase activity (GO:0051096)	extracellular vesicular exosome (GO:0070062)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|skin(1)	7	Melanoma(164;0.0171)					TCAGTTTGTAAGACATGAGTC	0.313																																					p.R15G		Atlas-SNP	.											.	SSBP1	17	.	0			c.A43G						.						123.0	111.0	115.0					7																	141441987		2202	4300	6502	SO:0001583	missense	6742	exon3			TTTGTAAGACATG	M94556	CCDS5866.1	7q34	2012-05-25	2012-05-25		ENSG00000106028	ENSG00000106028			11317	protein-coding gene	gene with protein product		600439	"""single-stranded DNA-binding protein"", ""single-stranded DNA binding protein 1"""			7789991	Standard	NM_001256510		Approved	SSBP, mtSSB	uc031szi.1	Q04837	OTTHUMG00000157572	ENST00000481508.1:c.43A>G	chr7.hg19:g.141441987A>G	ENSP00000419665:p.Arg15Gly	41.0	0.0		61.0	4.0	NM_001256513		Missense_Mutation	SNP	ENST00000481508.1	hg19	CCDS5866.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.500008	0.85176	.	.	ENSG00000106028	ENST00000265304;ENST00000498107;ENST00000467681;ENST00000465582;ENST00000463093;ENST00000484178;ENST00000473783;ENST00000481508	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.77246	0.4102	M	0.64997	1.995	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	T	0.78440	-0.2203	9	0.56958	D	0.05	-24.6187	16.188	0.81967	1.0:0.0:0.0:0.0	.	15;15	B7Z268;Q04837	.;SSBP_HUMAN	G	15	.	ENSP00000265304:R15G	R	+	1	2	SSBP1	141088456	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	3.683000	0.54663	2.216000	0.71823	0.528000	0.53228	AGA	.	.		0.313	SSBP1-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349187.1	NM_003143	
GIMAP8	155038	hgsc.bcm.edu	37	7	150171348	150171348	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:150171348A>G	ENST00000307271.3	+	4	1505	c.931A>G	c.(931-933)Aac>Gac	p.N311D		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	311	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		ATCTTTAAAGAACATTGACTC	0.453																																					p.N311D		Atlas-SNP	.											.	GIMAP8	136	.	0			c.A931G						.						73.0	79.0	77.0					7																	150171348		2203	4300	6503	SO:0001583	missense	155038	exon4			TTAAAGAACATTG	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.931A>G	chr7.hg19:g.150171348A>G	ENSP00000305107:p.Asn311Asp	63.0	0.0		126.0	31.0	NM_175571		Missense_Mutation	SNP	ENST00000307271.3	hg19	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	A	0.331	-0.956063	0.02267	.	.	ENSG00000171115	ENST00000307271	T	0.60797	0.16	4.47	-4.85	0.03142	AIG1 (1);	1.311810	0.05394	N	0.539498	T	0.18087	0.0434	N	0.00991	-1.07	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.19745	-1.0296	10	0.05833	T	0.94	.	2.3223	0.04214	0.479:0.1544:0.2523:0.1143	.	311	Q8ND71	GIMA8_HUMAN	D	311	ENSP00000305107:N311D	ENSP00000305107:N311D	N	+	1	0	GIMAP8	149802281	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.558000	0.00923	-0.941000	0.03700	-0.297000	0.09499	AAC	.	.		0.453	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
PAXIP1	22976	hgsc.bcm.edu	37	7	154759592	154759592	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:154759592A>G	ENST00000404141.1	-	8	1981	c.1827T>C	c.(1825-1827)tgT>tgC	p.C609C	PAXIP1_ENST00000397192.1_Silent_p.C609C|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	609	BRCT 3. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Gln-rich.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TTGCAAACACACATCCCAATA	0.403																																					p.C609C		Atlas-SNP	.											PAXIP1_ENST00000397192,colon,carcinoma,0,2	PAXIP1	150	.	0			c.T1827C						.						79.0	74.0	75.0					7																	154759592		1900	4119	6019	SO:0001819	synonymous_variant	22976	exon8			AAACACACATCCC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1827T>C	chr7.hg19:g.154759592A>G		71.0	1.0		75.0	4.0	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	ENST00000404141.1	hg19	CCDS47753.1																																																																																			.	.		0.403	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
INSIG1	3638	hgsc.bcm.edu	37	7	155090257	155090257	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:155090257A>G	ENST00000340368.4	+	2	473	c.262A>G	c.(262-264)Agc>Ggc	p.S88G	INSIG1_ENST00000344756.4_Intron|AC144652.1_ENST00000609974.1_lincRNA|INSIG1_ENST00000342407.5_Missense_Mutation_p.S88G	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	88					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTTGCAGAGGAGCCTCGTGCT	0.667																																					p.S88G		Atlas-SNP	.											.	INSIG1	20	.	0			c.A262G						.						51.0	47.0	48.0					7																	155090257		2202	4299	6501	SO:0001583	missense	3638	exon2			CAGAGGAGCCTCG		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.262A>G	chr7.hg19:g.155090257A>G	ENSP00000344741:p.Ser88Gly	59.0	0.0		77.0	4.0	NM_198337	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	hg19	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.621302	0.28889	.	.	ENSG00000186480	ENST00000340368;ENST00000425172;ENST00000342407	T;T;T	0.43294	0.95;0.99;1.05	4.85	1.18	0.20946	.	0.092218	0.85682	N	0.000000	T	0.15132	0.0365	N	0.00771	-1.2	0.80722	D	1	P;B	0.37370	0.592;0.004	B;B	0.42738	0.396;0.01	T	0.07635	-1.0762	10	0.14656	T	0.56	.	8.3313	0.32189	0.7662:0.0:0.2338:0.0	.	88;88	A4D2N1;O15503	.;INSI1_HUMAN	G	88	ENSP00000344741:S88G;ENSP00000414691:S88G;ENSP00000344035:S88G	ENSP00000344741:S88G	S	+	1	0	INSIG1	154721190	1.000000	0.71417	0.896000	0.35187	0.993000	0.82548	4.629000	0.61290	-0.029000	0.13827	0.529000	0.55759	AGC	.	.		0.667	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
MTMR9	66036	hgsc.bcm.edu	37	8	11174246	11174246	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:11174246A>G	ENST00000221086.3	+	8	1651	c.1178A>G	c.(1177-1179)gAg>gGg	p.E393G	AF131216.6_ENST00000498997.2_RNA|MTMR9_ENST00000526292.1_Missense_Mutation_p.E308G	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	393	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CAGAAGTGGGAGGCTCCTGTA	0.498																																					p.E393G		Atlas-SNP	.											.	MTMR9	58	.	0			c.A1178G						.						96.0	79.0	85.0					8																	11174246		2203	4300	6503	SO:0001583	missense	66036	exon8			AGTGGGAGGCTCC	AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1178A>G	chr8.hg19:g.11174246A>G	ENSP00000221086:p.Glu393Gly	191.0	0.0		139.0	6.0	NM_015458	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	ENST00000221086.3	hg19	CCDS5979.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.510468	0.85389	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.90444	-2.67;-2.67	4.87	4.87	0.63330	Myotubularin phosphatase domain (1);	.	.	.	.	D	0.89455	0.6720	M	0.85630	2.765	0.80722	D	1	P	0.41498	0.752	B	0.33042	0.157	D	0.89023	0.3436	9	0.31617	T	0.26	.	13.7877	0.63119	1.0:0.0:0.0:0.0	.	393	Q96QG7	MTMR9_HUMAN	G	393;308	ENSP00000221086:E393G;ENSP00000433239:E308G	ENSP00000221086:E393G	E	+	2	0	MTMR9	11211656	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	8.924000	0.92827	2.054000	0.61138	0.482000	0.46254	GAG	.	.		0.498	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458	
VPS37A	137492	hgsc.bcm.edu	37	8	17132309	17132309	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:17132309C>A	ENST00000324849.4	+	5	1158	c.484C>A	c.(484-486)Cct>Act	p.P162T	VPS37A_ENST00000324815.3_Missense_Mutation_p.S171Y|VPS37A_ENST00000521829.1_Missense_Mutation_p.P137T	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)	162					cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		TCCTCCATATCCTCCACAAGA	0.418																																					p.P162T		Atlas-SNP	.											.	VPS37A	22	.	0			c.C484A						.						105.0	89.0	95.0					8																	17132309		2203	4300	6503	SO:0001583	missense	137492	exon5			CCATATCCTCCAC		CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.484C>A	chr8.hg19:g.17132309C>A	ENSP00000318629:p.Pro162Thr	174.0	0.0		117.0	65.0	NM_152415	Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Missense_Mutation	SNP	ENST00000324849.4	hg19	CCDS6001.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.66|11.66	1.705839|1.705839	0.30232|0.30232	.|.	.|.	ENSG00000155975|ENSG00000155975	ENST00000324849;ENST00000521829|ENST00000324815	T;T|.	0.57595|.	0.39;0.45|.	4.25|4.25	3.38|3.38	0.38709|0.38709	.|.	0.436137|.	0.25823|.	N|.	0.028073|.	T|T	0.51295|0.51295	0.1666|0.1666	L|L	0.47716|0.47716	1.5|1.5	0.23473|0.23473	N|N	0.997602|0.997602	B;B|.	0.33583|.	0.418;0.047|.	B;B|.	0.30855|.	0.121;0.014|.	T|T	0.48410|0.48410	-0.9038|-0.9038	10|6	0.62326|0.72032	D|D	0.03|0.01	-13.1633|-13.1633	13.3433|13.3433	0.60557|0.60557	0.0:0.9219:0.0:0.0781|0.0:0.9219:0.0:0.0781	.|.	137;162|.	Q8NEZ2-2;Q8NEZ2|.	.;VP37A_HUMAN|.	T|Y	162;137|171	ENSP00000318629:P162T;ENSP00000429680:P137T|.	ENSP00000318629:P162T|ENSP00000318173:S171Y	P|S	+|+	1|2	0|0	VPS37A|VPS37A	17176680|17176680	0.785000|0.785000	0.28726|0.28726	0.708000|0.708000	0.30435|0.30435	0.272000|0.272000	0.26649|0.26649	2.024000|2.024000	0.41049|0.41049	1.398000|1.398000	0.46701|0.46701	-0.232000|-0.232000	0.12228|0.12228	CCT|TCC	.	.		0.418	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253301.2	NM_152415	
ATP6V1B2	526	hgsc.bcm.edu	37	8	20074766	20074766	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:20074766A>G	ENST00000276390.2	+	12	1237	c.1197A>G	c.(1195-1197)tcA>tcG	p.S399S		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	399					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	CCTCACTATCACGGTTAATGA	0.378																																					p.S399S	Pancreas(119;1230 1726 3901 4036 31644)	Atlas-SNP	.											.	ATP6V1B2	34	.	0			c.A1197G						.						201.0	174.0	184.0					8																	20074766		2203	4300	6503	SO:0001819	synonymous_variant	526	exon12			ACTATCACGGTTA	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.1197A>G	chr8.hg19:g.20074766A>G		80.0	0.0		95.0	4.0	NM_001693	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Silent	SNP	ENST00000276390.2	hg19	CCDS6014.1																																																																																			.	.		0.378	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	
POLR3D	661	hgsc.bcm.edu	37	8	22106822	22106822	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:22106822A>G	ENST00000397802.4	+	6	1136	c.921A>G	c.(919-921)cgA>cgG	p.R307R	POLR3D_ENST00000306433.4_Splice_Site_p.R307R			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	307					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		AGAAAGACCGAGTACGCTCAG	0.607																																					p.R307R		Atlas-SNP	.											.	POLR3D	26	.	0			c.A921G						.						59.0	51.0	54.0					8																	22106822		2203	4300	6503	SO:0001630	splice_region_variant	661	exon7			AGACCGAGTACGC	M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.921+1A>G	chr8.hg19:g.22106822A>G		90.0	0.0		84.0	5.0	NM_001722	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Silent	SNP	ENST00000397802.4	hg19	CCDS34858.1																																																																																			.	.		0.607	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722	Silent
EXTL3	2137	hgsc.bcm.edu	37	8	28575571	28575571	+	Silent	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:28575571G>T	ENST00000220562.4	+	3	2897	c.1995G>T	c.(1993-1995)gtG>gtT	p.V665V	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Silent_p.V281V	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	665					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		AGTTCACGGTGGTGATGTTGA	0.542																																					p.V665V		Atlas-SNP	.											.	EXTL3	83	.	0			c.G1995T						.						132.0	125.0	127.0					8																	28575571		2203	4300	6503	SO:0001819	synonymous_variant	2137	exon3			CACGGTGGTGATG	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1995G>T	chr8.hg19:g.28575571G>T		222.0	1.0		165.0	94.0	NM_001440	D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	hg19	CCDS6070.1																																																																																			.	.		0.542	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
FGFR1	2260	hgsc.bcm.edu	37	8	38285912	38285912	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:38285912A>G	ENST00000447712.2	-	4	1341	c.400T>C	c.(400-402)Tcc>Ccc	p.S134P	FGFR1_ENST00000425967.3_Missense_Mutation_p.S167P|RP11-350N15.4_ENST00000528407.1_RNA|FGFR1_ENST00000341462.5_Missense_Mutation_p.S137P|FGFR1_ENST00000326324.6_Missense_Mutation_p.S45P|FGFR1_ENST00000335922.5_Missense_Mutation_p.S126P|FGFR1_ENST00000397091.5_Missense_Mutation_p.S134P|FGFR1_ENST00000397113.2_Missense_Mutation_p.S134P|FGFR1_ENST00000397103.1_Missense_Mutation_p.S45P|FGFR1_ENST00000532791.1_Missense_Mutation_p.S134P|FGFR1_ENST00000356207.5_Missense_Mutation_p.S45P|FGFR1_ENST00000397108.4_Missense_Mutation_p.S134P	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	134					angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TCTGAAGAGGAGtcatcatca	0.493		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														p.S167P	Melanoma(146;1153 1840 21453 21841 43625)	Atlas-SNP	.		Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	.	FGFR1	284	.	0			c.T499C						.						169.0	174.0	172.0					8																	38285912		1978	4159	6137	SO:0001583	missense	2260	exon5			AAGAGGAGTCATC	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.400T>C	chr8.hg19:g.38285912A>G	ENSP00000400162:p.Ser134Pro	123.0	0.0		84.0	4.0	NM_001174067	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	ENST00000447712.2	hg19	CCDS6107.2	.	.	.	.	.	.	.	.	.	.	A	20.3	3.962112	0.74016	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000335922;ENST00000326324;ENST00000397103;ENST00000397108;ENST00000326296;ENST00000525001;ENST00000526742;ENST00000529552;ENST00000530568;ENST00000434187	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.79845	-1.23;-1.23;-1.27;-1.25;-1.28;-1.23;-1.21;-1.31;-1.17;-1.18;-1.23;-1.1;-1.05;-1.01;-0.97;-1.12	5.69	5.69	0.88448	.	0.113142	0.64402	D	0.000006	D	0.82591	0.5070	N	0.19112	0.55	0.80722	D	1	D;P;P;P;P;P;P;D;D;D;D;D	0.71674	0.998;0.945;0.951;0.951;0.909;0.945;0.882;0.96;0.993;0.99;0.995;0.977	D;P;P;P;P;D;B;P;P;D;D;P	0.79784	0.993;0.82;0.886;0.886;0.665;0.959;0.444;0.809;0.88;0.915;0.991;0.907	D	0.84807	0.0788	10	0.56958	D	0.05	.	15.1202	0.72438	1.0:0.0:0.0:0.0	.	45;45;134;167;45;45;45;134;126;45;45;134	B5A959;P11362-3;P11362-7;P11362-21;B5A958;P11362-14;P11362-4;P11362;P11362-20;P11362-16;P11362-18;P11362-2	.;.;.;.;.;.;.;FGFR1_HUMAN;.;.;.;.	P	134;167;134;137;134;134;134;45;126;45;45;134;137;134;45;45;45;45	ENSP00000380280:S134P;ENSP00000393312:S167P;ENSP00000400162:S134P;ENSP00000340636:S137P;ENSP00000432972:S134P;ENSP00000380302:S134P;ENSP00000348537:S45P;ENSP00000337247:S126P;ENSP00000327229:S45P;ENSP00000380292:S45P;ENSP00000380297:S134P;ENSP00000434712:S134P;ENSP00000433569:S45P;ENSP00000435283:S45P;ENSP00000434473:S45P;ENSP00000392645:S45P	ENSP00000311337:S134P	S	-	1	0	FGFR1	38405069	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.949000	0.56668	2.174000	0.68829	0.460000	0.39030	TCC	.	.		0.493	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
IDO2	169355	hgsc.bcm.edu	37	8	39840206	39840206	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:39840206A>G	ENST00000389060.4	+	4	351	c.351A>G	c.(349-351)gaA>gaG	p.E117E	IDO2_ENST00000343295.4_3'UTR|RP11-44K6.3_ENST00000517623.1_RNA|IDO2_ENST00000502986.2_Silent_p.E130E			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	117					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						CATTTGTCGAAGTCTCCAGGA	0.468																																					p.E130E		Atlas-SNP	.											.	IDO2	78	.	0			c.A390G						.						75.0	74.0	75.0					8																	39840206		1882	4107	5989	SO:0001819	synonymous_variant	169355	exon5			TGTCGAAGTCTCC	AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.351A>G	chr8.hg19:g.39840206A>G		85.0	0.0		70.0	5.0	NM_194294	A4UD41	Silent	SNP	ENST00000389060.4	hg19																																																																																				.	.		0.468	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294	
AP3M2	10947	hgsc.bcm.edu	37	8	42022975	42022975	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:42022975C>T	ENST00000518421.1	+	7	991	c.700C>T	c.(700-702)Cat>Tat	p.H234Y	AP3M2_ENST00000174653.3_Missense_Mutation_p.H234Y|AP3M2_ENST00000517922.1_Missense_Mutation_p.H234Y|AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000396926.3_Missense_Mutation_p.H234Y	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	234	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			TGTCAGCTTCCATCCTTGTGT	0.493																																					p.H234Y		Atlas-SNP	.											.	AP3M2	41	.	0			c.C700T						.						291.0	236.0	255.0					8																	42022975		2203	4300	6503	SO:0001583	missense	10947	exon7			AGCTTCCATCCTT	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.700C>T	chr8.hg19:g.42022975C>T	ENSP00000428787:p.His234Tyr	245.0	0.0		329.0	140.0	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	ENST00000518421.1	hg19	CCDS6125.1	.	.	.	.	.	.	.	.	.	.	C	34	5.319393	0.95682	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000521280;ENST00000517922;ENST00000517499	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	5.83	5.83	0.93111	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81555	0.4847	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87460	0.2407	10	0.87932	D	0	-22.8363	20.126	0.97982	0.0:1.0:0.0:0.0	.	234;234	E7ER80;P53677	.;AP3M2_HUMAN	Y	234;234;234;119;234;97	ENSP00000428787:H234Y;ENSP00000174653:H234Y;ENSP00000380132:H234Y;ENSP00000430616:H119Y;ENSP00000429435:H234Y;ENSP00000429037:H97Y	ENSP00000174653:H234Y	H	+	1	0	AP3M2	42142132	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.487000	0.81328	2.749000	0.94314	0.655000	0.94253	CAT	.	.		0.493	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
FNTA	2339	hgsc.bcm.edu	37	8	42939883	42939883	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:42939883T>C	ENST00000302279.3	+	8	1070	c.876T>C	c.(874-876)taT>taC	p.Y292Y	FNTA_ENST00000342116.4_Silent_p.Y225Y|FNTA_ENST00000529687.1_Silent_p.Y141Y	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	292					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TTTCCAAATATCCTAATCTGT	0.343																																					p.Y292Y		Atlas-SNP	.											.	FNTA	34	.	0			c.T876C						.						70.0	67.0	68.0					8																	42939883		2203	4300	6503	SO:0001819	synonymous_variant	2339	exon8			CAAATATCCTAAT	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.876T>C	chr8.hg19:g.42939883T>C		89.0	0.0		104.0	6.0	NM_002027	A6NJW0|Q53XJ9|Q9UDC1	Silent	SNP	ENST00000302279.3	hg19	CCDS6140.1																																																																																			.	.		0.343	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383178.1	NM_002027	
PCMTD1	115294	hgsc.bcm.edu	37	8	52746162	52746162	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:52746162T>C	ENST00000360540.5	-	5	904	c.498A>G	c.(496-498)ggA>ggG	p.G166G	PCMTD1_ENST00000544451.1_Silent_p.G90G|PCMTD1_ENST00000522514.1_Silent_p.G166G|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	166						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				GCACTCCAGCTCCACAATAAA	0.388																																					p.G166G		Atlas-SNP	.											.	PCMTD1	73	.	0			c.A498G						.						147.0	131.0	136.0					8																	52746162		2203	4300	6503	SO:0001819	synonymous_variant	115294	exon4			TCCAGCTCCACAA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.498A>G	chr8.hg19:g.52746162T>C		84.0	0.0		74.0	4.0	NM_052937	Q96FK9	Silent	SNP	ENST00000360540.5	hg19	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	T	10.67	1.414317	0.25465	.	.	ENSG00000168300	ENST00000519554	.	.	.	5.48	-7.11	0.01542	.	.	.	.	.	T	0.35189	0.0923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37865	-0.9687	4	.	.	.	-29.4437	1.9579	0.03380	0.4189:0.1175:0.1001:0.3635	.	.	.	.	G	58	.	.	E	-	2	0	PCMTD1	52908715	0.984000	0.35163	0.871000	0.34182	0.972000	0.66771	0.110000	0.15437	-1.607000	0.01589	-0.468000	0.05107	GAG	.	.		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
RP1	6101	hgsc.bcm.edu	37	8	55537397	55537397	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:55537397A>G	ENST00000220676.1	+	4	1103	c.955A>G	c.(955-957)Att>Gtt	p.I319V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	319					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGAAGATGATATTGAGAAATC	0.313																																					p.I319V	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.A955G						.						61.0	64.0	63.0					8																	55537397		2203	4298	6501	SO:0001583	missense	6101	exon4			GATGATATTGAGA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.955A>G	chr8.hg19:g.55537397A>G	ENSP00000220676:p.Ile319Val	79.0	0.0		94.0	4.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	hg19	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	7.976	0.750055	0.15778	.	.	ENSG00000104237	ENST00000220676	T	0.28454	1.61	5.08	-1.72	0.08107	.	0.574928	0.16670	N	0.204416	T	0.14657	0.0354	N	0.16166	0.38	0.28204	N	0.927216	B	0.21606	0.058	B	0.22386	0.039	T	0.30357	-0.9981	10	0.17369	T	0.5	.	9.8635	0.41129	0.627:0.0:0.373:0.0	.	319	P56715	RP1_HUMAN	V	319	ENSP00000220676:I319V	ENSP00000220676:I319V	I	+	1	0	RP1	55699950	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	2.456000	0.44997	-0.591000	0.05859	0.533000	0.62120	ATT	.	.		0.313	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
CHD7	55636	hgsc.bcm.edu	37	8	61707642	61707642	+	Missense_Mutation	SNP	C	C	T	rs200277422		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:61707642C>T	ENST00000423902.2	+	4	2673	c.2194C>T	c.(2194-2196)Cca>Tca	p.P732S	CHD7_ENST00000525508.1_Missense_Mutation_p.P732S|CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	732					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.556_871dup(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CAAAACACCCCCACCATCTCC	0.418																																					p.P732S		Atlas-SNP	.											.	CHD7	534	.	1	Insertion - In frame(1)	lung(1)	c.C2194T	GRCh37	CM060907	CHD7	M		.						100.0	101.0	101.0					8																	61707642		1835	4076	5911	SO:0001583	missense	55636	exon4			ACACCCCCACCAT	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.2194C>T	chr8.hg19:g.61707642C>T	ENSP00000392028:p.Pro732Ser	57.0	0.0		79.0	4.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	hg19	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637130	0.47049	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000525508	T;T	0.81415	-1.49;-1.11	5.46	5.46	0.80206	.	0.000000	0.40818	N	0.001004	T	0.74535	0.3729	L	0.36672	1.1	0.58432	D	0.999997	B	0.26081	0.141	B	0.31016	0.123	T	0.68663	-0.5349	10	0.09843	T	0.71	-10.8861	19.6793	0.95956	0.0:1.0:0.0:0.0	.	732	Q9P2D1	CHD7_HUMAN	S	732	ENSP00000392028:P732S;ENSP00000436027:P732S	ENSP00000307304:P732S	P	+	1	0	CHD7	61870196	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.292000	0.72725	2.713000	0.92767	0.655000	0.94253	CCA	.	C|0.998;G|0.002		0.418	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
SULF1	23213	hgsc.bcm.edu	37	8	70541861	70541861	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:70541861T>C	ENST00000260128.4	+	19	2948	c.2231T>C	c.(2230-2232)cTc>cCc	p.L744P	SULF1_ENST00000402687.4_Missense_Mutation_p.L744P|SULF1_ENST00000419716.3_Missense_Mutation_p.L744P|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Missense_Mutation_p.L744P	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	744					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CTGCCTGGCCTCACTTGCTTC	0.542																																					p.L744P		Atlas-SNP	.											.	SULF1	153	.	0			c.T2231C						.						133.0	117.0	123.0					8																	70541861		2203	4300	6503	SO:0001583	missense	23213	exon19			CTGGCCTCACTTG	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2231T>C	chr8.hg19:g.70541861T>C	ENSP00000260128:p.Leu744Pro	109.0	0.0		120.0	6.0	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	hg19	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382067	0.82792	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	4.75	4.75	0.60458	Alkaline-phosphatase-like, core domain (1);	0.063902	0.64402	D	0.000004	T	0.48484	0.1502	M	0.81942	2.565	0.80722	D	1	D	0.67145	0.996	P	0.60609	0.877	T	0.50767	-0.8789	10	0.38643	T	0.18	.	14.4268	0.67220	0.0:0.0:0.0:1.0	.	744	Q8IWU6	SULF1_HUMAN	P	744	ENSP00000403040:L744P;ENSP00000260128:L744P;ENSP00000385704:L744P;ENSP00000390315:L744P	ENSP00000260128:L744P	L	+	2	0	SULF1	70704415	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.838000	0.86804	1.977000	0.57605	0.533000	0.62120	CTC	.	.		0.542	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70744610	70744610	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:70744610T>C	ENST00000260126.4	-	2	1005	c.299A>G	c.(298-300)gAc>gGc	p.D100G	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.D100G|RP11-159H10.3_ENST00000528800.2_RNA|RP11-159H10.3_ENST00000501104.2_RNA|SLCO5A1_ENST00000528658.1_5'UTR|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.D100G|RP11-159H10.3_ENST00000533300.1_RNA	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TTTGCTGAGGTCCACCCTGTG	0.642											OREG0018815	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D100G		Atlas-SNP	.											.	SLCO5A1	142	.	0			c.A299G						.						100.0	95.0	97.0					8																	70744610		2203	4300	6503	SO:0001583	missense	81796	exon2			CTGAGGTCCACCC	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.299A>G	chr8.hg19:g.70744610T>C	ENSP00000260126:p.Asp100Gly	117.0	0.0	1124	138.0	18.0	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	hg19	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	T	5.441	0.266496	0.10294	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.41758	1.09;1.46;0.99	5.52	4.31	0.51392	.	0.238346	0.27504	N	0.019071	T	0.24275	0.0588	N	0.19112	0.55	0.22796	N	0.998724	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.08055	0.0;0.0;0.001;0.003	T	0.06197	-1.0840	10	0.41790	T	0.15	.	5.3437	0.15998	0.0:0.1244:0.19:0.6856	.	100;100;100;100	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	G	100	ENSP00000260126:D100G;ENSP00000434422:D100G;ENSP00000431611:D100G	ENSP00000260126:D100G	D	-	2	0	SLCO5A1	70907164	0.065000	0.20965	0.904000	0.35570	0.498000	0.33706	0.787000	0.26858	2.100000	0.63781	0.454000	0.30748	GAC	.	.		0.642	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
ZFHX4	79776	hgsc.bcm.edu	37	8	77616371	77616371	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:77616371G>A	ENST00000521891.2	+	2	496	c.48G>A	c.(46-48)caG>caA	p.Q16Q	ZFHX4_ENST00000455469.2_Silent_p.Q16Q|ZFHX4_ENST00000518282.1_Silent_p.Q16Q|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Silent_p.Q16Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	16					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAAATGGGCAGAGCACATCAA	0.498										HNSCC(33;0.089)																											p.Q16Q		Atlas-SNP	.											ZFHX4,NS,carcinoma,0,1	ZFHX4	878	.	0			c.G48A						.						54.0	53.0	53.0					8																	77616371		1985	4193	6178	SO:0001819	synonymous_variant	79776	exon2			TGGGCAGAGCACA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.48G>A	chr8.hg19:g.77616371G>A		126.0	0.0		144.0	63.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFHX4	79776	hgsc.bcm.edu	37	8	77768488	77768488	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:77768488G>A	ENST00000521891.2	+	10	9779	c.9331G>A	c.(9331-9333)Gga>Aga	p.G3111R	ZFHX4_ENST00000455469.2_Missense_Mutation_p.G3066R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G3085R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G3066R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3066	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTTCTCCCCGGAATGAACGG	0.522										HNSCC(33;0.089)																											p.G3111R		Atlas-SNP	.											.	ZFHX4	878	.	0			c.G9331A						.						42.0	43.0	42.0					8																	77768488		1939	4142	6081	SO:0001583	missense	79776	exon10			CTCCCCGGAATGA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9331G>A	chr8.hg19:g.77768488G>A	ENSP00000430497:p.Gly3111Arg	66.0	0.0		69.0	5.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525555	0.64860	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.60040	0.26;0.25;0.25;0.22	5.45	5.45	0.79879	.	0.000000	0.43579	U	0.000559	T	0.77491	0.4138	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.78912	-0.2017	10	0.87932	D	0	.	19.4735	0.94973	0.0:0.0:1.0:0.0	.	3066;3066;3111	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	3111;3095;3066;3066;3085	ENSP00000430497:G3111R;ENSP00000399605:G3066R;ENSP00000050961:G3066R;ENSP00000430848:G3085R	ENSP00000050961:G3066R	G	+	1	0	ZFHX4	77931043	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.657000	0.98554	2.836000	0.97738	0.655000	0.94253	GGA	.	.		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
TMEM67	91147	hgsc.bcm.edu	37	8	94822029	94822029	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:94822029A>G	ENST00000453321.3	+	26	2736	c.2678A>G	c.(2677-2679)gAt>gGt	p.D893G	TMEM67_ENST00000409623.3_Missense_Mutation_p.D812G	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	893					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			AAGGAAATGGATTACTTTATA	0.299																																					p.D893G		Atlas-SNP	.											.	TMEM67	187	.	0			c.A2678G						.						39.0	44.0	42.0					8																	94822029		2203	4286	6489	SO:0001583	missense	91147	exon26			AAATGGATTACTT	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.2678A>G	chr8.hg19:g.94822029A>G	ENSP00000389998:p.Asp893Gly	90.0	0.0		92.0	4.0	NM_153704	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	hg19	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	A	23.9	4.476383	0.84640	.	.	ENSG00000164953	ENST00000453321;ENST00000409623	D;D	0.97256	-4.31;-4.31	5.75	5.75	0.90469	.	0.051018	0.85682	D	0.000000	D	0.98235	0.9416	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.995	D	0.99316	1.0905	10	0.72032	D	0.01	-18.6676	16.0656	0.80867	1.0:0.0:0.0:0.0	.	893;812;812	Q5HYA8;B3KRU5;G5E9H2	MKS3_HUMAN;.;.	G	893;812	ENSP00000389998:D893G;ENSP00000386966:D812G	ENSP00000314488:D883G	D	+	2	0	TMEM67	94891205	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.874000	0.92363	2.203000	0.70933	0.377000	0.23210	GAT	.	.		0.299	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
NCALD	83988	hgsc.bcm.edu	37	8	102731720	102731720	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:102731720T>C	ENST00000311028.3	-	5	516	c.138A>G	c.(136-138)gaA>gaG	p.E46E	NCALD_ENST00000521599.1_Silent_p.E46E|NCALD_ENST00000519508.2_Silent_p.E46E|NCALD_ENST00000220931.6_Silent_p.E46E|NCALD_ENST00000395923.1_Silent_p.E46E|NCALD_ENST00000522951.1_Silent_p.E46E	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	46	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			TCTTAAACTCTTCCATTGACA	0.443																																					p.E46E		Atlas-SNP	.											.	NCALD	16	.	0			c.A138G						.						108.0	119.0	115.0					8																	102731720		2203	4300	6503	SO:0001819	synonymous_variant	83988	exon4			AAACTCTTCCATT	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.138A>G	chr8.hg19:g.102731720T>C		120.0	0.0		121.0	5.0	NM_001040627	P29554|Q8IYC3|Q9H0W2	Silent	SNP	ENST00000311028.3	hg19	CCDS6292.1																																																																																			.	.		0.443	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380732.2		
RIMS2	9699	hgsc.bcm.edu	37	8	104898200	104898200	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:104898200A>G	ENST00000436393.2	+	2	948	c.707A>G	c.(706-708)cAc>cGc	p.H236R	RIMS2_ENST00000406091.3_Missense_Mutation_p.H458R|RIMS2_ENST00000507740.1_Missense_Mutation_p.H266R|RIMS2_ENST00000262231.10_Missense_Mutation_p.H266R			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	489					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CGGAAACAGCACCACTTAGAT	0.463										HNSCC(12;0.0054)																											p.H458R		Atlas-SNP	.											.	RIMS2	1357	.	0			c.A1373G						.						98.0	91.0	93.0					8																	104898200		1950	4147	6097	SO:0001583	missense	9699	exon4			AACAGCACCACTT	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.707A>G	chr8.hg19:g.104898200A>G	ENSP00000390665:p.His236Arg	79.0	0.0		109.0	5.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	hg19		.	.	.	.	.	.	.	.	.	.	A	15.31	2.795966	0.50208	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.17691	2.26;2.74;2.32;2.48;2.39;2.31;2.71	5.65	5.65	0.86999	.	.	.	.	.	T	0.30978	0.0782	L	0.43152	1.355	0.80722	D	1	P;D;P;P;D	0.58620	0.885;0.983;0.876;0.905;0.967	B;P;P;P;P	0.60012	0.443;0.867;0.734;0.578;0.692	T	0.00967	-1.1497	9	0.39692	T	0.17	.	15.8726	0.79132	1.0:0.0:0.0:0.0	.	489;236;266;266;458	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	R	458;489;458;489;266;266;266;266;236	ENSP00000427018:H458R;ENSP00000384892:H458R;ENSP00000425205:H266R;ENSP00000262231:H266R;ENSP00000423559:H266R;ENSP00000386228:H266R;ENSP00000390665:H236R	ENSP00000262231:H266R	H	+	2	0	RIMS2	104967376	1.000000	0.71417	0.994000	0.49952	0.899000	0.52679	7.347000	0.79356	2.143000	0.66587	0.460000	0.39030	CAC	.	.		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
RIMS2	9699	hgsc.bcm.edu	37	8	105257145	105257145	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:105257145A>G	ENST00000436393.2	+	24	3631	c.3390A>G	c.(3388-3390)gaA>gaG	p.E1130E	RIMS2_ENST00000339750.2_Splice_Site_p.E48E|RIMS2_ENST00000406091.3_Splice_Site_p.K1112K|RIMS2_ENST00000507740.1_Splice_Site_p.K926K|RIMS2_ENST00000262231.10_Splice_Site_p.K951K			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1174					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCTCTGCAGAAGCAGGAGGTA	0.443										HNSCC(12;0.0054)																											p.K1112K		Atlas-SNP	.											RIMS2_ENST00000507740,NS,carcinoma,0,4	RIMS2	1357	.	0			c.A3336G						.						106.0	107.0	107.0					8																	105257145		1861	4107	5968	SO:0001630	splice_region_variant	9699	exon20			TGCAGAAGCAGGA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3389-1A>G	chr8.hg19:g.105257145A>G		69.0	1.0		66.0	3.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	hg19																																																																																				.	.		0.443	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	Silent
SAMD12	401474	hgsc.bcm.edu	37	8	119452108	119452108	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:119452108C>G	ENST00000314727.4	-	3	421	c.285G>C	c.(283-285)caG>caC	p.Q95H	SAMD12_ENST00000409003.4_Missense_Mutation_p.Q95H	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	95	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CACTGTAGATCTGATACTGAT	0.428																																					p.Q95H		Atlas-SNP	.											.	SAMD12	24	.	0			c.G285C						.						242.0	204.0	217.0					8																	119452108		2203	4300	6503	SO:0001583	missense	401474	exon3			GTAGATCTGATAC	AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.285G>C	chr8.hg19:g.119452108C>G	ENSP00000314173:p.Gln95His	172.0	0.0		176.0	70.0	NM_207506	Q0P502	Missense_Mutation	SNP	ENST00000314727.4	hg19	CCDS6325.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	11.83|11.83|11.83	1.754250|1.754250|1.754250	0.31046|0.31046|0.31046	.|.|.	.|.|.	ENSG00000177570|ENSG00000177570|ENSG00000177570	ENST00000453675|ENST00000409003;ENST00000524796;ENST00000314727;ENST00000526328|ENST00000526765	.|T;T;T;T|.	.|0.30981|.	.|1.51;1.51;1.51;1.51|.	5.68|5.68|5.68	3.49|3.49|3.49	0.39957|0.39957|0.39957	.|Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);|.	.|0.059657|.	.|0.64402|.	.|N|.	.|0.000002|.	T|T|T	0.42877|0.42877|0.42877	0.1222|0.1222|0.1222	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.36478|0.36478|0.36478	D|D|D	0.867694|0.867694|0.867694	.|B;B|.	.|0.20368|.	.|0.0;0.044|.	.|B;B|.	.|0.24848|.	.|0.001;0.056|.	T|T|T	0.40850|0.40850|0.40850	-0.9541|-0.9541|-0.9541	5|9|5	.|.|.	.|.|.	.|.|.	-6.6264|-6.6264|-6.6264	5.9633|5.9633|5.9633	0.19310|0.19310|0.19310	0.0:0.607:0.1501:0.243|0.0:0.607:0.1501:0.243|0.0:0.607:0.1501:0.243	.|.|.	.|95;95|.	.|B8ZZB7;Q8N8I0|.	.|.;SAM12_HUMAN|.	H|H|T	92|95;87;95;95|110	.|ENSP00000387133:Q95H;ENSP00000435927:Q87H;ENSP00000314173:Q95H;ENSP00000431360:Q95H|.	.|.|.	D|Q|R	-|-|-	1|3|2	0|2|0	SAMD12|SAMD12|SAMD12	119521289|119521289|119521289	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	2.308000|2.308000|2.308000	0.43690|0.43690|0.43690	0.630000|0.630000|0.630000	0.30394|0.30394|0.30394	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAT|CAG|AGA	.	.		0.428	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506	
ZHX2	22882	hgsc.bcm.edu	37	8	123964092	123964092	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:123964092A>T	ENST00000314393.4	+	3	1177	c.342A>T	c.(340-342)gaA>gaT	p.E114D		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	114					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TGTGTGCAGAATGTAACTTCA	0.488																																					p.E114D	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.A342T						.						104.0	94.0	97.0					8																	123964092		2203	4300	6503	SO:0001583	missense	22882	exon3			TGCAGAATGTAAC	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.342A>T	chr8.hg19:g.123964092A>T	ENSP00000314709:p.Glu114Asp	43.0	0.0		75.0	21.0	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	hg19	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.295241	0.60086	.	.	ENSG00000178764	ENST00000314393	T	0.53640	0.61	5.56	-0.804	0.10882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.058448	0.64402	D	0.000003	T	0.52837	0.1759	L	0.46157	1.445	0.34967	D	0.752741	D	0.69078	0.997	D	0.64410	0.925	T	0.59936	-0.7360	10	0.49607	T	0.09	-19.01	9.7281	0.40344	0.6344:0.0:0.3656:0.0	.	114	Q9Y6X8	ZHX2_HUMAN	D	114	ENSP00000314709:E114D	ENSP00000314709:E114D	E	+	3	2	ZHX2	124033273	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	1.042000	0.30303	-0.124000	0.11724	0.374000	0.22700	GAA	.	.		0.488	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
TONSL	4796	hgsc.bcm.edu	37	8	145659589	145659589	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:145659589G>A	ENST00000409379.3	-	21	3188	c.3159C>T	c.(3157-3159)gcC>gcT	p.A1053A	AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1053					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCTGGTCCAGGGCCAGGGAGC	0.687																																					p.A1053A		Atlas-SNP	.											.	TONSL	128	.	0			c.C3159T						.						17.0	19.0	18.0					8																	145659589		2197	4287	6484	SO:0001819	synonymous_variant	4796	exon21			GTCCAGGGCCAGG		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3159C>T	chr8.hg19:g.145659589G>A		123.0	0.0		100.0	9.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Silent	SNP	ENST00000409379.3	hg19	CCDS34968.2																																																																																			.	.		0.687	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
GLDC	2731	hgsc.bcm.edu	37	9	6554742	6554742	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:6554742A>G	ENST00000321612.6	-	19	2392	c.2242T>C	c.(2242-2244)Tcg>Ccg	p.S748P		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	748					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	TTTAGGTGCGAGACATCAGAC	0.552																																					p.S748P		Atlas-SNP	.											.	GLDC	118	.	0			c.T2242C						.						64.0	54.0	57.0					9																	6554742		2203	4300	6503	SO:0001583	missense	2731	exon19			GGTGCGAGACATC	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2242T>C	chr9.hg19:g.6554742A>G	ENSP00000370737:p.Ser748Pro	52.0	0.0		74.0	5.0	NM_000170	Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	hg19	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645367	0.67358	.	.	ENSG00000178445	ENST00000321612	D	0.98060	-4.69	5.37	5.37	0.77165	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99099	0.9690	H	0.96365	3.81	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	D	0.99271	1.0893	10	0.72032	D	0.01	-11.6913	15.6542	0.77121	1.0:0.0:0.0:0.0	.	748	P23378	GCSP_HUMAN	P	748	ENSP00000370737:S748P	ENSP00000370737:S748P	S	-	1	0	GLDC	6544742	1.000000	0.71417	0.997000	0.53966	0.288000	0.27193	8.927000	0.92846	2.162000	0.67917	0.379000	0.24179	TCG	.	.		0.552	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
CCDC171	203238	hgsc.bcm.edu	37	9	15695299	15695299	+	Silent	SNP	T	T	C	rs545117191		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:15695299T>C	ENST00000380701.3	+	11	1610	c.1282T>C	c.(1282-1284)Ttg>Ctg	p.L428L	CCDC171_ENST00000297641.3_Silent_p.L428L	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	428																	GGAATCGATCTTGGACAGCTT	0.388																																					p.L428L		Atlas-SNP	.											.	.	.	.	0			c.T1282C						.						168.0	157.0	161.0					9																	15695299		2203	4300	6503	SO:0001819	synonymous_variant	203238	exon11			TCGATCTTGGACA	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.1282T>C	chr9.hg19:g.15695299T>C		96.0	0.0		95.0	4.0	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Silent	SNP	ENST00000380701.3	hg19	CCDS6481.1																																																																																			.	.		0.388	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
PLIN2	123	hgsc.bcm.edu	37	9	19116605	19116605	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:19116605G>C	ENST00000276914.2	-	8	1134	c.955C>G	c.(955-957)Cag>Gag	p.Q319E	PLIN2_ENST00000411567.1_Missense_Mutation_p.Q238E	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	319					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TGGAGCTGCTGAGTCAGGTTG	0.473																																					p.Q319E		Atlas-SNP	.											.	PLIN2	41	.	0			c.C955G						.						146.0	120.0	129.0					9																	19116605		2203	4300	6503	SO:0001583	missense	123	exon8			GCTGCTGAGTCAG	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.955C>G	chr9.hg19:g.19116605G>C	ENSP00000276914:p.Gln319Glu	200.0	0.0		217.0	97.0	NM_001122	Q9BSC3	Missense_Mutation	SNP	ENST00000276914.2	hg19	CCDS6490.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755120	0.89843	.	.	ENSG00000147872	ENST00000411567;ENST00000276914	T;T	0.06068	3.35;3.35	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	T	0.29850	0.0746	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00184	-1.1944	10	0.40728	T	0.16	.	20.4945	0.99205	0.0:0.0:1.0:0.0	.	319	Q99541	PLIN2_HUMAN	E	238;319	ENSP00000415270:Q238E;ENSP00000276914:Q319E	ENSP00000276914:Q319E	Q	-	1	0	PLIN2	19106605	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.835000	0.99442	2.846000	0.97976	0.650000	0.86243	CAG	.	.		0.473	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
MLLT3	4300	hgsc.bcm.edu	37	9	20414041	20414041	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:20414041T>C	ENST00000380338.4	-	5	1089	c.803A>G	c.(802-804)aAc>aGc	p.N268S	MIR4473_ENST00000583731.1_RNA|MLLT3_ENST00000429426.2_Missense_Mutation_p.N265S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	268					anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		GGTGAGTAAGTTACTATCTGG	0.398			T	MLL	ALL																																p.N268S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3	125	.	0			c.A803G						.						278.0	280.0	279.0					9																	20414041		2203	4300	6503	SO:0001583	missense	4300	exon5			AGTAAGTTACTAT	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.803A>G	chr9.hg19:g.20414041T>C	ENSP00000369695:p.Asn268Ser	439.0	1.0		451.0	179.0	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	ENST00000380338.4	hg19	CCDS6494.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.835467	0.00579	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.88	1.92	0.25849	.	0.417336	0.26492	N	0.024065	T	0.35856	0.0946	L	0.29908	0.895	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.11717	-1.0576	9	0.06891	T	0.86	-17.8633	7.2808	0.26310	0.0:0.219:0.1242:0.6568	.	265;268	B7Z755;P42568	.;AF9_HUMAN	S	268;265;307	.	ENSP00000369695:N268S	N	-	2	0	MLLT3	20404041	1.000000	0.71417	0.998000	0.56505	0.318000	0.28184	1.235000	0.32671	0.499000	0.27970	-0.250000	0.11733	AAC	.	.		0.398	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
IFNA6	3443	hgsc.bcm.edu	37	9	21350645	21350645	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:21350645T>G	ENST00000380210.1	-	1	732	c.242A>C	c.(241-243)cAt>cCt	p.H81P		NM_021002.2	NP_066282.1	P05013	IFNA6_HUMAN	interferon, alpha 6	81					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(3)|lung(7)|skin(1)	11				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		AATCACCTCATGGAGGACAGA	0.473																																					p.H81P		Atlas-SNP	.											.	IFNA6	27	.	0			c.A242C						.						107.0	104.0	105.0					9																	21350645		2203	4300	6503	SO:0001583	missense	3443	exon1			ACCTCATGGAGGA		CCDS6504.1	9p22	2010-12-10			ENSG00000120235	ENSG00000120235		"""Interferons"""	5427	protein-coding gene	gene with protein product		147566				1385305	Standard	NM_021002		Approved	IFN-alphaK	uc011lni.2	P05013	OTTHUMG00000019676	ENST00000380210.1:c.242A>C	chr9.hg19:g.21350645T>G	ENSP00000369558:p.His81Pro	193.0	0.0		239.0	110.0	NM_021002	Q5VYQ1	Missense_Mutation	SNP	ENST00000380210.1	hg19	CCDS6504.1	.	.	.	.	.	.	.	.	.	.	T	19.15	3.772671	0.69992	.	.	ENSG00000120235	ENST00000380210	T	0.03745	3.82	3.78	2.55	0.30701	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.749872	0.12726	N	0.444311	T	0.19087	0.0458	M	0.89353	3.025	0.09310	N	1	D	0.67145	0.996	D	0.83275	0.996	T	0.04781	-1.0927	10	0.87932	D	0	.	7.2998	0.26413	0.0:0.1115:0.0:0.8885	.	81	P05013	IFNA6_HUMAN	P	81	ENSP00000369558:H81P	ENSP00000369558:H81P	H	-	2	0	IFNA6	21340645	0.776000	0.28616	0.009000	0.14445	0.827000	0.46813	1.890000	0.39728	0.379000	0.24794	0.482000	0.46254	CAT	.	.		0.473	IFNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051905.1	NM_021002	
PRUNE2	158471	hgsc.bcm.edu	37	9	79324155	79324155	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:79324155G>T	ENST00000376718.3	-	8	3158	c.3035C>A	c.(3034-3036)cCt>cAt	p.P1012H	PRUNE2_ENST00000428286.1_Missense_Mutation_p.P653H	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1012					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CAGTGACTGAGGAGGAATGTC	0.448																																					p.P1012H		Atlas-SNP	.											.	PRUNE2	331	.	0			c.C3035A						.						122.0	95.0	103.0					9																	79324155		1568	3582	5150	SO:0001583	missense	158471	exon8			GACTGAGGAGGAA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3035C>A	chr9.hg19:g.79324155G>T	ENSP00000365908:p.Pro1012His	151.0	0.0		176.0	9.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.183169	0.57800	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.46063	0.88;0.88	5.94	4.13	0.48395	.	0.894418	0.09666	N	0.771839	T	0.36991	0.0987	N	0.24115	0.695	0.09310	N	0.999998	D	0.63880	0.993	P	0.49999	0.628	T	0.17410	-1.0370	10	0.87932	D	0	-1.3206	6.0112	0.19578	0.156:0.0:0.6561:0.1879	.	1012	Q8WUY3	PRUN2_HUMAN	H	1012;653;1011	ENSP00000365908:P1012H;ENSP00000397425:P653H	ENSP00000365908:P1012H	P	-	2	0	PRUNE2	78513975	.	.	0.002000	0.10522	0.222000	0.24845	.	.	0.873000	0.35799	0.561000	0.74099	CCT	.	.		0.448	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TXN	7295	hgsc.bcm.edu	37	9	113018699	113018699	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:113018699T>C	ENST00000374517.5	-	1	221	c.17A>G	c.(16-18)gAg>gGg	p.E6G	TXN_ENST00000374515.5_Missense_Mutation_p.E6G	NM_003329.3	NP_003320.2	P10599	THIO_HUMAN	thioredoxin	6	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|glycerol ether metabolic process (GO:0006662)|innate immune response (GO:0045087)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oxidation-reduction process (GO:0055114)|positive regulation of DNA binding (GO:0043388)|regulation of protein import into nucleus, translocation (GO:0033158)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	peptide disulfide oxidoreductase activity (GO:0015037)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		TACCTTGCTCTCGATCTGCTT	0.642																																					p.E6G		Atlas-SNP	.											.	TXN	6	.	0			c.A17G						.						43.0	35.0	38.0					9																	113018699		2203	4298	6501	SO:0001583	missense	7295	exon1			TTGCTCTCGATCT	X77584	CCDS35103.1, CCDS59139.1	9q31	2008-02-05			ENSG00000136810	ENSG00000136810			12435	protein-coding gene	gene with protein product		187700					Standard	NM_003329		Approved	TRX	uc004bep.2	P10599	OTTHUMG00000020480	ENST00000374517.5:c.17A>G	chr9.hg19:g.113018699T>C	ENSP00000363641:p.Glu6Gly	52.0	0.0		65.0	6.0	NM_001244938	B1ALW1|O60744|Q53X69|Q96KI3|Q9UDG5	Missense_Mutation	SNP	ENST00000374517.5	hg19	CCDS35103.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.427853	0.43122	.	.	ENSG00000136810	ENST00000374517;ENST00000374515	T;T	0.03301	3.98;3.98	4.34	4.34	0.51931	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.176785	0.34268	N	0.004104	T	0.05044	0.0135	L	0.53617	1.68	0.35802	D	0.823206	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.15122	-1.0448	10	0.38643	T	0.18	-3.3249	10.467	0.44614	0.0:0.0:0.0:1.0	.	6;6	B1ALW1;P10599	.;THIO_HUMAN	G	6	ENSP00000363641:E6G;ENSP00000363639:E6G	ENSP00000363639:E6G	E	-	2	0	TXN	112058520	0.905000	0.30787	0.796000	0.32109	0.868000	0.49771	1.251000	0.32862	1.896000	0.54893	0.459000	0.35465	GAG	.	.		0.642	TXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053614.1		
HSDL2	84263	hgsc.bcm.edu	37	9	115232768	115232768	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:115232768A>G	ENST00000398805.3	+	11	1428	c.1201A>G	c.(1201-1203)Atg>Gtg	p.M401V	HSDL2_ENST00000262542.7_Missense_Mutation_p.M281V|HSDL2_ENST00000398803.1_Missense_Mutation_p.M328V|HSDL2_ENST00000539114.1_Missense_Mutation_p.M196V	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	401	SCP2.					membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						TAAAGGTAACATGGCCCTAGC	0.368																																					p.M401V		Atlas-SNP	.											.	HSDL2	24	.	0			c.A1201G						.						87.0	80.0	82.0					9																	115232768		1844	4093	5937	SO:0001583	missense	84263	exon11			GGTAACATGGCCC	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.1201A>G	chr9.hg19:g.115232768A>G	ENSP00000381785:p.Met401Val	54.0	0.0		42.0	4.0	NM_032303	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	hg19	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	A	15.09	2.729957	0.48833	.	.	ENSG00000119471	ENST00000398805;ENST00000398803;ENST00000262542;ENST00000539114	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.89	4.74	0.60224	SCP2 sterol-binding domain (2);	0.076479	0.85682	D	0.000000	T	0.42449	0.1203	M	0.64997	1.995	0.49915	D	0.999839	B;B;D	0.55172	0.029;0.134;0.97	B;B;P	0.58520	0.011;0.167;0.84	T	0.33420	-0.9869	10	0.87932	D	0	.	11.7592	0.51892	0.8528:0.1472:0.0:0.0	.	328;328;401	Q6YN16-2;B2R923;Q6YN16	.;.;HSDL2_HUMAN	V	401;328;281;196	ENSP00000381785:M401V;ENSP00000381783:M328V;ENSP00000262542:M281V;ENSP00000442278:M196V	ENSP00000262542:M281V	M	+	1	0	HSDL2	114272589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.859000	0.69539	1.029000	0.39812	0.455000	0.32223	ATG	.	.		0.368	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
COL27A1	85301	hgsc.bcm.edu	37	9	117015214	117015214	+	Splice_Site	SNP	T	T	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:117015214T>A	ENST00000356083.3	+	27	3532		c.e27+2			NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1						extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGACCCCAGGTAAGCAAAGCC	0.552																																					.		Atlas-SNP	.											.	COL27A1	200	.	0			c.3141+2T>A						.						113.0	102.0	106.0					9																	117015214		2203	4300	6503	SO:0001630	splice_region_variant	85301	exon27			CCCAGGTAAGCAA	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3141+2T>A	chr9.hg19:g.117015214T>A		128.0	0.0		166.0	58.0	NM_032888	Q66K43|Q96JF7	Splice_Site	SNP	ENST00000356083.3	hg19	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818321	0.50633	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7228	0.46050	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL27A1	116055035	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	2.612000	0.46343	2.091000	0.63221	0.459000	0.35465	.	.	.		0.552	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	Intron
OR5C1	392391	hgsc.bcm.edu	37	9	125551531	125551531	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:125551531T>C	ENST00000373680.2	+	1	382	c.320T>C	c.(319-321)gTc>gCc	p.V107A		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						CAGATGTTTGTCTTTGCAGGT	0.562																																					p.V107A		Atlas-SNP	.											.	OR5C1	45	.	0			c.T320C						.						136.0	122.0	127.0					9																	125551531		2203	4300	6503	SO:0001583	missense	392391	exon1			TGTTTGTCTTTGC	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.320T>C	chr9.hg19:g.125551531T>C	ENSP00000362784:p.Val107Ala	86.0	0.0		101.0	5.0	NM_001001923	B2RN54|B9EGT0|Q96RC4	Missense_Mutation	SNP	ENST00000373680.2	hg19	CCDS35131.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.842709	0.51057	.	.	ENSG00000148215	ENST00000373680	T	0.00397	7.57	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.255751	0.20247	U	0.096172	T	0.00300	0.0009	L	0.33137	0.985	0.25192	N	0.990127	B	0.23937	0.094	B	0.22386	0.039	T	0.51639	-0.8680	10	0.72032	D	0.01	.	14.0288	0.64601	0.0:0.0:0.0:1.0	.	107	Q8NGR4	OR5C1_HUMAN	A	107	ENSP00000362784:V107A	ENSP00000362784:V107A	V	+	2	0	OR5C1	124591352	0.000000	0.05858	0.965000	0.40720	0.994000	0.84299	0.438000	0.21559	2.151000	0.67156	0.528000	0.53228	GTC	.	.		0.562	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1		
CRB2	286204	hgsc.bcm.edu	37	9	126139301	126139301	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:126139301A>G	ENST00000373631.3	+	13	3819	c.3818A>G	c.(3817-3819)gAc>gGc	p.D1273G	CRB2_ENST00000373629.2_Missense_Mutation_p.D941G|DENND1A_ENST00000473039.1_5'Flank	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1273					cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CTGGAGATGGACAGTGTCCTC	0.647																																					p.D1273G		Atlas-SNP	.											.	CRB2	86	.	0			c.A3818G						.						19.0	22.0	21.0					9																	126139301		2199	4295	6494	SO:0001583	missense	286204	exon13			AGATGGACAGTGT	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3818A>G	chr9.hg19:g.126139301A>G	ENSP00000362734:p.Asp1273Gly	142.0	0.0		137.0	6.0	NM_173689	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	hg19	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	.	18.97	3.735006	0.69189	.	.	ENSG00000148204	ENST00000373631;ENST00000373629	D;D	0.90069	-2.03;-2.61	5.27	5.27	0.74061	.	0.000000	0.45361	D	0.000364	T	0.80287	0.4595	N	0.16166	0.38	0.80722	D	1	P	0.51537	0.946	B	0.41723	0.365	T	0.80398	-0.1399	10	0.27082	T	0.32	.	15.1857	0.72999	1.0:0.0:0.0:0.0	.	1273	Q5IJ48	CRUM2_HUMAN	G	1273;941	ENSP00000362734:D1273G;ENSP00000362732:D941G	ENSP00000362732:D941G	D	+	2	0	CRB2	125179122	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.897000	0.48664	1.992000	0.58205	0.402000	0.26972	GAC	.	.		0.647	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
FPGS	2356	hgsc.bcm.edu	37	9	130573285	130573285	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:130573285A>G	ENST00000373247.2	+	14	1399	c.1349A>G	c.(1348-1350)aAc>aGc	p.N450S	FPGS_ENST00000373225.3_Missense_Mutation_p.N400S|FPGS_ENST00000373245.1_3'UTR|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000393706.2_Missense_Mutation_p.N424S	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	450					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TCCACAGGCAACGCAGGTGAG	0.572																																					p.N450S		Atlas-SNP	.											.	FPGS	30	.	0			c.A1349G						.						52.0	38.0	43.0					9																	130573285		2202	4299	6501	SO:0001583	missense	2356	exon14			CAGGCAACGCAGG		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.1349A>G	chr9.hg19:g.130573285A>G	ENSP00000362344:p.Asn450Ser	46.0	0.0		62.0	4.0	NM_004957	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	hg19	CCDS35148.1	.	.	.	.	.	.	.	.	.	.	A	2.321	-0.355672	0.05138	.	.	ENSG00000136877	ENST00000373247;ENST00000393706;ENST00000373225	T;T;T	0.13420	2.99;3.0;2.59	5.27	2.86	0.33363	.	0.479409	0.24664	N	0.036616	T	0.06188	0.0160	N	0.20685	0.6	0.28886	N	0.894126	B;B	0.09022	0.002;0.0	B;B	0.15484	0.013;0.002	T	0.40757	-0.9546	10	0.06494	T	0.89	-17.5316	4.2368	0.10630	0.6931:0.0:0.1602:0.1467	.	424;450	Q05932-4;Q05932	.;FOLC_HUMAN	S	450;424;400	ENSP00000362344:N450S;ENSP00000377309:N424S;ENSP00000362322:N400S	ENSP00000362322:N400S	N	+	2	0	FPGS	129613106	0.477000	0.25909	0.053000	0.19242	0.865000	0.49528	1.960000	0.40422	0.314000	0.23086	-0.375000	0.07067	AAC	.	.		0.572	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
SETX	23064	hgsc.bcm.edu	37	9	135202230	135202230	+	Silent	SNP	A	A	G	rs151237267	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:135202230A>G	ENST00000224140.5	-	10	4937	c.4755T>C	c.(4753-4755)ccT>ccC	p.P1585P	SETX_ENST00000393220.1_Silent_p.P1585P|SETX_ENST00000372169.2_Silent_p.P1585P	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1585					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATGCAGGAGGAGGCAAGCCAG	0.403																																					p.P1585P		Atlas-SNP	.											.	SETX	234	.	0			c.T4755C						.						105.0	93.0	97.0					9																	135202230		2203	4300	6503	SO:0001819	synonymous_variant	23064	exon10			AGGAGGAGGCAAG	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4755T>C	chr9.hg19:g.135202230A>G		127.0	0.0		127.0	6.0	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	ENST00000224140.5	hg19	CCDS6947.1																																																																																			.	A|0.995;C|0.005		0.403	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
TSC1	7248	hgsc.bcm.edu	37	9	135798881	135798881	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:135798881T>C	ENST00000298552.3	-	6	585		c.e6-2		TSC1_ENST00000545250.1_Splice_Site|TSC1_ENST00000440111.2_Splice_Site|TSC1_ENST00000403810.1_Splice_Site|TSC1_ENST00000475903.1_Splice_Site	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1						activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)			NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		AGTGTCCATCTGCAGGAGAAA	0.473			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												.		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	167	.	0			c.211-2A>G						.						105.0	89.0	94.0					9																	135798881		2203	4300	6503	SO:0001630	splice_region_variant	7248	exon6	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCCATCTGCAGGA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.364-2A>G	chr9.hg19:g.135798881T>C		119.0	0.0		127.0	7.0	NM_001162427	B7Z897|Q5VVN5	Splice_Site	SNP	ENST00000298552.3	hg19	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.070589	0.55539	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000403810	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3559	0.66738	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSC1	134788702	1.000000	0.71417	0.419000	0.26584	0.649000	0.38597	7.482000	0.81143	1.994000	0.58287	0.533000	0.62120	.	.	.		0.473	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		Intron
NELFB	25920	hgsc.bcm.edu	37	9	140147365	140147365	+	5'Flank	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:140147365G>A	ENST00000343053.4	+	0	0				C9orf173_ENST00000388931.3_Silent_p.S248S|C9orf173_ENST00000412566.1_Silent_p.S248S	NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GCCCCCGCTCGCCGGCCTTCT	0.647																																					p.S248S		Atlas-SNP	.											.	C9orf173	19	.	0			c.G744A						.						9.0	11.0	11.0					9																	140147365		1876	4087	5963	SO:0001631	upstream_gene_variant	441476	exon5			CCGCTCGCCGGCC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778		chr9.hg19:g.140147365G>A	Exception_encountered	63.0	0.0		70.0	36.0	NM_001004353	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Silent	SNP	ENST00000343053.4	hg19	CCDS7040.1																																																																																			.	.		0.647	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
C10orf113	387638	hgsc.bcm.edu	37	10	21435343	21435344	+	Missense_Mutation	DNP	CT	CT	AA	rs45546236|rs72102767	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:21435343_21435344CT>AA	ENST00000534331.1	-	1	144_145	c.94_95AG>TT	c.(94-96)AGt>TTt	p.S32F	C10orf113_ENST00000377118.4_Missense_Mutation_p.S22F|NEBL_ENST00000417816.2_Intron|C10orf113_ENST00000529198.1_Missense_Mutation_p.S32F	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	32										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						AGCACAAACACTCTCTCTCATA	0.396																																					p.S32I|p.S32C		Atlas-SNP	.											.	C10orf113	32	.	0			c.G95T|c.A94T						.																																			SO:0001583	missense	387638	exon1			CAAACACTCTCTC|AAACACTCTCTCT		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.94_95delinsAA	chr10.hg19:g.21435343_21435344delinsAA	ENSP00000433646:p.Ser32Phe	64.0|65.0	0.0		101.0|103.0	5.0|6.0	NM_001177483	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	hg19	CCDS31162.2																																																																																			.	.		0.396	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896	
MYO3A	53904	hgsc.bcm.edu	37	10	26443748	26443748	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:26443748T>C	ENST00000265944.5	+	25	2955	c.2789T>C	c.(2788-2790)tTt>tCt	p.F930S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	930	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GCATCATATTTTAGAGTAAGA	0.403																																					p.F930S		Atlas-SNP	.											.	MYO3A	371	.	0			c.T2789C						.						102.0	105.0	104.0					10																	26443748		2203	4300	6503	SO:0001583	missense	53904	exon25			CATATTTTAGAGT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2789T>C	chr10.hg19:g.26443748T>C	ENSP00000265944:p.Phe930Ser	68.0	0.0		90.0	4.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.943328	0.92593	.	.	ENSG00000095777	ENST00000265944	T	0.75050	-0.9	5.56	5.56	0.83823	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.92034	0.7476	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95176	0.8295	10	0.87932	D	0	.	16.0048	0.80354	0.0:0.0:0.0:1.0	.	930	Q8NEV4	MYO3A_HUMAN	S	930	ENSP00000265944:F930S	ENSP00000265944:F930S	F	+	2	0	MYO3A	26483754	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.997000	0.88414	2.237000	0.73441	0.528000	0.53228	TTT	.	.		0.403	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
DDX50	79009	hgsc.bcm.edu	37	10	70694063	70694063	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:70694063C>T	ENST00000373585.3	+	9	1455	c.1348C>T	c.(1348-1350)Cgt>Tgt	p.R450C	DDX50_ENST00000466265.1_Intron	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	450	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TGTGGCTGCCCGTGGTTTGGA	0.403																																					p.R450C		Atlas-SNP	.											.	DDX50	65	.	0			c.C1348T						.						83.0	85.0	84.0					10																	70694063		2203	4300	6503	SO:0001583	missense	79009	exon9			GCTGCCCGTGGTT	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.1348C>T	chr10.hg19:g.70694063C>T	ENSP00000362687:p.Arg450Cys	52.0	0.0		66.0	24.0	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	hg19	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079049	0.94050	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.79247	-1.25	5.48	5.48	0.80851	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93151	0.7819	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95239	0.8349	10	0.87932	D	0	-7.8583	19.7088	0.96084	0.0:1.0:0.0:0.0	.	450	Q9BQ39	DDX50_HUMAN	C	450	ENSP00000362687:R450C	ENSP00000362687:R450C	R	+	1	0	DDX50	70364069	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.165000	0.77544	2.722000	0.93159	0.561000	0.74099	CGT	.	.		0.403	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
KAT6B	23522	hgsc.bcm.edu	37	10	76741556	76741556	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:76741556T>C	ENST00000287239.4	+	11	2732	c.2243T>C	c.(2242-2244)cTt>cCt	p.L748P	KAT6B_ENST00000372714.1_Missense_Mutation_p.L456P|KAT6B_ENST00000372725.1_Missense_Mutation_p.L456P|KAT6B_ENST00000372724.1_Missense_Mutation_p.L456P|KAT6B_ENST00000372711.1_Missense_Mutation_p.L565P|KAT6B_ENST00000490365.1_3'UTR	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	748	Catalytic.|MYST-type HAT.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTACCAAAGCTTTACCTGTGT	0.299																																					p.L748P		Atlas-SNP	.											.	.	.	.	0			c.T2243C						.						46.0	56.0	53.0					10																	76741556		2202	4299	6501	SO:0001583	missense	23522	exon11			CAAAGCTTTACCT	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.2243T>C	chr10.hg19:g.76741556T>C	ENSP00000287239:p.Leu748Pro	52.0	0.0		76.0	4.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	hg19	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857335	0.51376	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.85955	-1.99;-1.99;-2.05;-1.99;-2.03	5.73	5.73	0.89815	.	0.000000	0.41294	D	0.000915	D	0.92795	0.7709	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.996	D	0.93761	0.7067	10	0.87932	D	0	-8.7284	16.0173	0.80450	0.0:0.0:0.0:1.0	.	565;456;748	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	P	456;456;748;456;565	ENSP00000361810:L456P;ENSP00000361809:L456P;ENSP00000287239:L748P;ENSP00000361799:L456P;ENSP00000361796:L565P	ENSP00000287239:L748P	L	+	2	0	KAT6B	76411562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.191000	0.70037	0.528000	0.53228	CTT	.	.		0.299	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
DUPD1	338599	hgsc.bcm.edu	37	10	76818256	76818256	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:76818256A>T	ENST00000338487.5	-	1	16	c.17T>A	c.(16-18)gTg>gAg	p.V6E		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	6					protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GCTTGTCTTCACTTCTCCAGA	0.532																																					p.V6E		Atlas-SNP	.											.	DUPD1	30	.	0			c.T17A						.						68.0	65.0	66.0					10																	76818256		2203	4300	6503	SO:0001583	missense	338599	exon1			GTCTTCACTTCTC		CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.17T>A	chr10.hg19:g.76818256A>T	ENSP00000340609:p.Val6Glu	53.0	0.0		79.0	23.0	NM_001003892	B2RP93	Missense_Mutation	SNP	ENST00000338487.5	hg19	CCDS31223.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.578326	0.00879	.	.	ENSG00000188716	ENST00000338487	T	0.04706	3.57	5.13	1.99	0.26369	.	3.565550	0.00861	N	0.001920	T	0.04452	0.0122	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.42799	-0.9430	10	0.11794	T	0.64	0.0675	6.265	0.20922	0.1029:0.363:0.5341:0.0	.	6	Q68J44	DUPD1_HUMAN	E	6	ENSP00000340609:V6E	ENSP00000340609:V6E	V	-	2	0	DUPD1	76488262	0.002000	0.14202	0.020000	0.16555	0.727000	0.41649	1.316000	0.33620	0.530000	0.28619	-0.468000	0.05107	GTG	.	.		0.532	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048777.2	XM_291741	
SAMD8	142891	hgsc.bcm.edu	37	10	76868819	76868819	+	5'Flank	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:76868819A>G	ENST00000542569.1	+	0	0				SAMD8_ENST00000372690.3_5'Flank|DUSP13_ENST00000607131.1_5'UTR|DUSP13_ENST00000607009.1_5'UTR|DUSP13_ENST00000491677.2_5'UTR|DUSP13_ENST00000372700.3_Missense_Mutation_p.S33P|SAMD8_ENST00000372687.4_5'Flank|DUSP13_ENST00000372702.3_Missense_Mutation_p.S33P	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8						ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CTGCAAGAAGACTTCCCTGCC	0.632																																					p.S33P		Atlas-SNP	.											.	DUSP13	82	.	0			c.T97C						.						101.0	79.0	86.0					10																	76868819		2203	4300	6503	SO:0001631	upstream_gene_variant	51207	exon1			AAGAAGACTTCCC	AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515		chr10.hg19:g.76868819A>G	Exception_encountered	64.0	0.0		84.0	4.0	NM_001007272	Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	hg19	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	A	0.377	-0.931020	0.02359	.	.	ENSG00000079393	ENST00000372702;ENST00000372700	T;T	0.61274	0.12;3.34	5.52	-0.013	0.13986	.	.	.	.	.	T	0.28599	0.0708	N	0.08118	0	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.13045	-1.0524	9	0.29301	T	0.29	.	0.9259	0.01324	0.3726:0.2841:0.1141:0.2292	.	33;33	Q9UII6-4;Q6B8I1	.;MDSP_HUMAN	P	33	ENSP00000361787:S33P;ENSP00000361785:S33P	ENSP00000361785:S33P	S	-	1	0	DUSP13	76538825	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-1.077000	0.03416	-0.286000	0.09076	-0.219000	0.12488	TCT	.	.		0.632	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660	
FAS	355	hgsc.bcm.edu	37	10	90762898	90762898	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:90762898A>G	ENST00000355279.2	+	2	143	c.143A>G	c.(142-144)aAc>aGc	p.N48S	FAS_ENST00000357339.2_Missense_Mutation_p.N48S|FAS_ENST00000355740.2_Missense_Mutation_p.N48S|FAS_ENST00000313771.5_3'UTR|FAS_ENST00000352159.4_Missense_Mutation_p.N48S			P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	GAGACTCAGAACTTGGAAGGC	0.438																																					p.N48S		Atlas-SNP	.											.	FAS	47	.	0			c.A143G						.						131.0	118.0	122.0					10																	90762898		2203	4300	6503	SO:0001583	missense	355	exon2			CTCAGAACTTGGA	M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355279.2:c.143A>G	chr10.hg19:g.90762898A>G	ENSP00000347426:p.Asn48Ser	109.0	0.0		72.0	4.0	NM_152872	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355279.2	hg19	CCDS7395.1	.	.	.	.	.	.	.	.	.	.	A	8.300	0.819796	0.16678	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000352159;ENST00000357339;ENST00000355279;ENST00000371875	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	3.65	1.54	0.23209	.	.	.	.	.	T	0.65491	0.2696	L	0.44542	1.39	0.09310	N	1	P;P;P;P	0.46220	0.874;0.814;0.867;0.717	P;B;B;B	0.47402	0.546;0.225;0.316;0.113	T	0.52328	-0.8590	9	0.18710	T	0.47	-2.2449	3.6119	0.08063	0.1628:0.2595:0.5777:0.0	.	48;48;48;48	P25445-4;P25445-6;Q5T9P3;P25445	.;.;.;TNR6_HUMAN	S	75;48;48;48;48;48	ENSP00000347979:N48S;ENSP00000345601:N48S;ENSP00000349896:N48S;ENSP00000347426:N48S	ENSP00000345601:N48S	N	+	2	0	FAS	90752878	0.009000	0.17119	0.002000	0.10522	0.054000	0.15201	1.069000	0.30641	0.401000	0.25424	0.459000	0.35465	AAC	.	.		0.438	FAS-011	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000049280.2		
TBC1D12	23232	hgsc.bcm.edu	37	10	96260080	96260080	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:96260080T>C	ENST00000225235.4	+	6	1625	c.1515T>C	c.(1513-1515)acT>acC	p.T505T		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	505	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				TAAATATCACTCCTGGTTTGT	0.413																																					p.T505T		Atlas-SNP	.											.	TBC1D12	51	.	0			c.T1515C						.						140.0	128.0	132.0					10																	96260080		1872	4104	5976	SO:0001819	synonymous_variant	23232	exon6			TATCACTCCTGGT	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1515T>C	chr10.hg19:g.96260080T>C		120.0	0.0		70.0	4.0	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	hg19	CCDS41553.1																																																																																			.	.		0.413	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
HPSE2	60495	hgsc.bcm.edu	37	10	100904083	100904083	+	Silent	SNP	C	C	T	rs200038077		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:100904083C>T	ENST00000370552.3	-	3	581	c.522G>A	c.(520-522)ctG>ctA	p.L174L	HPSE2_ENST00000370546.1_Silent_p.L174L|HPSE2_ENST00000370549.1_Silent_p.L174L|HPSE2_ENST00000404542.1_Intron	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	174					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TTTGGAGCTCCAGCATAACAT	0.428																																					p.L174L		Atlas-SNP	.											.	HPSE2	203	.	0			c.G522A						.						113.0	111.0	112.0					10																	100904083		2203	4300	6503	SO:0001819	synonymous_variant	60495	exon3			GAGCTCCAGCATA	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.522G>A	chr10.hg19:g.100904083C>T		69.0	0.0		62.0	4.0	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	hg19	CCDS7477.1																																																																																			.	C|0.999;T|0.001		0.428	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
CHUK	1147	hgsc.bcm.edu	37	10	101978562	101978562	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:101978562T>C	ENST00000370397.7	-	8	796	c.710A>G	c.(709-711)aAg>aGg	p.K237R		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CTTTGGATCCTTCTTCTTAAT	0.323																																					p.K237R	Ovarian(159;52 1904 10536 35305 37148)	Atlas-SNP	.											CHUK,caecum,carcinoma,0,5	CHUK	71	.	0			c.A710G						.						118.0	111.0	113.0					10																	101978562		2203	4300	6503	SO:0001583	missense	1147	exon8			GGATCCTTCTTCT	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.710A>G	chr10.hg19:g.101978562T>C	ENSP00000359424:p.Lys237Arg	118.0	0.0		79.0	4.0	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	hg19	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582282	0.86748	.	.	ENSG00000213341	ENST00000370397	T	0.65549	-0.16	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77350	0.4117	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.79470	-0.1790	10	0.72032	D	0.01	-16.8521	14.3262	0.66523	0.0:0.0:0.0:1.0	.	237	O15111	IKKA_HUMAN	R	237	ENSP00000359424:K237R	ENSP00000359424:K237R	K	-	2	0	CHUK	101968552	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.661000	0.83786	2.263000	0.75096	0.533000	0.62120	AAG	.	.		0.323	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
BTRC	8945	hgsc.bcm.edu	37	10	103190119	103190119	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:103190119T>C	ENST00000370187.3	+	2	184	c.66T>C	c.(64-66)tcT>tcC	p.S22S	BTRC_ENST00000393441.4_Silent_p.S7S|BTRC_ENST00000408038.2_Intron	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	22					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TGCCCAGGTCTCTGTGGCTGG	0.542																																					p.S22S		Atlas-SNP	.											.	BTRC	64	.	0			c.T66C						.						77.0	74.0	75.0					10																	103190119		2203	4300	6503	SO:0001819	synonymous_variant	8945	exon2			CAGGTCTCTGTGG	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.66T>C	chr10.hg19:g.103190119T>C		146.0	0.0		82.0	4.0	NM_001256856	B5MD49|Q5W141|Q5W142|Q9Y213	Silent	SNP	ENST00000370187.3	hg19	CCDS7512.1																																																																																			.	.		0.542	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
PPRC1	23082	hgsc.bcm.edu	37	10	103908392	103908392	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:103908392T>C	ENST00000278070.2	+	11	4597	c.4558T>C	c.(4558-4560)Tct>Cct	p.S1520P	PPRC1_ENST00000489648.1_3'UTR|PPRC1_ENST00000413464.2_Missense_Mutation_p.S1256P|PPRC1_ENST00000370012.1_Missense_Mutation_p.S487P	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1520	Arg-rich.|Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CAGGTACAGCTCTTATCGTTC	0.502																																					p.S1520P		Atlas-SNP	.											.	PPRC1	151	.	0			c.T4558C						.						184.0	172.0	176.0					10																	103908392		2203	4300	6503	SO:0001583	missense	23082	exon11			TACAGCTCTTATC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4558T>C	chr10.hg19:g.103908392T>C	ENSP00000278070:p.Ser1520Pro	130.0	0.0		97.0	4.0	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	hg19	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	t	11.12	1.545661	0.27652	.	.	ENSG00000148840	ENST00000278070;ENST00000413464;ENST00000370012	T;T;T	0.38401	1.14;1.14;1.14	5.43	4.27	0.50696	Nucleotide-binding, alpha-beta plait (1);	0.578506	0.20168	N	0.097792	T	0.23649	0.0572	N	0.19112	0.55	0.20074	N	0.999934	B;B;B	0.28419	0.134;0.211;0.03	B;B;B	0.22601	0.018;0.04;0.013	T	0.10823	-1.0613	10	0.36615	T	0.2	.	12.6748	0.56887	0.0:0.0:0.138:0.862	.	1256;1398;1520	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	P	1520;1256;487	ENSP00000278070:S1520P;ENSP00000399743:S1256P;ENSP00000359029:S487P	ENSP00000278070:S1520P	S	+	1	0	PPRC1	103898382	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	2.524000	0.45589	0.965000	0.38133	0.448000	0.29417	TCT	.	.		0.502	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
TAF5	6877	hgsc.bcm.edu	37	10	105139430	105139430	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:105139430A>G	ENST00000369839.3	+	4	1202	c.1179A>G	c.(1177-1179)ggA>ggG	p.G393G	TAF5_ENST00000351396.4_Silent_p.G393G	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	393					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		ATGAAGAGGGAGAAAATGAAG	0.343																																					p.G393G		Atlas-SNP	.											.	TAF5	47	.	0			c.A1179G						.						69.0	66.0	67.0					10																	105139430		2203	4300	6503	SO:0001819	synonymous_variant	6877	exon4			AGAGGGAGAAAAT	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1179A>G	chr10.hg19:g.105139430A>G		134.0	0.0		89.0	4.0	NM_006951	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Silent	SNP	ENST00000369839.3	hg19	CCDS7547.1																																																																																			.	.		0.343	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
COL17A1	1308	hgsc.bcm.edu	37	10	105830329	105830329	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:105830329T>C	ENST00000353479.5	-	9	754		c.e9-2		COL17A1_ENST00000393211.3_Splice_Site|COL17A1_ENST00000369733.3_Splice_Site	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1						cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		ATTCTGTCCCTGTGAAAGAAT	0.512																																					.		Atlas-SNP	.											.	COL17A1	149	.	0			c.464-2A>G	GRCh37	CS063258	COL17A1	S		.						119.0	113.0	115.0					10																	105830329		2203	4300	6503	SO:0001630	splice_region_variant	1308	exon10			TGTCCCTGTGAAA	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.464-2A>G	chr10.hg19:g.105830329T>C		58.0	0.0		43.0	4.0	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Splice_Site	SNP	ENST00000353479.5	hg19	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.370316	0.61624	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0249	0.80536	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL17A1	105820319	1.000000	0.71417	0.998000	0.56505	0.526000	0.34562	7.000000	0.76290	2.270000	0.75569	0.459000	0.35465	.	.	.		0.512	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	Intron
SMC3	9126	hgsc.bcm.edu	37	10	112356255	112356255	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:112356255A>G	ENST00000361804.4	+	19	2189	c.2063A>G	c.(2062-2064)gAa>gGa	p.E688G		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	688					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GCAGAAGAAGAACTAGGTGAA	0.403																																					p.E688G		Atlas-SNP	.											.	SMC3	103	.	0			c.A2063G						.						107.0	108.0	108.0					10																	112356255		2203	4300	6503	SO:0001583	missense	9126	exon19			AAGAAGAACTAGG	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2063A>G	chr10.hg19:g.112356255A>G	ENSP00000354720:p.Glu688Gly	61.0	0.0		61.0	4.0	NM_005445	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	hg19	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959914	0.74016	.	.	ENSG00000108055	ENST00000361804	D	0.89050	-2.46	5.13	5.13	0.70059	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.90219	0.6942	M	0.66939	2.045	0.80722	D	1	P	0.49961	0.93	P	0.48524	0.58	D	0.90969	0.4818	10	0.56958	D	0.05	.	14.9491	0.71057	1.0:0.0:0.0:0.0	.	688	Q9UQE7	SMC3_HUMAN	G	688	ENSP00000354720:E688G	ENSP00000354720:E688G	E	+	2	0	SMC3	112346245	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	8.962000	0.93254	1.930000	0.55929	0.260000	0.18958	GAA	.	.		0.403	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
VWA2	340706	hgsc.bcm.edu	37	10	116044664	116044664	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:116044664T>C	ENST00000392982.3	+	10	1182	c.932T>C	c.(931-933)gTt>gCt	p.V311A	VWA2_ENST00000603594.1_Missense_Mutation_p.V311A			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	311	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		GGCACATGTGTTCCAGAAGGA	0.602																																					p.V311A		Atlas-SNP	.											.	VWA2	64	.	0			c.T932C						.						84.0	66.0	72.0					10																	116044664		2203	4300	6503	SO:0001583	missense	340706	exon10			CATGTGTTCCAGA	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.932T>C	chr10.hg19:g.116044664T>C	ENSP00000376708:p.Val311Ala	75.0	0.0		65.0	4.0	NM_001272046	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	hg19		.	.	.	.	.	.	.	.	.	.	T	18.93	3.727647	0.69074	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	D	0.93488	-3.23	5.49	5.49	0.81192	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.291582	0.32593	N	0.005886	D	0.91825	0.7413	L	0.39467	1.215	0.28003	N	0.935209	P;P	0.48640	0.913;0.894	P;P	0.48334	0.574;0.525	D	0.87768	0.2603	10	0.49607	T	0.09	.	13.8431	0.63451	0.0:0.0:0.0:1.0	.	311;311	Q5GFL6;Q5GFL6-2	VWA2_HUMAN;.	A	311	ENSP00000376708:V311A	ENSP00000298715:V311A	V	+	2	0	VWA2	116034654	1.000000	0.71417	0.395000	0.26283	0.403000	0.30841	7.370000	0.79589	2.076000	0.62316	0.533000	0.62120	GTT	.	.		0.602	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496	
SEC23IP	11196	hgsc.bcm.edu	37	10	121677482	121677482	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:121677482A>G	ENST00000369075.3	+	9	1751	c.1679A>G	c.(1678-1680)aAc>aGc	p.N560S	SEC23IP_ENST00000543134.1_Missense_Mutation_p.N349S	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	560					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		ATGGAGATAAACCATCTGCAT	0.383																																					p.N560S		Atlas-SNP	.											.	SEC23IP	100	.	0			c.A1679G						.						101.0	99.0	100.0					10																	121677482		2203	4300	6503	SO:0001583	missense	11196	exon9			AGATAAACCATCT	AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1679A>G	chr10.hg19:g.121677482A>G	ENSP00000358071:p.Asn560Ser	101.0	0.0		93.0	5.0	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	hg19	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.305968	0.81247	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.50548	0.74;0.74	5.51	4.35	0.52113	.	0.040106	0.85682	D	0.000000	T	0.76040	0.3932	H	0.96048	3.76	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.66196	0.942;0.936	T	0.83041	-0.0157	10	0.87932	D	0	-24.6233	12.8103	0.57635	0.8631:0.1369:0.0:0.0	.	349;560	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	S	560;349	ENSP00000358071:N560S;ENSP00000438773:N349S	ENSP00000358071:N560S	N	+	2	0	SEC23IP	121667472	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.071000	0.93980	0.998000	0.38996	0.533000	0.62120	AAC	.	.		0.383	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
PIDD1	55367	hgsc.bcm.edu	37	11	802841	802841	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:802841A>G	ENST00000347755.5	-	4	901	c.760T>C	c.(760-762)Tct>Cct	p.S254P	PIDD_ENST00000411829.2_Missense_Mutation_p.S254P|PIDD_ENST00000534649.1_5'Flank	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					GCTGGCACAGAGGCCAGGAGG	0.677																																					p.S254P		Atlas-SNP	.											.	PIDD	76	.	0			c.T760C						.						18.0	22.0	21.0					11																	802841		2183	4282	6465	SO:0001583	missense	55367	exon4			GCACAGAGGCCAG																												ENST00000347755.5:c.760T>C	chr11.hg19:g.802841A>G	ENSP00000337797:p.Ser254Pro	127.0	0.0		147.0	6.0	NM_145887		Missense_Mutation	SNP	ENST00000347755.5	hg19	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	A	12.88	2.070568	0.36566	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.20463	2.07;2.07	4.44	3.28	0.37604	.	0.718142	0.12984	N	0.423012	T	0.26593	0.0650	L	0.28608	0.87	0.09310	N	1	D;D;D	0.71674	0.996;0.998;0.998	P;P;P	0.62649	0.806;0.876;0.905	T	0.08006	-1.0743	10	0.48119	T	0.1	.	4.876	0.13656	0.5276:0.1404:0.0:0.332	.	254;108;254	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	P	254	ENSP00000416801:S254P;ENSP00000337797:S254P	ENSP00000337797:S254P	S	-	1	0	PIDD	792841	0.987000	0.35691	0.030000	0.17652	0.066000	0.16364	2.542000	0.45744	0.719000	0.32188	0.454000	0.30748	TCT	.	.		0.677	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1		
IFITM10	402778	hgsc.bcm.edu	37	11	1756545	1756545	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:1756545A>G	ENST00000340134.4	-	3	800	c.652T>C	c.(652-654)Ttc>Ctc	p.F218L	IFITM10_ENST00000482459.1_5'UTR	NM_001170820.3	NP_001164291.2	A6NMD0	IFM10_HUMAN	interferon induced transmembrane protein 10	218					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AGGAAGATGAAGACGAGGATG	0.577																																					p.F218L		Atlas-SNP	.											.	.	.	.	0			c.T652C						.						141.0	149.0	147.0					11																	1756545		692	1591	2283	SO:0001583	missense	402778	exon3			AGATGAAGACGAG		CCDS53593.1, CCDS53593.2	11p15.5	2011-05-06			ENSG00000244242	ENSG00000244242			40022	protein-coding gene	gene with protein product							Standard	NM_001170820		Approved		uc021qbs.2	A6NMD0	OTTHUMG00000043933	ENST00000340134.4:c.652T>C	chr11.hg19:g.1756545A>G	ENSP00000344430:p.Phe218Leu	63.0	0.0		82.0	5.0	NM_001170820	A6NEU7	Missense_Mutation	SNP	ENST00000340134.4	hg19	CCDS53593.2	.	.	.	.	.	.	.	.	.	.	a	12.89	2.072307	0.36566	.	.	ENSG00000244242	ENST00000382123;ENST00000340134	T	0.47869	0.83	3.98	2.85	0.33270	.	0.373810	0.24470	N	0.038257	T	0.20047	0.0482	N	0.01874	-0.695	0.38879	D	0.956879	.	.	.	.	.	.	T	0.05886	-1.0858	8	0.25106	T	0.35	.	6.8712	0.24121	0.8154:0.0:0.1846:0.0	.	.	.	.	L	120;218	ENSP00000344430:F218L	ENSP00000344430:F218L	F	-	1	0	IFITM10	1713121	1.000000	0.71417	0.970000	0.41538	0.897000	0.52465	2.859000	0.48364	0.581000	0.29539	0.379000	0.24179	TTC	.	.		0.577	IFITM10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000102341.5	NM_001170820	
OR51G1	79324	hgsc.bcm.edu	37	11	4944635	4944635	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:4944635A>G	ENST00000321961.2	-	1	1002	c.935T>C	c.(934-936)aTa>aCa	p.I312T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAGTGACTTTATAAACTGAAA	0.413																																					p.I312T		Atlas-SNP	.											.	OR51G1	74	.	0			c.T935C						.						93.0	92.0	92.0					11																	4944635		2201	4298	6499	SO:0001583	missense	79324	exon1			GACTTTATAAACT	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.935T>C	chr11.hg19:g.4944635A>G	ENSP00000322546:p.Ile312Thr	113.0	0.0		117.0	16.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	hg19	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	A	8.544	0.873893	0.17395	.	.	ENSG00000176879	ENST00000321961	T	0.36878	1.23	4.17	2.96	0.34315	.	1.754140	0.03997	U	0.295786	T	0.19167	0.0460	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09509	-1.0671	10	0.31617	T	0.26	.	7.6017	0.28079	0.7844:0.2156:0.0:0.0	.	312	Q8NGK1	O51G1_HUMAN	T	312	ENSP00000322546:I312T	ENSP00000322546:I312T	I	-	2	0	OR51G1	4901211	0.002000	0.14202	0.097000	0.21041	0.664000	0.39144	1.714000	0.37961	1.746000	0.51805	0.455000	0.32223	ATA	.	.		0.413	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
AMPD3	272	hgsc.bcm.edu	37	11	10500172	10500172	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:10500172T>C	ENST00000396554.3	+	3	689	c.348T>C	c.(346-348)tcT>tcC	p.S116S	AMPD3_ENST00000444303.2_Intron	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	107					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CGGCCATGTCTCCCACAACCC	0.592																																					p.S116S		Atlas-SNP	.											.	AMPD3	68	.	0			c.T348C						.						103.0	111.0	108.0					11																	10500172		2201	4294	6495	SO:0001819	synonymous_variant	272	exon3			CATGTCTCCCACA	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.348T>C	chr11.hg19:g.10500172T>C		89.0	0.0		114.0	5.0	NM_000480	A0AUX0|B7Z2S2|B7Z763|B7Z877	Silent	SNP	ENST00000396554.3	hg19	CCDS7802.1																																																																																			.	.		0.592	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480	
EIF4G2	1982	hgsc.bcm.edu	37	11	10824623	10824623	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:10824623T>C	ENST00000526148.1	-	11	1460	c.950A>G	c.(949-951)gAc>gGc	p.D317G	EIF4G2_ENST00000339995.5_Missense_Mutation_p.D317G|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000396525.2_Missense_Mutation_p.D317G|EIF4G2_ENST00000525681.1_Missense_Mutation_p.D317G|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525995.1_5'Flank	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TGGTCCATTGTCAAGAAAAGC	0.348																																					p.D317G		Atlas-SNP	.											.	EIF4G2	89	.	0			c.A950G						.						86.0	82.0	83.0					11																	10824623		2201	4294	6495	SO:0001583	missense	1982	exon11			CCATTGTCAAGAA	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.950A>G	chr11.hg19:g.10824623T>C	ENSP00000433664:p.Asp317Gly	99.0	0.0		125.0	5.0	NM_001172705		Missense_Mutation	SNP	ENST00000526148.1	hg19	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.322942	0.81580	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531416	T;T;T;T;T	0.26660	2.04;2.04;2.04;2.05;1.72	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.43765	0.1262	L	0.59436	1.845	0.50171	D	0.999854	D;D;D	0.62365	0.991;0.985;0.985	P;P;P	0.56751	0.805;0.714;0.643	T	0.48091	-0.9065	9	0.66056	D	0.02	-7.3949	16.6407	0.85098	0.0:0.0:0.0:1.0	.	317;317;390	P78344-2;P78344;B4DZF2	.;IF4G2_HUMAN;.	G	317;317;317;317;390;317	ENSP00000433664:D317G;ENSP00000433371:D317G;ENSP00000340281:D317G;ENSP00000379778:D317G;ENSP00000431583:D317G	ENSP00000340281:D317G	D	-	2	0	EIF4G2	10781199	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.910000	0.87451	2.326000	0.78906	0.533000	0.62120	GAC	.	.		0.348	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
SERGEF	26297	hgsc.bcm.edu	37	11	18026056	18026056	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:18026056A>G	ENST00000265965.5	-	4	530	c.379T>C	c.(379-381)Tcc>Ccc	p.S127P	SERGEF_ENST00000532265.1_Missense_Mutation_p.S13P|RP1-59M18.2_ENST00000525523.1_RNA|SERGEF_ENST00000532212.1_5'UTR|SERGEF_ENST00000528200.1_Missense_Mutation_p.S127P	NM_012139.2	NP_036271.1	Q9UGK8	SRGEF_HUMAN	secretion regulating guanine nucleotide exchange factor	127					negative regulation of protein secretion (GO:0050709)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(5)|lung(5)	12						AAGGAGTTGGATCCACATGAT	0.428																																					p.S127P		Atlas-SNP	.											.	SERGEF	38	.	0			c.T379C						.						97.0	77.0	84.0					11																	18026056		2200	4293	6493	SO:0001583	missense	26297	exon4			AGTTGGATCCACA	AJ243950	CCDS7828.1	11p14.3	2006-03-09			ENSG00000129158	ENSG00000129158			17499	protein-coding gene	gene with protein product		606051				10571079, 12459492	Standard	NM_012139		Approved	DelGEF, Gnefr	uc001mnm.3	Q9UGK8	OTTHUMG00000166420	ENST00000265965.5:c.379T>C	chr11.hg19:g.18026056A>G	ENSP00000265965:p.Ser127Pro	48.0	0.0		62.0	4.0	NM_012139	Q9UGK9	Missense_Mutation	SNP	ENST00000265965.5	hg19	CCDS7828.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.283639	0.80803	.	.	ENSG00000129158	ENST00000265965;ENST00000528200;ENST00000532265;ENST00000529728;ENST00000530613;ENST00000532389	D;D;D;D;D;D	0.85258	-1.5;-1.5;-1.96;-1.96;-1.96;-1.96	5.42	5.42	0.78866	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.94278	0.8162	H	0.96301	3.8	0.48452	D	0.999659	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.966;0.999;0.994;0.996	D	0.94401	0.7623	10	0.34782	T	0.22	-6.2116	13.1018	0.59224	1.0:0.0:0.0:0.0	.	13;13;127;127	B4DFC0;E9PMV6;Q9UGK8-2;Q9UGK8	.;.;.;SRGEF_HUMAN	P	127;127;13;13;13;13	ENSP00000265965:S127P;ENSP00000434188:S127P;ENSP00000431314:S13P;ENSP00000437297:S13P;ENSP00000436080:S13P;ENSP00000435898:S13P	ENSP00000265965:S127P	S	-	1	0	SERGEF	17982632	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	3.999000	0.57031	2.282000	0.76494	0.533000	0.62120	TCC	.	.		0.428	SERGEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389538.1	NM_012139	
FBXO3	26273	hgsc.bcm.edu	37	11	33770421	33770421	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:33770421T>C	ENST00000265651.3	-	9	968	c.950A>G	c.(949-951)gAt>gGt	p.D317G	FBXO3_ENST00000532057.1_Missense_Mutation_p.D4G|FBXO3_ENST00000526785.1_Missense_Mutation_p.D204G|FBXO3_ENST00000530401.1_Missense_Mutation_p.D312G|FBXO3_ENST00000534136.1_Missense_Mutation_p.D317G|FBXO3_ENST00000448981.2_Missense_Mutation_p.D317G|FBXO3_ENST00000531080.1_Missense_Mutation_p.D4G	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	317	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		AGGAAGTGCATCTTTTGACAT	0.423																																					p.D317G		Atlas-SNP	.											.	FBXO3	37	.	0			c.A950G						.						95.0	89.0	91.0					11																	33770421		2202	4298	6500	SO:0001583	missense	26273	exon9			AGTGCATCTTTTG	AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.950A>G	chr11.hg19:g.33770421T>C	ENSP00000265651:p.Asp317Gly	72.0	0.0		88.0	4.0	NM_012175	B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	ENST00000265651.3	hg19	CCDS7887.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.898632	0.52227	.	.	ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000531080;ENST00000532057;ENST00000534136;ENST00000448981	T;T;T;T;T	0.51817	0.69;0.69;0.71;0.7;0.71	5.46	5.46	0.80206	ApaG domain (4);	0.349704	0.34603	N	0.003827	T	0.44329	0.1288	L	0.41356	1.27	0.44956	D	0.997975	P;P;P	0.42296	0.775;0.775;0.704	B;B;B	0.41412	0.356;0.356;0.294	T	0.47799	-0.9089	10	0.66056	D	0.02	-21.3837	15.5183	0.75842	0.0:0.0:0.0:1.0	.	312;317;317	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	G	204;317;312;4;4;317;317	ENSP00000435680:D204G;ENSP00000265651:D317G;ENSP00000433781:D312G;ENSP00000431745:D317G;ENSP00000408836:D317G	ENSP00000265651:D317G	D	-	2	0	FBXO3	33726997	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.681000	0.46926	2.090000	0.63153	0.402000	0.26972	GAT	.	.		0.423	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388665.1	NM_012175	
AMBRA1	55626	hgsc.bcm.edu	37	11	46431903	46431903	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:46431903A>G	ENST00000458649.2	-	16	3550	c.3132T>C	c.(3130-3132)ggT>ggC	p.G1044G	AMBRA1_ENST00000314845.3_Silent_p.G954G|AMBRA1_ENST00000534300.1_Silent_p.G984G|AMBRA1_ENST00000426438.1_Silent_p.G1015G|AMBRA1_ENST00000528950.1_Silent_p.G1015G|AMBRA1_ENST00000298834.3_Silent_p.G984G|AMBRA1_ENST00000533727.1_Silent_p.G925G			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1044					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGTACTCAACACCAGAGTTTA	0.507																																					p.G1047G		Atlas-SNP	.											.	AMBRA1	201	.	0			c.T3141C						.						104.0	92.0	96.0					11																	46431903		2201	4299	6500	SO:0001819	synonymous_variant	55626	exon18			CTCAACACCAGAG	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3132T>C	chr11.hg19:g.46431903A>G		79.0	0.0		96.0	4.0	NM_001267782	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	hg19																																																																																				.	.		0.507	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
SPI1	6688	hgsc.bcm.edu	37	11	47380554	47380554	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:47380554A>G	ENST00000378538.3	-	4	556	c.334T>C	c.(334-336)Tcc>Ccc	p.S112P	SPI1_ENST00000533030.1_Intron|SPI1_ENST00000227163.4_Missense_Mutation_p.S113P|SPI1_ENST00000533968.1_Missense_Mutation_p.S112P	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene	112					anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		GGCAGGTAGGAGACCTGGACG	0.662																																					p.S113P		Atlas-SNP	.											.	SPI1	21	.	0			c.T337C						.						20.0	22.0	21.0					11																	47380554		2197	4288	6485	SO:0001583	missense	6688	exon4			GGTAGGAGACCTG	X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.334T>C	chr11.hg19:g.47380554A>G	ENSP00000367799:p.Ser112Pro	225.0	0.0		306.0	13.0	NM_001080547		Missense_Mutation	SNP	ENST00000378538.3	hg19	CCDS7933.2	.	.	.	.	.	.	.	.	.	.	A	5.171	0.217116	0.09810	.	.	ENSG00000066336	ENST00000378538;ENST00000227163;ENST00000533968	T;T;T	0.32023	1.47;1.47;1.47	4.64	-1.75	0.08031	.	0.299208	0.37809	N	0.001934	T	0.12603	0.0306	N	0.16066	0.365	0.44627	D	0.997603	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.15867	-1.0422	10	0.19147	T	0.46	-10.7714	5.854	0.18710	0.5077:0.0:0.3691:0.1232	.	112;112;113	F5H3K6;P17947;P17947-2	.;SPI1_HUMAN;.	P	112;113;112	ENSP00000367799:S112P;ENSP00000227163:S113P;ENSP00000438846:S112P	ENSP00000227163:S113P	S	-	1	0	SPI1	47337130	0.088000	0.21588	0.993000	0.49108	0.528000	0.34623	-0.341000	0.07811	-0.386000	0.07821	-0.411000	0.06167	TCC	.	.		0.662	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316571.1	NM_003120	
OR4S2	219431	hgsc.bcm.edu	37	11	55418935	55418935	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:55418935G>T	ENST00000312422.2	+	1	556	c.556G>T	c.(556-558)Gcc>Tcc	p.A186S		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				GTTGAAACTTGCCTGCACAGA	0.438																																					p.A186S		Atlas-SNP	.											.	OR4S2	89	.	0			c.G556T						.						265.0	199.0	222.0					11																	55418935		2182	4053	6235	SO:0001583	missense	219431	exon1			AAACTTGCCTGCA	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.556G>T	chr11.hg19:g.55418935G>T	ENSP00000310337:p.Ala186Ser	235.0	0.0		301.0	114.0	NM_001004059	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	hg19	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546866	0.65198	.	.	ENSG00000174982	ENST00000312422	T	0.00021	9.02	5.35	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000063	T	0.00210	0.0006	L	0.39326	1.205	0.31411	N	0.675523	D	0.58620	0.983	P	0.54544	0.755	T	0.63906	-0.6531	10	0.62326	D	0.03	.	12.213	0.54389	0.0:0.0:0.692:0.308	.	186	Q8NH73	OR4S2_HUMAN	S	186	ENSP00000310337:A186S	ENSP00000310337:A186S	A	+	1	0	OR4S2	55175511	0.000000	0.05858	1.000000	0.80357	0.954000	0.61252	-0.531000	0.06171	1.231000	0.43661	0.542000	0.68232	GCC	.	.		0.438	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
OR5M10	390167	hgsc.bcm.edu	37	11	56344846	56344847	+	Missense_Mutation	DNP	TT	TT	AG	rs148438199	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:56344846_56344847TT>AG	ENST00000526812.2	-	1	416_417	c.351_352AA>CT	c.(349-354)tcAAtg>tcCTtg	p.M118L		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TCCAATGCCATTGAAGCAAGGA	0.45																																					p.M118L|p.S117S		Atlas-SNP	.											.,1|.	OR5M10	56	.	0			c.A352T|c.A351C						.																																			SO:0001583	missense	390167	exon1			ATGCCATTGAAGC|TGCCATTGAAGCA	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.351_352delinsAG	chr11.hg19:g.56344846_56344847delinsAG	ENSP00000436004:p.Met118Leu	80.0	0.0		115.0|114.0	13.0|12.0	NM_001004741	B9EIL9	Missense_Mutation|Silent	SNP	ENST00000526812.2	hg19	CCDS53630.1																																																																																			.	.		0.450	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
OR5M10	390167	hgsc.bcm.edu	37	11	56344851	56344851	+	Missense_Mutation	SNP	G	G	C	rs148438199	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:56344851G>C	ENST00000526812.2	-	1	412	c.347C>G	c.(346-348)gCt>gGt	p.A116G		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TGCCATTGAAGCAAGGAAGTA	0.458																																					p.A116G		Atlas-SNP	.											.	OR5M10	56	.	0			c.C347G						.						170.0	146.0	154.0					11																	56344851		1999	4171	6170	SO:0001583	missense	390167	exon1			ATTGAAGCAAGGA	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.347C>G	chr11.hg19:g.56344851G>C	ENSP00000436004:p.Ala116Gly	81.0	0.0		120.0	5.0	NM_001004741	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	hg19	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	G	6.112	0.388856	0.11581	.	.	ENSG00000254834	ENST00000526812	T	0.02032	4.49	4.04	2.12	0.27331	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03783	0.0107	M	0.62266	1.93	0.09310	N	1	B	0.12630	0.006	B	0.17433	0.018	T	0.28713	-1.0035	9	0.62326	D	0.03	.	9.6505	0.39895	0.1688:0.0:0.8312:0.0	.	116	Q6IEU7	OR5MA_HUMAN	G	116	ENSP00000436004:A116G	ENSP00000436004:A116G	A	-	2	0	OR5M10	56101427	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	1.138000	0.31491	0.455000	0.26910	0.632000	0.83419	GCT	.	.		0.458	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57076580	57076580	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:57076580T>C	ENST00000532437.1	-	5	3916	c.3605A>G	c.(3604-3606)gAc>gGc	p.D1202G	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.D1202G			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1202	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CAGGTTCATGTCTCTCAAGCT	0.582																																					p.D1202G		Atlas-SNP	.											.	TNKS1BP1	148	.	0			c.A3605G						.						113.0	124.0	120.0					11																	57076580		2201	4296	6497	SO:0001583	missense	85456	exon6			TTCATGTCTCTCA	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3605A>G	chr11.hg19:g.57076580T>C	ENSP00000437271:p.Asp1202Gly	116.0	0.0		125.0	5.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	hg19	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	T	5.180	0.218776	0.09810	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.32988	1.43;1.43	5.05	2.68	0.31781	.	0.360712	0.23602	N	0.046431	T	0.21427	0.0516	L	0.34521	1.04	0.09310	N	1	B	0.32101	0.356	B	0.33454	0.164	T	0.12604	-1.0541	10	0.44086	T	0.13	-16.7742	7.7382	0.28827	0.0:0.1715:0.0:0.8285	.	1202	Q9C0C2	TB182_HUMAN	G	1202	ENSP00000350990:D1202G;ENSP00000437271:D1202G	ENSP00000350990:D1202G	D	-	2	0	TNKS1BP1	56833156	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.986000	0.29590	0.736000	0.32559	0.379000	0.24179	GAC	.	.		0.582	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
MPEG1	219972	hgsc.bcm.edu	37	11	58979671	58979671	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:58979671G>A	ENST00000361050.3	-	1	753	c.668C>T	c.(667-669)gCc>gTc	p.A223V	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	223	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				GAGGAAGGAGGCCCTGAGGTG	0.557																																					p.A223V		Atlas-SNP	.											.	MPEG1	72	.	0			c.C668T						.						55.0	55.0	55.0					11																	58979671		1959	4125	6084	SO:0001583	missense	219972	exon1			AAGGAGGCCCTGA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.668C>T	chr11.hg19:g.58979671G>A	ENSP00000354335:p.Ala223Val	44.0	0.0		49.0	21.0	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	hg19	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	8.324	0.824912	0.16678	.	.	ENSG00000197629	ENST00000361050	D	0.84370	-1.84	5.21	4.27	0.50696	Membrane attack complex component/perforin (MACPF) domain (3);	1.165770	0.06199	N	0.682903	T	0.78136	0.4236	N	0.14661	0.345	0.09310	N	1	B	0.27910	0.193	B	0.30716	0.119	T	0.65804	-0.6079	10	0.42905	T	0.14	-1.5054	12.5026	0.55964	0.0:0.215:0.785:0.0	.	223	Q2M385	MPEG1_HUMAN	V	223	ENSP00000354335:A223V	ENSP00000354335:A223V	A	-	2	0	MPEG1	58736247	0.837000	0.29446	0.052000	0.19188	0.161000	0.22273	4.656000	0.61483	1.107000	0.41642	0.650000	0.86243	GCC	.	.		0.557	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
FADS3	3995	hgsc.bcm.edu	37	11	61641336	61641336	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:61641336A>G	ENST00000278829.2	-	12	1440	c.1288T>C	c.(1288-1290)Tcc>Ccc	p.S430P	FADS3_ENST00000525588.1_Splice_Site_p.S402P|FADS3_ENST00000527697.1_Splice_Site_p.S315P|FADS3_ENST00000540820.1_3'UTR	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	430					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TTCTTCAGGGACCTGGGAGGT	0.607																																					p.S430P		Atlas-SNP	.											.	FADS3	29	.	0			c.T1288C						.						27.0	25.0	26.0					11																	61641336		2202	4298	6500	SO:0001630	splice_region_variant	3995	exon12			TCAGGGACCTGGG		CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.1287-1T>C	chr11.hg19:g.61641336A>G		132.0	0.0		242.0	10.0	NM_021727	O60426	Missense_Mutation	SNP	ENST00000278829.2	hg19	CCDS8013.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	19.38|19.38	3.817282|3.817282	0.70912|0.70912	.|.	.|.	ENSG00000221968|ENSG00000221968	ENST00000527697;ENST00000278829;ENST00000525588|ENST00000525094	T;T;T|.	0.59083|.	1.88;0.29;0.3|.	4.78|4.78	3.64|3.64	0.41730|0.41730	.|.	.|.	.|.	.|.	.|.	T|T	0.77718|0.77718	0.4172|0.4172	M|M	0.90759|0.90759	3.145|3.145	0.80722|0.80722	D|D	1|1	D;D|.	0.62365|.	0.991;0.975|.	D;P|.	0.65874|.	0.939;0.905|.	T|T	0.78713|0.78713	-0.2097|-0.2097	9|5	0.48119|.	T|.	0.1|.	-10.1189|-10.1189	9.7867|9.7867	0.40681|0.40681	0.8455:0.0:0.0:0.1545|0.8455:0.0:0.0:0.1545	.|.	315;430|.	E9PKP8;Q9Y5Q0|.	.;FADS3_HUMAN|.	P|A	315;430;402|100	ENSP00000431533:S315P;ENSP00000278829:S430P;ENSP00000432206:S402P|.	ENSP00000278829:S430P|.	S|V	-|-	1|2	0|0	FADS3|FADS3	61397912|61397912	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.924000|0.924000	0.55760|0.55760	5.326000|5.326000	0.65875|0.65875	0.669000|0.669000	0.31146|0.31146	0.454000|0.454000	0.30748|0.30748	TCC|GTC	.	.		0.607	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394836.1		Missense_Mutation
SLC22A11	55867	hgsc.bcm.edu	37	11	64326710	64326710	+	Splice_Site	SNP	G	G	A	rs571324325		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:64326710G>A	ENST00000301891.4	+	2	871	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	SLC22A11_ENST00000377581.3_Splice_Site_p.R166Q|SLC22A11_ENST00000377585.3_Splice_Site_p.R166Q|SLC22A11_ENST00000490834.1_Intron	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	166					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	CTCTCCTACCGGTGAGTGCCT	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15989	0.0		0.0	False		,,,				2504	0.0				p.R166Q		Atlas-SNP	.											.	SLC22A11	54	.	0			c.G497A						.						95.0	84.0	87.0					11																	64326710		2201	4297	6498	SO:0001630	splice_region_variant	55867	exon2			CCTACCGGTGAGT	AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.497+1G>A	chr11.hg19:g.64326710G>A		67.0	0.0		98.0	39.0	NM_018484	A8K426|Q53GR2|Q6ZP72|Q8NBU4	Missense_Mutation	SNP	ENST00000301891.4	hg19	CCDS8074.1	.	.	.	.	.	.	.	.	.	.	.	20.6	4.013927	0.75161	.	.	ENSG00000168065	ENST00000301891;ENST00000377585;ENST00000377581	T;T;T	0.68181	-0.31;-0.31;-0.31	3.37	2.43	0.29744	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	U	0.000000	T	0.81103	0.4753	M	0.91090	3.175	0.31483	N	0.666961	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78974	-0.1992	10	0.87932	D	0	.	4.328	0.11050	0.1216:0.0:0.6521:0.2262	.	166;166;166	Q9NSA0-2;A6NCG2;Q9NSA0	.;.;S22AB_HUMAN	Q	166	ENSP00000301891:R166Q;ENSP00000366809:R166Q;ENSP00000366804:R166Q	ENSP00000301891:R166Q	R	+	2	0	SLC22A11	64083286	0.993000	0.37304	0.914000	0.36105	0.153000	0.21895	1.303000	0.33470	0.746000	0.32786	0.485000	0.47835	CGG	.	.		0.587	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104886.4	NM_018484	Missense_Mutation
LTBP3	4054	hgsc.bcm.edu	37	11	65315205	65315205	+	Missense_Mutation	SNP	C	C	G	rs150534522		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:65315205C>G	ENST00000301873.5	-	13	2202	c.1934G>C	c.(1933-1935)cGc>cCc	p.R645P	LTBP3_ENST00000532932.1_Missense_Mutation_p.R75P|LTBP3_ENST00000536982.1_Missense_Mutation_p.R271P|LTBP3_ENST00000322147.4_Missense_Mutation_p.R645P|LTBP3_ENST00000529189.1_5'Flank	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	645	Cys-rich.|EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GCGGTAGCCGCGGTTGCAGTG	0.711																																					p.R645P		Atlas-SNP	.											LTBP3,colon,carcinoma,0,1	LTBP3	55	.	0			c.G1934C						.						9.0	11.0	10.0					11																	65315205		2165	4255	6420	SO:0001583	missense	4054	exon13			TAGCCGCGGTTGC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1934G>C	chr11.hg19:g.65315205C>G	ENSP00000301873:p.Arg645Pro	34.0	0.0		40.0	5.0	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	hg19	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.804536	0.31869	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866	D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94	4.39	4.39	0.52855	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.344897	0.30999	N	0.008453	D	0.84051	0.5387	N	0.01076	-1.035	0.30505	N	0.77	D;B;B;P;B;B	0.67145	0.996;0.013;0.005;0.8;0.004;0.114	P;B;B;B;B;B	0.62491	0.903;0.011;0.003;0.301;0.007;0.135	T	0.79176	-0.1911	10	0.18710	T	0.47	.	9.6673	0.39992	0.2078:0.7922:0.0:0.0	.	556;271;528;645;645;75	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2	.;.;.;LTBP3_HUMAN;.;.	P	645;645;75;271;556	ENSP00000326647:R645P;ENSP00000301873:R645P;ENSP00000435530:R75P;ENSP00000441912:R271P;ENSP00000435276:R556P	ENSP00000301873:R645P	R	-	2	0	LTBP3	65071781	0.006000	0.16342	1.000000	0.80357	0.802000	0.45316	-0.053000	0.11846	2.272000	0.75746	0.313000	0.20887	CGC	.	.		0.711	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
AP5B1	91056	hgsc.bcm.edu	37	11	65547419	65547419	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:65547419A>G	ENST00000532090.2	-	2	755	c.545T>C	c.(544-546)gTc>gCc	p.V182A		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	182	Leu-rich.				endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						GAGTGGCTGGACAGGGCCTTC	0.692																																					p.V182A		Atlas-SNP	.											.	AP5B1	40	.	0			c.T545C						.						9.0	12.0	11.0					11																	65547419		1888	4108	5996	SO:0001583	missense	91056	exon2			GGCTGGACAGGGC	JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.545T>C	chr11.hg19:g.65547419A>G	ENSP00000454303:p.Val182Ala	115.0	0.0		100.0	6.0	NM_138368	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	ENST00000532090.2	hg19	CCDS58146.1																																																																																			.	.		0.692	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390636.2	NM_138368	
ANKRD13D	338692	hgsc.bcm.edu	37	11	67067337	67067337	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:67067337A>G	ENST00000447274.2	+	9	1834	c.659A>G	c.(658-660)cAg>cGg	p.Q220R	ANKRD13D_ENST00000511455.2_Missense_Mutation_p.Q307R|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.Q220R|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.Q220R|ANKRD13D_ENST00000515828.1_5'Flank			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	220						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GGGATGGCGCAGCAGCATTCC	0.687																																					p.Q307R		Atlas-SNP	.											.	ANKRD13D	71	.	0			c.A920G						.						55.0	50.0	51.0					11																	67067337		2200	4295	6495	SO:0001583	missense	338692	exon9			TGGCGCAGCAGCA	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.659A>G	chr11.hg19:g.67067337A>G	ENSP00000402616:p.Gln220Arg	108.0	0.0		100.0	4.0	NM_207354	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	hg19		.	.	.	.	.	.	.	.	.	.	A	20.3	3.966936	0.74131	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.53	4.53	0.55603	.	0.085250	0.47455	D	0.000240	T	0.33411	0.0862	L	0.27053	0.805	0.45676	D	0.998597	P;P	0.47191	0.591;0.891	B;B	0.43082	0.399;0.407	T	0.13255	-1.0516	10	0.44086	T	0.13	-23.3046	13.6837	0.62502	1.0:0.0:0.0:0.0	.	307;220	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	R	220;307;220;220	ENSP00000402616:Q220R;ENSP00000427130:Q307R;ENSP00000310874:Q220R;ENSP00000444404:Q220R	ENSP00000310874:Q220R	Q	+	2	0	ANKRD13D	66823913	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	8.780000	0.91799	1.905000	0.55150	0.260000	0.18958	CAG	.	.		0.687	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73076917	73076917	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:73076917C>A	ENST00000263674.3	+	20	6270	c.5920C>A	c.(5920-5922)Cgc>Agc	p.R1974S		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1974					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CGGCCACGTCCGCTTCTTGGC	0.647																																					p.R1974S		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.C5920A						.						53.0	53.0	53.0					11																	73076917		2200	4293	6493	SO:0001583	missense	9828	exon20			CACGTCCGCTTCT	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5920C>A	chr11.hg19:g.73076917C>A	ENSP00000263674:p.Arg1974Ser	72.0	0.0		90.0	28.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580432	0.86645	.	.	ENSG00000110237	ENST00000263674	T	0.34667	1.35	5.28	5.28	0.74379	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.64356	-0.6427	10	0.62326	D	0.03	-21.8845	18.0725	0.89415	0.0:1.0:0.0:0.0	.	1974	Q96PE2	ARHGH_HUMAN	S	1974	ENSP00000263674:R1974S	ENSP00000263674:R1974S	R	+	1	0	ARHGEF17	72754565	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.172000	0.65003	2.755000	0.94549	0.655000	0.94253	CGC	.	.		0.647	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
FAM168A	23201	hgsc.bcm.edu	37	11	73179515	73179515	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:73179515T>C	ENST00000064778.4	-	2	289	c.5A>G	c.(4-6)aAc>aGc	p.N2S	FAM168A_ENST00000356467.4_Missense_Mutation_p.N2S|FAM168A_ENST00000450446.2_Missense_Mutation_p.N2S			Q92567	F168A_HUMAN	family with sequence similarity 168, member A	2										endometrium(3)|kidney(1)|lung(1)	5						GTAAACAGGGTTCATTGTGGA	0.458																																					p.N2S		Atlas-SNP	.											.	FAM168A	18	.	0			c.A5G						.						96.0	92.0	94.0					11																	73179515		1877	4096	5973	SO:0001583	missense	23201	exon2			ACAGGGTTCATTG	BC014932	CCDS41689.1, CCDS66165.1, CCDS73346.1	11q13.4	2008-06-11	2008-06-11	2008-06-11		ENSG00000054965			28999	protein-coding gene	gene with protein product	"""tongue cancer chemotherapy resistance-associated protein 1"""		"""KIAA0280"""	KIAA0280			Standard	XM_005273852		Approved	TCRP1	uc001oty.1	Q92567		ENST00000064778.4:c.5A>G	chr11.hg19:g.73179515T>C	ENSP00000064778:p.Asn2Ser	69.0	0.0		74.0	4.0	NM_015159	A2ICY2|A2ID81|Q86UG2	Missense_Mutation	SNP	ENST00000064778.4	hg19		.	.	.	.	.	.	.	.	.	.	T	21.9	4.210023	0.79240	.	.	ENSG00000054965	ENST00000064778;ENST00000450446;ENST00000356467	.	.	.	5.4	5.4	0.78164	.	0.090529	0.64402	D	0.000001	T	0.73814	0.3635	M	0.62723	1.935	0.46279	D	0.998968	D;P;P	0.56035	0.974;0.927;0.927	D;D;D	0.70487	0.969;0.953;0.953	T	0.69457	-0.5140	9	0.15066	T	0.55	.	14.9051	0.70711	0.0:0.0:0.0:1.0	.	2;2;2	Q92567-3;Q92567;Q92567-2	.;F168A_HUMAN;.	S	2	.	ENSP00000064778:N2S	N	-	2	0	FAM168A	72857163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.405000	0.73272	2.165000	0.68154	0.460000	0.39030	AAC	.	.		0.458	FAM168A-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000397424.1	NM_015159	
MYO7A	4647	hgsc.bcm.edu	37	11	76858854	76858854	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:76858854T>C	ENST00000409709.3	+	4	415	c.143T>C	c.(142-144)aTc>aCc	p.I48T	MYO7A_ENST00000458637.2_Missense_Mutation_p.I48T|MYO7A_ENST00000409893.1_Missense_Mutation_p.I48T|MYO7A_ENST00000409619.2_Missense_Mutation_p.I37T	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	48					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GAACACTGGATCTCTCCGCAG	0.687																																					p.I48T		Atlas-SNP	.											.	MYO7A	164	.	0			c.T143C						.						34.0	38.0	37.0					11																	76858854		2145	4238	6383	SO:0001583	missense	4647	exon4			ACTGGATCTCTCC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.143T>C	chr11.hg19:g.76858854T>C	ENSP00000386331:p.Ile48Thr	95.0	0.0		147.0	7.0	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.611471	0.87258	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.81536	0.4843	M	0.66378	2.025	0.80722	D	1	P;D;P	0.65815	0.945;0.995;0.893	P;D;P	0.66979	0.65;0.948;0.504	D	0.83844	0.0259	10	0.72032	D	0.01	.	14.6277	0.68635	0.0:0.0:0.0:1.0	.	48;48;48	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	T	48;48;48;37;47;47;47;47	ENSP00000386331:I48T;ENSP00000386689:I48T;ENSP00000392185:I48T;ENSP00000386635:I37T	ENSP00000345075:I47T	I	+	2	0	MYO7A	76536502	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.522000	0.81844	2.041000	0.60428	0.374000	0.22700	ATC	.	.		0.687	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
CADM1	23705	hgsc.bcm.edu	37	11	115049371	115049371	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:115049371T>C	ENST00000452722.3	-	9	1223	c.1203A>G	c.(1201-1203)agA>agG	p.R401R	CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000536727.1_Silent_p.R402R|CADM1_ENST00000542447.2_Silent_p.R373R|CADM1_ENST00000331581.6_Silent_p.R430R|CADM1_ENST00000537058.1_Silent_p.R412R	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TACCTTTATGTCTGGCAAAAT	0.527																																					p.R401R		Atlas-SNP	.											.	CADM1	74	.	0			c.A1203G						.						174.0	165.0	168.0					11																	115049371		2201	4296	6497	SO:0001819	synonymous_variant	23705	exon9			TTTATGTCTGGCA	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1203A>G	chr11.hg19:g.115049371T>C		45.0	0.0		54.0	4.0	NM_014333		Silent	SNP	ENST00000452722.3	hg19	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	T	5.760	0.324542	0.10900	.	.	ENSG00000182985	ENST00000545380	.	.	.	5.0	3.87	0.44632	.	.	.	.	.	T	0.61160	0.2325	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57888	-0.7733	4	.	.	.	.	10.4248	0.44371	0.0:0.0763:0.0:0.9237	.	.	.	.	A	372	.	.	T	-	1	0	CADM1	114554581	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.823000	0.55715	0.950000	0.37743	0.533000	0.62120	ACA	.	.		0.527	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CEP164	22897	hgsc.bcm.edu	37	11	117222640	117222640	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:117222640A>C	ENST00000278935.3	+	5	476	c.329A>C	c.(328-330)aAg>aCg	p.K110T		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	110	Interaction with ATRIP.|Lys-rich.			K -> N (in Ref. 5; AAH54015). {ECO:0000305}.	cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GGGGCCATTaagaagaagaaa	0.512																																					p.K110T		Atlas-SNP	.											.	CEP164	121	.	0			c.A329C						.						47.0	47.0	47.0					11																	117222640		2201	4296	6497	SO:0001583	missense	22897	exon4			CCATTAAGAAGAA	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.329A>C	chr11.hg19:g.117222640A>C	ENSP00000278935:p.Lys110Thr	57.0	0.0		87.0	6.0	NM_001271933	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	hg19	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.111278	0.37242	.	.	ENSG00000110274	ENST00000525734;ENST00000533153;ENST00000278935;ENST00000525416;ENST00000545330;ENST00000527609;ENST00000533570;ENST00000529538	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.95	5.95	0.96441	.	0.625053	0.15094	N	0.280936	T	0.73426	0.3585	L	0.60455	1.87	0.30319	N	0.787799	D;B;P;D	0.69078	0.997;0.264;0.873;0.996	D;B;P;D	0.66847	0.921;0.049;0.544;0.947	T	0.72093	-0.4394	10	0.52906	T	0.07	-16.947	10.3413	0.43879	0.9238:0.0:0.0762:0.0	.	110;64;110;110	E9PI34;B7Z884;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	T	110;64;110;64;64;110;110;110	ENSP00000436609:K110T;ENSP00000436034:K64T;ENSP00000278935:K110T;ENSP00000435759:K64T;ENSP00000436351:K110T;ENSP00000431302:K110T	ENSP00000278935:K110T	K	+	2	0	CEP164	116727850	1.000000	0.71417	0.997000	0.53966	0.353000	0.29299	5.568000	0.67385	2.279000	0.76181	0.533000	0.62120	AAG	.	.		0.512	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
KMT2A	4297	hgsc.bcm.edu	37	11	118368716	118368716	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:118368716A>G	ENST00000389506.5	+	21	5721	c.5721A>G	c.(5719-5721)tcA>tcG	p.S1907S	KMT2A_ENST00000354520.4_Silent_p.S1869S|KMT2A_ENST00000534358.1_Silent_p.S1910S			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1907					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CTTTGTGGTCAGCGGAAGTGT	0.378																																					p.S1910S		Atlas-SNP	.											.	MLL	548	.	0			c.A5730G						.						162.0	151.0	155.0					11																	118368716		2200	4296	6496	SO:0001819	synonymous_variant	4297	exon21			GTGGTCAGCGGAA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5721A>G	chr11.hg19:g.118368716A>G		93.0	0.0		95.0	4.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	ENST00000389506.5	hg19	CCDS31686.1																																																																																			.	.		0.378	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
CXCR5	643	hgsc.bcm.edu	37	11	118764607	118764607	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:118764607G>A	ENST00000292174.4	+	2	530	c.354G>A	c.(352-354)ggG>ggA	p.G118G	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	118					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		GGGTCCTGGGGACCTTCCTCT	0.622																																					p.G118G		Atlas-SNP	.											.	CXCR5	34	.	0			c.G354A						.						81.0	72.0	75.0					11																	118764607		2200	4295	6495	SO:0001819	synonymous_variant	643	exon2			CCTGGGGACCTTC	X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.354G>A	chr11.hg19:g.118764607G>A		173.0	0.0		177.0	42.0	NM_001716	Q14811	Silent	SNP	ENST00000292174.4	hg19	CCDS8402.1																																																																																			.	.		0.622	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389309.1	NM_001716	
BCL9L	283149	hgsc.bcm.edu	37	11	118769314	118769314	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:118769314T>C	ENST00000334801.3	-	8	5274	c.4310A>G	c.(4309-4311)aAg>aGg	p.K1437R	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1437					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GCCCCGCTGCTTCATCAGCAT	0.682																																					p.K1437R		Atlas-SNP	.											.	BCL9L	254	.	0			c.A4310G						.						20.0	20.0	20.0					11																	118769314		2191	4280	6471	SO:0001583	missense	283149	exon8			CGCTGCTTCATCA	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.4310A>G	chr11.hg19:g.118769314T>C	ENSP00000335320:p.Lys1437Arg	159.0	0.0		113.0	5.0	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	hg19	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.124169	0.77436	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000431085	T	0.70282	-0.47	4.23	4.23	0.50019	.	0.163061	0.28635	N	0.014659	T	0.79246	0.4413	L	0.52573	1.65	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.986	T	0.80379	-0.1407	10	0.54805	T	0.06	-22.3707	13.6054	0.62044	0.0:0.0:0.0:1.0	.	1432;1437	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	R	1437;1400;683;1392	ENSP00000335320:K1437R	ENSP00000335320:K1437R	K	-	2	0	BCL9L	118274524	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.213000	0.77950	1.671000	0.50874	0.254000	0.18369	AAG	.	.		0.682	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
ABCG4	64137	hgsc.bcm.edu	37	11	119030961	119030961	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:119030961A>G	ENST00000449422.2	+	13	1650	c.1462A>G	c.(1462-1464)Agc>Ggc	p.S488G	ABCG4_ENST00000531739.1_Missense_Mutation_p.S488G|ABCG4_ENST00000307417.3_Missense_Mutation_p.S488G	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	488	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGTCTACTGCAGCATTGTGTA	0.647																																					p.S488G		Atlas-SNP	.											.	ABCG4	77	.	0			c.A1462G						.						91.0	81.0	84.0					11																	119030961		2200	4295	6495	SO:0001583	missense	64137	exon13			TACTGCAGCATTG	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1462A>G	chr11.hg19:g.119030961A>G	ENSP00000406874:p.Ser488Gly	108.0	0.0		141.0	6.0	NM_022169	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	hg19	CCDS8415.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.383268	0.82792	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.72051	-0.62;-0.62;-0.62	5.2	5.2	0.72013	ABC-2 type transporter (1);	0.110385	0.85682	D	0.000000	T	0.73606	0.3608	M	0.67700	2.07	0.58432	D	0.999999	P	0.42010	0.768	P	0.45167	0.472	T	0.75442	-0.3316	10	0.45353	T	0.12	-27.4158	15.2835	0.73810	1.0:0.0:0.0:0.0	.	488	Q9H172	ABCG4_HUMAN	G	488	ENSP00000304111:S488G;ENSP00000406874:S488G;ENSP00000434318:S488G	ENSP00000304111:S488G	S	+	1	0	ABCG4	118536171	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.358000	0.79466	2.196000	0.70406	0.456000	0.33151	AGC	.	.		0.647	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
SORL1	6653	hgsc.bcm.edu	37	11	121420770	121420770	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:121420770T>C	ENST00000260197.7	+	15	2282	c.2153T>C	c.(2152-2154)gTg>gCg	p.V718A		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	718					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CCTTGCCCTGTGGGTTCTACT	0.502																																					p.V718A		Atlas-SNP	.											.	SORL1	218	.	0			c.T2153C						.						114.0	106.0	109.0					11																	121420770		2203	4299	6502	SO:0001583	missense	6653	exon15			GCCCTGTGGGTTC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2153T>C	chr11.hg19:g.121420770T>C	ENSP00000260197:p.Val718Ala	54.0	0.0		92.0	5.0	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	hg19	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	T	9.968	1.224614	0.22457	.	.	ENSG00000137642	ENST00000260197	D	0.90844	-2.74	5.38	3.03	0.35002	VPS10 (1);	0.262628	0.36740	N	0.002423	T	0.79441	0.4446	N	0.21097	0.63	0.80722	D	1	B	0.14805	0.011	B	0.12837	0.008	T	0.64943	-0.6288	10	0.07175	T	0.84	.	7.3355	0.26607	0.1289:0.0705:0.0:0.8006	.	718	Q92673	SORL_HUMAN	A	718	ENSP00000260197:V718A	ENSP00000260197:V718A	V	+	2	0	SORL1	120925980	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.837000	0.55820	0.338000	0.23692	0.533000	0.62120	GTG	.	.		0.502	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128932247	128932247	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:128932247T>C	ENST00000310343.9	-	9	848	c.849A>G	c.(847-849)ggA>ggG	p.G283G	ARHGAP32_ENST00000524655.1_Silent_p.G209G	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	283	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						AAACAATGTCTCCCACCTAGG	0.383																																					p.G283G		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.A849G						.						99.0	89.0	92.0					11																	128932247		1566	3579	5145	SO:0001819	synonymous_variant	9743	exon9			AATGTCTCCCACC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.849A>G	chr11.hg19:g.128932247T>C		43.0	0.0		47.0	4.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	hg19	CCDS44769.1																																																																																			.	.		0.383	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
SLC6A13	6540	hgsc.bcm.edu	37	12	333670	333670	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:333670A>G	ENST00000343164.4	-	10	1122	c.1070T>C	c.(1069-1071)cTg>cCg	p.L357P	SLC6A13_ENST00000539668.1_5'Flank|SLC6A13_ENST00000445055.2_Missense_Mutation_p.L265P	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	357					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GATGAAAGCCAGGCCAGGGCC	0.627																																					p.L357P		Atlas-SNP	.											.	SLC6A13	62	.	0			c.T1070C						.						88.0	77.0	81.0					12																	333670		2203	4298	6501	SO:0001583	missense	6540	exon10			AAAGCCAGGCCAG	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1070T>C	chr12.hg19:g.333670A>G	ENSP00000339260:p.Leu357Pro	152.0	0.0		176.0	63.0	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	hg19	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118608	0.77323	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	D;D	0.84873	-1.91;-1.91	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	H	0.99806	4.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.98476	1.0603	10	0.87932	D	0	.	15.8025	0.78463	1.0:0.0:0.0:0.0	.	265;336;357	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	P	265;336;357	ENSP00000407104:L265P;ENSP00000339260:L357P	ENSP00000318097:L336P	L	-	2	0	SLC6A13	203931	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	9.339000	0.96797	2.138000	0.66242	0.368000	0.22195	CTG	.	.		0.627	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
CD163L1	283316	hgsc.bcm.edu	37	12	7510070	7510070	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:7510070T>A	ENST00000313599.3	-	19	4349	c.4292A>T	c.(4291-4293)aAc>aTc	p.N1431I	CD163L1_ENST00000416109.2_Missense_Mutation_p.N1441I|CD163L1_ENST00000396630.1_Missense_Mutation_p.N1399I			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1431						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ACAACCATGGTTGGGGGTGTC	0.458																																					p.N1431I		Atlas-SNP	.											.	CD163L1	238	.	0			c.A4292T						.						79.0	79.0	79.0					12																	7510070		2203	4300	6503	SO:0001583	missense	283316	exon19			CCATGGTTGGGGG	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.4292A>T	chr12.hg19:g.7510070T>A	ENSP00000315945:p.Asn1431Ile	52.0	0.0		74.0	24.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	hg19	CCDS8577.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0|0	-2.765064|-2.765064	0.00082|0.00082	.|.	.|.	ENSG00000177675|ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630|ENST00000539726	T;T;T|.	0.01963|.	5.0;5.0;4.53|.	1.07|1.07	-2.14|-2.14	0.07123|0.07123	.|.	.|.	.|.	.|.	.|.	T|T	0.13030|0.13030	0.0316|0.0316	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.25169|.	0.119;0.036|.	B;B|.	0.23018|.	0.029;0.043|.	T|T	0.07009|0.07009	-1.0795|-1.0795	9|5	0.36615|.	T|.	0.2|.	.|.	0.8518|0.8518	0.01174|0.01174	0.2098:0.163:0.1491:0.4781|0.2098:0.163:0.1491:0.4781	.|.	1441;1431|.	E7EVK4;Q9NR16|.	.;C163B_HUMAN|.	I|H	1431;1441;1399|86	ENSP00000315945:N1431I;ENSP00000393474:N1441I;ENSP00000379871:N1399I|.	ENSP00000315945:N1431I|.	N|Q	-|-	2|3	0|2	CD163L1|CD163L1	7401337|7401337	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.776000|-2.776000	0.00776|0.00776	-3.939000|-3.939000	0.00089|0.00089	-3.420000|-3.420000	0.00038|0.00038	AAC|CAA	.	.		0.458	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
PLCZ1	89869	hgsc.bcm.edu	37	12	18841123	18841123	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:18841123A>G	ENST00000538330.1	-	9	1218	c.837T>C	c.(835-837)acT>acC	p.T279T	PLCZ1_ENST00000266505.7_Silent_p.T497T|PLCZ1_ENST00000435379.1_Silent_p.T302T|PLCZ1_ENST00000447925.2_Silent_p.T495T|PLCZ1_ENST00000534932.1_5'UTR|PLCZ1_ENST00000539875.1_Silent_p.T304T|PLCZ1_ENST00000541695.1_Silent_p.T360T					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					ATGATGAATGAGTAAGAGGCA	0.294																																					p.T497T		Atlas-SNP	.											PLCZ1,lower_third,carcinoma,0,1	PLCZ1	107	.	0			c.T1491C						.						93.0	102.0	99.0					12																	18841123		2203	4298	6501	SO:0001819	synonymous_variant	89869	exon13			TGAATGAGTAAGA	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.837T>C	chr12.hg19:g.18841123A>G		29.0	0.0		44.0	2.0	NM_033123		Silent	SNP	ENST00000538330.1	hg19		.	.	.	.	.	.	.	.	.	.	A	0.757	-0.770799	0.02974	.	.	ENSG00000139151	ENST00000536023	.	.	.	4.43	-0.12	0.13539	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30534	-0.9975	4	.	.	.	.	9.098	0.36651	0.429:0.0:0.571:0.0	.	.	.	.	P	67	.	.	S	-	1	0	PLCZ1	18732390	0.000000	0.05858	0.000000	0.03702	0.378000	0.30076	0.358000	0.20216	-0.099000	0.12263	0.260000	0.18958	TCA	.	.		0.294	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19436349	19436349	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:19436349T>C	ENST00000299275.6	+	11	1437	c.1431T>C	c.(1429-1431)ccT>ccC	p.P477P	PLEKHA5_ENST00000359180.3_Silent_p.P477P|PLEKHA5_ENST00000424268.1_Silent_p.P369P|PLEKHA5_ENST00000543806.1_Silent_p.P369P|PLEKHA5_ENST00000309364.4_Silent_p.P477P|PLEKHA5_ENST00000538714.1_Silent_p.P477P|PLEKHA5_ENST00000429027.2_Silent_p.P483P|PLEKHA5_ENST00000317589.4_Silent_p.P477P|PLEKHA5_ENST00000355397.3_Silent_p.P477P|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000539256.1_Silent_p.P235P	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	477					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GTGTAACCCCTTCCACTCATG	0.517																																					p.P483P	Pancreas(196;329 2193 11246 14234 19524)	Atlas-SNP	.											.	PLEKHA5	198	.	0			c.T1449C						.						85.0	79.0	81.0					12																	19436349		2203	4300	6503	SO:0001819	synonymous_variant	54477	exon12			AACCCCTTCCACT	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1431T>C	chr12.hg19:g.19436349T>C		85.0	0.0		92.0	5.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	ENST00000299275.6	hg19	CCDS8682.1																																																																																			.	.		0.517	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
ARNTL2	56938	hgsc.bcm.edu	37	12	27573461	27573461	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:27573461T>C	ENST00000266503.5	+	17	1925	c.1907T>C	c.(1906-1908)cTc>cCc	p.L636P	ARNTL2_ENST00000395901.2_Missense_Mutation_p.L599P|ARNTL2_ENST00000544915.1_Missense_Mutation_p.L602P|ARNTL2_ENST00000546179.1_3'UTR|RP11-165P7.1_ENST00000500498.2_RNA|ARNTL2_ENST00000261178.5_Missense_Mutation_p.L588P|ARNTL2_ENST00000311001.5_Missense_Mutation_p.L622P|ARNTL2_ENST00000542388.1_Missense_Mutation_p.L551P			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	636					circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					CAGTGGACCCTCTAGCCTTTG	0.398																																					p.L636P		Atlas-SNP	.											.	ARNTL2	54	.	0			c.T1907C						.						67.0	72.0	70.0					12																	27573461		2203	4300	6503	SO:0001583	missense	56938	exon17			GGACCCTCTAGCC	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.1907T>C	chr12.hg19:g.27573461T>C	ENSP00000266503:p.Leu636Pro	74.0	0.0		67.0	5.0	NM_020183	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	ENST00000266503.5	hg19	CCDS8712.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	16.51|16.51	3.144285|3.144285	0.57044|0.57044	.|.	.|.	ENSG00000029153|ENSG00000029153	ENST00000544915;ENST00000395901;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388|ENST00000457040	T;T;T;T;T;T|.	0.20332|.	2.22;2.21;2.08;2.24;2.08;2.3|.	3.63|3.63	3.63|3.63	0.41609|0.41609	.|.	0.092201|.	0.41823|.	D|.	0.000819|.	T|T	0.72495|0.72495	0.3467|0.3467	M|M	0.79258|0.79258	2.445|2.445	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;0.996;1.0|.	T|T	0.73898|0.73898	-0.3837|-0.3837	10|5	0.87932|.	D|.	0|.	.|.	11.2885|11.2885	0.49237|0.49237	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	602;599;588;622;636|.	Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1|.	.;.;.;.;BMAL2_HUMAN|.	P|P	602;599;622;588;636;551|588	ENSP00000442438:L602P;ENSP00000379238:L599P;ENSP00000312247:L622P;ENSP00000261178:L588P;ENSP00000266503:L636P;ENSP00000445836:L551P|.	ENSP00000261178:L588P|.	L|S	+|+	2|1	0|0	ARNTL2|ARNTL2	27464728|27464728	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.882000|0.882000	0.50991|0.50991	2.907000|2.907000	0.48743|0.48743	1.648000|1.648000	0.50643|0.50643	0.460000|0.460000	0.39030|0.39030	CTC|TCT	.	.		0.398	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183	
KIAA1551	55196	hgsc.bcm.edu	37	12	32136525	32136525	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:32136525C>T	ENST00000312561.4	+	4	3050	c.2636C>T	c.(2635-2637)tCa>tTa	p.S879L	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	879																	TCACAGGAGTCAAGGAATAGT	0.368																																					p.S879L		Atlas-SNP	.											.	.	.	.	0			c.C2636T						.						113.0	104.0	107.0					12																	32136525		2203	4300	6503	SO:0001583	missense	55196	exon4			AGGAGTCAAGGAA	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2636C>T	chr12.hg19:g.32136525C>T	ENSP00000310338:p.Ser879Leu	137.0	0.0		170.0	47.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	hg19	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	C	15.50	2.853414	0.51270	.	.	ENSG00000174718	ENST00000312561	T	0.13420	2.59	5.26	3.11	0.35812	.	1.228570	0.05849	N	0.620894	T	0.13756	0.0333	L	0.48362	1.52	0.09310	N	1	B	0.28713	0.22	B	0.25614	0.062	T	0.29212	-1.0019	9	.	.	.	.	7.5112	0.27575	0.0:0.7065:0.1722:0.1213	.	879	Q9HCM1	CL035_HUMAN	L	879	ENSP00000310338:S879L	.	S	+	2	0	C12orf35	32027792	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	1.297000	0.33400	1.175000	0.42826	0.655000	0.94253	TCA	.	.		0.368	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
SLC38A1	81539	hgsc.bcm.edu	37	12	46598344	46598344	+	Silent	SNP	A	A	G	rs148843987		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:46598344A>G	ENST00000398637.5	-	10	1370	c.676T>C	c.(676-678)Ttg>Ctg	p.L226L	SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000546893.1_Silent_p.L226L|SLC38A1_ENST00000439706.1_Silent_p.L226L|SLC38A1_ENST00000549049.1_Silent_p.L226L|SLC38A1_ENST00000552197.1_Silent_p.L226L	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	226					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)	p.L226L(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			ATACAGCTCAAGGAAAATCCA	0.299																																					p.L226L		Atlas-SNP	.											SLC38A1,hand,malignant_melanoma,0,1	SLC38A1	58	.	1	Substitution - coding silent(1)	skin(1)	c.T676C						.						163.0	154.0	157.0					12																	46598344		1819	4073	5892	SO:0001819	synonymous_variant	81539	exon10			AGCTCAAGGAAAA	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.676T>C	chr12.hg19:g.46598344A>G		53.0	0.0		58.0	3.0	NM_030674	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Silent	SNP	ENST00000398637.5	hg19	CCDS41774.1																																																																																			.	.		0.299	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
DDN	23109	hgsc.bcm.edu	37	12	49391026	49391026	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:49391026T>C	ENST00000421952.2	-	2	1654	c.1633A>G	c.(1633-1635)Act>Gct	p.T545A	RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	545	Interaction with CD2AP and NPHS1. {ECO:0000250}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						ATGCGGAAAGTGCGCTCCTCC	0.697																																					p.T545A		Atlas-SNP	.											.	DDN	54	.	0			c.A1633G						.						15.0	18.0	17.0					12																	49391026		2179	4252	6431	SO:0001583	missense	23109	exon2			GGAAAGTGCGCTC	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.1633A>G	chr12.hg19:g.49391026T>C	ENSP00000390590:p.Thr545Ala	68.0	0.0		49.0	4.0	NM_015086		Missense_Mutation	SNP	ENST00000421952.2	hg19	CCDS31791.2	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.820079	0.00595	.	.	ENSG00000181418	ENST00000421952	T	0.35789	1.29	3.77	0.45	0.16624	.	0.358287	0.20559	N	0.089941	T	0.09730	0.0239	N	0.02916	-0.46	0.23693	N	0.997094	B	0.02656	0.0	B	0.01281	0.0	T	0.28996	-1.0026	10	0.02654	T	1	-0.2369	2.6788	0.05087	0.2864:0.3595:0.0:0.354	.	545	O94850	DEND_HUMAN	A	545	ENSP00000390590:T545A	ENSP00000390590:T545A	T	-	1	0	DDN	47677293	0.652000	0.27349	0.998000	0.56505	0.082000	0.17680	-0.220000	0.09215	0.071000	0.16664	-0.366000	0.07423	ACT	.	.		0.697	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
NCKAP5L	57701	hgsc.bcm.edu	37	12	50189186	50189186	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:50189186A>G	ENST00000335999.6	-	8	2658	c.2457T>C	c.(2455-2457)ccT>ccC	p.P819P		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	815	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GTGACTTGGAAGGGAGCTTGG	0.637																																					p.P819P		Atlas-SNP	.											.	NCKAP5L	142	.	0			c.T2457C						.						71.0	75.0	74.0					12																	50189186		1956	4129	6085	SO:0001819	synonymous_variant	57701	exon8			CTTGGAAGGGAGC	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.2457T>C	chr12.hg19:g.50189186A>G		43.0	0.0		65.0	5.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Silent	SNP	ENST00000335999.6	hg19	CCDS41781.2	.	.	.	.	.	.	.	.	.	.	A	7.397	0.632023	0.14322	.	.	ENSG00000167566	ENST00000433948	.	.	.	5.0	-5.43	0.02632	.	.	.	.	.	T	0.34571	0.0902	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40040	-0.9584	4	.	.	.	-8.5755	0.3128	0.00290	0.3303:0.2175:0.2375:0.2146	.	.	.	.	L	534	.	.	F	-	1	0	NCKAP5L	48475453	0.966000	0.33281	0.864000	0.33941	0.979000	0.70002	0.063000	0.14410	-0.871000	0.04042	0.459000	0.35465	TTC	.	.		0.637	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
CSRNP2	81566	hgsc.bcm.edu	37	12	51457625	51457625	+	Silent	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:51457625C>A	ENST00000228515.1	-	5	1833	c.1536G>T	c.(1534-1536)acG>acT	p.T512T		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	512					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						CTTCATTGTCCGTGCGGAAGG	0.557																																					p.T512T		Atlas-SNP	.											.	CSRNP2	47	.	0			c.G1536T						.						65.0	67.0	67.0					12																	51457625		2203	4300	6503	SO:0001819	synonymous_variant	81566	exon5			ATTGTCCGTGCGG	AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1536G>T	chr12.hg19:g.51457625C>A		154.0	0.0		152.0	71.0	NM_030809		Silent	SNP	ENST00000228515.1	hg19	CCDS8807.1																																																																																			.	.		0.557	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1		
CSRNP2	81566	hgsc.bcm.edu	37	12	51457641	51457641	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:51457641C>A	ENST00000228515.1	-	5	1817	c.1520G>T	c.(1519-1521)aGc>aTc	p.S507I		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	507					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						GAAGGGGAGGCTTGAGGGGGA	0.552																																					p.S507I		Atlas-SNP	.											.	CSRNP2	47	.	0			c.G1520T						.						76.0	80.0	79.0					12																	51457641		2203	4300	6503	SO:0001583	missense	81566	exon5			GGGAGGCTTGAGG	AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1520G>T	chr12.hg19:g.51457641C>A	ENSP00000228515:p.Ser507Ile	166.0	0.0		169.0	76.0	NM_030809		Missense_Mutation	SNP	ENST00000228515.1	hg19	CCDS8807.1	.	.	.	.	.	.	.	.	.	.	C	2.280	-0.365020	0.05103	.	.	ENSG00000110925	ENST00000228515	T	0.44881	0.91	4.7	-5.93	0.02254	.	0.731516	0.13256	N	0.401675	T	0.25568	0.0622	N	0.19112	0.55	0.09310	N	0.999992	B	0.24963	0.115	B	0.32624	0.149	T	0.31998	-0.9923	10	0.59425	D	0.04	-0.9344	9.8188	0.40869	0.0:0.1756:0.117:0.7074	.	507	Q9H175	CSRN2_HUMAN	I	507	ENSP00000228515:S507I	ENSP00000228515:S507I	S	-	2	0	CSRNP2	49743908	0.028000	0.19301	0.029000	0.17559	0.059000	0.15707	-2.027000	0.01433	-1.102000	0.03023	-0.474000	0.04947	AGC	.	.		0.552	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1		
CELA1	1990	hgsc.bcm.edu	37	12	51723604	51723604	+	Missense_Mutation	SNP	C	C	G	rs201129231		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:51723604C>G	ENST00000293636.1	-	7	663	c.623G>C	c.(622-624)gGc>gCc	p.G208A		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	208	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ATGGAGGGGGCCCCCAGAGTC	0.552																																					p.G208A		Atlas-SNP	.											.	CELA1	39	.	0			c.G623C						.						59.0	61.0	60.0					12																	51723604		2203	4300	6503	SO:0001583	missense	1990	exon7			AGGGGGCCCCCAG		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.623G>C	chr12.hg19:g.51723604C>G	ENSP00000293636:p.Gly208Ala	46.0	0.0		35.0	4.0	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	hg19	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699931	0.48307	.	.	ENSG00000139610	ENST00000293636	D	0.96300	-3.97	5.37	4.46	0.54185	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.97949	0.9325	M	0.83483	2.645	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.98693	1.0697	10	0.87932	D	0	-20.8256	14.5125	0.67797	0.1481:0.8519:0.0:0.0	rs60311818	208	Q9UNI1	CELA1_HUMAN	A	208	ENSP00000293636:G208A	ENSP00000293636:G208A	G	-	2	0	CELA1	50009871	1.000000	0.71417	0.033000	0.17914	0.084000	0.17831	7.543000	0.82106	1.357000	0.45904	0.484000	0.47621	GGC	.	C|0.999;G|0.001		0.552	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
BAZ2A	11176	hgsc.bcm.edu	37	12	56995380	56995380	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:56995380A>G	ENST00000551812.1	-	20	4220	c.4027T>C	c.(4027-4029)Tct>Cct	p.S1343P	BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000179765.5_Missense_Mutation_p.S1311P|BAZ2A_ENST00000549884.1_Missense_Mutation_p.S1341P|BAZ2A_ENST00000379441.3_Missense_Mutation_p.S1313P	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1343	Pro-rich.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TGGTCCTCAGAAACTGCAGGG	0.557																																					p.S1343P		Atlas-SNP	.											.	BAZ2A	263	.	0			c.T4027C						.						39.0	46.0	44.0					12																	56995380		2022	4169	6191	SO:0001583	missense	11176	exon20			CCTCAGAAACTGC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.4027T>C	chr12.hg19:g.56995380A>G	ENSP00000446880:p.Ser1343Pro	67.0	0.0		88.0	5.0	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	hg19	CCDS44924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.86|15.86	2.957999|2.957999	0.53400|0.53400	.|.	.|.	ENSG00000076108|ENSG00000076108	ENST00000547453|ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	.|T;T;T;T;T	.|0.71698	.|-0.3;-0.29;-0.3;-0.59;-0.3	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.265653	.|0.32081	.|N	.|0.006602	T|T	0.75474|0.75474	0.3854|0.3854	L|L	0.43152|0.43152	1.355|1.355	0.35549|0.35549	D|D	0.803695|0.803695	.|B;D;B;B	.|0.57899	.|0.089;0.981;0.158;0.022	.|B;P;B;B	.|0.61592	.|0.035;0.891;0.045;0.02	T|T	0.81230|0.81230	-0.1027|-0.1027	5|10	.|0.48119	.|T	.|0.1	.|.	11.9893|11.9893	0.53166|0.53166	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1341;1343;1343;1316	.|F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.|.;.;BAZ2A_HUMAN;.	S|P	11|1313;1311;1343;279;1341	.|ENSP00000368754:S1313P;ENSP00000179765:S1311P;ENSP00000446880:S1343P;ENSP00000448760:S279P;ENSP00000447941:S1341P	.|ENSP00000179765:S1311P	F|S	-|-	2|1	0|0	BAZ2A|BAZ2A	55281647|55281647	0.916000|0.916000	0.31088|0.31088	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.877000|1.877000	0.39598|0.39598	2.155000|2.155000	0.67459|0.67459	0.533000|0.533000	0.62120|0.62120	TTC|TCT	.	.		0.557	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
LRP1	4035	hgsc.bcm.edu	37	12	57569808	57569808	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:57569808T>C	ENST00000243077.3	+	24	4376	c.3910T>C	c.(3910-3912)Ttc>Ctc	p.F1304L		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1304					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CGCCCTGGACTTCCACCTCAG	0.602											OREG0021937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F1304L		Atlas-SNP	.											.	LRP1	428	.	0			c.T3910C						.						146.0	113.0	124.0					12																	57569808		2203	4300	6503	SO:0001583	missense	4035	exon24			CTGGACTTCCACC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3910T>C	chr12.hg19:g.57569808T>C	ENSP00000243077:p.Phe1304Leu	106.0	0.0	1024	117.0	7.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.418626	0.83559	.	.	ENSG00000123384	ENST00000243077	D	0.91996	-2.95	4.9	4.9	0.64082	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.95762	0.8621	M	0.84511	2.7	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	D	0.95846	0.8870	10	0.52906	T	0.07	.	13.6488	0.62299	0.0:0.0:0.0:1.0	.	1304	Q07954	LRP1_HUMAN	L	1304	ENSP00000243077:F1304L	ENSP00000243077:F1304L	F	+	1	0	LRP1	55856075	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.868000	0.87116	2.063000	0.61619	0.533000	0.62120	TTC	.	.		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
KIF5A	3798	hgsc.bcm.edu	37	12	57966045	57966045	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:57966045A>G	ENST00000455537.2	+	14	1838	c.1564A>G	c.(1564-1566)Aag>Gag	p.K522E	KIF5A_ENST00000286452.5_Missense_Mutation_p.K433E	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	522					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GCTGTCTCAGAAGGTGGTAAG	0.577																																					p.K522E		Atlas-SNP	.											.	KIF5A	143	.	0			c.A1564G						.						80.0	77.0	78.0					12																	57966045		2201	4298	6499	SO:0001583	missense	3798	exon14			TCTCAGAAGGTGG	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1564A>G	chr12.hg19:g.57966045A>G	ENSP00000408979:p.Lys522Glu	93.0	0.0		93.0	4.0	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	hg19	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056761	0.76074	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	D;D	0.81996	-1.56;-1.56	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.89949	0.6863	M	0.79805	2.47	0.58432	D	0.999994	D;D	0.63880	0.982;0.993	P;D	0.64687	0.889;0.928	D	0.90751	0.4657	10	0.54805	T	0.06	.	13.4909	0.61395	1.0:0.0:0.0:0.0	.	433;522	B7Z2M7;Q12840	.;KIF5A_HUMAN	E	522;433	ENSP00000408979:K522E;ENSP00000286452:K433E	ENSP00000286452:K433E	K	+	1	0	KIF5A	56252312	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.139000	0.94554	2.102000	0.63906	0.459000	0.35465	AAG	.	.		0.577	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
TBK1	29110	hgsc.bcm.edu	37	12	64889483	64889483	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:64889483G>C	ENST00000331710.5	+	15	1987	c.1648G>C	c.(1648-1650)Gaa>Caa	p.E550Q		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	550					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		AAATAGTGTAGAAAAACTACA	0.289																																					p.E550Q		Atlas-SNP	.											.	TBK1	149	.	0			c.G1648C						.						42.0	43.0	43.0					12																	64889483		2202	4300	6502	SO:0001583	missense	29110	exon15			AGTGTAGAAAAAC	AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.1648G>C	chr12.hg19:g.64889483G>C	ENSP00000329967:p.Glu550Gln	58.0	0.0		109.0	50.0	NM_013254	A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	ENST00000331710.5	hg19	CCDS8968.1	.	.	.	.	.	.	.	.	.	.	G	6.703	0.498447	0.12762	.	.	ENSG00000183735	ENST00000331710	T	0.08807	3.05	4.77	4.77	0.60923	.	0.178480	0.50627	D	0.000115	T	0.19685	0.0473	L	0.32530	0.975	0.58432	D	0.999998	D	0.63880	0.993	D	0.72982	0.979	T	0.02015	-1.1229	9	.	.	.	-15.0624	18.6721	0.91516	0.0:0.0:1.0:0.0	.	550	Q9UHD2	TBK1_HUMAN	Q	550	ENSP00000329967:E550Q	.	E	+	1	0	TBK1	63175750	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.249000	0.89833	2.582000	0.87167	0.655000	0.94253	GAA	.	.		0.289	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401130.1	NM_013254	
CAND1	55832	hgsc.bcm.edu	37	12	67701207	67701207	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:67701207C>T	ENST00000545606.1	+	11	3397	c.2960C>T	c.(2959-2961)aCg>aTg	p.T987M		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	987					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TCAGTGGTTACGGCTGTGAAA	0.363																																					p.T987M		Atlas-SNP	.											.	CAND1	100	.	0			c.C2960T						.						72.0	67.0	69.0					12																	67701207		2203	4298	6501	SO:0001583	missense	55832	exon11			TGGTTACGGCTGT		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2960C>T	chr12.hg19:g.67701207C>T	ENSP00000442318:p.Thr987Met	57.0	0.0		82.0	34.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.2|28.2	4.897587|4.897587	0.91962|0.91962	.|.	.|.	ENSG00000111530|ENSG00000111530	ENST00000540047|ENST00000545606;ENST00000299218;ENST00000544619	.|T;T	.|0.20200	.|2.09;2.09	5.26|5.26	5.26|5.26	0.73747|0.73747	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.55162|0.55162	0.1903|0.1903	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.80764	.|0.994;0.935	T|T	0.62124|0.62124	-0.6920|-0.6920	5|9	.|.	.|.	.|.	-13.9614|-13.9614	19.2139|19.2139	0.93768|0.93768	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|819;987	.|Q86VP6-2;Q86VP6	.|.;CAND1_HUMAN	W|M	401|987;987;527	.|ENSP00000442318:T987M;ENSP00000444089:T527M	.|.	R|T	+|+	1|2	2|0	CAND1|CAND1	65987474|65987474	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	7.719000|7.719000	0.84751|0.84751	2.628000|2.628000	0.89032|0.89032	0.585000|0.585000	0.79938|0.79938	CGG|ACG	.	.		0.363	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
NAV3	89795	hgsc.bcm.edu	37	12	78513703	78513703	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:78513703A>G	ENST00000397909.2	+	15	3900	c.3727A>G	c.(3727-3729)Att>Gtt	p.I1243V	NAV3_ENST00000228327.6_Missense_Mutation_p.I1243V|NAV3_ENST00000266692.7_Missense_Mutation_p.I1243V|NAV3_ENST00000536525.2_Missense_Mutation_p.I1243V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1243	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GTATCCAGATATTGCCTCACC	0.428										HNSCC(70;0.22)																											p.I1243V		Atlas-SNP	.											.	NAV3	506	.	0			c.A3727G						.						53.0	52.0	52.0					12																	78513703		1872	4117	5989	SO:0001583	missense	89795	exon15			CCAGATATTGCCT	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3727A>G	chr12.hg19:g.78513703A>G	ENSP00000381007:p.Ile1243Val	155.0	0.0		200.0	75.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.33|10.33	1.319165|1.319165	0.23994|0.23994	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.26223|.	1.9;1.9;1.88;1.75|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.40554|.	U|.	0.001076|.	T|T	0.49355|0.49355	0.1552|0.1552	N|N	0.16567|0.16567	0.415|0.415	0.80722|0.80722	D|D	1|1	B;D;D;D|.	0.63880|.	0.089;0.993;0.988;0.991|.	B;D;D;D|.	0.74674|.	0.052;0.984;0.968;0.978|.	T|T	0.46386|0.46386	-0.9195|-0.9195	10|5	0.06494|.	T|.	0.89|.	-17.4833|-17.4833	15.2698|15.2698	0.73693|0.73693	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1243;1243;1243;1243|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	V|C	1243|314	ENSP00000446132:I1243V;ENSP00000381007:I1243V;ENSP00000228327:I1243V;ENSP00000266692:I1243V|.	ENSP00000228327:I1243V|.	I|Y	+|+	1|2	0|0	NAV3|NAV3	77037834|77037834	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.936000|0.936000	0.57629|0.57629	9.017000|9.017000	0.93651|0.93651	2.010000|2.010000	0.58986|0.58986	0.533000|0.533000	0.62120|0.62120	ATT|TAT	.	.		0.428	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
CEP290	80184	hgsc.bcm.edu	37	12	88444170	88444170	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:88444170T>C	ENST00000552810.1	-	53	7513	c.7170A>G	c.(7168-7170)acA>acG	p.T2390T	RNA5SP364_ENST00000516938.1_RNA|CEP290_ENST00000309041.7_Silent_p.T2392T|CEP290_ENST00000397838.3_Silent_p.T1450T|CEP290_ENST00000547691.2_Silent_p.T1450T	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	2390					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTTTGAGCTGTGTCTCTAGAT	0.308																																					p.T2390T		Atlas-SNP	.											.	CEP290	195	.	0			c.A7170G						.						105.0	90.0	94.0					12																	88444170		1809	4074	5883	SO:0001819	synonymous_variant	80184	exon53			GAGCTGTGTCTCT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.7170A>G	chr12.hg19:g.88444170T>C		41.0	0.0		65.0	4.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	ENST00000552810.1	hg19	CCDS55858.1																																																																																			.	.		0.308	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
CEP290	80184	hgsc.bcm.edu	37	12	88486591	88486591	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:88486591C>A	ENST00000552810.1	-	29	3671	c.3328G>T	c.(3328-3330)Gat>Tat	p.D1110Y	CEP290_ENST00000309041.7_Missense_Mutation_p.D1112Y|CEP290_ENST00000397838.3_Missense_Mutation_p.D170Y|CEP290_ENST00000547691.2_Missense_Mutation_p.D170Y	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1110					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTCTGTGCATCCAAATTGATT	0.348																																					p.D1110Y		Atlas-SNP	.											.	CEP290	195	.	0			c.G3328T						.						203.0	192.0	195.0					12																	88486591		1900	4119	6019	SO:0001583	missense	80184	exon29			GTGCATCCAAATT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.3328G>T	chr12.hg19:g.88486591C>A	ENSP00000448012:p.Asp1110Tyr	176.0	0.0		177.0	64.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	hg19	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466119	0.84425	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.64438	0.48;-0.1;-0.1;0.48	5.83	5.83	0.93111	.	0.183068	0.56097	D	0.000025	T	0.64091	0.2567	L	0.34521	1.04	0.48901	D	0.999726	P	0.48503	0.911	P	0.49226	0.603	T	0.66428	-0.5926	10	0.72032	D	0.01	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	1110	O15078	CE290_HUMAN	Y	170;1110;1112;170	ENSP00000446905:D170Y;ENSP00000448012:D1110Y;ENSP00000308021:D1112Y;ENSP00000380938:D170Y	ENSP00000308021:D1112Y	D	-	1	0	CEP290	87010722	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	5.464000	0.66719	2.762000	0.94881	0.591000	0.81541	GAT	.	.		0.348	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
WSCD2	9671	hgsc.bcm.edu	37	12	108642083	108642083	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:108642083A>G	ENST00000332082.4	+	10	2479	c.1661A>G	c.(1660-1662)aAc>aGc	p.N554S	WSCD2_ENST00000261400.3_Missense_Mutation_p.N574S|WSCD2_ENST00000549903.1_Missense_Mutation_p.N574S|WSCD2_ENST00000547525.1_Missense_Mutation_p.N554S			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	554						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						AAAGGGCGGAACCTAACGGGT	0.582																																					p.N554S		Atlas-SNP	.											.	WSCD2	125	.	0			c.A1661G						.						53.0	56.0	55.0					12																	108642083		2012	4191	6203	SO:0001583	missense	9671	exon9			GGCGGAACCTAAC		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1661A>G	chr12.hg19:g.108642083A>G	ENSP00000331933:p.Asn554Ser	70.0	0.0		95.0	4.0	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	hg19	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.911584	0.52439	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.36520	1.25;1.28;1.25;1.28	4.63	4.63	0.57726	.	0.047841	0.85682	D	0.000000	T	0.46698	0.1406	M	0.74881	2.28	0.47862	D	0.999532	P;P	0.51351	0.944;0.793	P;B	0.48270	0.572;0.138	T	0.52786	-0.8529	10	0.54805	T	0.06	-58.837	13.2043	0.59787	1.0:0.0:0.0:0.0	.	574;554	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	S	554;574;554;574	ENSP00000448047:N554S;ENSP00000261400:N574S;ENSP00000331933:N554S;ENSP00000447272:N574S	ENSP00000261400:N574S	N	+	2	0	WSCD2	107166213	1.000000	0.71417	0.996000	0.52242	0.573000	0.36030	5.832000	0.69337	1.726000	0.51525	0.533000	0.62120	AAC	.	.		0.582	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
DAO	1610	hgsc.bcm.edu	37	12	109288106	109288106	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:109288106A>G	ENST00000228476.3	+	7	779	c.575A>G	c.(574-576)gAc>gGc	p.D192G	DAO_ENST00000551281.1_Missense_Mutation_p.D126G	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	192					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	CTACAACGAGACCCCCTGCTG	0.552																																					p.D192G		Atlas-SNP	.											.	DAO	58	.	0			c.A575G						.						63.0	50.0	54.0					12																	109288106		2203	4300	6503	SO:0001583	missense	1610	exon7			AACGAGACCCCCT	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.575A>G	chr12.hg19:g.109288106A>G	ENSP00000228476:p.Asp192Gly	98.0	0.0		92.0	4.0	NM_001917	B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	ENST00000228476.3	hg19	CCDS9122.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198837	0.79015	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547768;ENST00000547166	D;D;D;T	0.81659	-1.52;-1.52;-1.52;-0.26	5.51	5.51	0.81932	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.93028	0.7781	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95116	0.8242	10	0.87932	D	0	-11.3905	14.4973	0.67698	1.0:0.0:0.0:0.0	.	192;175	P14920;Q7Z312	OXDA_HUMAN;.	G	126;192;69;192	ENSP00000446853:D126G;ENSP00000228476:D192G;ENSP00000449967:D69G;ENSP00000447104:D192G	ENSP00000228476:D192G	D	+	2	0	DAO	107812235	1.000000	0.71417	0.996000	0.52242	0.715000	0.41141	8.942000	0.92970	2.108000	0.64289	0.409000	0.27619	GAC	.	.		0.552	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
ACACB	32	hgsc.bcm.edu	37	12	109613960	109613960	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:109613960A>G	ENST00000338432.7	+	9	1448	c.1329A>G	c.(1327-1329)gcA>gcG	p.A443A	ACACB_ENST00000377854.5_Silent_p.A443A|ACACB_ENST00000377848.3_Silent_p.A443A|ACACB_ENST00000543080.1_3'UTR			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	443	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GCACCCAGGCAGCAGAAAGAA	0.542																																					p.A443A		Atlas-SNP	.											.	ACACB	330	.	0			c.A1329G						.						240.0	253.0	248.0					12																	109613960		2203	4300	6503	SO:0001819	synonymous_variant	32	exon8			CCAGGCAGCAGAA	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1329A>G	chr12.hg19:g.109613960A>G		74.0	0.0		94.0	4.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	hg19	CCDS31898.1																																																																																			.	.		0.542	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
ANAPC7	51434	hgsc.bcm.edu	37	12	110812082	110812082	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:110812082T>C	ENST00000455511.3	-	11	1667	c.1667A>G	c.(1666-1668)gAg>gGg	p.E556G	ANAPC7_ENST00000481473.1_5'UTR	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	556					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						CGTGGGACTCTCCTCCTTCTC	0.577																																					p.E556G		Atlas-SNP	.											.	ANAPC7	68	.	0			c.A1667G						.						133.0	103.0	113.0					12																	110812082		2203	4300	6503	SO:0001583	missense	51434	exon11			GGACTCTCCTCCT	AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1667A>G	chr12.hg19:g.110812082T>C	ENSP00000394394:p.Glu556Gly	57.0	0.0		83.0	5.0	NM_016238	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	ENST00000455511.3	hg19	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	T	12.53	1.965737	0.34659	.	.	ENSG00000196510	ENST00000455511;ENST00000481473;ENST00000486321	T	0.65732	-0.17	5.88	4.71	0.59529	.	0.089296	0.85682	N	0.000000	T	0.37433	0.1003	N	0.03608	-0.345	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.11641	-1.0579	10	0.25751	T	0.34	-29.7449	12.1758	0.54184	0.0:0.0673:0.0:0.9327	.	556	Q9UJX3	APC7_HUMAN	G	556;130;154	ENSP00000394394:E556G	ENSP00000394394:E556G	E	-	2	0	ANAPC7	109296465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.973000	0.70456	1.016000	0.39470	0.459000	0.35465	GAG	.	.		0.577	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	NM_016238	
ARPC3	10094	hgsc.bcm.edu	37	12	110874444	110874444	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:110874444T>C	ENST00000228825.7	-	5	443	c.297A>G	c.(295-297)ggA>ggG	p.G99G	RP11-478C19.2_ENST00000550231.1_RNA	NM_001278556.1|NM_005719.2	NP_001265485.1|NP_005710.1	O15145	ARPC3_HUMAN	actin related protein 2/3 complex, subunit 3, 21kDa	99					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			lung(1)|ovary(1)	2						AATTAGTGATTCCCAGCGTAT	0.383																																					p.G99G		Atlas-SNP	.											.	ARPC3	7	.	0			c.A297G						.						130.0	122.0	125.0					12																	110874444		2203	4300	6503	SO:0001819	synonymous_variant	10094	exon5			AGTGATTCCCAGC	AF006086	CCDS9146.1	12q24	2011-07-06	2002-08-29		ENSG00000111229	ENSG00000111229		"""Actin related protein 2/3 complex subunits"""	706	protein-coding gene	gene with protein product		604225	"""actin related protein 2/3 complex, subunit 3 (21 kD)"""			9230079, 9359840	Standard	NM_001278556		Approved	p21-Arc, ARC21	uc001tqq.3	O15145	OTTHUMG00000134333	ENST00000228825.7:c.297A>G	chr12.hg19:g.110874444T>C		102.0	0.0		94.0	4.0	NM_005719	O00554	Silent	SNP	ENST00000228825.7	hg19	CCDS9146.1																																																																																			.	.		0.383	ARPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259487.2		
ACAD10	80724	hgsc.bcm.edu	37	12	112186252	112186252	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:112186252A>G	ENST00000313698.4	+	17	2772	c.2617A>G	c.(2617-2619)Acg>Gcg	p.T873A	ACAD10_ENST00000455480.2_Missense_Mutation_p.T904A|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_Missense_Mutation_p.T475A	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	873						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						CCGGCCTCTGACGGTGTATGG	0.587																																					p.T904A		Atlas-SNP	.											.	ACAD10	93	.	0			c.A2710G						.						66.0	69.0	68.0					12																	112186252		2203	4300	6503	SO:0001583	missense	80724	exon18			CCTCTGACGGTGT	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2617A>G	chr12.hg19:g.112186252A>G	ENSP00000325137:p.Thr873Ala	63.0	0.0		97.0	4.0	NM_001136538	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	hg19	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.178374	0.38511	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000455480;ENST00000313698	D;D;D	0.98835	-5.17;-5.17;-5.17	5.87	3.41	0.39046	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.374922	0.25951	N	0.027258	D	0.96250	0.8777	L	0.39147	1.195	0.26255	N	0.978663	B;B;B	0.29988	0.116;0.008;0.264	B;B;B	0.33454	0.081;0.011;0.164	D	0.90202	0.4258	10	0.26408	T	0.33	.	10.3102	0.43704	0.7443:0.0:0.0:0.2557	.	904;873;873	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	A	475;873;904;873	ENSP00000376411:T475A;ENSP00000389813:T904A;ENSP00000325137:T873A	ENSP00000325137:T873A	T	+	1	0	ACAD10	110670635	0.945000	0.32115	0.786000	0.31890	0.439000	0.31926	1.603000	0.36794	0.417000	0.25871	0.533000	0.62120	ACG	.	.		0.587	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
RPH3A	22895	hgsc.bcm.edu	37	12	113319635	113319635	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:113319635T>C	ENST00000389385.4	+	15	1807	c.1310T>C	c.(1309-1311)cTg>cCg	p.L437P	RPH3A_ENST00000543106.2_Missense_Mutation_p.L437P|RPH3A_ENST00000551052.1_Missense_Mutation_p.L433P|RPH3A_ENST00000415485.3_Missense_Mutation_p.L437P|RPH3A_ENST00000548866.1_Missense_Mutation_p.L388P|RPH3A_ENST00000447659.2_Missense_Mutation_p.L388P|RPH3A_ENST00000420983.2_Missense_Mutation_p.L437P|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	437	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CTGCACCTCCTGCCGGGAGCC	0.592																																					p.L437P		Atlas-SNP	.											.	RPH3A	98	.	0			c.T1310C						.						93.0	87.0	89.0					12																	113319635		2203	4300	6503	SO:0001583	missense	22895	exon15			ACCTCCTGCCGGG	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1310T>C	chr12.hg19:g.113319635T>C	ENSP00000374036:p.Leu437Pro	99.0	0.0		111.0	5.0	NM_001143854	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	hg19	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.249630	0.80024	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913;ENST00000552755	T;T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86;1.86	5.34	5.34	0.76211	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.47455	D	0.000224	T	0.56529	0.1991	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	T	0.64960	-0.6284	10	0.87932	D	0	.	14.329	0.66541	0.0:0.0:0.0:1.0	.	388;437;437;433	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	P	437;437;388;433;437;388;437;89;89	ENSP00000440384:L437P;ENSP00000374036:L437P;ENSP00000413254:L388P;ENSP00000448297:L433P;ENSP00000405357:L437P;ENSP00000450347:L388P;ENSP00000408889:L437P	ENSP00000374036:L437P	L	+	2	0	RPH3A	111804018	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.673000	0.83973	2.029000	0.59856	0.459000	0.35465	CTG	.	.		0.592	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
OAS3	4940	hgsc.bcm.edu	37	12	113384738	113384738	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:113384738A>G	ENST00000228928.7	+	4	1006	c.827A>G	c.(826-828)gAg>gGg	p.E276G	OAS3_ENST00000546638.1_3'UTR|RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	276	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						TATGGCTTCGAGGACCCTGCA	0.572																																					p.E276G		Atlas-SNP	.											.	OAS3	63	.	0			c.A827G						.						81.0	84.0	83.0					12																	113384738		1991	4169	6160	SO:0001583	missense	4940	exon4			GCTTCGAGGACCC	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.827A>G	chr12.hg19:g.113384738A>G	ENSP00000228928:p.Glu276Gly	141.0	0.0		150.0	6.0	NM_006187	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	hg19	CCDS44981.1	.	.	.	.	.	.	.	.	.	.	A	15.55	2.867603	0.51588	.	.	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.48522	0.81	4.23	3.08	0.35506	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	.	.	.	.	T	0.46964	0.1420	M	0.75150	2.29	0.18873	N	0.999987	B	0.21071	0.051	B	0.24394	0.053	T	0.49204	-0.8964	9	0.87932	D	0	.	6.4409	0.21849	0.8871:0.0:0.1129:0.0	.	276	Q9Y6K5	OAS3_HUMAN	G	276	ENSP00000228928:E276G	ENSP00000228928:E276G	E	+	2	0	OAS3	111869121	0.051000	0.20477	0.144000	0.22314	0.809000	0.45718	2.017000	0.40981	0.765000	0.33221	-0.250000	0.11733	GAG	.	.		0.572	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
TPCN1	53373	hgsc.bcm.edu	37	12	113730811	113730811	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:113730811A>G	ENST00000335509.6	+	26	2500	c.2186A>G	c.(2185-2187)gAg>gGg	p.E729G	TPCN1_ENST00000392569.4_Missense_Mutation_p.E661G|TPCN1_ENST00000550785.1_Missense_Mutation_p.E801G|TPCN1_ENST00000541517.1_Missense_Mutation_p.E801G	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	729					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						CTCTACCGGGAGGCACGGGGG	0.612																																					p.E801G		Atlas-SNP	.											.	TPCN1	109	.	0			c.A2402G						.						45.0	46.0	46.0					12																	113730811		2203	4300	6503	SO:0001583	missense	53373	exon27			ACCGGGAGGCACG	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.2186A>G	chr12.hg19:g.113730811A>G	ENSP00000335300:p.Glu729Gly	71.0	0.0		87.0	5.0	NM_001143819	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	hg19	CCDS31908.1	.	.	.	.	.	.	.	.	.	.	A	10.90	1.481676	0.26598	.	.	ENSG00000186815	ENST00000335509;ENST00000550785;ENST00000541517;ENST00000392569	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.24	1.39	0.22231	.	0.394007	0.29034	N	0.013344	T	0.27063	0.0663	L	0.44542	1.39	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.11665	-1.0578	10	0.26408	T	0.33	-11.939	3.1944	0.06628	0.4881:0.0:0.3309:0.181	.	801;729	Q9ULQ1-3;Q9ULQ1	.;TPC1_HUMAN	G	729;801;801;661	ENSP00000335300:E729G;ENSP00000448083:E801G;ENSP00000438125:E801G;ENSP00000376350:E661G	ENSP00000335300:E729G	E	+	2	0	TPCN1	112215194	0.393000	0.25237	0.658000	0.29665	0.726000	0.41606	0.433000	0.21477	0.320000	0.23234	0.459000	0.35465	GAG	.	.		0.612	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	
CIT	11113	hgsc.bcm.edu	37	12	120172998	120172998	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:120172998C>T	ENST00000261833.7	-	24	3049	c.2997G>A	c.(2995-2997)acG>acA	p.T999T	CIT_ENST00000392521.2_Silent_p.T1041T|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	999					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TCTCTCGTTCCGTGATCTCCC	0.498																																					p.T1041T		Atlas-SNP	.											.	CIT	535	.	0			c.G3123A						.						170.0	146.0	154.0					12																	120172998		2203	4300	6503	SO:0001819	synonymous_variant	11113	exon25			TCGTTCCGTGATC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2997G>A	chr12.hg19:g.120172998C>T		371.0	0.0		450.0	155.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	hg19	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053691	0.36277	.	.	ENSG00000122966	ENST00000392520;ENST00000546026	.	.	.	5.23	-10.5	0.00291	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53222	-0.8469	4	.	.	.	.	3.3542	0.07163	0.1814:0.2758:0.3843:0.1584	.	.	.	.	Q	627;25	.	.	R	-	2	0	CIT	118657381	0.000000	0.05858	0.083000	0.20561	0.966000	0.64601	-6.437000	0.00066	-4.113000	0.00072	-0.294000	0.09567	CGG	.	.		0.498	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
OASL	8638	hgsc.bcm.edu	37	12	121469367	121469367	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:121469367T>C	ENST00000257570.5	-	3	805	c.535A>G	c.(535-537)Aag>Gag	p.K179E	OASL_ENST00000339275.5_Missense_Mutation_p.K179E	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	179					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCGCAGGCCTTGATCAGGCTC	0.552																																					p.K179E	Colon(192;517 2041 31392 31913 39966)	Atlas-SNP	.											.	OASL	49	.	0			c.A535G						.						78.0	76.0	76.0					12																	121469367		2203	4300	6503	SO:0001583	missense	8638	exon3			AGGCCTTGATCAG	AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.535A>G	chr12.hg19:g.121469367T>C	ENSP00000257570:p.Lys179Glu	59.0	0.0		64.0	4.0	NM_198213	B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Missense_Mutation	SNP	ENST00000257570.5	hg19	CCDS9211.1	.	.	.	.	.	.	.	.	.	.	C	7.540	0.660485	0.14645	.	.	ENSG00000135114	ENST00000257570;ENST00000339275	T;T	0.08896	3.04;3.04	5.52	-9.7	0.00521	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	2.095300	0.02164	N	0.059085	T	0.03871	0.0109	N	0.11131	0.1	0.09310	N	1	B;B	0.12013	0.005;0.004	B;B	0.15870	0.009;0.014	T	0.32587	-0.9901	10	0.06891	T	0.86	0.0239	12.1162	0.53866	0.0:0.5402:0.0995:0.3604	.	179;179	Q15646-2;Q15646	.;OASL_HUMAN	E	179	ENSP00000257570:K179E;ENSP00000341125:K179E	ENSP00000257570:K179E	K	-	1	0	OASL	119953750	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-1.390000	0.02528	-2.539000	0.00486	-2.397000	0.00225	AAG	.	.		0.552	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337875.2	NM_003733	
SETD1B	23067	hgsc.bcm.edu	37	12	122246139	122246139	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:122246139A>G	ENST00000604567.1	+	5	638	c.570A>G	c.(568-570)gaA>gaG	p.E190E	SETD1B_ENST00000267197.5_Silent_p.E190E|SETD1B_ENST00000542440.1_Silent_p.E190E			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	190					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GGTTCTATGAACTGTTGGTCA	0.587																																					p.E190E		Atlas-SNP	.											.	SETD1B	105	.	0			c.A570G						.						81.0	83.0	82.0					12																	122246139		692	1591	2283	SO:0001819	synonymous_variant	23067	exon4			CTATGAACTGTTG	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.570A>G	chr12.hg19:g.122246139A>G		114.0	0.0		142.0	6.0	NM_015048	F6MFW1	Silent	SNP	ENST00000604567.1	hg19																																																																																				.	.		0.587	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
CLIP1	6249	hgsc.bcm.edu	37	12	122864937	122864937	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:122864937T>C	ENST00000540338.1	-	1	104	c.63A>G	c.(61-63)acA>acG	p.T21T	CLIP1_ENST00000361654.4_Silent_p.T21T|CLIP1_ENST00000302528.7_Silent_p.T21T|CLIP1_ENST00000358808.2_Silent_p.T21T|CLIP1_ENST00000537178.1_Silent_p.T21T			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	21					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TCTTCAGAGCTGTGCTTCCAG	0.398																																					p.T21T		Atlas-SNP	.											.	CLIP1	126	.	0			c.A63G						.						115.0	111.0	113.0					12																	122864937		2203	4300	6503	SO:0001819	synonymous_variant	6249	exon2			CAGAGCTGTGCTT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.63A>G	chr12.hg19:g.122864937T>C		51.0	0.0		74.0	4.0	NM_002956	A0AVD3|Q17RS4|Q29RG0	Silent	SNP	ENST00000540338.1	hg19	CCDS58285.1																																																																																			.	.		0.398	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
EP400	57634	hgsc.bcm.edu	37	12	132527997	132527997	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:132527997T>C	ENST00000333577.4	+	34	6573	c.6464T>C	c.(6463-6465)tTc>tCc	p.F2155S	EP400_ENST00000332482.4_Missense_Mutation_p.F2082S|EP400_ENST00000389562.2_Missense_Mutation_p.F2118S|EP400_ENST00000330386.6_Missense_Mutation_p.F2038S|EP400_ENST00000389561.2_Missense_Mutation_p.F2119S			Q96L91	EP400_HUMAN	E1A binding protein p400	2155					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CTAGCTGACTTCATGGAGCAG	0.408																																					p.F2119S		Atlas-SNP	.											.	EP400	370	.	0			c.T6356C						.						115.0	104.0	108.0					12																	132527997		2203	4300	6503	SO:0001583	missense	57634	exon33			CTGACTTCATGGA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.6464T>C	chr12.hg19:g.132527997T>C	ENSP00000333602:p.Phe2155Ser	82.0	0.0		82.0	4.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	hg19		.	.	.	.	.	.	.	.	.	.	T	11.83	1.756523	0.31137	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.89875	-2.58;-2.57;-2.57;-2.57;-2.57	5.74	5.74	0.90152	.	0.169215	0.50627	D	0.000107	D	0.88153	0.6360	L	0.51422	1.61	0.40413	D	0.979764	P;P;P	0.45827	0.867;0.867;0.867	B;B;B	0.44044	0.439;0.439;0.439	D	0.89987	0.4105	10	0.87932	D	0	.	16.0315	0.80582	0.0:0.0:0.0:1.0	.	2119;2038;2118	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	S	2155;2119;2118;2082;2038;2119	ENSP00000333602:F2155S;ENSP00000374212:F2119S;ENSP00000374213:F2118S;ENSP00000331737:F2082S;ENSP00000330620:F2038S	ENSP00000330620:F2038S	F	+	2	0	EP400	131093950	1.000000	0.71417	0.997000	0.53966	0.355000	0.29361	7.305000	0.78891	2.186000	0.69663	0.455000	0.32223	TTC	.	.		0.408	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
P2RX2	22953	hgsc.bcm.edu	37	12	133196677	133196677	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:133196677T>C	ENST00000389110.3	+	5	586	c.549T>C	c.(547-549)tcT>tcC	p.S183S	P2RX2_ENST00000350048.5_Silent_p.S159S|P2RX2_ENST00000348800.5_Silent_p.S183S|P2RX2_ENST00000352418.4_Silent_p.S111S|P2RX2_ENST00000351222.4_Silent_p.S91S|P2RX2_ENST00000449132.2_Missense_Mutation_p.C148R|P2RX2_ENST00000343948.4_Silent_p.S183S	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	183					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ATGGGGCCTCTGTCAGGTGCA	0.677																																					p.S183S		Atlas-SNP	.											.	P2RX2	49	.	0			c.T549C						.						11.0	10.0	11.0					12																	133196677		2193	4290	6483	SO:0001819	synonymous_variant	22953	exon5			GGCCTCTGTCAGG	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.549T>C	chr12.hg19:g.133196677T>C		94.0	0.0		96.0	4.0	NM_170683	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Silent	SNP	ENST00000389110.3	hg19	CCDS31931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.770|7.770	0.707287|0.707287	0.15239|0.15239	.|.	.|.	ENSG00000187848|ENSG00000187848	ENST00000449132|ENST00000542301;ENST00000536121;ENST00000535910	T|.	0.17370|.	2.28|.	4.78|4.78	-9.55|-9.55	0.00569|0.00569	.|.	.|.	.|.	.|.	.|.	T|T	0.14874|0.14874	0.0359|0.0359	.|.	.|.	.|.	0.26071|0.26071	N|N	0.981224|0.981224	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.06826|0.06826	-1.0805|-1.0805	8|4	0.87932|.	D|.	0|.	-10.4783|-10.4783	1.2559|1.2559	0.01991|0.01991	0.2128:0.2955:0.258:0.2337|0.2128:0.2955:0.258:0.2337	.|.	148|.	Q9UBL9-7|.	.|.	R|P	148|194;169;139	ENSP00000405531:C148R|.	ENSP00000405531:C148R|.	C|L	+|+	1|2	0|0	P2RX2|P2RX2	131706750|131706750	0.053000|0.053000	0.20554|0.20554	0.000000|0.000000	0.03702|0.03702	0.256000|0.256000	0.26092|0.26092	-0.742000|-0.742000	0.04850|0.04850	-4.223000|-4.223000	0.00063|0.00063	-2.060000|-2.060000	0.00399|0.00399	TGT|CTG	.	.		0.677	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1		
ZMYM2	7750	hgsc.bcm.edu	37	13	20567643	20567643	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:20567643C>T	ENST00000382874.2	+	4	621	c.431C>T	c.(430-432)cCt>cTt	p.P144L	ZMYM2_ENST00000382881.3_Missense_Mutation_p.P144L|ZMYM2_ENST00000382869.3_Missense_Mutation_p.P144L|ZMYM2_ENST00000382871.2_Missense_Mutation_p.P144L	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CGAAGACCTCCTGAGACTAAA	0.383																																					p.P144L		Atlas-SNP	.											.	ZMYM2	191	.	0			c.C431T						.						101.0	106.0	105.0					13																	20567643		2108	4249	6357	SO:0001583	missense	7750	exon4			GACCTCCTGAGAC	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.431C>T	chr13.hg19:g.20567643C>T	ENSP00000372327:p.Pro144Leu	91.0	0.0		113.0	43.0	NM_001190964	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	hg19	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968388	0.34754	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382881;ENST00000382874;ENST00000382871	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.39	4.45	0.53987	.	0.742403	0.12412	N	0.471194	T	0.29126	0.0724	L	0.52573	1.65	0.80722	D	1	B;B;B	0.20261	0.002;0.002;0.043	B;B;B	0.18871	0.008;0.008;0.023	T	0.03296	-1.1051	10	0.34782	T	0.22	-0.1595	10.415	0.44316	0.0:0.8386:0.0:0.1614	.	144;144;144	A8K126;Q9UBW7;Q9UBW7-2	.;ZMYM2_HUMAN;.	L	144	ENSP00000372322:P144L;ENSP00000372334:P144L;ENSP00000372327:P144L;ENSP00000372324:P144L	ENSP00000372322:P144L	P	+	2	0	ZMYM2	19465643	0.338000	0.24775	0.837000	0.33122	0.982000	0.71751	1.128000	0.31369	1.232000	0.43678	0.650000	0.86243	CCT	.	.		0.383	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
LATS2	26524	hgsc.bcm.edu	37	13	21555755	21555755	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:21555755T>C	ENST00000382592.4	-	6	2920	c.2515A>G	c.(2515-2517)Agc>Ggc	p.S839G	LATS2_ENST00000542899.1_Missense_Mutation_p.S839G	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CAGAGGTCGCTGGGCTCCATG	0.512																																					p.S839G		Atlas-SNP	.											.	LATS2	176	.	0			c.A2515G						.						53.0	49.0	51.0					13																	21555755		2203	4300	6503	SO:0001583	missense	26524	exon6			GGTCGCTGGGCTC	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2515A>G	chr13.hg19:g.21555755T>C	ENSP00000372035:p.Ser839Gly	98.0	0.0		89.0	4.0	NM_014572		Missense_Mutation	SNP	ENST00000382592.4	hg19	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	T	13.23	2.175109	0.38413	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.61510	0.1;0.1	5.69	-1.69	0.08186	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.201497	0.43919	N	0.000502	T	0.39860	0.1094	L	0.28458	0.855	0.42515	D	0.992982	B	0.06786	0.001	B	0.08055	0.003	T	0.11108	-1.0601	10	0.44086	T	0.13	.	10.5325	0.44986	0.0:0.4384:0.0:0.5616	.	839	Q9NRM7	LATS2_HUMAN	G	839	ENSP00000372035:S839G;ENSP00000441817:S839G	ENSP00000372035:S839G	S	-	1	0	LATS2	20453755	0.996000	0.38824	0.103000	0.21229	0.731000	0.41821	1.413000	0.34725	-0.240000	0.09696	-0.262000	0.10625	AGC	.	.		0.512	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1		
SPATA13	221178	hgsc.bcm.edu	37	13	24797158	24797158	+	Intron	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:24797158T>C	ENST00000382095.4	+	2	185				SPATA13_ENST00000382108.3_Missense_Mutation_p.C31R|SPATA13_ENST00000424834.2_Missense_Mutation_p.C31R|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.C31R	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CGCAGCCCCCTGTGCAGGCTC	0.682																																					p.C31R		Atlas-SNP	.											.	SPATA13	92	.	0			c.T91C						.						65.0	74.0	71.0					13																	24797158		692	1591	2283	SO:0001627	intron_variant	221178	exon2			GCCCCCTGTGCAG	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-26457T>C	chr13.hg19:g.24797158T>C		80.0	0.0		94.0	4.0	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	hg19	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.07|12.07	1.827986|1.827986	0.32329|0.32329	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108|ENST00000424834	T|.	0.75589|.	-0.95|.	5.26|5.26	1.25|1.25	0.21368|0.21368	.|.	0.421206|.	0.16753|.	U|.	0.200941|.	T|T	0.38665|0.38665	0.1049|0.1049	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.27971|0.27971	-1.0058|-1.0058	8|5	0.72032|.	D|.	0.01|.	.|.	11.7859|11.7859	0.52043|0.52043	0.0:0.0:0.4601:0.5399|0.0:0.0:0.4601:0.5399	.|.	.|.	.|.	.|.	R|P	31|68	ENSP00000371542:C31R|.	ENSP00000371542:C31R|.	C|L	+|+	1|2	0|0	SPATA13|SPATA13	23695158|23695158	0.429000|0.429000	0.25530|0.25530	0.000000|0.000000	0.03702|0.03702	0.015000|0.015000	0.08874|0.08874	2.005000|2.005000	0.40864|0.40864	0.054000|0.054000	0.16065|0.16065	0.397000|0.397000	0.26171|0.26171	TGT|CTG	.	.		0.682	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
ATP12A	479	hgsc.bcm.edu	37	13	25266639	25266639	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:25266639A>G	ENST00000381946.3	+	9	1308	c.1141A>G	c.(1141-1143)Acc>Gcc	p.T381A	ATP12A_ENST00000218548.6_Missense_Mutation_p.T387A			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	381					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GGCTGTGGAGACCCTCGGCTC	0.562																																					p.T387A	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.A1159G						.						91.0	82.0	85.0					13																	25266639		2203	4300	6503	SO:0001583	missense	479	exon9			GTGGAGACCCTCG	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1141A>G	chr13.hg19:g.25266639A>G	ENSP00000371372:p.Thr381Ala	66.0	0.0		87.0	4.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.907853	0.92107	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.91521	-2.86;-2.86	5.63	5.63	0.86233	ATPase, P-type, cytoplasmic domain N (1);ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.95799	0.8633	M	0.88031	2.925	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	D	0.96432	0.9320	10	0.87932	D	0	.	13.789	0.63128	1.0:0.0:0.0:0.0	.	387;381	P54707-2;P54707	.;AT12A_HUMAN	A	387;381	ENSP00000218548:T387A;ENSP00000371372:T381A	ENSP00000218548:T387A	T	+	1	0	ATP12A	24164639	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	9.079000	0.94032	2.145000	0.66743	0.533000	0.62120	ACC	.	.		0.562	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
ATP12A	479	hgsc.bcm.edu	37	13	25266681	25266681	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:25266681A>G	ENST00000381946.3	+	9	1350	c.1183A>G	c.(1183-1185)Aca>Gca	p.T395A	ATP12A_ENST00000218548.6_Missense_Mutation_p.T401A			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	395					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CAAGACTGGGACACTGACCCA	0.532																																					p.T401A	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.A1201G						.						97.0	85.0	89.0					13																	25266681		2203	4300	6503	SO:0001583	missense	479	exon9			ACTGGGACACTGA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1183A>G	chr13.hg19:g.25266681A>G	ENSP00000371372:p.Thr395Ala	101.0	0.0		125.0	7.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456532	0.84317	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.99143	-5.48;-5.48	5.63	5.63	0.86233	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.99588	0.9851	H	0.98577	4.27	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.85130	0.997;0.99	D	0.97737	1.0206	10	0.87932	D	0	.	13.789	0.63128	1.0:0.0:0.0:0.0	.	401;395	P54707-2;P54707	.;AT12A_HUMAN	A	401;395	ENSP00000218548:T401A;ENSP00000371372:T395A	ENSP00000218548:T401A	T	+	1	0	ATP12A	24164681	1.000000	0.71417	0.983000	0.44433	0.716000	0.41182	7.246000	0.78247	2.145000	0.66743	0.533000	0.62120	ACA	.	.		0.532	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
BRCA2	675	hgsc.bcm.edu	37	13	32937516	32937516	+	Missense_Mutation	SNP	A	A	G	rs80359064		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:32937516A>G	ENST00000380152.3	+	18	8410	c.8177A>G	c.(8176-8178)tAt>tGt	p.Y2726C	BRCA2_ENST00000544455.1_Missense_Mutation_p.Y2726C			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2726					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GATGGGTGGTATGCTGTTAAG	0.403			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.Y2726C	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.A8177G						.	A	CYS/TYR	0,4406		0,0,2203	148.0	143.0	145.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	8177	5.5	1.0	13	dbSNP_132	145	1,8599	1.2+/-3.3	0,1,4299	no	missense	BRCA2	NM_000059.3	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	2726/3419	32937516	1,13005	2203	4300	6503	SO:0001583	missense	675	exon18	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	GGTGGTATGCTGT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8177A>G	chr13.hg19:g.32937516A>G	ENSP00000369497:p.Tyr2726Cys	139.0	0.0		168.0	66.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302460	0.60195	0.0	1.16E-4	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.95482	-3.72;-3.72	5.49	5.49	0.81192	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 1 (1);	0.000000	0.85682	D	0.000000	D	0.98283	0.9431	M	0.93197	3.39	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99560	1.0968	10	0.87932	D	0	.	15.5697	0.76323	1.0:0.0:0.0:0.0	.	2726	P51587	BRCA2_HUMAN	C	2726	ENSP00000369497:Y2726C;ENSP00000439902:Y2726C	ENSP00000369497:Y2726C	Y	+	2	0	BRCA2	31835516	1.000000	0.71417	0.992000	0.48379	0.414000	0.31173	8.962000	0.93254	2.084000	0.62774	0.260000	0.18958	TAT	.	.		0.403	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
NBEA	26960	hgsc.bcm.edu	37	13	36046643	36046643	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:36046643T>C	ENST00000400445.3	+	41	7089	c.6555T>C	c.(6553-6555)gaT>gaC	p.D2185D	NBEA_ENST00000379939.2_Silent_p.D2182D|NBEA_ENST00000540320.1_Silent_p.D2185D|NBEA_ENST00000310336.4_Silent_p.D2185D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2185					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TAGATGAGGATGATTCTGCCT	0.498																																					p.D2185D		Atlas-SNP	.											.	NBEA	340	.	0			c.T6555C						.						90.0	90.0	90.0					13																	36046643		1997	4175	6172	SO:0001819	synonymous_variant	26960	exon41			TGAGGATGATTCT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6555T>C	chr13.hg19:g.36046643T>C		88.0	0.0		94.0	4.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.		0.498	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
WBP4	11193	hgsc.bcm.edu	37	13	41642739	41642739	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:41642739C>T	ENST00000379487.3	+	5	705	c.305C>T	c.(304-306)cCa>cTa	p.P102L	WBP4_ENST00000542082.1_Missense_Mutation_p.P81L	NM_007187.3	NP_009118.1	O75554	WBP4_HUMAN	WW domain binding protein 4	102					mRNA cis splicing, via spliceosome (GO:0045292)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	nucleic acid binding (GO:0003676)|proline-rich region binding (GO:0070064)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|prostate(1)|skin(1)	12		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		AGCACTATCCCACCTACCTCG	0.383																																					p.P102L		Atlas-SNP	.											.	WBP4	40	.	0			c.C305T						.						73.0	76.0	75.0					13																	41642739		2203	4300	6503	SO:0001583	missense	11193	exon5			CTATCCCACCTAC	AF071185	CCDS9375.1	13q13.3	2012-10-17	2012-10-17		ENSG00000120688	ENSG00000120688			12739	protein-coding gene	gene with protein product	"""formin binding protein 21"""	604981				9724750	Standard	NM_007187		Approved	FBP21, MGC117310	uc001uxt.3	O75554	OTTHUMG00000016784	ENST00000379487.3:c.305C>T	chr13.hg19:g.41642739C>T	ENSP00000368801:p.Pro102Leu	50.0	0.0		64.0	4.0	NM_007187	B7Z4M2|Q32P29	Missense_Mutation	SNP	ENST00000379487.3	hg19	CCDS9375.1	.	.	.	.	.	.	.	.	.	.	C	8.289	0.817387	0.16607	.	.	ENSG00000120688	ENST00000379487;ENST00000542082	.	.	.	5.55	4.68	0.58851	.	0.243771	0.32533	N	0.005966	T	0.32346	0.0826	N	0.14661	0.345	0.35028	D	0.758557	B;B	0.25312	0.123;0.085	B;B	0.22386	0.02;0.039	T	0.37731	-0.9693	9	0.49607	T	0.09	-0.9466	6.8715	0.24123	0.1827:0.7291:0.0:0.0882	.	81;102	B7Z4M2;O75554	.;WBP4_HUMAN	L	102;81	.	ENSP00000368801:P102L	P	+	2	0	WBP4	40540739	0.293000	0.24371	0.958000	0.39756	0.155000	0.21991	2.705000	0.47127	1.270000	0.44297	0.655000	0.94253	CCA	.	.		0.383	WBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044655.2	NM_007187	
NAA16	79612	hgsc.bcm.edu	37	13	41941630	41941630	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:41941630A>G	ENST00000379406.3	+	14	1919	c.1595A>G	c.(1594-1596)aAg>aGg	p.K532R	NAA16_ENST00000497143.1_3'UTR	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	532					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						TGCATGAGAAAGATGACCCTT	0.333																																					p.K532R		Atlas-SNP	.											.	NAA16	74	.	0			c.A1595G						.						101.0	96.0	97.0					13																	41941630		2203	4300	6503	SO:0001583	missense	79612	exon14			TGAGAAAGATGAC	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1595A>G	chr13.hg19:g.41941630A>G	ENSP00000368716:p.Lys532Arg	74.0	0.0		91.0	4.0	NM_024561	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	hg19	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	A	18.27	3.587641	0.66105	.	.	ENSG00000172766	ENST00000379406	T	0.57752	0.38	5.27	4.09	0.47781	.	0.076964	0.52532	N	0.000061	T	0.55878	0.1948	M	0.64567	1.98	0.80722	D	1	B	0.26635	0.155	B	0.39935	0.314	T	0.52373	-0.8584	10	0.36615	T	0.2	-7.9668	10.9292	0.47207	0.9259:0.0:0.0741:0.0	.	532	Q6N069	NAA16_HUMAN	R	532	ENSP00000368716:K532R	ENSP00000368716:K532R	K	+	2	0	NAA16	40839630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.784000	0.68990	0.846000	0.35142	0.477000	0.44152	AAG	.	.		0.333	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
LACC1	144811	hgsc.bcm.edu	37	13	44455558	44455558	+	Missense_Mutation	SNP	C	C	A	rs150202700		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:44455558C>A	ENST00000441843.1	+	2	922	c.437C>A	c.(436-438)tCc>tAc	p.S146Y	LACC1_ENST00000325686.6_Missense_Mutation_p.S146Y|CCDC122_ENST00000476570.2_5'Flank|CCDC122_ENST00000444614.3_5'Flank	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	146																	TTTAAACAGTCCATTGAAATA	0.328																																					p.S146Y		Atlas-SNP	.											.	.	.	.	0			c.C437A						.	C	TYR/SER,TYR/SER	0,4406		0,0,2203	77.0	83.0	81.0		437,437	3.9	0.7	13	dbSNP_134	81	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	LACC1	NM_001128303.1,NM_153218.2	144,144	0,2,6501	AA,AC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	146/431,146/431	44455558	2,13004	2203	4300	6503	SO:0001583	missense	144811	exon2			AACAGTCCATTGA	AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.437C>A	chr13.hg19:g.44455558C>A	ENSP00000391747:p.Ser146Tyr	76.0	0.0		76.0	25.0	NM_001128303	A2A3Z6|Q8N8X5	Missense_Mutation	SNP	ENST00000441843.1	hg19	CCDS9391.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752758	0.31046	0.0	2.33E-4	ENSG00000179630	ENST00000441843;ENST00000425906;ENST00000325686	T;T	0.49432	0.78;0.78	5.66	3.87	0.44632	.	0.582429	0.19783	N	0.106171	T	0.51176	0.1659	M	0.70595	2.14	0.20307	N	0.999917	P	0.52842	0.956	P	0.44732	0.459	T	0.50048	-0.8873	10	0.66056	D	0.02	0.0021	13.1243	0.59344	0.4207:0.5793:0.0:0.0	.	146	Q8IV20	LACC1_HUMAN	Y	146	ENSP00000391747:S146Y;ENSP00000317619:S146Y	ENSP00000317619:S146Y	S	+	2	0	LACC1	43353558	0.002000	0.14202	0.658000	0.29665	0.241000	0.25554	1.504000	0.35726	0.793000	0.33875	0.655000	0.94253	TCC	.	C|1.000;A|0.000		0.328	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044726.3	NM_153218	
TDRD3	81550	hgsc.bcm.edu	37	13	61084796	61084796	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:61084796G>A	ENST00000196169.3	+	10	1557	c.769G>A	c.(769-771)Gaa>Aaa	p.E257K	TDRD3_ENST00000535286.1_Missense_Mutation_p.E350K|TDRD3_ENST00000377881.2_Missense_Mutation_p.E257K|TDRD3_ENST00000377894.2_Missense_Mutation_p.E257K	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	257					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.E257Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AATAAGATCTGAAGATGAAGA	0.368																																					p.E350K	Colon(36;164 906 35820 50723)	Atlas-SNP	.											TDRD3_ENST00000535286,NS,carcinoma,0,2	TDRD3	123	.	1	Substitution - Missense(1)	lung(1)	c.G1048A						.						102.0	104.0	104.0					13																	61084796		2203	4300	6503	SO:0001583	missense	81550	exon10			AGATCTGAAGATG	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.769G>A	chr13.hg19:g.61084796G>A	ENSP00000196169:p.Glu257Lys	35.0	0.0		43.0	3.0	NM_001146070	B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	ENST00000196169.3	hg19	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.984215	0.93044	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.3	5.73	5.73	0.89815	.	0.047482	0.85682	D	0.000000	D	0.95825	0.8641	M	0.64997	1.995	0.80722	D	1	D;D;D	0.71674	0.992;0.998;0.991	P;D;P	0.80764	0.901;0.994;0.718	D	0.93270	0.6651	10	0.16420	T	0.52	-25.2901	19.8994	0.96980	0.0:0.0:1.0:0.0	.	350;256;257	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	K	257;257;257;350	ENSP00000196169:E257K;ENSP00000367113:E257K;ENSP00000367126:E257K;ENSP00000440190:E350K	ENSP00000196169:E257K	E	+	1	0	TDRD3	59982797	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.042000	0.93793	2.703000	0.92315	0.650000	0.86243	GAA	.	.		0.368	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
SCEL	8796	hgsc.bcm.edu	37	13	78143580	78143580	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:78143580A>G	ENST00000349847.3	+	8	557	c.473A>G	c.(472-474)aAg>aGg	p.K158R	SCEL_ENST00000377246.3_Missense_Mutation_p.K158R|SCEL_ENST00000535157.1_Missense_Mutation_p.K158R	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	158					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		CCTGTAAAGAAGAAGAGGTAG	0.433																																					p.K158R		Atlas-SNP	.											.	SCEL	85	.	0			c.A473G						.						126.0	113.0	117.0					13																	78143580		2203	4300	6503	SO:0001583	missense	8796	exon8			TAAAGAAGAAGAG	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.473A>G	chr13.hg19:g.78143580A>G	ENSP00000302579:p.Lys158Arg	56.0	0.0		65.0	4.0	NM_003843	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	hg19	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	A	15.07	2.725093	0.48833	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.26518	1.73;1.73;1.73	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000007	T	0.47948	0.1473	M	0.69823	2.125	0.35269	D	0.780255	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.81914	0.994;0.99;0.995	T	0.61456	-0.7059	10	0.59425	D	0.04	-29.7879	11.4487	0.50138	1.0:0.0:0.0:0.0	.	158;158;158	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	R	135;158;158;158	ENSP00000437895:K158R;ENSP00000366454:K158R;ENSP00000302579:K158R	ENSP00000315127:K135R	K	+	2	0	SCEL	77041581	1.000000	0.71417	1.000000	0.80357	0.053000	0.15095	2.531000	0.45650	2.261000	0.74972	0.528000	0.53228	AAG	.	.		0.433	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
LINC00283	100874057	hgsc.bcm.edu	37	13	103394092	103394092	+	RNA	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:103394092C>T	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		ATCCTTCTCTCTCCCACGGAA	0.393																																					p.E2985E		Atlas-SNP	.											.	.	.	.	0			c.G8955A						.						37.0	30.0	32.0					13																	103394092		692	1590	2282			643677	exon4			TTCTCTCTCCCAC			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103394092C>T		74.0	0.0		86.0	4.0	NM_001146197		Silent	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.393	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
SLC10A2	6555	hgsc.bcm.edu	37	13	103701761	103701761	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:103701761T>C	ENST00000245312.3	-	5	1393	c.797A>G	c.(796-798)aAc>aGc	p.N266S		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	266					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TAGCTGCGTGTTCTGCATCCC	0.458																																					p.N266S		Atlas-SNP	.											.	SLC10A2	67	.	0			c.A797G						.						148.0	111.0	124.0					13																	103701761		2203	4300	6503	SO:0001583	missense	6555	exon5			TGCGTGTTCTGCA	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.797A>G	chr13.hg19:g.103701761T>C	ENSP00000245312:p.Asn266Ser	143.0	0.0		187.0	70.0	NM_000452	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	hg19	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	T	19.08	3.758437	0.69763	.	.	ENSG00000125255	ENST00000245312	T	0.75938	-0.98	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.88062	0.6336	M	0.87971	2.92	0.58432	D	0.999993	D	0.89917	1.0	D	0.87578	0.998	D	0.90071	0.4163	10	0.87932	D	0	-20.8516	16.2484	0.82467	0.0:0.0:0.0:1.0	.	266	Q12908	NTCP2_HUMAN	S	266	ENSP00000245312:N266S	ENSP00000245312:N266S	N	-	2	0	SLC10A2	102499762	1.000000	0.71417	0.951000	0.38953	0.146000	0.21551	7.989000	0.88205	2.291000	0.77112	0.533000	0.62120	AAC	.	.		0.458	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
DHRS4L1	728635	hgsc.bcm.edu	37	14	24517998	24517998	+	RNA	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:24517998T>C	ENST00000558293.1	+	0	646					NR_102693.1																						CCTGGACTTATCAAGACTAGC	0.522																																					p.I218T		Atlas-SNP	.											.	.	.	.	0			c.T653C						.						141.0	137.0	139.0					14																	24517998		2203	4298	6501			728635	exon8			GACTTATCAAGAC																													chr14.hg19:g.24517998T>C		674.0	0.0		875.0	333.0	NM_001082488		Missense_Mutation	SNP	ENST00000558293.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.56	1.384474	0.25031	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.67	4.67	0.58626	NAD(P)-binding domain (1);	.	.	.	.	T	0.70360	0.3215	L	0.60455	1.87	0.50813	D	0.999890	D	0.89917	1.0	D	0.97110	1.0	T	0.76694	-0.2865	7	0.46703	T	0.11	.	12.0988	0.53772	0.0:0.0:0.0:1.0	.	218	P0CG22	DR4L1_HUMAN	T	218	.	ENSP00000380255:I218T	I	+	2	0	AL136295.1	23587838	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	6.335000	0.72949	1.958000	0.56883	0.329000	0.21502	ATC	.	.		0.522	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
LRRC16B	90668	hgsc.bcm.edu	37	14	24523470	24523470	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:24523470T>C	ENST00000342740.5	+	4	360	c.206T>C	c.(205-207)gTc>gCc	p.V69A	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	69						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		TCCTTCAATGTCCTGGAGATC	0.597																																					p.V69A		Atlas-SNP	.											.	LRRC16B	120	.	0			c.T206C						.						81.0	72.0	75.0					14																	24523470		2203	4300	6503	SO:0001583	missense	90668	exon4			TCAATGTCCTGGA	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.206T>C	chr14.hg19:g.24523470T>C	ENSP00000340467:p.Val69Ala	61.0	0.0		94.0	4.0	NM_138360	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	hg19	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.170924	0.57584	.	.	ENSG00000186648	ENST00000342740	T	0.15603	2.41	4.8	4.8	0.61643	.	0.519033	0.18193	N	0.148762	T	0.12732	0.0309	N	0.22421	0.69	0.80722	D	1	P	0.48764	0.915	B	0.41088	0.347	T	0.03335	-1.1047	10	0.66056	D	0.02	-21.357	11.0069	0.47639	0.0:0.0:0.0:1.0	.	69	Q8ND23	LR16B_HUMAN	A	69	ENSP00000340467:V69A	ENSP00000340467:V69A	V	+	2	0	LRRC16B	23593310	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	3.764000	0.55264	1.914000	0.55421	0.379000	0.24179	GTC	.	.		0.597	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
NYNRIN	57523	hgsc.bcm.edu	37	14	24879219	24879219	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:24879219A>C	ENST00000382554.3	+	4	2537	c.2219A>C	c.(2218-2220)cAg>cCg	p.Q740P		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	740					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CACCAGTTTCAGATGGAGGGG	0.637																																					p.Q740P		Atlas-SNP	.											.	NYNRIN	120	.	0			c.A2219C						.						21.0	24.0	23.0					14																	24879219		1938	4122	6060	SO:0001583	missense	57523	exon4			AGTTTCAGATGGA	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2219A>C	chr14.hg19:g.24879219A>C	ENSP00000371994:p.Gln740Pro	98.0	0.0		138.0	8.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320603	0.23994	.	.	ENSG00000205978	ENST00000382554	T	0.10860	2.83	4.85	0.987	0.19790	.	.	.	.	.	T	0.06096	0.0158	N	0.24115	0.695	0.09310	N	1	P	0.46277	0.875	B	0.38378	0.272	T	0.31138	-0.9954	9	0.66056	D	0.02	.	3.7416	0.08532	0.5625:0.0:0.0946:0.3429	.	740	Q9P2P1	NYNRI_HUMAN	P	740	ENSP00000371994:Q740P	ENSP00000371994:Q740P	Q	+	2	0	NYNRIN	23949059	0.036000	0.19791	0.001000	0.08648	0.004000	0.04260	0.934000	0.28910	0.070000	0.16634	-0.256000	0.11100	CAG	.	.		0.637	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
AKAP6	9472	hgsc.bcm.edu	37	14	33291695	33291695	+	Missense_Mutation	SNP	T	T	C	rs386776215		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:33291695T>C	ENST00000280979.4	+	13	4846	c.4676T>C	c.(4675-4677)cTc>cCc	p.L1559P	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1559					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCCAAACAGCTCTCCCTTTTA	0.413																																					p.L1559P	Melanoma(49;821 1200 7288 13647 42351)	Atlas-SNP	.											.	AKAP6	308	.	0			c.T4676C						.						114.0	121.0	118.0					14																	33291695		2203	4300	6503	SO:0001583	missense	9472	exon13			AACAGCTCTCCCT	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4676T>C	chr14.hg19:g.33291695T>C	ENSP00000280979:p.Leu1559Pro	90.0	0.0		93.0	4.0	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	hg19	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	T	8.626	0.892436	0.17613	.	.	ENSG00000151320	ENST00000280979	T	0.05996	3.36	5.79	4.65	0.58169	.	0.374376	0.27567	N	0.018797	T	0.06234	0.0161	L	0.38838	1.175	0.80722	D	1	B	0.13145	0.007	B	0.08055	0.003	T	0.20538	-1.0272	10	0.49607	T	0.09	-3.9077	9.9309	0.41521	0.0:0.0763:0.0:0.9237	.	1559	Q13023	AKAP6_HUMAN	P	1559	ENSP00000280979:L1559P	ENSP00000280979:L1559P	L	+	2	0	AKAP6	32361446	0.999000	0.42202	1.000000	0.80357	0.937000	0.57800	2.066000	0.41452	2.209000	0.71365	0.528000	0.53228	CTC	.	.		0.413	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
BAZ1A	11177	hgsc.bcm.edu	37	14	35227928	35227928	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:35227928T>C	ENST00000382422.2	-	24	4695	c.4368A>G	c.(4366-4368)aaA>aaG	p.K1456K	BAZ1A_ENST00000358716.4_Silent_p.K1424K|BAZ1A_ENST00000360310.1_Silent_p.K1456K			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1456	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TAGAAACAAGTTTCAAAAAAG	0.373																																					p.K1456K		Atlas-SNP	.											.	BAZ1A	128	.	0			c.A4368G						.						78.0	74.0	75.0					14																	35227928		2203	4300	6503	SO:0001819	synonymous_variant	11177	exon25			AACAAGTTTCAAA	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.4368A>G	chr14.hg19:g.35227928T>C		58.0	0.0		65.0	4.0	NM_013448	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Silent	SNP	ENST00000382422.2	hg19	CCDS9651.1																																																																																			.	.		0.373	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
LRFN5	145581	hgsc.bcm.edu	37	14	42357029	42357029	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:42357029A>G	ENST00000298119.4	+	3	2390	c.1201A>G	c.(1201-1203)Acc>Gcc	p.T401A	LRFN5_ENST00000554171.1_Missense_Mutation_p.T401A|LRFN5_ENST00000554120.1_Missense_Mutation_p.T401A	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	401						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTCAACTTCTACCAAGTCAGG	0.368										HNSCC(30;0.082)																											p.T401A		Atlas-SNP	.											.	LRFN5	269	.	0			c.A1201G						.						83.0	84.0	83.0					14																	42357029		2203	4300	6503	SO:0001583	missense	145581	exon3			ACTTCTACCAAGT	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1201A>G	chr14.hg19:g.42357029A>G	ENSP00000298119:p.Thr401Ala	62.0	0.0		92.0	4.0	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	hg19	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	5.968	0.362503	0.11296	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.52057	0.78;0.69;0.68	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000018	T	0.27798	0.0684	N	0.12831	0.26	0.58432	D	0.999999	B;B	0.14438	0.0;0.01	B;B	0.12156	0.003;0.007	T	0.12016	-1.0564	10	0.07990	T	0.79	.	13.6708	0.62424	1.0:0.0:0.0:0.0	.	401;401	G3V364;Q96NI6	.;LRFN5_HUMAN	A	401	ENSP00000298119:T401A;ENSP00000451897:T401A;ENSP00000451067:T401A	ENSP00000298119:T401A	T	+	1	0	LRFN5	41426779	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.920000	0.70017	2.165000	0.68154	0.460000	0.39030	ACC	.	.		0.368	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
TMEM260	54916	hgsc.bcm.edu	37	14	57083976	57083976	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:57083976A>G	ENST00000261556.6	+	9	1139	c.1017A>G	c.(1015-1017)agA>agG	p.R339R	TMEM260_ENST00000538838.1_Silent_p.R339R|TMEM260_ENST00000553335.1_3'UTR|TMEM260_ENST00000536419.1_5'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	339						integral component of membrane (GO:0016021)											TTGCTTGGAGAGCAAATTTAG	0.313																																					p.R339R		Atlas-SNP	.											.	.	.	.	0			c.A1017G						.						128.0	122.0	124.0					14																	57083976		2202	4299	6501	SO:0001819	synonymous_variant	0	exon9			TTGGAGAGCAAAT	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1017A>G	chr14.hg19:g.57083976A>G		109.0	0.0		108.0	5.0	NM_017799	A8KAN4|B3KPF5|Q86XE1	Silent	SNP	ENST00000261556.6	hg19	CCDS9727.2																																																																																			.	.		0.313	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
PCNXL4	64430	hgsc.bcm.edu	37	14	60585412	60585412	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:60585412T>C	ENST00000406854.1	+	7	2496		c.e7+2		PCNXL4_ENST00000406949.1_Splice_Site|PCNXL4_ENST00000535349.1_Splice_Site|PCNXL4_ENST00000404681.2_Splice_Site|PCNXL4_ENST00000317623.4_Splice_Site			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)							integral component of membrane (GO:0016021)											GAAGTTTAGGTAAGTAAATGG	0.398																																					.		Atlas-SNP	.											.	.	.	.	0			c.1240+2T>C						.						66.0	49.0	55.0					14																	60585412		2203	4300	6503	SO:0001630	splice_region_variant	64430	exon6			TTTAGGTAAGTAA	AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.1942+2T>C	chr14.hg19:g.60585412T>C		80.0	0.0		100.0	4.0	NM_022495	A8MXM2|Q9BQG8|Q9H9F2	Splice_Site	SNP	ENST00000406854.1	hg19		.	.	.	.	.	.	.	.	.	.	T	22.6	4.308018	0.81247	.	.	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681;ENST00000554534	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C14orf135	59655165	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.033000	0.76504	2.367000	0.80283	0.528000	0.53228	.	.	.		0.398	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495	Intron
ZFYVE26	23503	hgsc.bcm.edu	37	14	68220472	68220472	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:68220472T>C	ENST00000347230.4	-	39	7278	c.7140A>G	c.(7138-7140)ggA>ggG	p.G2380G	RN7SL213P_ENST00000463482.2_RNA|ZFYVE26_ENST00000557306.1_Silent_p.G226G	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2380					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CATTTTTCCCTCCCAGCATGA	0.393																																					p.G2380G		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.A7140G						.						73.0	63.0	66.0					14																	68220472		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon39			TTTCCCTCCCAGC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.7140A>G	chr14.hg19:g.68220472T>C		61.0	0.0		77.0	4.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	hg19	CCDS9788.1																																																																																			.	.		0.393	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
C14orf1	11161	hgsc.bcm.edu	37	14	76117958	76117958	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:76117958C>T	ENST00000256319.6	-	5	808	c.363G>A	c.(361-363)atG>atA	p.M121I	FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000553587.1_Intron	NM_007176.3	NP_009107.1	Q9UKR5	ERG28_HUMAN	chromosome 14 open reading frame 1	121					sterol biosynthetic process (GO:0016126)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)		GCCCGACCAGCATACCCAGGA	0.473																																					p.M121I		Atlas-SNP	.											.	C14orf1	13	.	0			c.G363A						.						162.0	161.0	161.0					14																	76117958		2203	4300	6503	SO:0001583	missense	11161	exon5			GACCAGCATACCC	AF134159	CCDS9845.1	14q24.3	2012-08-16			ENSG00000133935	ENSG00000133935			1187	protein-coding gene	gene with protein product		604576				10449901, 12958361, 11160377	Standard	NM_007176		Approved	NET51, ERG28	uc001xrt.3	Q9UKR5	OTTHUMG00000171488	ENST00000256319.6:c.363G>A	chr14.hg19:g.76117958C>T	ENSP00000256319:p.Met121Ile	76.0	0.0		104.0	37.0	NM_007176	Q9P093|Q9UPI2	Missense_Mutation	SNP	ENST00000256319.6	hg19	CCDS9845.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949887	0.92660	.	.	ENSG00000133935	ENST00000256319	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.85831	0.5788	M	0.91818	3.245	0.80722	D	1	D	0.57899	0.981	D	0.67900	0.954	D	0.88229	0.2902	9	0.72032	D	0.01	-35.6857	19.4226	0.94727	0.0:1.0:0.0:0.0	.	121	Q9UKR5	ERG28_HUMAN	I	121	.	ENSP00000256319:M121I	M	-	3	0	C14orf1	75187711	1.000000	0.71417	0.990000	0.47175	0.871000	0.50021	7.226000	0.78060	2.684000	0.91462	0.650000	0.86243	ATG	.	.		0.473	C14orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413683.1	NM_007176	
NRDE2	55051	hgsc.bcm.edu	37	14	90755002	90755002	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:90755002A>G	ENST00000354366.3	-	11	2949	c.2717T>C	c.(2716-2718)cTg>cCg	p.L906P	NRDE2_ENST00000357904.3_Missense_Mutation_p.L675P	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	906																	GCATTTAGCCAGGCTAATTAG	0.483																																					p.L906P		Atlas-SNP	.											.	.	.	.	0			c.T2717C						.						63.0	60.0	61.0					14																	90755002		2203	4300	6503	SO:0001583	missense	55051	exon11			TTAGCCAGGCTAA	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.2717T>C	chr14.hg19:g.90755002A>G	ENSP00000346335:p.Leu906Pro	45.0	0.0		72.0	4.0	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	hg19	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.566942	0.45694	.	.	ENSG00000119720	ENST00000354366;ENST00000357904	T;T	0.34859	1.56;1.34	4.84	4.84	0.62591	.	0.086877	0.47852	D	0.000207	T	0.55593	0.1930	M	0.76002	2.32	0.80722	D	1	D;D	0.58620	0.971;0.983	P;P	0.59761	0.732;0.863	T	0.58896	-0.7555	10	0.48119	T	0.1	-8.3797	14.5799	0.68282	1.0:0.0:0.0:0.0	.	675;906	E9PBK4;Q9H7Z3	.;CN102_HUMAN	P	906;675	ENSP00000346335:L906P;ENSP00000350579:L675P	ENSP00000346335:L906P	L	-	2	0	C14orf102	89824755	0.509000	0.26163	0.044000	0.18714	0.075000	0.17131	5.159000	0.64923	2.038000	0.60285	0.528000	0.53228	CTG	.	.		0.483	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
CCDC88C	440193	hgsc.bcm.edu	37	14	91806281	91806281	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:91806281T>C	ENST00000389857.6	-	7	657	c.571A>G	c.(571-573)Agc>Ggc	p.S191G		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	191					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				AGCACCATGCTCCTCGACAGG	0.667																																					p.S191G		Atlas-SNP	.											.	CCDC88C	192	.	0			c.A571G						.						14.0	18.0	16.0					14																	91806281		2043	4182	6225	SO:0001583	missense	440193	exon7			CCATGCTCCTCGA		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.571A>G	chr14.hg19:g.91806281T>C	ENSP00000374507:p.Ser191Gly	147.0	0.0		181.0	12.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	hg19	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.775385	0.70107	.	.	ENSG00000015133	ENST00000389857;ENST00000541408	T	0.17370	2.28	5.18	5.18	0.71444	.	0.246855	0.27526	U	0.018968	T	0.14570	0.0352	N	0.16656	0.425	0.80722	D	1	B	0.26547	0.152	B	0.32928	0.155	T	0.08994	-1.0695	10	0.72032	D	0.01	-16.8104	15.0422	0.71799	0.0:0.0:0.0:1.0	.	191	Q9P219	DAPLE_HUMAN	G	191;155	ENSP00000374507:S191G	ENSP00000374507:S191G	S	-	1	0	CCDC88C	90876034	1.000000	0.71417	0.838000	0.33150	0.968000	0.65278	6.276000	0.72601	1.942000	0.56320	0.459000	0.35465	AGC	.	.		0.667	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
YY1	7528	hgsc.bcm.edu	37	14	100742844	100742844	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:100742844C>G	ENST00000262238.4	+	4	1181	c.921C>G	c.(919-921)ttC>ttG	p.F307L		NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	307	Binding to DNA.|Involved in nuclear matrix association.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				CAAAGATGTTCAGGGATAACT	0.428																																					p.F307L		Atlas-SNP	.											.	YY1	20	.	0			c.C921G						.						76.0	73.0	74.0					14																	100742844		2203	4300	6503	SO:0001583	missense	7528	exon4			GATGTTCAGGGAT	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.921C>G	chr14.hg19:g.100742844C>G	ENSP00000262238:p.Phe307Leu	85.0	0.0		105.0	27.0	NM_003403	Q14935	Missense_Mutation	SNP	ENST00000262238.4	hg19	CCDS9957.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566514	0.86439	.	.	ENSG00000100811	ENST00000262238;ENST00000553625	T	0.18502	2.21	5.63	5.63	0.86233	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.40423	0.1116	L	0.55743	1.74	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.02844	-1.1103	10	0.52906	T	0.07	.	20.0344	0.97551	0.0:1.0:0.0:0.0	.	307	P25490	TYY1_HUMAN	L	307;117	ENSP00000262238:F307L	ENSP00000262238:F307L	F	+	3	2	YY1	99812597	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.943000	0.70211	2.803000	0.96430	0.650000	0.86243	TTC	.	.		0.428	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318277.1	NM_003403	
GABRB3	2562	hgsc.bcm.edu	37	15	26828551	26828551	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:26828551T>C	ENST00000311550.5	-	5	583	c.472A>G	c.(472-474)Aca>Gca	p.T158A	GABRB3_ENST00000541819.2_Missense_Mutation_p.T214A|GABRB3_ENST00000400188.3_Missense_Mutation_p.T87A|GABRB3_ENST00000545868.1_Missense_Mutation_p.T73A|GABRB3_ENST00000299267.4_Missense_Mutation_p.T158A	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	158					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CATGCTGCTGTCGTGGTGATT	0.468																																					p.T158A		Atlas-SNP	.											.	GABRB3	338	.	0			c.A472G						.						148.0	131.0	137.0					15																	26828551		2203	4300	6503	SO:0001583	missense	2562	exon5			CTGCTGTCGTGGT		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.472A>G	chr15.hg19:g.26828551T>C	ENSP00000308725:p.Thr158Ala	93.0	0.0		78.0	4.0	NM_021912	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	hg19	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.741182	0.30865	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868;ENST00000555094	T;T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33;-1.33	4.76	4.76	0.60689	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.91112	0.7202	M	0.91768	3.24	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.995	D;D;D	0.76071	0.918;0.987;0.945	D	0.92932	0.6364	10	0.72032	D	0.01	.	13.74	0.62842	0.0:0.0:0.0:1.0	.	214;158;158	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	A	158;214;158;87;73;73	ENSP00000308725:T158A;ENSP00000442408:T214A;ENSP00000299267:T158A;ENSP00000383049:T87A;ENSP00000439169:T73A;ENSP00000452272:T73A	ENSP00000299267:T158A	T	-	1	0	GABRB3	24379644	1.000000	0.71417	0.466000	0.27168	0.730000	0.41778	7.854000	0.86942	1.900000	0.55004	0.528000	0.53228	ACA	.	.		0.468	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
C15orf52	388115	hgsc.bcm.edu	37	15	40628995	40628995	+	Silent	SNP	T	T	C	rs143912259		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:40628995T>C	ENST00000559313.1	-	8	909	c.894A>G	c.(892-894)aaA>aaG	p.K298K	C15orf52_ENST00000557973.1_5'Flank|C15orf52_ENST00000397536.2_Silent_p.K88K	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	298							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GGGGCTGTAGTTTCTGGTGGC	0.577																																					p.K298K		Atlas-SNP	.											.	C15orf52	47	.	0			c.A894G						.	T		0,4406		0,0,2203	57.0	63.0	61.0		894	2.6	0.1	15	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C15orf52	NM_207380.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		298/535	40628995	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	388115	exon8			CTGTAGTTTCTGG	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.894A>G	chr15.hg19:g.40628995T>C		64.0	0.0		74.0	39.0	NM_207380	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Silent	SNP	ENST00000559313.1	hg19	CCDS10055.2																																																																																			.	T|1.000;C|0.000		0.577	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319567.2	NM_207380	
SPTBN5	51332	hgsc.bcm.edu	37	15	42163597	42163597	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:42163597A>G	ENST00000320955.6	-	29	5650	c.5423T>C	c.(5422-5424)gTc>gCc	p.V1808A		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1808					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCTCTGACGGACCATGGGGCC	0.667																																					p.V1773A		Atlas-SNP	.											.	SPTBN5	171	.	0			c.T5318C						.						12.0	14.0	13.0					15																	42163597		1990	4115	6105	SO:0001583	missense	51332	exon29			TGACGGACCATGG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.5423T>C	chr15.hg19:g.42163597A>G	ENSP00000317790:p.Val1808Ala	212.0	0.0		153.0	7.0	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	hg19		.	.	.	.	.	.	.	.	.	.	.	5.207	0.223659	0.09863	.	.	ENSG00000137877	ENST00000320955	T	0.54866	0.55	4.7	-0.9	0.10544	.	0.740862	0.12022	N	0.506785	T	0.21022	0.0506	N	0.01771	-0.73	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24977	-1.0145	10	0.18276	T	0.48	.	7.8825	0.29631	0.7049:0.0:0.2951:0.0	.	1808	Q9NRC6	SPTN5_HUMAN	A	1808	ENSP00000317790:V1808A	ENSP00000317790:V1808A	V	-	2	0	SPTBN5	39950889	0.006000	0.16342	0.000000	0.03702	0.022000	0.10575	0.645000	0.24782	-0.130000	0.11599	-0.337000	0.08149	GTC	.	.		0.667	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
CEP152	22995	hgsc.bcm.edu	37	15	49033896	49033896	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:49033896T>C	ENST00000380950.2	-	26	4182	c.3995A>G	c.(3994-3996)gAg>gGg	p.E1332G	CEP152_ENST00000399334.3_Missense_Mutation_p.E1276G|CEP152_ENST00000325747.5_Missense_Mutation_p.E1239G	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1332					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AATCTTTTTCTCAGCCCTGTG	0.383																																					p.E1332G		Atlas-SNP	.											.	CEP152	145	.	0			c.A3995G						.						149.0	137.0	141.0					15																	49033896		1807	4077	5884	SO:0001583	missense	22995	exon26			TTTTTCTCAGCCC	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3995A>G	chr15.hg19:g.49033896T>C	ENSP00000370337:p.Glu1332Gly	70.0	0.0		89.0	4.0	NM_001194998	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	hg19	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.553265	0.65425	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.66280	0.06;-0.01;-0.2	5.87	5.87	0.94306	.	0.065981	0.64402	D	0.000015	T	0.74129	0.3676	M	0.68593	2.085	0.58432	D	0.999999	D;D;D	0.63046	0.985;0.992;0.992	P;P;P	0.57101	0.676;0.813;0.813	T	0.77395	-0.2604	10	0.87932	D	0	-15.8868	16.2774	0.82651	0.0:0.0:0.0:1.0	.	1239;1332;1276	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	G	1332;1239;1276	ENSP00000370337:E1332G;ENSP00000321000:E1239G;ENSP00000382271:E1276G	ENSP00000321000:E1239G	E	-	2	0	CEP152	46821188	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.451000	0.80668	2.247000	0.74100	0.482000	0.46254	GAG	.	.		0.383	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
RORA	6095	hgsc.bcm.edu	37	15	60806947	60806947	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:60806947T>C	ENST00000335670.6	-	4	392	c.292A>G	c.(292-294)Agg>Ggg	p.R98G	RP11-219B17.1_ENST00000559824.1_RNA|RP11-219B17.1_ENST00000559902.1_RNA|RORA_ENST00000261523.5_Missense_Mutation_p.R131G|RORA_ENST00000309157.4_Missense_Mutation_p.R123G|RP11-219B17.1_ENST00000501579.2_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000449337.2_Missense_Mutation_p.R43G|RP11-219B17.1_ENST00000558140.1_RNA|RORA_ENST00000560004.1_5'UTR	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	98					angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TGACTTCTCCTGAAAAAGCCC	0.423																																					p.R131G		Atlas-SNP	.											.	RORA	114	.	0			c.A391G						.						119.0	111.0	114.0					15																	60806947		2203	4300	6503	SO:0001583	missense	6095	exon5			TTCTCCTGAAAAA	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.292A>G	chr15.hg19:g.60806947T>C	ENSP00000335087:p.Arg98Gly	107.0	0.0		99.0	4.0	NM_134260	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	hg19	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.850811	0.71719	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.97870	-4.58;-4.58;-4.58;-4.58	6.17	3.74	0.42951	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.038962	0.85682	D	0.000000	D	0.99052	0.9675	H	0.96080	3.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.992;0.999;0.998	D	0.99250	1.0887	10	0.87932	D	0	.	13.0657	0.59032	0.0:0.0:0.3841:0.6159	.	98;123;131;43	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	G	98;43;123;131	ENSP00000335087:R98G;ENSP00000402971:R43G;ENSP00000309753:R123G;ENSP00000261523:R131G	ENSP00000261523:R131G	R	-	1	2	RORA	58594239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.038000	0.57318	1.119000	0.41883	0.533000	0.62120	AGG	.	.		0.423	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
CLN6	54982	hgsc.bcm.edu	37	15	68504129	68504129	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:68504129C>T	ENST00000249806.5	-	4	527	c.370G>A	c.(370-372)Gcc>Acc	p.A124T	CLN6_ENST00000538696.1_Missense_Mutation_p.A156T|CLN6_ENST00000564752.1_Missense_Mutation_p.A124T|CLN6_ENST00000418702.2_Intron|RP11-315D16.2_ENST00000562767.1_Intron|CLN6_ENST00000566347.1_Intron|CLN6_ENST00000565471.1_Intron	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant	124					cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						TGGATGCTGGCACCCATGATG	0.587																																					p.A124T		Atlas-SNP	.											.	CLN6	16	.	0			c.G370A						.						126.0	117.0	120.0					15																	68504129		2200	4298	6498	SO:0001583	missense	54982	exon4			TGCTGGCACCCAT	AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.370G>A	chr15.hg19:g.68504129C>T	ENSP00000249806:p.Ala124Thr	95.0	0.0		95.0	4.0	NM_017882	A8K560|B4DDH6|Q6IAB1|Q96SR0	Missense_Mutation	SNP	ENST00000249806.5	hg19	CCDS10227.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575549	0.65878	.	.	ENSG00000128973	ENST00000249806;ENST00000538696	D;D	0.95342	-3.68;-3.68	5.14	4.13	0.48395	.	0.057879	0.64402	D	0.000002	D	0.92185	0.7522	L	0.40543	1.245	0.80722	D	1	P;P	0.45531	0.86;0.767	P;B	0.44561	0.453;0.359	D	0.91988	0.5600	10	0.39692	T	0.17	-38.2012	16.3115	0.82873	0.1413:0.8587:0.0:0.0	.	156;124	B4DDH6;Q9NWW5	.;CLN6_HUMAN	T	124;156	ENSP00000249806:A124T;ENSP00000445770:A156T	ENSP00000249806:A124T	A	-	1	0	CLN6	66291183	0.990000	0.36364	1.000000	0.80357	0.992000	0.81027	2.868000	0.48436	2.388000	0.81334	0.511000	0.50034	GCC	.	.		0.587	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257066.1	NM_017882	
ITGA11	22801	hgsc.bcm.edu	37	15	68620599	68620599	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:68620599A>G	ENST00000315757.7	-	16	1989	c.1903T>C	c.(1903-1905)Tcc>Ccc	p.S635P	ITGA11_ENST00000423218.2_Splice_Site_p.S635P	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	635					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						ACTGGGCGGGACCTGGAGGAG	0.602																																					p.S635P		Atlas-SNP	.											.	ITGA11	110	.	0			c.T1903C						.						73.0	78.0	76.0					15																	68620599		1993	4170	6163	SO:0001630	splice_region_variant	22801	exon16			GGCGGGACCTGGA	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1902-1T>C	chr15.hg19:g.68620599A>G		92.0	0.0		130.0	8.0	NM_001004439	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	hg19	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.858117	0.51376	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491	T;T	0.61742	0.08;0.08	5.7	1.85	0.25348	Integrin alpha-2 (1);	0.224650	0.48286	D	0.000193	T	0.67988	0.2952	M	0.71036	2.16	0.45567	D	0.998519	D;D	0.58620	0.983;0.982	D;P	0.66979	0.948;0.895	T	0.66400	-0.5933	10	0.87932	D	0	.	6.2284	0.20722	0.4256:0.3435:0.0:0.2309	.	635;635	A8K8T0;Q9UKX5	.;ITA11_HUMAN	P	635;635;270	ENSP00000327290:S635P;ENSP00000403392:S635P	ENSP00000327290:S635P	S	-	1	0	ITGA11	66407653	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	2.434000	0.44802	0.419000	0.25927	0.459000	0.35465	TCC	.	.		0.602	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	Missense_Mutation
MYO9A	4649	hgsc.bcm.edu	37	15	72170493	72170493	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:72170493T>C	ENST00000356056.5	-	31	6291	c.5819A>G	c.(5818-5820)gAg>gGg	p.E1940G	MYO9A_ENST00000424560.1_Missense_Mutation_p.E2011G|MYO9A_ENST00000444904.1_Missense_Mutation_p.E1921G|MYO9A_ENST00000564571.1_Missense_Mutation_p.E1940G	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1940	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATCACGCTGCTCAAGCCTCAT	0.373																																					p.E1940G		Atlas-SNP	.											.	MYO9A	203	.	0			c.A5819G						.						86.0	85.0	85.0					15																	72170493		2199	4297	6496	SO:0001583	missense	4649	exon31			CGCTGCTCAAGCC	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.5819A>G	chr15.hg19:g.72170493T>C	ENSP00000348349:p.Glu1940Gly	120.0	0.0		184.0	9.0	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	hg19	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.224819	0.58668	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.14640	2.49;2.49;2.49	5.21	5.21	0.72293	.	.	.	.	.	T	0.38321	0.1036	M	0.76574	2.34	0.51012	D	0.999909	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	T	0.25813	-1.0121	9	0.87932	D	0	.	15.373	0.74581	0.0:0.0:0.0:1.0	.	2011;1940	B2RTY4-4;B2RTY4	.;MYO9A_HUMAN	G	1940;2011;1921	ENSP00000348349:E1940G;ENSP00000399162:E2011G;ENSP00000398250:E1921G	ENSP00000348349:E1940G	E	-	2	0	MYO9A	69957547	1.000000	0.71417	1.000000	0.80357	0.100000	0.18952	7.628000	0.83189	2.075000	0.62263	0.482000	0.46254	GAG	.	.		0.373	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
SCAMP5	192683	hgsc.bcm.edu	37	15	75310253	75310253	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:75310253C>T	ENST00000361900.6	+	6	543	c.336C>T	c.(334-336)ttC>ttT	p.F112F	SCAMP5_ENST00000562212.1_Silent_p.F112F|SCAMP5_ENST00000425597.3_Silent_p.F112F|SCAMP5_ENST00000568081.1_Silent_p.F45F|SCAMP5_ENST00000545456.1_Silent_p.F41F|SCAMP5_ENST00000565923.1_3'UTR	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	112					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)				large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						TCTTTACCTTCATGGCTCAGT	0.632																																					p.F112F		Atlas-SNP	.											.	SCAMP5	34	.	0			c.C336T						.						127.0	126.0	126.0					15																	75310253		2078	4202	6280	SO:0001819	synonymous_variant	192683	exon6			TACCTTCATGGCT	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.336C>T	chr15.hg19:g.75310253C>T		121.0	0.0		135.0	50.0	NM_001178111	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Silent	SNP	ENST00000361900.6	hg19	CCDS45306.1																																																																																			.	.		0.632	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2	NM_138967	
IQGAP1	8826	hgsc.bcm.edu	37	15	91043300	91043300	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:91043300T>C	ENST00000268182.5	+	38	5058	c.4934T>C	c.(4933-4935)cTc>cCc	p.L1645P	IQGAP1_ENST00000560738.1_Missense_Mutation_p.L1073P	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1645	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AATGTCAACCTCCTGATCTTC	0.398																																					p.L1645P		Atlas-SNP	.											.	IQGAP1	140	.	0			c.T4934C						.						99.0	91.0	93.0					15																	91043300		2198	4298	6496	SO:0001583	missense	8826	exon38			TCAACCTCCTGAT	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4934T>C	chr15.hg19:g.91043300T>C	ENSP00000268182:p.Leu1645Pro	94.0	0.0		96.0	5.0	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	hg19	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.583534	0.86748	.	.	ENSG00000140575	ENST00000268182	T	0.03242	4.0	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.21387	0.0515	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.00595	-1.1653	10	0.66056	D	0.02	-14.7305	15.1546	0.72730	0.0:0.0:0.0:1.0	.	266;1645	B4DNP4;P46940	.;IQGA1_HUMAN	P	1645	ENSP00000268182:L1645P	ENSP00000268182:L1645P	L	+	2	0	IQGAP1	88844304	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.901000	0.87382	2.180000	0.69256	0.454000	0.30748	CTC	.	.		0.398	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
LRRC28	123355	hgsc.bcm.edu	37	15	99892588	99892588	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:99892588C>T	ENST00000301981.3	+	7	847	c.607C>T	c.(607-609)Cga>Tga	p.R203*	LRRC28_ENST00000422500.2_Nonsense_Mutation_p.R134*|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000447360.2_Nonsense_Mutation_p.R203*|LRRC28_ENST00000442993.2_3'UTR|LRRC28_ENST00000558879.1_Intron	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	203										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			AGGTCGATCTCGAGAACTACA	0.353																																					p.R203X		Atlas-SNP	.											LRRC28,NS,malignant_melanoma,0,1	LRRC28	38	.	0			c.C607T						.						166.0	156.0	160.0					15																	99892588		2197	4297	6494	SO:0001587	stop_gained	123355	exon7			CGATCTCGAGAAC	AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.607C>T	chr15.hg19:g.99892588C>T	ENSP00000304923:p.Arg203*	33.0	0.0		25.0	2.0	NM_144598	A8KA22|Q6UY49|Q6ZSS6	Nonsense_Mutation	SNP	ENST00000301981.3	hg19	CCDS10380.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692475	0.88735	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500	.	.	.	5.52	4.6	0.57074	.	0.131334	0.49916	D	0.000129	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	13.6262	0.62165	0.0:0.9257:0.0:0.0743	.	.	.	.	X	203;203;134	.	ENSP00000304923:R203X	R	+	1	2	LRRC28	97710111	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	4.317000	0.59184	1.334000	0.45468	0.655000	0.94253	CGA	.	.		0.353	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313546.1	NM_144598	
SNRPA1	6627	hgsc.bcm.edu	37	15	101827183	101827183	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:101827183T>C	ENST00000254193.6	-	5	461	c.389A>G	c.(388-390)cAt>cGt	p.H130R	SNRPA1_ENST00000560856.1_5'UTR	NM_003090.2	NP_003081.2	P09661	RU2A_HUMAN	small nuclear ribonucleoprotein polypeptide A'	130	LRRCT.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	Lung NSC(78;0.00156)|all_lung(78;0.00195)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00113)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CAATCTGTAATGCTTCTTATT	0.373																																					p.H130R		Atlas-SNP	.											.	SNRPA1	11	.	0			c.A389G						.						114.0	117.0	116.0					15																	101827183		2203	4299	6502	SO:0001583	missense	6627	exon5			CTGTAATGCTTCT	AJ130971	CCDS10391.1	15q26.3	2011-10-11			ENSG00000131876	ENSG00000131876			11152	protein-coding gene	gene with protein product		603521				2928112	Standard	NM_003090		Approved	Lea1	uc002bww.3	P09661	OTTHUMG00000149871	ENST00000254193.6:c.389A>G	chr15.hg19:g.101827183T>C	ENSP00000254193:p.His130Arg	64.0	0.0		87.0	4.0	NM_003090	B2R5I6|Q8TBD2	Missense_Mutation	SNP	ENST00000254193.6	hg19	CCDS10391.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.715126	0.89112	.	.	ENSG00000131876	ENST00000254193	T	0.60548	0.18	5.62	5.62	0.85841	U2A&apos (1);/phosphoprotein 32 family A, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.57140	0.2033	L	0.58969	1.84	0.80722	D	1	B	0.25105	0.118	B	0.28991	0.097	T	0.56396	-0.7986	10	0.48119	T	0.1	-22.7339	14.9907	0.71387	0.0:0.0:0.0:1.0	.	130	P09661	RU2A_HUMAN	R	130	ENSP00000254193:H130R	ENSP00000254193:H130R	H	-	2	0	SNRPA1	99644706	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.564000	0.82326	2.127000	0.65507	0.533000	0.62120	CAT	.	.		0.373	SNRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313621.2	NM_003090	
TELO2	9894	hgsc.bcm.edu	37	16	1551668	1551668	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:1551668T>C	ENST00000262319.6	+	11	1645	c.1366T>C	c.(1366-1368)Tcc>Ccc	p.S456P		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	456					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				TTAAAGCACGTCCCTCGTTCC	0.607																																					p.S456P		Atlas-SNP	.											.	TELO2	44	.	0			c.T1366C						.						56.0	69.0	64.0					16																	1551668		2195	4300	6495	SO:0001583	missense	9894	exon11			AGCACGTCCCTCG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1366T>C	chr16.hg19:g.1551668T>C	ENSP00000262319:p.Ser456Pro	121.0	0.0		138.0	6.0	NM_016111	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	hg19	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.237542	0.22711	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	D	0.84223	-1.82	5.18	-7.91	0.01165	.	1.609610	0.02739	N	0.116080	T	0.60547	0.2277	N	0.01742	-0.745	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.55560	-0.8122	10	0.27785	T	0.31	-1.6602	6.2357	0.20762	0.1148:0.5761:0.1259:0.1832	.	456	Q9Y4R8	TELO2_HUMAN	P	70;456	ENSP00000262319:S456P	ENSP00000262319:S456P	S	+	1	0	TELO2	1491669	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.063000	0.00622	-1.421000	0.02007	0.533000	0.62120	TCC	.	.		0.607	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
PKD1	5310	hgsc.bcm.edu	37	16	2153323	2153323	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:2153323T>C	ENST00000262304.4	-	23	8943	c.8735A>G	c.(8734-8736)gAc>gGc	p.D2912G	PKD1_ENST00000423118.1_Missense_Mutation_p.D2912G|PKD1_ENST00000561991.1_5'Flank	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2912					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTTGCTGCTGTCCAGGGTGAC	0.697																																					p.D2912G		Atlas-SNP	.											.	PKD1	184	.	0			c.A8735G						.						22.0	25.0	24.0					16																	2153323		2144	4222	6366	SO:0001583	missense	5310	exon23			CTGCTGTCCAGGG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8735A>G	chr16.hg19:g.2153323T>C	ENSP00000262304:p.Asp2912Gly	110.0	0.0		86.0	4.0	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	hg19	CCDS32369.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.630|5.630	0.300866|0.300866	0.10678|0.10678	.|.	.|.	ENSG00000008710|ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101|ENST00000382481	T;T|.	0.70164|.	-0.46;-0.46|.	4.89|4.89	3.8|3.8	0.43715|0.43715	.|.	0.427016|.	0.27836|.	N|.	0.017643|.	T|T	0.34019|0.34019	0.0883|0.0883	N|N	0.19112|0.19112	0.55|0.55	0.22975|0.22975	N|N	0.998482|0.998482	P;B|.	0.34615|.	0.459;0.002|.	B;B|.	0.30401|.	0.115;0.003|.	T|T	0.26538|0.26538	-1.0100|-1.0100	10|6	0.23302|0.87932	T|D	0.38|0	.|.	10.4202|10.4202	0.44346|0.44346	0.0:0.077:0.0:0.923|0.0:0.077:0.0:0.923	.|.	2912;2912|.	P98161-3;P98161|.	.;PKD1_HUMAN|.	G|A	2912;2912;2247|1150	ENSP00000262304:D2912G;ENSP00000399501:D2912G|.	ENSP00000262304:D2912G|ENSP00000371921:T1150A	D|T	-|-	2|1	0|0	PKD1|PKD1	2093324|2093324	0.986000|0.986000	0.35501|0.35501	0.184000|0.184000	0.23157|0.23157	0.533000|0.533000	0.34776|0.34776	3.312000|3.312000	0.51927|0.51927	0.888000|0.888000	0.36160|0.36160	0.454000|0.454000	0.30748|0.30748	GAC|ACA	.	.		0.697	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
TIGD7	91151	hgsc.bcm.edu	37	16	3348989	3348989	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:3348989A>G	ENST00000396862.1	-	2	3454	c.1626T>C	c.(1624-1626)ccT>ccC	p.P542P	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Silent_p.P542P	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	542						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CAGAAGTTGAAGGCCCACTGA	0.353																																					p.P542P		Atlas-SNP	.											.	TIGD7	41	.	0			c.T1626C						.						50.0	51.0	50.0					16																	3348989		2197	4300	6497	SO:0001819	synonymous_variant	91151	exon2			AGTTGAAGGCCCA	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1626T>C	chr16.hg19:g.3348989A>G		92.0	0.0		80.0	4.0	NM_033208	Q9BXZ0	Silent	SNP	ENST00000396862.1	hg19	CCDS10500.1																																																																																			.	.		0.353	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208	
NLRC3	197358	hgsc.bcm.edu	37	16	3602250	3602250	+	RNA	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:3602250T>C	ENST00000301749.7	-	0	2703				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCCGCTGGGCTCCCATGGGCC	0.557																																					p.G766G		Atlas-SNP	.											.	NLRC3	103	.	0			c.A2298G						.						82.0	78.0	79.0					16																	3602250		1925	4142	6067			197358	exon10			CTGGGCTCCCATG	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3602250T>C		92.0	0.0		117.0	5.0	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	hg19																																																																																				.	.		0.557	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
ATF7IP2	80063	hgsc.bcm.edu	37	16	10527419	10527419	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:10527419G>A	ENST00000396560.2	+	4	1100	c.873G>A	c.(871-873)gaG>gaA	p.E291E	ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000396559.1_Silent_p.E291E|ATF7IP2_ENST00000324570.5_Silent_p.E291E|ATF7IP2_ENST00000356427.2_Silent_p.E291E	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						CAGAAAACGAGGAAAATGTTA	0.328																																					p.E291E		Atlas-SNP	.											.	ATF7IP2	40	.	0			c.G873A						.						58.0	60.0	60.0					16																	10527419		2196	4299	6495	SO:0001819	synonymous_variant	80063	exon4			AAACGAGGAAAAT	AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.873G>A	chr16.hg19:g.10527419G>A		168.0	0.0		190.0	47.0	NM_024997	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Silent	SNP	ENST00000396560.2	hg19	CCDS10540.1																																																																																			.	.		0.328	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997	
CIITA	4261	hgsc.bcm.edu	37	16	10989540	10989540	+	Missense_Mutation	SNP	A	A	G	rs143732812		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:10989540A>G	ENST00000324288.8	+	3	347	c.214A>G	c.(214-216)Acc>Gcc	p.T72A	CIITA_ENST00000381835.5_Missense_Mutation_p.T72A|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	72	Asp/Glu-rich (acidic).				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CGACACAGACACCATCAACTG	0.562			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.T72A		Atlas-SNP	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.A214G						.	A	ALA/THR	0,4394		0,0,2197	93.0	88.0	90.0		214	4.8	1.0	16	dbSNP_134	90	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CIITA	NM_000246.3	58	0,2,6495	GG,GA,AA		0.0233,0.0,0.0154	probably-damaging	72/1131	10989540	2,12992	2197	4300	6497	SO:0001583	missense	4261	exon3			ACAGACACCATCA	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.214A>G	chr16.hg19:g.10989540A>G	ENSP00000316328:p.Thr72Ala	102.0	0.0		136.0	6.0	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	hg19	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.774165	0.69992	0.0	2.33E-4	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	D;T	0.85702	-2.02;0.52	4.78	4.78	0.61160	.	0.000000	0.48286	D	0.000195	D	0.89497	0.6732	L	0.57536	1.79	0.25508	N	0.987483	D;D;D;D;D;D	0.76494	0.999;0.993;0.997;0.997;0.998;0.998	D;D;D;D;D;P	0.85130	0.997;0.978;0.917;0.917;0.948;0.839	T	0.82016	-0.0666	10	0.46703	T	0.11	.	10.7295	0.46087	1.0:0.0:0.0:0.0	.	72;72;72;72;72;72	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	A	72	ENSP00000316328:T72A;ENSP00000371257:T72A	ENSP00000316328:T72A	T	+	1	0	CIITA	10897041	1.000000	0.71417	0.987000	0.45799	0.963000	0.63663	4.088000	0.57678	1.801000	0.52704	0.533000	0.62120	ACC	.	A|1.000;G|0.000		0.562	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ACSM2A	123876	hgsc.bcm.edu	37	16	20497902	20497902	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:20497902T>C	ENST00000573854.1	+	14	1750	c.1636T>C	c.(1636-1638)Ttt>Ctt	p.F546L	ACSM2A_ENST00000536134.1_Missense_Mutation_p.F318L|ACSM2A_ENST00000219054.6_Missense_Mutation_p.F546L|ACSM2A_ENST00000575690.1_Missense_Mutation_p.F546L|ACSM2A_ENST00000396104.2_Missense_Mutation_p.F546L|ACSM2A_ENST00000417235.2_Missense_Mutation_p.F467L|AC137056.1_ENST00000593357.1_5'Flank	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	546					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						ACAGATAGAGTTTGTCTTGAA	0.493																																					p.F546L		Atlas-SNP	.											.	ACSM2A	120	.	0			c.T1636C						.						140.0	138.0	139.0					16																	20497902		2203	4298	6501	SO:0001583	missense	123876	exon15			ATAGAGTTTGTCT	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1636T>C	chr16.hg19:g.20497902T>C	ENSP00000459451:p.Phe546Leu	149.0	0.0		163.0	8.0	NM_001010845	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	hg19	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.301749	0.60195	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	3.74	3.74	0.42951	.	0.000000	0.45126	D	0.000390	T	0.69378	0.3104	L	0.56769	1.78	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.72181	-0.4368	10	0.87932	D	0	-13.4765	10.867	0.46862	0.0:0.0:0.0:1.0	.	546	Q08AH3	ACS2A_HUMAN	L	467;546;318;546	ENSP00000392169:F467L;ENSP00000219054:F546L;ENSP00000445082:F318L;ENSP00000379411:F546L	ENSP00000219054:F546L	F	+	1	0	ACSM2A	20405403	1.000000	0.71417	0.990000	0.47175	0.321000	0.28281	5.650000	0.67944	1.565000	0.49641	0.254000	0.18369	TTT	.	.		0.493	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
DNAH3	55567	hgsc.bcm.edu	37	16	21139101	21139101	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:21139101T>C	ENST00000261383.3	-	8	1114	c.1115A>G	c.(1114-1116)gAa>gGa	p.E372G	DNAH3_ENST00000415178.1_Missense_Mutation_p.E372G|CTC-508F8.1_ENST00000575612.1_RNA	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	372	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CGCTAGTATTTCTGCTGTTCG	0.458																																					p.E372G		Atlas-SNP	.											.	DNAH3	1142	.	0			c.A1115G						.						130.0	129.0	129.0					16																	21139101		2201	4300	6501	SO:0001583	missense	55567	exon8			AGTATTTCTGCTG	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1115A>G	chr16.hg19:g.21139101T>C	ENSP00000261383:p.Glu372Gly	58.0	0.0		89.0	4.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.938486	0.52972	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.26223	1.75;1.9	5.42	5.42	0.78866	.	0.067691	0.56097	D	0.000021	T	0.38983	0.1061	M	0.65975	2.015	0.34727	D	0.729321	B;P	0.52061	0.229;0.95	B;P	0.52554	0.053;0.702	T	0.53961	-0.8364	10	0.36615	T	0.2	.	12.9781	0.58547	0.0:0.0:0.0:1.0	.	372;343	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	G	372;372;343	ENSP00000261383:E372G;ENSP00000394245:E372G	ENSP00000261383:E372G	E	-	2	0	DNAH3	21046602	1.000000	0.71417	0.958000	0.39756	0.936000	0.57629	3.781000	0.55394	2.055000	0.61198	0.460000	0.39030	GAA	.	.		0.458	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
HS3ST2	9956	hgsc.bcm.edu	37	16	22926369	22926369	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:22926369A>G	ENST00000261374.3	+	2	1024	c.590A>G	c.(589-591)gAc>gGc	p.D197G		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	197					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		ATGTCCCGAGACACCAAGCTG	0.577																																					p.D197G		Atlas-SNP	.											.	HS3ST2	59	.	0			c.A590G						.						124.0	111.0	115.0					16																	22926369		2197	4300	6497	SO:0001583	missense	9956	exon2			CCCGAGACACCAA	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.590A>G	chr16.hg19:g.22926369A>G	ENSP00000261374:p.Asp197Gly	89.0	0.0		81.0	4.0	NM_006043	Q52LZ1	Missense_Mutation	SNP	ENST00000261374.3	hg19	CCDS10606.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.761313	0.49468	.	.	ENSG00000122254	ENST00000261374;ENST00000540146	T	0.44083	0.93	5.25	5.25	0.73442	Sulfotransferase domain (1);	0.331796	0.35739	N	0.003019	T	0.37679	0.1012	L	0.45051	1.395	0.49915	D	0.999839	B	0.09022	0.002	B	0.18871	0.023	T	0.14364	-1.0475	10	0.40728	T	0.16	.	14.3773	0.66886	1.0:0.0:0.0:0.0	.	197	Q9Y278	HS3S2_HUMAN	G	197;205	ENSP00000261374:D197G	ENSP00000261374:D197G	D	+	2	0	HS3ST2	22833870	1.000000	0.71417	0.981000	0.43875	0.974000	0.67602	7.576000	0.82467	1.999000	0.58509	0.459000	0.35465	GAC	.	.		0.577	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
TNRC6A	27327	hgsc.bcm.edu	37	16	24801289	24801289	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:24801289A>G	ENST00000395799.3	+	6	1455	c.1326A>G	c.(1324-1326)caA>caG	p.Q442Q	TNRC6A_ENST00000315183.7_Silent_p.Q442Q	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	442	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1, AGO3 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TCAGTGGTCAACCTCAAAATA	0.423																																					p.Q442Q		Atlas-SNP	.											.	TNRC6A	171	.	0			c.A1326G						.						64.0	61.0	62.0					16																	24801289		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon6			TGGTCAACCTCAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1326A>G	chr16.hg19:g.24801289A>G		72.0	0.0		83.0	4.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.		0.423	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TNRC6A	27327	hgsc.bcm.edu	37	16	24801444	24801444	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:24801444A>G	ENST00000395799.3	+	6	1610	c.1481A>G	c.(1480-1482)cAg>cGg	p.Q494R	TNRC6A_ENST00000315183.7_Missense_Mutation_p.Q494R	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	494	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1, AGO3 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CCTCAGATGCAGGCTCCATCA	0.483																																					p.Q494R		Atlas-SNP	.											.	TNRC6A	171	.	0			c.A1481G						.						90.0	83.0	85.0					16																	24801444		2197	4300	6497	SO:0001583	missense	27327	exon6			AGATGCAGGCTCC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1481A>G	chr16.hg19:g.24801444A>G	ENSP00000379144:p.Gln494Arg	90.0	0.0		86.0	4.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	A	9.243	1.038871	0.19669	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12879	2.64;2.66	5.69	4.59	0.56863	.	0.153542	0.45606	D	0.000346	T	0.13372	0.0324	L	0.58101	1.795	0.80722	D	1	B;B;P	0.35011	0.358;0.358;0.48	B;B;B	0.30855	0.116;0.117;0.121	T	0.04708	-1.0932	10	0.13853	T	0.58	-0.8115	12.9948	0.58640	0.865:0.135:0.0:0.0	.	241;494;494	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	R	494	ENSP00000326900:Q494R;ENSP00000379144:Q494R	ENSP00000326900:Q494R	Q	+	2	0	TNRC6A	24708945	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.681000	0.61663	0.962000	0.38057	0.460000	0.39030	CAG	.	.		0.483	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
NFATC2IP	84901	hgsc.bcm.edu	37	16	28967623	28967623	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:28967623T>C	ENST00000320805.4	+	5	886	c.811T>C	c.(811-813)Tgc>Cgc	p.C271R	NFATC2IP_ENST00000562977.1_Intron|NFATC2IP_ENST00000564978.1_Intron|RP11-264B17.2_ENST00000568057.1_RNA|MIR4517_ENST00000578855.1_RNA|NFATC2IP_ENST00000568148.1_5'Flank|RP11-264B17.2_ENST00000569974.1_RNA	NM_032815.3	NP_116204.3	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein	271					cytokine production (GO:0001816)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(2)	11						CAAAATCCGTTGCCGGGCTGA	0.607																																					p.C271R		Atlas-SNP	.											.	NFATC2IP	24	.	0			c.T811C						.						43.0	42.0	42.0					16																	28967623		2197	4300	6497	SO:0001583	missense	84901	exon5			ATCCGTTGCCGGG	AK074761	CCDS10645.1	16p11.2	2010-09-13			ENSG00000176953	ENSG00000176953			25906	protein-coding gene	gene with protein product		614525				15698469	Standard	NM_032815		Approved	FLJ14639, NIP45, RAD60, ESC2	uc002dru.3	Q8NCF5	OTTHUMG00000097763	ENST00000320805.4:c.811T>C	chr16.hg19:g.28967623T>C	ENSP00000324792:p.Cys271Arg	68.0	0.0		90.0	4.0	NM_032815	B7Z4G5|Q66K34|Q6NVK1|Q8NFR2|Q96ST9	Missense_Mutation	SNP	ENST00000320805.4	hg19	CCDS10645.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669835	0.47677	.	.	ENSG00000176953	ENST00000320805	T	0.21543	2.0	5.49	5.49	0.81192	Ubiquitin (1);	0.123818	0.53938	D	0.000049	T	0.22166	0.0534	L	0.45581	1.43	0.80722	D	1	P	0.48503	0.911	B	0.43809	0.432	T	0.01452	-1.1351	10	0.37606	T	0.19	-12.6719	12.0051	0.53255	0.0:0.0:0.0:1.0	.	271	Q8NCF5	NF2IP_HUMAN	R	271	ENSP00000324792:C271R	ENSP00000324792:C271R	C	+	1	0	NFATC2IP	28875124	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.615000	0.54167	2.076000	0.62316	0.533000	0.62120	TGC	.	.		0.607	NFATC2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214999.2	NM_032815	
SRCAP	10847	hgsc.bcm.edu	37	16	30732698	30732698	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:30732698T>C	ENST00000262518.4	+	21	3827	c.3442T>C	c.(3442-3444)Tct>Cct	p.S1148P	SRCAP_ENST00000344771.4_Intron|SRCAP_ENST00000395059.2_Missense_Mutation_p.S1148P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1148	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CACCACCACTTCTACCACCAC	0.632																																					p.S1148P		Atlas-SNP	.											.	SRCAP	298	.	0			c.T3442C						.						96.0	84.0	88.0					16																	30732698		2197	4300	6497	SO:0001583	missense	10847	exon21			ACCACTTCTACCA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3442T>C	chr16.hg19:g.30732698T>C	ENSP00000262518:p.Ser1148Pro	69.0	0.0		100.0	5.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	T	9.295	1.051668	0.19827	.	.	ENSG00000080603	ENST00000262518;ENST00000395059	D;D	0.91180	-2.8;-2.79	4.4	3.3	0.37823	.	.	.	.	.	T	0.80014	0.4546	N	0.14661	0.345	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.14578	0.011;0.005	T	0.73145	-0.4075	9	0.54805	T	0.06	-6.1346	5.0633	0.14568	0.1614:0.0897:0.0:0.7489	.	1148;1148	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	P	1148	ENSP00000262518:S1148P;ENSP00000378499:S1148P	ENSP00000262518:S1148P	S	+	1	0	SRCAP	30640199	0.002000	0.14202	0.455000	0.27031	0.780000	0.44128	0.621000	0.24418	1.011000	0.39340	0.455000	0.32223	TCT	.	.		0.632	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ZNF629	23361	hgsc.bcm.edu	37	16	30793663	30793663	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:30793663G>A	ENST00000262525.4	-	3	2193	c.1986C>T	c.(1984-1986)taC>taT	p.Y662Y	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGGAGCAGATGTAGGTCTTGG	0.627																																					p.Y662Y		Atlas-SNP	.											.	ZNF629	44	.	0			c.C1986T						.						16.0	17.0	17.0					16																	30793663		2033	4188	6221	SO:0001819	synonymous_variant	23361	exon3			GCAGATGTAGGTC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1986C>T	chr16.hg19:g.30793663G>A		58.0	0.0		56.0	18.0	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	hg19	CCDS45463.1																																																																																			.	.		0.627	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
C16orf78	123970	hgsc.bcm.edu	37	16	49412388	49412388	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:49412388G>A	ENST00000299191.3	+	3	395	c.278G>A	c.(277-279)gGa>gAa	p.G93E		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	93						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						AAGGCCTTAGGAAAGAGATTC	0.557																																					p.G93E		Atlas-SNP	.											C16orf78,NS,malignant_melanoma,0,1	C16orf78	57	.	0			c.G278A						.						37.0	33.0	34.0					16																	49412388		2198	4299	6497	SO:0001583	missense	123970	exon3			CCTTAGGAAAGAG	BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.278G>A	chr16.hg19:g.49412388G>A	ENSP00000299191:p.Gly93Glu	42.0	0.0		43.0	14.0	NM_144602		Missense_Mutation	SNP	ENST00000299191.3	hg19	CCDS10738.1	.	.	.	.	.	.	.	.	.	.	G	0.051	-1.249016	0.01469	.	.	ENSG00000166152	ENST00000299191	T	0.41065	1.01	3.04	-3.04	0.05412	.	6.024030	0.00424	N	0.000066	T	0.23766	0.0575	N	0.24115	0.695	0.09310	N	0.999999	B	0.21606	0.058	B	0.14023	0.01	T	0.03463	-1.1034	9	.	.	.	0.8377	0.4665	0.00525	0.3689:0.1722:0.2698:0.1891	.	93	Q8WTQ4	CP078_HUMAN	E	93	ENSP00000299191:G93E	.	G	+	2	0	C16orf78	47969889	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.057000	0.03486	-0.666000	0.05310	0.462000	0.41574	GGA	.	.		0.557	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256846.1	NM_144602	
DRC7	84229	hgsc.bcm.edu	37	16	57758667	57758667	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:57758667T>C	ENST00000360716.3	+	13	1899	c.1678T>C	c.(1678-1680)Tcc>Ccc	p.S560P	CCDC135_ENST00000394337.4_Missense_Mutation_p.S560P|CCDC135_ENST00000336825.8_Missense_Mutation_p.S495P			Q8IY82	CC135_HUMAN		560					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						AGACTTCCTCTCCTACCGCCA	0.577																																					p.S560P		Atlas-SNP	.											.	CCDC135	97	.	0			c.T1678C						.						84.0	72.0	76.0					16																	57758667		2198	4300	6498	SO:0001583	missense	84229	exon12			TTCCTCTCCTACC																												ENST00000360716.3:c.1678T>C	chr16.hg19:g.57758667T>C	ENSP00000353942:p.Ser560Pro	84.0	0.0		123.0	7.0	NM_032269	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	hg19	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	.	10.56	1.384217	0.25031	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.09817	3.1;2.94;3.1	5.29	1.24	0.21308	.	0.588107	0.18613	N	0.136106	T	0.14700	0.0355	M	0.63428	1.95	0.09310	N	0.999999	D;P	0.54601	0.967;0.813	P;B	0.45071	0.468;0.252	T	0.12400	-1.0549	10	0.39692	T	0.17	-22.956	13.273	0.60172	0.0:0.0:0.3834:0.6166	.	495;560	Q8IY82-2;Q8IY82	.;CC135_HUMAN	P	560;495;560	ENSP00000377869:S560P;ENSP00000338938:S495P;ENSP00000353942:S560P	ENSP00000338938:S495P	S	+	1	0	CCDC135	56316168	0.963000	0.33076	0.990000	0.47175	0.326000	0.28443	0.606000	0.24194	0.283000	0.22279	0.533000	0.62120	TCC	.	.		0.577	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
ZNF319	57567	hgsc.bcm.edu	37	16	58031121	58031121	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:58031121A>G	ENST00000299237.2	-	2	1671	c.1049T>C	c.(1048-1050)aTg>aCg	p.M350T	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						CTTGAAGCCCATGGGGCACAG	0.652																																					p.M350T		Atlas-SNP	.											.	ZNF319	42	.	0			c.T1049C						.						65.0	58.0	60.0					16																	58031121		2198	4300	6498	SO:0001583	missense	57567	exon2			AAGCCCATGGGGC	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.1049T>C	chr16.hg19:g.58031121A>G	ENSP00000299237:p.Met350Thr	88.0	0.0		75.0	5.0	NM_020807	Q52LH8	Missense_Mutation	SNP	ENST00000299237.2	hg19	CCDS32462.1	.	.	.	.	.	.	.	.	.	.	A	8.695	0.908443	0.17833	.	.	ENSG00000166188	ENST00000299237	T	0.17370	2.28	4.97	3.86	0.44501	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.20861	0.0502	N	0.14661	0.345	0.52501	D	0.999958	D	0.65815	0.995	D	0.63381	0.914	T	0.03212	-1.1060	10	0.87932	D	0	-22.5478	10.2792	0.43530	0.852:0.0:0.0:0.148	.	350	Q9P2F9	ZN319_HUMAN	T	350	ENSP00000299237:M350T	ENSP00000299237:M350T	M	-	2	0	ZNF319	56588622	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	6.098000	0.71458	0.725000	0.32318	-0.333000	0.08304	ATG	.	.		0.652	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
AARS	16	hgsc.bcm.edu	37	16	70303590	70303590	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:70303590A>G	ENST00000261772.8	-	7	1036	c.893T>C	c.(892-894)cTg>cCg	p.L298P		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		GTGGTCAGCCAGCACCCGGTA	0.587																																					p.L298P		Atlas-SNP	.											.	AARS	62	.	0			c.T893C						.						210.0	178.0	189.0					16																	70303590		2198	4300	6498	SO:0001583	missense	16	exon7			TCAGCCAGCACCC	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.893T>C	chr16.hg19:g.70303590A>G	ENSP00000261772:p.Leu298Pro	89.0	0.0		107.0	5.0	NM_001605		Missense_Mutation	SNP	ENST00000261772.8	hg19	CCDS32474.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.717015	0.89205	.	.	ENSG00000090861	ENST00000261772	T	0.74947	-0.89	5.67	5.67	0.87782	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89842	0.6832	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.92562	0.6059	10	0.87932	D	0	-13.6413	13.8675	0.63598	1.0:0.0:0.0:0.0	.	306;298	E7ETK8;P49588	.;SYAC_HUMAN	P	298	ENSP00000261772:L298P	ENSP00000261772:L298P	L	-	2	0	AARS	68861091	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.178000	0.69098	0.533000	0.62120	CTG	.	.		0.587	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
COG4	25839	hgsc.bcm.edu	37	16	70553593	70553593	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:70553593T>C	ENST00000323786.5	-	2	234	c.213A>G	c.(211-213)caA>caG	p.Q71Q	COG4_ENST00000393612.4_Silent_p.Q67Q|COG4_ENST00000564653.1_Silent_p.Q71Q	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	67	Interacts with SCFD1.				Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				CAATGGTGTTTTGCTGTTCCA	0.443																																					p.Q71Q		Atlas-SNP	.											.	COG4	64	.	0			c.A213G						.						143.0	120.0	128.0					16																	70553593		2198	4300	6498	SO:0001819	synonymous_variant	25839	exon2			GGTGTTTTGCTGT	AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.213A>G	chr16.hg19:g.70553593T>C		88.0	0.0		115.0	5.0	NM_015386	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Silent	SNP	ENST00000323786.5	hg19	CCDS10892.2																																																																																			.	.		0.443	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250326.3		
HYDIN	54768	hgsc.bcm.edu	37	16	70884467	70884467	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:70884467T>C	ENST00000393567.2	-	74	12685	c.12535A>G	c.(12535-12537)Aca>Gca	p.T4179A	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4179					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACATTTAATGTCACAGGGTGG	0.448																																					p.T4179A		Atlas-SNP	.											.	HYDIN	788	.	0			c.A12535G						.						31.0	30.0	30.0					16																	70884467		1822	4079	5901	SO:0001583	missense	54768	exon74			TTAATGTCACAGG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12535A>G	chr16.hg19:g.70884467T>C	ENSP00000377197:p.Thr4179Ala	149.0	0.0		212.0	39.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	hg19	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774801	0.31411	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01015	5.44	5.56	4.42	0.53409	.	0.269330	0.19193	U	0.120392	T	0.01627	0.0052	M	0.74881	2.28	0.51767	D	0.999937	B	0.14805	0.011	B	0.19391	0.025	T	0.50825	-0.8782	10	0.17832	T	0.49	.	9.8956	0.41316	0.3173:0.0:0.0:0.6827	.	4178	F8WD23	.	A	4179;4178	ENSP00000377197:T4179A	ENSP00000313052:T4178A	T	-	1	0	HYDIN	69441968	0.918000	0.31147	0.958000	0.39756	0.503000	0.33858	1.845000	0.39279	2.113000	0.64589	0.418000	0.28097	ACA	.	.		0.448	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
ADAMTS18	170692	hgsc.bcm.edu	37	16	77326981	77326981	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:77326981A>G	ENST00000282849.5	-	20	3599	c.3181T>C	c.(3181-3183)Tgg>Cgg	p.W1061R	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1061	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACCTCGCTCCACGAAGAAGCG	0.522																																					p.W1061R		Atlas-SNP	.											.	ADAMTS18	270	.	0			c.T3181C						.						72.0	67.0	69.0					16																	77326981		2198	4300	6498	SO:0001583	missense	170692	exon20			CGCTCCACGAAGA	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3181T>C	chr16.hg19:g.77326981A>G	ENSP00000282849:p.Trp1061Arg	44.0	0.0		63.0	4.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	hg19	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	A	14.51	2.556594	0.45487	.	.	ENSG00000140873	ENST00000282849	T	0.77489	-1.1	5.79	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.92919	0.7747	H	0.99425	4.56	0.58432	D	0.999992	D;D	0.89917	0.991;1.0	P;D	0.91635	0.905;0.999	D	0.94072	0.7336	10	0.87932	D	0	.	11.6097	0.51052	0.8667:0.0:0.0:0.1333	.	1061;1061	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	R	1061	ENSP00000282849:W1061R	ENSP00000282849:W1061R	W	-	1	0	ADAMTS18	75884482	1.000000	0.71417	0.791000	0.31998	0.009000	0.06853	8.596000	0.90844	1.013000	0.39391	0.455000	0.32223	TGG	.	.		0.522	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
C16orf46	123775	hgsc.bcm.edu	37	16	81095083	81095083	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:81095083G>A	ENST00000299578.5	-	4	1106	c.871C>T	c.(871-873)Ctg>Ttg	p.L291L	RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000378611.4_Silent_p.L291L|C16orf46_ENST00000444657.3_5'Flank	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	291						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						GGATCGGTCAGCAGGGATATC	0.592																																					p.L291L		Atlas-SNP	.											.	C16orf46	57	.	0			c.C871T						.						105.0	101.0	102.0					16																	81095083		2202	4300	6502	SO:0001819	synonymous_variant	123775	exon3			CGGTCAGCAGGGA	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.871C>T	chr16.hg19:g.81095083G>A		184.0	0.0		208.0	67.0	NM_001100873	Q96MA7	Silent	SNP	ENST00000299578.5	hg19	CCDS10932.1																																																																																			.	.		0.592	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337	
TAF1C	9013	hgsc.bcm.edu	37	16	84212770	84212770	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:84212770T>C	ENST00000567759.1	-	14	2569	c.2387A>G	c.(2386-2388)cAg>cGg	p.Q796R	TAF1C_ENST00000341690.6_Missense_Mutation_p.Q702R|TAF1C_ENST00000378541.4_Missense_Mutation_p.Q796R|TAF1C_ENST00000541676.1_Missense_Mutation_p.Q703R|TAF1C_ENST00000566732.1_Missense_Mutation_p.Q770R|TAF1C_ENST00000570117.1_Missense_Mutation_p.Q464R	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	796					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						AGTCAACTCCTGGGAGGGCGG	0.657																																					p.Q796R		Atlas-SNP	.											.	TAF1C	60	.	0			c.A2387G						.						23.0	20.0	21.0					16																	84212770		2199	4298	6497	SO:0001583	missense	9013	exon14			AACTCCTGGGAGG	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.2387A>G	chr16.hg19:g.84212770T>C	ENSP00000455265:p.Gln796Arg	71.0	0.0		68.0	4.0	NM_005679	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	hg19	CCDS32496.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.559364	0.45590	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000544090	T;T;T	0.02606	4.23;4.23;4.23	5.3	4.15	0.48705	.	0.345909	0.23926	N	0.043192	T	0.11110	0.0271	M	0.68317	2.08	0.29661	N	0.843181	P;P;D;D	0.67145	0.582;0.713;0.996;0.981	B;B;D;D	0.75484	0.248;0.424;0.986;0.969	T	0.00783	-1.1568	10	0.87932	D	0	-23.2519	8.5069	0.33193	0.1715:0.0:0.0:0.8285	.	770;319;796;702	Q15572-6;F5H0H4;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	R	796;703;702;319	ENSP00000367802:Q796R;ENSP00000437900:Q703R;ENSP00000345305:Q702R	ENSP00000345305:Q702R	Q	-	2	0	TAF1C	82770271	0.997000	0.39634	0.996000	0.52242	0.085000	0.17905	1.148000	0.31614	2.005000	0.58758	0.533000	0.62120	CAG	.	.		0.657	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
ADAD2	161931	hgsc.bcm.edu	37	16	84229269	84229269	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:84229269A>G	ENST00000315906.5	+	6	1070	c.1018A>G	c.(1018-1020)Agc>Ggc	p.S340G	RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.S422G|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	340	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						CCTCTACATCAGCAACACCCC	0.721																																					p.S422G		Atlas-SNP	.											.	ADAD2	46	.	0			c.A1264G						.						23.0	29.0	27.0					16																	84229269		2198	4298	6496	SO:0001583	missense	161931	exon7			TACATCAGCAACA	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1018A>G	chr16.hg19:g.84229269A>G	ENSP00000325153:p.Ser340Gly	118.0	0.0		70.0	4.0	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	hg19	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.246694	0.59103	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.96265	-3.96;-3.96	5.22	5.22	0.72569	Adenosine deaminase/editase (2);	0.052582	0.85682	D	0.000000	D	0.98254	0.9422	M	0.92555	3.32	0.39297	D	0.964835	D;D	0.71674	0.998;0.998	D;D	0.69307	0.963;0.941	D	0.99910	1.1196	10	0.72032	D	0.01	-36.8217	11.7794	0.52003	1.0:0.0:0.0:0.0	.	340;422	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	G	340;422	ENSP00000325153:S340G;ENSP00000268624:S422G	ENSP00000268624:S422G	S	+	1	0	ADAD2	82786770	1.000000	0.71417	0.996000	0.52242	0.236000	0.25371	5.674000	0.68117	2.088000	0.63022	0.528000	0.53228	AGC	.	.		0.721	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ATP2C2	9914	hgsc.bcm.edu	37	16	84438813	84438813	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:84438813A>G	ENST00000262429.4	+	3	379	c.290A>G	c.(289-291)gAc>gGc	p.D97G	ATP2C2_ENST00000416219.2_Missense_Mutation_p.D97G	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	97					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						TTTGTTGCTGACAACAGCGAA	0.557																																					p.D97G		Atlas-SNP	.											.	ATP2C2	75	.	0			c.A290G						.						62.0	68.0	66.0					16																	84438813		2081	4219	6300	SO:0001583	missense	9914	exon3			TTGCTGACAACAG	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.290A>G	chr16.hg19:g.84438813A>G	ENSP00000262429:p.Asp97Gly	128.0	0.0		144.0	6.0	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	hg19	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	A	3.574	-0.087034	0.07097	.	.	ENSG00000064270	ENST00000416219;ENST00000262429	T;T	0.78246	-1.16;-1.16	5.1	3.99	0.46301	ATPase, P-type cation-transporter, N-terminal (2);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.422774	0.23446	N	0.048095	T	0.60353	0.2262	N	0.20328	0.56	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.002	T	0.42849	-0.9427	10	0.21540	T	0.41	.	9.4888	0.38946	0.9099:0.0:0.0901:0.0	.	97;114;97	E7ES94;O75185-2;O75185	.;.;AT2C2_HUMAN	G	97	ENSP00000397925:D97G;ENSP00000262429:D97G	ENSP00000262429:D97G	D	+	2	0	ATP2C2	82996314	0.969000	0.33509	0.006000	0.13384	0.013000	0.08279	3.270000	0.51600	2.041000	0.60428	0.482000	0.46254	GAC	.	.		0.557	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
ZNF469	84627	hgsc.bcm.edu	37	16	88497617	88497617	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:88497617T>C	ENST00000437464.1	+	2	3655	c.3655T>C	c.(3655-3657)Tct>Cct	p.S1219P	ZNF469_ENST00000565624.1_Missense_Mutation_p.S1247P	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GGCTTTGCGTTCTCCTCCAGC	0.642																																					p.S1219P		Atlas-SNP	.											.	ZNF469	121	.	0			c.T3655C						.						28.0	43.0	38.0					16																	88497617		692	1590	2282	SO:0001583	missense	84627	exon2			TTGCGTTCTCCTC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3655T>C	chr16.hg19:g.88497617T>C	ENSP00000402343:p.Ser1219Pro	73.0	0.0		88.0	4.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	T	8.927	0.962583	0.18583	.	.	ENSG00000225614	ENST00000437464	T	0.08720	3.06	3.66	-7.33	0.01431	.	.	.	.	.	T	0.04318	0.0119	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.44636	-0.9315	9	0.51188	T	0.08	.	9.0426	0.36327	0.0:0.5797:0.2655:0.1548	.	1219	Q96JG9	ZN469_HUMAN	P	1219	ENSP00000402343:S1219P	ENSP00000402343:S1219P	S	+	1	0	ZNF469	87025118	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.596000	0.02091	-1.281000	0.02399	-0.619000	0.04042	TCT	.	.		0.642	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ACSF3	197322	hgsc.bcm.edu	37	16	89180759	89180759	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:89180759A>G	ENST00000317447.4	+	6	1367	c.990A>G	c.(988-990)tcA>tcG	p.S330S	ACSF3_ENST00000378345.4_Silent_p.S65S|CTD-2555A7.3_ENST00000562782.1_RNA|ACSF3_ENST00000406948.3_Silent_p.S330S	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	330					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		TGATGGTCTCAGGCTCAGCTG	0.632																																					p.S330S		Atlas-SNP	.											.	ACSF3	40	.	0			c.A990G						.						126.0	96.0	106.0					16																	89180759		2198	4300	6498	SO:0001819	synonymous_variant	197322	exon6			GGTCTCAGGCTCA	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.990A>G	chr16.hg19:g.89180759A>G		121.0	0.0		139.0	9.0	NM_174917	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Silent	SNP	ENST00000317447.4	hg19	CCDS10974.1	.	.	.	.	.	.	.	.	.	.	A	0.629	-0.817805	0.02776	.	.	ENSG00000176715	ENST00000543676	.	.	.	5.02	-10.0	0.00425	.	.	.	.	.	T	0.34395	0.0896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40997	-0.9533	4	.	.	.	-7.3756	3.4117	0.07361	0.5049:0.0757:0.1169:0.3025	.	.	.	.	G	78	.	.	R	+	1	2	ACSF3	87708260	0.000000	0.05858	0.037000	0.18230	0.010000	0.07245	-3.958000	0.00325	-2.202000	0.00745	-1.584000	0.00852	AGG	.	.		0.632	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
PELP1	27043	hgsc.bcm.edu	37	17	4585844	4585844	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:4585844T>C	ENST00000574876.1	-	5	612	c.595A>G	c.(595-597)Atg>Gtg	p.M199V	PELP1_ENST00000572293.1_Missense_Mutation_p.M249V|PELP1_ENST00000570823.1_5'Flank|PELP1_ENST00000436683.2_Missense_Mutation_p.M52V|PELP1_ENST00000301396.4_Missense_Mutation_p.M199V|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000269230.7_Missense_Mutation_p.M199V			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	199					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						CAAGCCTTCATTCCTTCCAAT	0.493																																					p.M199V		Atlas-SNP	.											.	PELP1	102	.	0			c.A595G						.						109.0	103.0	105.0					17																	4585844		2029	4188	6217	SO:0001583	missense	27043	exon5			CCTTCATTCCTTC		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.595A>G	chr17.hg19:g.4585844T>C	ENSP00000461625:p.Met199Val	75.0	0.0		61.0	4.0	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	ENST00000574876.1	hg19	CCDS58503.1	.	.	.	.	.	.	.	.	.	.	t	15.50	2.851703	0.51270	.	.	ENSG00000141456	ENST00000301396;ENST00000269230;ENST00000436683	T;T;T	0.66460	-0.21;-0.11;-0.13	4.59	4.59	0.56863	.	0.051642	0.64402	D	0.000001	T	0.67702	0.2921	N	0.19112	0.55	0.30407	N	0.779429	D;D	0.53885	0.963;0.963	D;D	0.69824	0.966;0.966	T	0.67715	-0.5599	10	0.66056	D	0.02	-21.1964	10.2857	0.43566	0.0:0.0:0.0:1.0	.	52;199	E7EV54;Q8IZL8	.;PELP1_HUMAN	V	199;199;52	ENSP00000301396:M199V;ENSP00000269230:M199V;ENSP00000416231:M52V	ENSP00000269230:M199V	M	-	1	0	AC091153.1	4532593	1.000000	0.71417	0.997000	0.53966	0.820000	0.46376	6.190000	0.72057	1.934000	0.56057	0.375000	0.23000	ATG	.	.		0.493	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
DNAH2	146754	hgsc.bcm.edu	37	17	7721766	7721766	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:7721766T>C	ENST00000572933.1	+	69	11984	c.10524T>C	c.(10522-10524)gcT>gcC	p.A3508A	DNAH2_ENST00000389173.2_Silent_p.A3508A			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3508	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAACTTTGCTGTTAAAGAAC	0.488																																					p.A3508A		Atlas-SNP	.											.	DNAH2	498	.	0			c.T10524C						.						171.0	168.0	169.0					17																	7721766		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon68			CTTTGCTGTTAAA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10524T>C	chr17.hg19:g.7721766T>C		80.0	0.0		57.0	33.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	hg19	CCDS32551.1																																																																																			.	.		0.488	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CNTROB	116840	hgsc.bcm.edu	37	17	7842848	7842848	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:7842848T>C	ENST00000563694.1	+	8	1870	c.945T>C	c.(943-945)gcT>gcC	p.A315A	CNTROB_ENST00000565740.1_Silent_p.A315A|CNTROB_ENST00000380255.3_Silent_p.A315A|CNTROB_ENST00000380262.3_Silent_p.A315A	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	315					centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				AAAGGCAAGCTCTGACTCTGA	0.577																																					p.A315A		Atlas-SNP	.											.	CNTROB	61	.	0			c.T945C						.						101.0	97.0	98.0					17																	7842848		2203	4300	6503	SO:0001819	synonymous_variant	116840	exon8			GCAAGCTCTGACT	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.945T>C	chr17.hg19:g.7842848T>C		135.0	0.0		85.0	6.0	NM_001037144	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Silent	SNP	ENST00000563694.1	hg19	CCDS11126.1																																																																																			.	.		0.577	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
ULK2	9706	hgsc.bcm.edu	37	17	19700945	19700945	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:19700945T>C	ENST00000395544.4	-	18	2072	c.1573A>G	c.(1573-1575)Aga>Gga	p.R525G	ULK2_ENST00000580130.1_5'UTR|ULK2_ENST00000361658.2_Missense_Mutation_p.R525G	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	525					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CTCTGCAGTCTAGCACCCGAT	0.517																																					p.R525G		Atlas-SNP	.											.	ULK2	142	.	0			c.A1573G						.						53.0	46.0	48.0					17																	19700945		2203	4300	6503	SO:0001583	missense	9706	exon18			GCAGTCTAGCACC	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1573A>G	chr17.hg19:g.19700945T>C	ENSP00000378914:p.Arg525Gly	42.0	0.0		33.0	4.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	hg19	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.198751	0.79015	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.36340	1.26;1.26	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.77820	2.39	0.44424	D	0.997341	D	0.65815	0.995	P	0.55455	0.776	T	0.61544	-0.7041	10	0.72032	D	0.01	-21.2887	15.642	0.77012	0.0:0.0:0.0:1.0	.	525	Q8IYT8	ULK2_HUMAN	G	525	ENSP00000354877:R525G;ENSP00000378914:R525G	ENSP00000354877:R525G	R	-	1	2	ULK2	19641537	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.643000	0.46604	2.288000	0.76882	0.533000	0.62120	AGA	.	.		0.517	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
KSR1	8844	hgsc.bcm.edu	37	17	25932752	25932752	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:25932752T>C	ENST00000319524.6	+	15	1973	c.1973T>C	c.(1972-1974)gTg>gCg	p.V658A	KSR1_ENST00000268763.6_Missense_Mutation_p.V521A|KSR1_ENST00000509603.2_Missense_Mutation_p.V636A|KSR1_ENST00000398988.3_Missense_Mutation_p.V521A			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	658	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		AAGAAAGAGGTGATGAACTAC	0.627																																					p.V521A	Esophageal Squamous(88;1120 1336 6324 10502 16832)	Atlas-SNP	.											.	KSR1	151	.	0			c.T1562C						.						20.0	23.0	22.0					17																	25932752		2054	4184	6238	SO:0001583	missense	8844	exon15			AAGAGGTGATGAA	U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1973T>C	chr17.hg19:g.25932752T>C	ENSP00000323178:p.Val658Ala	110.0	0.0		147.0	8.0	NM_014238	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	ENST00000319524.6	hg19		.	.	.	.	.	.	.	.	.	.	T	32	5.109239	0.94292	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	T;T;T	0.44482	0.92;0.92;0.92	5.67	5.67	0.87782	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64114	0.2569	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	T	0.66736	-0.5848	10	0.59425	D	0.04	.	15.0899	0.72185	0.0:0.0:0.0:1.0	.	656;636	Q8IVT5;F5H0K8	KSR1_HUMAN;.	A	658;636;521;521	ENSP00000323178:V658A;ENSP00000438795:V636A;ENSP00000268763:V521A	ENSP00000268763:V521A	V	+	2	0	KSR1	22956879	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.925000	0.87563	2.165000	0.68154	0.533000	0.62120	GTG	.	.		0.627	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_014238	
TP53I13	90313	hgsc.bcm.edu	37	17	27899619	27899619	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:27899619A>G	ENST00000301057.7	+	6	1088	c.973A>G	c.(973-975)Acc>Gcc	p.T325A	RP11-68I3.4_ENST00000579050.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA	NM_138349.2	NP_612358.3	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	325						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(3;0.236)		GGTGCTGCTCACCCTGGCCAC	0.697																																					p.T325A		Atlas-SNP	.											.	TP53I13	17	.	0			c.A973G						.						8.0	9.0	9.0					17																	27899619		2110	4221	6331	SO:0001583	missense	90313	exon6			CTGCTCACCCTGG	AK075341	CCDS42289.1	17q11.2	2006-01-16				ENSG00000167543			25102	protein-coding gene	gene with protein product						14767535	Standard	NM_138349		Approved	DSCP1	uc002hee.3	Q8NBR0		ENST00000301057.7:c.973A>G	chr17.hg19:g.27899619A>G	ENSP00000301057:p.Thr325Ala	90.0	0.0		116.0	5.0	NM_138349	Q7L5U3	Missense_Mutation	SNP	ENST00000301057.7	hg19	CCDS42289.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.930467	0.34096	.	.	ENSG00000167543	ENST00000301057;ENST00000378818	.	.	.	4.52	4.52	0.55395	.	0.128822	0.51477	D	0.000095	T	0.43100	0.1232	L	0.38838	1.175	0.45554	D	0.998505	P	0.41393	0.748	B	0.43225	0.412	T	0.20273	-1.0280	9	0.13108	T	0.6	-23.8016	11.7479	0.51830	1.0:0.0:0.0:0.0	.	325	Q8NBR0	P5I13_HUMAN	A	325;92	.	ENSP00000301057:T325A	T	+	1	0	TP53I13	24923745	0.967000	0.33354	0.993000	0.49108	0.984000	0.73092	1.492000	0.35594	2.039000	0.60335	0.379000	0.24179	ACC	.	.		0.697	TP53I13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447804.2	NM_138349	
CPD	1362	hgsc.bcm.edu	37	17	28770949	28770949	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:28770949T>C	ENST00000225719.4	+	11	2579	c.2503T>C	c.(2503-2505)Ttg>Ctg	p.L835L	CPD_ENST00000543464.2_Silent_p.L588L	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	835	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						CTGGCGTCTCTTGGTTCCAGG	0.448																																					p.L835L		Atlas-SNP	.											.	CPD	89	.	0			c.T2503C						.						166.0	166.0	166.0					17																	28770949		2203	4300	6503	SO:0001819	synonymous_variant	1362	exon11			CGTCTCTTGGTTC	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2503T>C	chr17.hg19:g.28770949T>C		61.0	0.0		90.0	5.0	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	hg19	CCDS11257.1																																																																																			.	.		0.448	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
NF1	4763	hgsc.bcm.edu	37	17	29576138	29576138	+	Splice_Site	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:29576138G>C	ENST00000358273.4	+	30	4493		c.e30+1		NF1_ENST00000356175.3_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTATACCAGGTATGCTTACA	0.393			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											.		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	NF1_ENST00000358273,NS,carcinoma,0,3	NF1	1586	.	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(8)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.4110+1G>C	GRCh37	CS000898|CS971829	NF1	S		.						150.0	136.0	141.0					17																	29576138		2203	4300	6503	SO:0001630	splice_region_variant	4763	exon30	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TACCAGGTATGCT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4110+1G>C	chr17.hg19:g.29576138G>C		87.0	0.0		94.0	28.0	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849295	0.91277	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26600264	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.378000	0.97191	2.873000	0.98535	0.563000	0.77884	.	.	.		0.393	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Intron
ZNF830	91603	hgsc.bcm.edu	37	17	33289487	33289487	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:33289487T>C	ENST00000361952.3	+	1	939	c.902T>C	c.(901-903)tTg>tCg	p.L301S	CCT6B_ENST00000421975.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000436961.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	301					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				GAGGGACGGTTGGACCGCCAG	0.473																																					p.L301S		Atlas-SNP	.											.	ZNF830	26	.	0			c.T902C						.						98.0	85.0	90.0					17																	33289487		2203	4300	6503	SO:0001583	missense	91603	exon1			GACGGTTGGACCG	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.902T>C	chr17.hg19:g.33289487T>C	ENSP00000354518:p.Leu301Ser	73.0	0.0		93.0	4.0	NM_052857	Q96F60|Q96GZ5|Q9BU38	Missense_Mutation	SNP	ENST00000361952.3	hg19	CCDS32618.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.336680	0.81801	.	.	ENSG00000198783	ENST00000361952	T	0.15952	2.38	6.08	6.08	0.98989	.	0.202340	0.37136	N	0.002231	T	0.35393	0.0930	L	0.52364	1.645	0.58432	D	0.99999	D	0.89917	1.0	D	0.77557	0.99	T	0.02958	-1.1089	10	0.52906	T	0.07	-24.5993	13.0356	0.58870	0.0:0.0:0.0:1.0	.	301	Q96NB3	ZN830_HUMAN	S	301	ENSP00000354518:L301S	ENSP00000354518:L301S	L	+	2	0	ZNF830	30313600	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.766000	0.74970	2.333000	0.79357	0.533000	0.62120	TTG	.	.		0.473	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
SLFN14	342618	hgsc.bcm.edu	37	17	33880034	33880034	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:33880034T>C	ENST00000415846.3	-	3	1654	c.1619A>G	c.(1618-1620)gAa>gGa	p.E540G	RP11-1094M14.12_ENST00000588445.1_RNA	NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	540							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						GTCTTCCATTTCCTCCTCATC	0.522																																					p.E540G		Atlas-SNP	.											.	SLFN14	43	.	0			c.A1619G						.						144.0	139.0	140.0					17																	33880034		692	1591	2283	SO:0001583	missense	342618	exon3			TCCATTTCCTCCT		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.1619A>G	chr17.hg19:g.33880034T>C	ENSP00000391101:p.Glu540Gly	112.0	0.0		109.0	9.0	NM_001129820	B2RTW9	Missense_Mutation	SNP	ENST00000415846.3	hg19	CCDS45650.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.459259	0.43634	.	.	ENSG00000236320	ENST00000415846	T	0.02140	4.43	5.19	4.09	0.47781	.	.	.	.	.	T	0.05823	0.0152	M	0.63843	1.955	0.09310	N	1	D	0.59767	0.986	P	0.50970	0.655	T	0.27536	-1.0071	9	0.62326	D	0.03	-9.5695	8.9302	0.35666	0.0:0.0:0.1877:0.8123	.	540	P0C7P3	SLN14_HUMAN	G	540	ENSP00000391101:E540G	ENSP00000391101:E540G	E	-	2	0	SLFN14	30904147	0.004000	0.15560	0.095000	0.20976	0.512000	0.34134	0.904000	0.28491	0.958000	0.37956	0.533000	0.62120	GAA	.	.		0.522	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448928.1	NM_001129820	
GAS2L2	246176	hgsc.bcm.edu	37	17	34073039	34073039	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:34073039A>G	ENST00000254466.6	-	6	1504	c.1477T>C	c.(1477-1479)Tct>Cct	p.S493P	GAS2L2_ENST00000587565.1_Missense_Mutation_p.S477P	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	493					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGGTTGGAGAACGGACAGAC	0.627																																					p.S493P		Atlas-SNP	.											.	GAS2L2	94	.	0			c.T1477C						.						95.0	97.0	96.0					17																	34073039		2203	4300	6503	SO:0001583	missense	246176	exon6			TTGGAGAACGGAC	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1477T>C	chr17.hg19:g.34073039A>G	ENSP00000254466:p.Ser493Pro	53.0	0.0		77.0	4.0	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	hg19	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	A	5.721	0.317597	0.10845	.	.	ENSG00000132139	ENST00000254466	T	0.25579	1.79	4.99	2.71	0.32032	.	0.511250	0.19144	N	0.121624	T	0.14141	0.0342	N	0.20986	0.625	0.09310	N	0.999999	B	0.24533	0.105	B	0.22880	0.042	T	0.19353	-1.0308	10	0.49607	T	0.09	-5.9467	3.2615	0.06850	0.6464:0.0:0.1822:0.1714	.	493	Q8NHY3	GA2L2_HUMAN	P	493	ENSP00000254466:S493P	ENSP00000254466:S493P	S	-	1	0	GAS2L2	31097152	0.005000	0.15991	0.000000	0.03702	0.004000	0.04260	0.273000	0.18662	0.362000	0.24319	-0.290000	0.09829	TCT	.	.		0.627	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
TOP2A	7153	hgsc.bcm.edu	37	17	38552571	38552571	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:38552571T>C	ENST00000423485.1	-	28	3842	c.3684A>G	c.(3682-3684)aaA>aaG	p.K1228K		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1228					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	CTGCCTCTGCTTTCATTTCTA	0.448																																					p.K1228K		Atlas-SNP	.											.	TOP2A	124	.	0			c.A3684G						.						45.0	41.0	42.0					17																	38552571		1844	4079	5923	SO:0001819	synonymous_variant	7153	exon28			CTCTGCTTTCATT		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.3684A>G	chr17.hg19:g.38552571T>C		69.0	0.0		46.0	4.0	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Silent	SNP	ENST00000423485.1	hg19	CCDS45672.1																																																																																			.	.		0.448	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
KRTAP1-4	728255	hgsc.bcm.edu	37	17	39186236	39186236	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:39186236G>T	ENST00000377747.4	-	1	120	c.95C>A	c.(94-96)aCc>aAc	p.T32N	KRTAP1-5_ENST00000361883.5_5'Flank	NM_001257305.1	NP_001244234.1	P0C5Y4	KRA14_HUMAN	keratin associated protein 1-4	32						keratin filament (GO:0045095)				lung(1)	1						GCAGGAGCTGGTCTGGCAGCA	0.632																																					p.T32N		Atlas-SNP	.											.	KRTAP1-4	4	.	0			c.C95A						.																																			SO:0001583	missense	728255	exon1			GAGCTGGTCTGGC	AC007455	CCDS58548.1	17q21.2	2010-06-22			ENSG00000204887	ENSG00000204887		"""Keratin associated proteins"""	18904	protein-coding gene	gene with protein product		608821					Standard	NM_001257305		Approved	KAP1.4	uc031raf.1	P0C5Y4	OTTHUMG00000133631	ENST00000377747.4:c.95C>A	chr17.hg19:g.39186236G>T	ENSP00000366976:p.Thr32Asn	69.0	0.0		101.0	46.0	NM_001257305	A6NJ92	Missense_Mutation	SNP	ENST00000377747.4	hg19	CCDS58548.1	.	.	.	.	.	.	.	.	.	.	G	8.823	0.938036	0.18206	.	.	ENSG00000204887	ENST00000377747	T	0.32988	1.43	4.23	1.04	0.20106	.	1.178950	0.06498	N	0.735867	T	0.32526	0.0832	.	.	.	.	.	.	.	.	.	.	.	.	T	0.43572	-0.9383	6	0.52906	T	0.07	.	7.6968	0.28600	0.0:0.3425:0.4807:0.1768	.	.	.	.	N	32	ENSP00000366976:T32N	ENSP00000366976:T32N	T	-	2	0	KRTAP1-4	36439762	0.031000	0.19500	0.202000	0.23494	0.337000	0.28794	0.352000	0.20113	0.292000	0.22492	0.655000	0.94253	ACC	.	.		0.632	KRTAP1-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257776.3		
KRTAP9-2	83899	hgsc.bcm.edu	37	17	39383332	39383332	+	Missense_Mutation	SNP	G	G	C	rs542786200	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:39383332G>C	ENST00000377721.3	+	1	433	c.426G>C	c.(424-426)caG>caC	p.Q142H	KRTAP9-2_ENST00000455970.2_Missense_Mutation_p.Q126H	NM_031961.2	NP_114167.2	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9-2	142	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament (GO:0045095)				large_intestine(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ACTGCTGCCAGCCCTGCTGCC	0.612																																					p.Q142H		Atlas-SNP	.											.	KRTAP9-2	24	.	0			c.G426C						.						36.0	40.0	39.0					17																	39383332		2030	3937	5967	SO:0001583	missense	83899	exon1			CTGCCAGCCCTGC	AJ406946	CCDS32651.1	17q21.2	2013-06-25			ENSG00000239886	ENSG00000239886		"""Keratin associated proteins"""	16926	protein-coding gene	gene with protein product						11279113	Standard	NM_031961		Approved	KAP9.2	uc002hwf.3	Q9BYQ4	OTTHUMG00000133609	ENST00000377721.3:c.426G>C	chr17.hg19:g.39383332G>C	ENSP00000366950:p.Gln142His	181.0	0.0		239.0	17.0	NM_031961	Q17RK8|Q2TB15|Q6ISF6	Missense_Mutation	SNP	ENST00000377721.3	hg19	CCDS32651.1	.	.	.	.	.	.	.	.	.	.	.	18.41	3.618122	0.66787	.	.	ENSG00000239886	ENST00000377721;ENST00000455970	T;T	0.01705	5.37;4.68	3.29	2.28	0.28536	.	.	.	.	.	T	0.07369	0.0186	M	0.77103	2.36	0.22050	N	0.999392	D	0.65815	0.995	D	0.63488	0.915	T	0.16129	-1.0413	9	0.62326	D	0.03	.	6.2648	0.20919	0.2531:0.0:0.7468:0.0	.	142	Q9BYQ4	KRA92_HUMAN	H	142;126	ENSP00000366950:Q142H;ENSP00000398325:Q126H	ENSP00000366950:Q142H	Q	+	3	2	KRTAP9-2	36636858	0.019000	0.18553	0.997000	0.53966	0.702000	0.40608	-0.380000	0.07427	0.671000	0.31185	0.298000	0.19748	CAG	.	.		0.612	KRTAP9-2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257717.1		
KRT17	3872	hgsc.bcm.edu	37	17	39778675	39778675	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:39778675C>A	ENST00000311208.8	-	3	671	c.604G>T	c.(604-606)Gcc>Tcc	p.A202S	JUP_ENST00000540235.1_Missense_Mutation_p.A361S	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	202	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				TCCAGGTCGGCTCTGGCCAGG	0.607																																					p.A202S	Pancreas(92;1242 2086 39193 50508)	Atlas-SNP	.											.	KRT17	57	.	0			c.G604T						.						75.0	77.0	77.0					17																	39778675		2203	4300	6503	SO:0001583	missense	3872	exon3			GGTCGGCTCTGGC	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.604G>T	chr17.hg19:g.39778675C>A	ENSP00000308452:p.Ala202Ser	438.0	0.0		608.0	224.0	NM_000422	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	hg19	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258354	0.39896	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	T;T	0.76578	-1.03;-1.03	3.87	3.87	0.44632	Prefoldin (1);Filament (1);	0.000000	0.44097	D	0.000489	T	0.63165	0.2488	N	0.16790	0.44	0.24686	N	0.993332	B	0.23185	0.081	B	0.33799	0.17	T	0.50676	-0.8800	10	0.18710	T	0.47	.	10.1206	0.42618	0.0:0.9072:0.0:0.0928	.	202	Q04695	K1C17_HUMAN	S	202;361	ENSP00000308452:A202S;ENSP00000441751:A361S	ENSP00000441751:A361S	A	-	1	0	JUP;KRT17	37032201	0.388000	0.25197	0.983000	0.44433	0.957000	0.61999	1.001000	0.29783	2.164000	0.68074	0.655000	0.94253	GCC	.	.		0.607	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
MPP3	4356	hgsc.bcm.edu	37	17	41907094	41907094	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:41907094A>G	ENST00000398389.4	-	7	534	c.369T>C	c.(367-369)ccT>ccC	p.P123P	MPP3_ENST00000398393.1_Silent_p.P148P	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	123					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CGATATTGTCAGGCAGAGGCG	0.547																																					p.P123P		Atlas-SNP	.											.	MPP3	42	.	0			c.T369C						.						67.0	74.0	72.0					17																	41907094		1952	4137	6089	SO:0001819	synonymous_variant	4356	exon7			ATTGTCAGGCAGA		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.369T>C	chr17.hg19:g.41907094A>G		84.0	0.0		96.0	4.0	NM_001932	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Silent	SNP	ENST00000398389.4	hg19	CCDS42344.1																																																																																			.	.		0.547	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932	
SPOP	8405	hgsc.bcm.edu	37	17	47684733	47684733	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:47684733T>C	ENST00000393328.2	-	9	1081	c.716A>G	c.(715-717)aAt>aGt	p.N239S	SPOP_ENST00000504102.1_Splice_Site_p.N239S|SPOP_ENST00000503676.1_Splice_Site_p.N239S|SPOP_ENST00000393331.3_Splice_Site_p.N239S|SPOP_ENST00000347630.2_Splice_Site_p.N239S	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	239	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.			N -> S (in Ref. 3; BAD96309). {ECO:0000305}.	glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						TTCAACTCGATTCTATGCCAG	0.368										Prostate(2;0.17)																											p.N239S		Atlas-SNP	.											.	SPOP	91	.	0			c.A716G						.						74.0	70.0	72.0					17																	47684733		2203	4300	6503	SO:0001630	splice_region_variant	8405	exon8			ACTCGATTCTATG	AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.715-1A>G	chr17.hg19:g.47684733T>C		81.0	0.0		67.0	4.0	NM_001007228	B2R6S3|D3DTW7|Q53HJ1	Missense_Mutation	SNP	ENST00000393328.2	hg19	CCDS11551.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438941	0.63067	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872;ENST00000509079	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.43	5.43	0.79202	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.53465	0.1798	L	0.35723	1.085	0.80722	D	1	B	0.18968	0.032	B	0.18263	0.021	T	0.48948	-0.8989	10	0.35671	T	0.21	-14.0961	15.3001	0.73940	0.0:0.0:0.0:1.0	.	239	O43791	SPOP_HUMAN	S	239;239;239;239;123;239;192;239	ENSP00000377001:N239S;ENSP00000377004:N239S;ENSP00000240327:N239S;ENSP00000425905:N239S;ENSP00000420908:N239S;ENSP00000426986:N239S	ENSP00000240327:N239S	N	-	2	0	SPOP	45039732	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.868000	0.87116	2.279000	0.76181	0.533000	0.62120	AAT	.	.		0.368	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365154.2	NM_003563	Missense_Mutation
CACNA1G	8913	hgsc.bcm.edu	37	17	48703642	48703642	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:48703642A>G	ENST00000359106.5	+	38	6664	c.6664A>G	c.(6664-6666)Agc>Ggc	p.S2222G	CACNA1G_ENST00000358244.5_Intron|CACNA1G_ENST00000510115.1_Missense_Mutation_p.S2143G|CACNA1G_ENST00000507510.2_Missense_Mutation_p.S2177G|CACNA1G_ENST00000507336.1_Missense_Mutation_p.S2211G|CACNA1G_ENST00000512389.1_Missense_Mutation_p.S2118G|CACNA1G_ENST00000507896.1_Intron|CACNA1G_ENST00000515765.1_Missense_Mutation_p.S2166G|CACNA1G_ENST00000429973.2_Missense_Mutation_p.S2111G|CACNA1G_ENST00000503485.1_Missense_Mutation_p.S2095G|CACNA1G_ENST00000352832.5_Missense_Mutation_p.S2095G|CACNA1G_ENST00000502264.1_Missense_Mutation_p.S2151G|CACNA1G_ENST00000510366.1_Missense_Mutation_p.S2077G|CACNA1G_ENST00000514079.1_Missense_Mutation_p.S2136G|CACNA1G_ENST00000360761.4_Missense_Mutation_p.S2106G|CACNA1G_ENST00000505165.1_Intron|CACNA1G_ENST00000354983.4_Missense_Mutation_p.S2188G|CACNA1G_ENST00000442258.2_Missense_Mutation_p.S2088G|CACNA1G_ENST00000513689.2_Missense_Mutation_p.S2132G|CACNA1G_ENST00000507609.1_Missense_Mutation_p.S2122G|CACNA1G_ENST00000515411.1_Missense_Mutation_p.S2159G|CTB-22K21.2_ENST00000502435.1_RNA|CACNA1G_ENST00000514717.1_Missense_Mutation_p.S2072G|CACNA1G_ENST00000514181.1_Missense_Mutation_p.S2104G|CACNA1G_ENST00000513964.1_Missense_Mutation_p.S2084G|CACNA1G_ENST00000515165.1_Missense_Mutation_p.S2129G	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	2222					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CACGGAGCTGAGCTGGATTTC	0.652											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S2222G		Atlas-SNP	.											.	CACNA1G	659	.	0			c.A6664G						.						38.0	47.0	44.0					17																	48703642		1998	4164	6162	SO:0001583	missense	8913	exon38			GAGCTGAGCTGGA	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.6664A>G	chr17.hg19:g.48703642A>G	ENSP00000352011:p.Ser2222Gly	96.0	0.0	956	123.0	5.0	NM_018896	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	hg19	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.039723	0.55003	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000359106;ENST00000429973;ENST00000515411	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97232	-4.19;-4.18;-4.11;-4.19;-4.22;-4.21;-4.3;-4.26;-4.3;-4.29;-4.18;-4.13;-4.25;-4.18;-4.15;-4.22;-4.18;-4.18;-4.22;-4.13;-4.21;-4.17	5.32	4.17	0.49024	.	0.439112	0.25439	N	0.030675	D	0.96962	0.9008	L	0.42245	1.32	0.28302	N	0.923081	D;B;B;D;B;P;D;B;D;B;B;B;D;B;P;B;B;B;D;B;B;B	0.61080	0.989;0.004;0.002;0.964;0.002;0.885;0.964;0.001;0.964;0.202;0.354;0.212;0.964;0.215;0.89;0.035;0.021;0.146;0.989;0.227;0.003;0.001	D;B;B;D;B;P;D;B;D;B;B;B;D;B;P;B;B;B;D;B;B;B	0.70227	0.958;0.005;0.009;0.968;0.003;0.633;0.968;0.003;0.968;0.281;0.138;0.114;0.968;0.146;0.695;0.012;0.012;0.065;0.958;0.179;0.003;0.001	D	0.92695	0.6170	10	0.52906	T	0.07	.	10.6744	0.45776	0.84:0.16:0.0:0.0	.	2072;2084;2077;2159;2132;2104;2136;2095;2122;2151;2118;2211;2111;2166;2129;2199;2177;2095;2088;2143;2106;2222	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN	G	2106;2095;2188;2088;2151;2118;2084;2072;2077;2095;2177;2211;2132;2122;2143;2129;2104;2166;2136;2222;2111;2159	ENSP00000353990:S2106G;ENSP00000339302:S2095G;ENSP00000347078:S2188G;ENSP00000409759:S2088G;ENSP00000425522:S2151G;ENSP00000426261:S2118G;ENSP00000425451:S2084G;ENSP00000422407:S2072G;ENSP00000426814:S2077G;ENSP00000427238:S2095G;ENSP00000423112:S2177G;ENSP00000420918:S2211G;ENSP00000426172:S2132G;ENSP00000423045:S2122G;ENSP00000427173:S2143G;ENSP00000426098:S2129G;ENSP00000425698:S2104G;ENSP00000426232:S2166G;ENSP00000423317:S2136G;ENSP00000352011:S2222G;ENSP00000414388:S2111G;ENSP00000423155:S2159G	ENSP00000339302:S2095G	S	+	1	0	CACNA1G	46058641	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.298000	0.33412	2.010000	0.58986	0.379000	0.24179	AGC	.	.		0.652	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
CEP95	90799	hgsc.bcm.edu	37	17	62528114	62528114	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:62528114T>C	ENST00000556440.2	+	14	2156	c.1646T>C	c.(1645-1647)cTc>cCc	p.L549P	AC009994.2_ENST00000579926.1_RNA|CEP95_ENST00000553412.1_Missense_Mutation_p.L385P	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	549						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AGAGGTGGCCTCCCAAAGCCA	0.428																																					p.L549P		Atlas-SNP	.											.	CEP95	103	.	0			c.T1646C						.						79.0	75.0	76.0					17																	62528114		1871	4096	5967	SO:0001583	missense	90799	exon14			GTGGCCTCCCAAA	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1646T>C	chr17.hg19:g.62528114T>C	ENSP00000450461:p.Leu549Pro	57.0	0.0		80.0	4.0	NM_138363	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	hg19	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363258	0.41902	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.34472	1.36;1.36	5.97	4.89	0.63831	.	0.942091	0.09055	N	0.855130	T	0.43809	0.1264	L	0.54323	1.7	0.28087	N	0.93197	D	0.56035	0.974	P	0.51135	0.66	T	0.20638	-1.0269	10	0.35671	T	0.21	0.0229	8.2179	0.31524	0.0:0.0693:0.1338:0.7969	.	549	Q96GE4	CEP95_HUMAN	P	484;549;385	ENSP00000450461:L549P;ENSP00000450906:L385P	ENSP00000438458:L484P	L	+	2	0	CEP95	59958576	0.101000	0.21875	0.994000	0.49952	0.384000	0.30261	0.957000	0.29215	1.048000	0.40298	0.533000	0.62120	CTC	.	.		0.428	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
HELZ	9931	hgsc.bcm.edu	37	17	65105654	65105654	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:65105654G>A	ENST00000358691.5	-	29	4233	c.4067C>T	c.(4066-4068)cCt>cTt	p.P1356L	HELZ_ENST00000580168.1_Missense_Mutation_p.P1357L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1356						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTGGCGATTAGGGATTGCATA	0.463																																					p.P1356L		Atlas-SNP	.											.	HELZ	160	.	0			c.C4067T						.						197.0	199.0	198.0					17																	65105654		2018	4180	6198	SO:0001583	missense	9931	exon29			CGATTAGGGATTG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4067C>T	chr17.hg19:g.65105654G>A	ENSP00000351524:p.Pro1356Leu	305.0	0.0		501.0	131.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674680	0.29693	.	.	ENSG00000198265	ENST00000358691	D	0.83506	-1.73	5.82	5.82	0.92795	.	0.152258	0.64402	D	0.000011	T	0.81278	0.4789	L	0.34521	1.04	0.80722	D	1	D;D	0.54207	0.965;0.965	P;P	0.45913	0.497;0.497	D	0.83499	0.0074	10	0.87932	D	0	-15.2697	20.0939	0.97831	0.0:0.0:1.0:0.0	.	1357;1356	B7ZLW2;P42694	.;HELZ_HUMAN	L	1356	ENSP00000351524:P1356L	ENSP00000351524:P1356L	P	-	2	0	HELZ	62536116	1.000000	0.71417	0.904000	0.35570	0.364000	0.29643	6.629000	0.74267	2.756000	0.94617	0.643000	0.83706	CCT	.	.		0.463	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
SDK2	54549	hgsc.bcm.edu	37	17	71386431	71386431	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:71386431T>C	ENST00000392650.3	-	29	4187	c.4187A>G	c.(4186-4188)aAg>aGg	p.K1396R	SDK2_ENST00000388726.3_Missense_Mutation_p.K1396R	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1396	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GTCACCTCTCTTCTCGGTGGT	0.652																																					p.K1396R		Atlas-SNP	.											.	SDK2	219	.	0			c.A4187G						.						23.0	20.0	21.0					17																	71386431		2203	4297	6500	SO:0001583	missense	54549	exon29			CCTCTCTTCTCGG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4187A>G	chr17.hg19:g.71386431T>C	ENSP00000376421:p.Lys1396Arg	59.0	0.0		84.0	4.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	hg19	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.725484	0.48833	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.60299	0.2;0.22;1.52	5.4	4.32	0.51571	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.55049	0.1896	M	0.71581	2.175	0.49582	D	0.999807	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.002;0.004	T	0.51317	-0.8721	10	0.38643	T	0.18	.	11.1332	0.48360	0.0:0.0738:0.0:0.9262	.	1396;1396;1396	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	R	1020;1396;1396;572;1396	ENSP00000376421:K1396R;ENSP00000373378:K1396R;ENSP00000407098:K572R	ENSP00000324967:K1396R	K	-	2	0	SDK2	68898026	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.833000	0.69349	0.878000	0.35920	0.459000	0.35465	AAG	.	.		0.652	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SLC9A3R1	9368	hgsc.bcm.edu	37	17	72759578	72759578	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:72759578A>G	ENST00000262613.5	+	3	871	c.676A>G	c.(676-678)Acc>Gcc	p.T226A	SLC9A3R1_ENST00000413388.2_Missense_Mutation_p.T70A	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1	226	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						CGGGGACGAGACCAAGCTGCT	0.617																																					p.T226A		Atlas-SNP	.											.	SLC9A3R1	12	.	0			c.A676G						.						64.0	60.0	61.0					17																	72759578		2203	4300	6503	SO:0001583	missense	9368	exon3			GACGAGACCAAGC	AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863	ENST00000262613.5:c.676A>G	chr17.hg19:g.72759578A>G	ENSP00000262613:p.Thr226Ala	152.0	0.0		242.0	12.0	NM_004252	B3KY21|O43552|Q86WQ5	Missense_Mutation	SNP	ENST00000262613.5	hg19	CCDS11705.1	.	.	.	.	.	.	.	.	.	.	A	9.998	1.232662	0.22626	.	.	ENSG00000109062	ENST00000262613	T	0.26660	1.72	5.45	-0.171	0.13331	PDZ/DHR/GLGF (4);	0.286306	0.37095	N	0.002252	T	0.13628	0.0330	N	0.20530	0.585	0.31742	N	0.635708	B	0.02656	0.0	B	0.20767	0.031	T	0.25984	-1.0116	9	.	.	.	-22.0401	9.2428	0.37506	0.613:0.0:0.387:0.0	.	226	O14745	NHRF1_HUMAN	A	226	ENSP00000262613:T226A	.	T	+	1	0	SLC9A3R1	70271173	1.000000	0.71417	0.984000	0.44739	0.591000	0.36615	1.191000	0.32138	-0.292000	0.08999	-0.456000	0.05471	ACC	.	.		0.617	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443671.1		
ITGB4	3691	hgsc.bcm.edu	37	17	73729645	73729645	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:73729645A>G	ENST00000200181.3	+	13	1716	c.1529A>G	c.(1528-1530)aAg>aGg	p.K510R	ITGB4_ENST00000450894.3_Missense_Mutation_p.K510R|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000579662.1_Missense_Mutation_p.K510R|ITGB4_ENST00000449880.2_Missense_Mutation_p.K510R|ITGB4_ENST00000339591.3_Missense_Mutation_p.K510R	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	510	Cysteine-rich tandem repeats.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCGAGGACAAGCCGTGCTCC	0.632																																					p.K510R		Atlas-SNP	.											.	ITGB4	165	.	0			c.A1529G						.						60.0	51.0	54.0					17																	73729645		2203	4300	6503	SO:0001583	missense	3691	exon13			AGGACAAGCCGTG		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1529A>G	chr17.hg19:g.73729645A>G	ENSP00000200181:p.Lys510Arg	52.0	0.0		96.0	4.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	A	8.535	0.872026	0.17322	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.90133	-2.62;-2.62;-2.62	4.78	0.983	0.19767	.	0.210963	0.41194	D	0.000928	D	0.85864	0.5796	L	0.45744	1.44	0.22050	N	0.999391	P;P;P;P;P	0.42908	0.57;0.793;0.692;0.565;0.565	B;P;B;B;B	0.44518	0.25;0.452;0.366;0.07;0.156	T	0.77389	-0.2606	10	0.51188	T	0.08	.	5.0596	0.14550	0.6407:0.0:0.0796:0.2796	.	470;510;510;510;510	B4E3N0;P16144-5;P16144-3;A0AVL6;P16144	.;.;.;.;ITB4_HUMAN	R	426;510;510;510	ENSP00000200181:K510R;ENSP00000344079:K510R;ENSP00000400217:K510R	ENSP00000200181:K510R	K	+	2	0	ITGB4	71241240	0.997000	0.39634	0.208000	0.23602	0.289000	0.27227	2.950000	0.49081	0.184000	0.20083	0.454000	0.30748	AAG	.	.		0.632	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
CYGB	114757	hgsc.bcm.edu	37	17	74527573	74527573	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:74527573A>G	ENST00000293230.5	-	2	706	c.344T>C	c.(343-345)cTc>cCc	p.L115P	CYGB_ENST00000586160.1_5'Flank|PRCD_ENST00000592432.1_Intron|CYGB_ENST00000589342.1_Missense_Mutation_p.L115P|CYGB_ENST00000589145.1_Missense_Mutation_p.L50P|CYGB_ENST00000590175.1_Missense_Mutation_p.L50P	NM_134268.4	NP_599030.1	Q8WWM9	CYGB_HUMAN	cytoglobin	115	Globin.				oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)	7						CTTGTGCTTGAGGGCGTGGGC	0.642																																					p.L115P		Atlas-SNP	.											.	CYGB	9	.	0			c.T344C						.						107.0	91.0	97.0					17																	74527573		2203	4300	6503	SO:0001583	missense	114757	exon2			TGCTTGAGGGCGT	AJ315162	CCDS11746.1	17q25	2008-07-18				ENSG00000161544			16505	protein-coding gene	gene with protein product	"""stellate cell activation-associated protein"", ""histoglobin"""	608759				11919282	Standard	NM_134268		Approved	HGB, STAP	uc002jru.2	Q8WWM9		ENST00000293230.5:c.344T>C	chr17.hg19:g.74527573A>G	ENSP00000293230:p.Leu115Pro	57.0	0.0		119.0	5.0	NM_134268	Q541Y7|Q8N2X5	Missense_Mutation	SNP	ENST00000293230.5	hg19	CCDS11746.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.536854	0.65085	.	.	ENSG00000161544	ENST00000293230	D	0.92858	-3.12	5.52	5.52	0.82312	Globin-like (1);Globin, structural domain (1);	0.301352	0.35903	N	0.002907	D	0.91855	0.7422	M	0.75447	2.3	0.80722	D	1	B	0.15473	0.013	B	0.23275	0.045	D	0.89250	0.3590	10	0.51188	T	0.08	-10.1027	15.6427	0.77020	1.0:0.0:0.0:0.0	.	115	Q8WWM9	CYGB_HUMAN	P	115	ENSP00000293230:L115P	ENSP00000293230:L115P	L	-	2	0	CYGB	72039168	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	7.076000	0.76806	2.100000	0.63781	0.379000	0.24179	CTC	.	.		0.642	CYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450590.1	NM_134268	
DNAH17	8632	hgsc.bcm.edu	37	17	76464900	76464900	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:76464900T>C	ENST00000585328.1	-	55	8686	c.8562A>G	c.(8560-8562)acA>acG	p.T2854T	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Silent_p.T2845T	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2845	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CCTGGGAGTCTGTCATCAGGA	0.567																																					p.T2859T		Atlas-SNP	.											.	DNAH17	347	.	0			c.A8577G						.						83.0	88.0	87.0					17																	76464900		2088	4202	6290	SO:0001819	synonymous_variant	8632	exon55			GGAGTCTGTCATC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8562A>G	chr17.hg19:g.76464900T>C		62.0	0.0		111.0	5.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	hg19																																																																																				.	.		0.567	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
CHMP6	79643	hgsc.bcm.edu	37	17	78972946	78972946	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:78972946C>G	ENST00000325167.5	+	8	677	c.599C>G	c.(598-600)gCt>gGt	p.A200G	CTD-2561B21.7_ENST00000577061.2_RNA|CTD-2561B21.7_ENST00000576215.1_RNA	NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	200					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)			lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CTGGTGGCAGCTTCGTAACGT	0.617																																					p.A200G		Atlas-SNP	.											.	CHMP6	16	.	0			c.C599G						.						119.0	98.0	105.0					17																	78972946		2203	4300	6503	SO:0001583	missense	79643	exon8			TGGCAGCTTCGTA	BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.599C>G	chr17.hg19:g.78972946C>G	ENSP00000317468:p.Ala200Gly	95.0	0.0		128.0	37.0	NM_024591	A8K7U0|Q53FU4|Q9HAE8	Missense_Mutation	SNP	ENST00000325167.5	hg19	CCDS11774.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484349	0.84854	.	.	ENSG00000176108	ENST00000325167	T	0.61040	0.14	4.77	4.77	0.60923	.	0.132704	0.49305	D	0.000158	T	0.72277	0.3440	L	0.60455	1.87	0.58432	D	0.999993	D	0.76494	0.999	D	0.78314	0.991	T	0.75602	-0.3261	10	0.72032	D	0.01	-16.2775	15.5945	0.76569	0.0:1.0:0.0:0.0	.	200	Q96FZ7	CHMP6_HUMAN	G	200	ENSP00000317468:A200G	ENSP00000317468:A200G	A	+	2	0	CHMP6	76587541	0.974000	0.33945	0.920000	0.36463	0.904000	0.53231	2.383000	0.44354	2.180000	0.69256	0.645000	0.84053	GCT	.	.		0.617	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438215.1	NM_024591	
VAPA	9218	hgsc.bcm.edu	37	18	9931911	9931911	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:9931911A>G	ENST00000400000.2	+	2	439	c.184A>G	c.(184-186)Agg>Ggg	p.R62G	VAPA_ENST00000340541.4_Missense_Mutation_p.R62G|VAPA_ENST00000584796.1_3'UTR	NM_003574.5|NM_194434.2	NP_003565.4|NP_919415.2	Q9P0L0	VAPA_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa	62	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				cell death (GO:0008219)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein localization to endoplasmic reticulum (GO:0070972)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein heterodimerization activity (GO:0046982)|signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(1)|lung(2)|prostate(1)	4						GTACTGTGTGAGGCCCAACAG	0.398																																					p.R62G		Atlas-SNP	.											.	VAPA	28	.	0			c.A184G						.						81.0	86.0	84.0					18																	9931911		2138	4272	6410	SO:0001583	missense	9218	exon2			TGTGTGAGGCCCA		CCDS11847.2, CCDS11848.2	18p11.2	2008-07-28	2002-08-29		ENSG00000101558	ENSG00000101558			12648	protein-coding gene	gene with protein product		605703	"""VAMP (vesicle-associated membrane protein)-associated protein A (33kD)"""			9920726, 9657962	Standard	NM_003574		Approved	hVAP-33, VAP-A	uc002koj.3	Q9P0L0	OTTHUMG00000131603	ENST00000400000.2:c.184A>G	chr18.hg19:g.9931911A>G	ENSP00000382880:p.Arg62Gly	73.0	0.0		97.0	4.0	NM_003574	A6NDZ0|D3DUI3|O75453|Q5U0E7|Q9UBZ2	Missense_Mutation	SNP	ENST00000400000.2	hg19	CCDS11848.2	.	.	.	.	.	.	.	.	.	.	A	22.0	4.235121	0.79800	.	.	ENSG00000101558	ENST00000340541;ENST00000400000	T;T	0.74947	-0.89;-0.89	5.57	-1.77	0.07982	PapD-like (2);	0.000000	0.85682	D	0.000000	D	0.90796	0.7110	H	0.98351	4.21	0.80722	D	1	D;D	0.76494	0.991;0.999	D;D	0.85130	0.995;0.997	D	0.93121	0.6525	9	.	.	.	-17.51	18.0014	0.89198	0.322:0.678:0.0:0.0	.	62;62	Q9P0L0;Q9P0L0-2	VAPA_HUMAN;.	G	62	ENSP00000345656:R62G;ENSP00000382880:R62G	.	R	+	1	2	VAPA	9921911	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	1.157000	0.31724	-0.425000	0.07371	0.533000	0.62120	AGG	.	.		0.398	VAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254490.1		
DSG4	147409	hgsc.bcm.edu	37	18	28971041	28971041	+	Splice_Site	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:28971041C>T	ENST00000308128.4	+	7	820	c.685C>T	c.(685-687)Caa>Taa	p.Q229*	RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Splice_Site_p.Q229*|RP11-534N16.1_ENST00000581452.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	229	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTTGATTAAGCAACACAGTAT	0.388																																					p.Q229X		Atlas-SNP	.											.	DSG4	343	.	0			c.C685T						.						123.0	104.0	110.0					18																	28971041		2203	4300	6503	SO:0001630	splice_region_variant	147409	exon7			ATTAAGCAACACA	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.685-1C>T	chr18.hg19:g.28971041C>T		84.0	0.0		83.0	4.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Nonsense_Mutation	SNP	ENST00000308128.4	hg19	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	C	36	5.647942	0.96714	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	.	.	.	5.99	2.97	0.34412	.	0.251262	0.21026	N	0.081431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.427	0.94746	0.0:0.5373:0.4627:0.0	.	.	.	.	X	229	.	.	Q	+	1	0	DSG4	27225039	0.972000	0.33761	1.000000	0.80357	0.711000	0.40976	-0.014000	0.12656	0.817000	0.34445	0.655000	0.94253	CAA	.	.		0.388	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	Nonsense_Mutation
ASXL3	80816	hgsc.bcm.edu	37	18	31326119	31326119	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:31326119T>C	ENST00000269197.5	+	12	6307	c.6307T>C	c.(6307-6309)Tat>Cat	p.Y2103H		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACAAGTTTCCTATGACCAGAA	0.413																																					p.Y2103H		Atlas-SNP	.											.	ASXL3	405	.	0			c.T6307C						.						90.0	90.0	90.0					18																	31326119		1853	4098	5951	SO:0001583	missense	80816	exon12			GTTTCCTATGACC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6307T>C	chr18.hg19:g.31326119T>C	ENSP00000269197:p.Tyr2103His	48.0	0.0		80.0	4.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	hg19	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	T	16.83	3.230122	0.58777	.	.	ENSG00000141431	ENST00000269197	T	0.17370	2.28	5.86	5.86	0.93980	.	.	.	.	.	T	0.27832	0.0685	N	0.24115	0.695	0.41471	D	0.988105	D	0.89917	1.0	D	0.80764	0.994	T	0.05869	-1.0859	9	0.24483	T	0.36	.	16.2605	0.82541	0.0:0.0:0.0:1.0	.	2103	Q9C0F0	ASXL3_HUMAN	H	2103	ENSP00000269197:Y2103H	ENSP00000269197:Y2103H	Y	+	1	0	ASXL3	29580117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.153000	0.71819	2.237000	0.73441	0.460000	0.39030	TAT	.	.		0.413	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
ALPK2	115701	hgsc.bcm.edu	37	18	56247584	56247584	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:56247584C>A	ENST00000361673.3	-	4	637	c.424G>T	c.(424-426)Gag>Tag	p.E142*	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	142						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGTTCCTTCTCATCAATCTGA	0.493																																					p.E142X		Atlas-SNP	.											.	ALPK2	487	.	0			c.G424T						.						279.0	268.0	272.0					18																	56247584		2139	4236	6375	SO:0001587	stop_gained	115701	exon4			CCTTCTCATCAAT	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.424G>T	chr18.hg19:g.56247584C>A	ENSP00000354991:p.Glu142*	270.0	1.0		306.0	125.0	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Nonsense_Mutation	SNP	ENST00000361673.3	hg19	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	34	5.320269	0.95682	.	.	ENSG00000198796	ENST00000361673	.	.	.	5.78	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-0.0203	3.2863	0.06932	0.1426:0.5675:0.1381:0.1518	.	.	.	.	X	142	.	ENSP00000354991:E142X	E	-	1	0	ALPK2	54398564	0.001000	0.12720	0.002000	0.10522	0.096000	0.18686	0.715000	0.25822	0.732000	0.32470	0.467000	0.42956	GAG	.	.		0.493	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
PIGN	23556	hgsc.bcm.edu	37	18	59713126	59713126	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:59713126A>G	ENST00000357637.5	-	31	3174	c.2759T>C	c.(2758-2760)cTc>cCc	p.L920P	PIGN_ENST00000400334.3_Missense_Mutation_p.L920P	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	920					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ACATAGTCTGAGTTTCTTCGT	0.448																																					p.L920P		Atlas-SNP	.											.	PIGN	62	.	0			c.T2759C						.						102.0	100.0	101.0					18																	59713126		2006	4195	6201	SO:0001583	missense	23556	exon31			AGTCTGAGTTTCT	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2759T>C	chr18.hg19:g.59713126A>G	ENSP00000350263:p.Leu920Pro	77.0	0.0		94.0	5.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	hg19	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089235	0.76756	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.32272	1.46;1.46	5.23	5.23	0.72850	.	0.165198	0.41001	D	0.000968	T	0.52289	0.1725	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.65987	0.868;0.94	T	0.53732	-0.8397	10	0.45353	T	0.12	-11.2283	12.6467	0.56738	1.0:0.0:0.0:0.0	.	920;920	B2RCI8;O95427	.;PIGN_HUMAN	P	920	ENSP00000350263:L920P;ENSP00000383188:L920P	ENSP00000350263:L920P	L	-	2	0	PIGN	57864106	1.000000	0.71417	0.923000	0.36655	0.920000	0.55202	6.969000	0.76092	1.963000	0.57068	0.460000	0.39030	CTC	.	.		0.448	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
SERPINB10	5273	hgsc.bcm.edu	37	18	61587033	61587033	+	Silent	SNP	A	A	G	rs149788289		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:61587033A>G	ENST00000238508.3	+	5	443	c.384A>G	c.(382-384)gaA>gaG	p.E128E		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	128					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				AATATTTAGAAGACATGAAAA	0.328																																					p.E128E		Atlas-SNP	.											.	SERPINB10	53	.	0			c.A384G						.	A		1,4405	2.1+/-5.4	0,1,2202	66.0	81.0	76.0		384	0.3	1.0	18	dbSNP_134	76	0,8598		0,0,4299	no	coding-synonymous	SERPINB10	NM_005024.1		0,1,6501	GG,GA,AA		0.0,0.0227,0.0077		128/398	61587033	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	5273	exon4			TTTAGAAGACATG	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.384A>G	chr18.hg19:g.61587033A>G		66.0	0.0		75.0	4.0	NM_005024	Q4VAX4|Q4VAX7	Silent	SNP	ENST00000238508.3	hg19	CCDS11990.1																																																																																			.	A|1.000;G|0.000		0.328	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
MUM1	84939	hgsc.bcm.edu	37	19	1362334	1362334	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:1362334A>G	ENST00000415183.3	+	5	1226	c.1200A>G	c.(1198-1200)agA>agG	p.R400R	MUM1_ENST00000311401.5_Silent_p.R331R|MUM1_ENST00000344663.3_Silent_p.R400R|MUM1_ENST00000591806.1_Silent_p.R400R			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	399					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCACCAAGAGTCCTTTTAT	0.582																																					p.R400R		Atlas-SNP	.											.	MUM1	54	.	0			c.A1200G						.						58.0	55.0	56.0					19																	1362334		2203	4300	6503	SO:0001819	synonymous_variant	84939	exon6			ACCAAGAGTCCTT	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1200A>G	chr19.hg19:g.1362334A>G		80.0	0.0		95.0	5.0	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Silent	SNP	ENST00000415183.3	hg19																																																																																				.	.		0.582	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
REXO1	57455	hgsc.bcm.edu	37	19	1816497	1816497	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:1816497A>G	ENST00000170168.4	-	14	3483	c.3389T>C	c.(3388-3390)cTg>cCg	p.L1130P	MIR1909_ENST00000411312.1_RNA|CTB-31O20.3_ENST00000586259.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	1130	Exonuclease.					nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACATGCTCAGCAGAACGGC	0.672																																					p.L1130P		Atlas-SNP	.											.	REXO1	55	.	0			c.T3389C						.						56.0	45.0	49.0					19																	1816497		2201	4300	6501	SO:0001583	missense	57455	exon14			ATGCTCAGCAGAA	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.3389T>C	chr19.hg19:g.1816497A>G	ENSP00000170168:p.Leu1130Pro	71.0	0.0		77.0	4.0	NM_020695	Q9ULT2	Missense_Mutation	SNP	ENST00000170168.4	hg19	CCDS32866.1	.	.	.	.	.	.	.	.	.	.	a	15.00	2.702213	0.48307	.	.	ENSG00000079313	ENST00000170168;ENST00000543452	T	0.22134	1.97	4.01	4.01	0.46588	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.54886	0.1886	M	0.93978	3.48	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.995;1.0;1.0	T	0.67205	-0.5729	10	0.72032	D	0.01	-19.0048	12.5244	0.56077	1.0:0.0:0.0:0.0	.	116;439;1130	B4DVD3;B4DWY3;Q8N1G1	.;.;REXO1_HUMAN	P	1130;402	ENSP00000170168:L1130P	ENSP00000170168:L1130P	L	-	2	0	REXO1	1767497	1.000000	0.71417	0.998000	0.56505	0.216000	0.24613	6.600000	0.74132	1.792000	0.52537	0.454000	0.30748	CTG	.	.		0.672	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
FZR1	51343	hgsc.bcm.edu	37	19	3530851	3530851	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:3530851A>G	ENST00000395095.3	+	7	716	c.716A>G	c.(715-717)gAg>gGg	p.E239G	FZR1_ENST00000313639.8_Missense_Mutation_p.E150G|FZR1_ENST00000441788.2_Missense_Mutation_p.E239G	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	239					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTGGTCTGAGCGGGTGAGT	0.632																																					p.E239G		Atlas-SNP	.											.	FZR1	42	.	0			c.A716G						.						74.0	58.0	63.0					19																	3530851		2201	4300	6501	SO:0001583	missense	51343	exon7			GGTCTGAGCGGGT	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.716A>G	chr19.hg19:g.3530851A>G	ENSP00000378529:p.Glu239Gly	67.0	0.0		87.0	4.0	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	hg19	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799849	0.70567	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.29397	1.57;1.57;5.01	4.75	4.75	0.60458	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	L	0.28054	0.825	0.80722	D	1	B;P;D	0.89917	0.004;0.887;1.0	B;P;D	0.91635	0.012;0.528;0.999	T	0.11251	-1.0595	10	0.22706	T	0.39	-42.9006	13.0749	0.59081	1.0:0.0:0.0:0.0	.	239;150;239	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	G	239;239;150	ENSP00000410369:E239G;ENSP00000378529:E239G;ENSP00000321800:E150G	ENSP00000321800:E150G	E	+	2	0	FZR1	3481851	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.015000	0.93640	1.782000	0.52362	0.533000	0.62120	GAG	.	.		0.632	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
ANKRD24	170961	hgsc.bcm.edu	37	19	4200121	4200121	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:4200121A>G	ENST00000600132.1	+	5	572	c.296A>G	c.(295-297)gAg>gGg	p.E99G	ANKRD24_ENST00000318934.4_Missense_Mutation_p.E99G|ANKRD24_ENST00000262970.5_Missense_Mutation_p.E189G	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	99										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		AGCTGTCTGGAGGTGATGATA	0.652																																					p.E99G		Atlas-SNP	.											.	ANKRD24	180	.	0			c.A296G						.						26.0	28.0	27.0					19																	4200121		1982	4152	6134	SO:0001583	missense	170961	exon5			GTCTGGAGGTGAT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.296A>G	chr19.hg19:g.4200121A>G	ENSP00000471252:p.Glu99Gly	100.0	0.0		114.0	5.0	NM_133475	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	hg19	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	A	19.83	3.900249	0.72754	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.68025	-0.3;-0.3	4.17	4.17	0.49024	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.73450	0.3588	L	0.43757	1.38	0.46185	D	0.998912	D;D	0.89917	1.0;0.971	D;P	0.91635	0.999;0.908	T	0.73994	-0.3807	9	0.52906	T	0.07	-18.7771	10.5727	0.45209	1.0:0.0:0.0:0.0	.	99;189	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	G	99;189	ENSP00000321731:E99G;ENSP00000262970:E189G	ENSP00000262970:E189G	E	+	2	0	ANKRD24	4151121	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.568000	0.82369	1.510000	0.48803	0.260000	0.18958	GAG	.	.		0.652	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
DCAF15	90379	hgsc.bcm.edu	37	19	14071164	14071164	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:14071164T>C	ENST00000254337.6	+	11	1613	c.1592T>C	c.(1591-1593)gTc>gCc	p.V531A		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	531					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						TTCGAGACAGTCAGTGTAGGC	0.612											OREG0025301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V531A		Atlas-SNP	.											.	DCAF15	30	.	0			c.T1592C						.						136.0	118.0	124.0					19																	14071164		2203	4300	6503	SO:0001583	missense	90379	exon11			AGACAGTCAGTGT	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1592T>C	chr19.hg19:g.14071164T>C	ENSP00000254337:p.Val531Ala	115.0	0.0	692	85.0	4.0	NM_138353	B3KS86|Q96DW0|Q9BU31	Missense_Mutation	SNP	ENST00000254337.6	hg19	CCDS32926.1	.	.	.	.	.	.	.	.	.	.	t	25.6	4.658600	0.88154	.	.	ENSG00000132017	ENST00000254337	.	.	.	4.35	4.35	0.52113	.	0.000000	0.64402	D	0.000006	T	0.46600	0.1401	L	0.32530	0.975	0.53005	D	0.999965	D	0.61697	0.99	P	0.46339	0.513	T	0.53049	-0.8493	9	0.87932	D	0	-26.9513	12.8094	0.57631	0.0:0.0:0.0:1.0	.	531	Q66K64	DCA15_HUMAN	A	531	.	ENSP00000254337:V531A	V	+	2	0	DCAF15	13932164	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.958000	0.76025	1.748000	0.51833	0.459000	0.35465	GTC	.	.		0.612	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353	
FKBP8	23770	hgsc.bcm.edu	37	19	18649200	18649200	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:18649200T>C	ENST00000596558.2	-	5	704	c.595A>G	c.(595-597)Acc>Gcc	p.T199A	FKBP8_ENST00000453489.2_Missense_Mutation_p.T228A|FKBP8_ENST00000222308.4_Missense_Mutation_p.T199A|AC005387.2_ENST00000596596.1_RNA|FKBP8_ENST00000610101.1_Intron|FKBP8_ENST00000608443.1_Missense_Mutation_p.T200A|FKBP8_ENST00000597960.3_Missense_Mutation_p.T200A			Q14318	FKBP8_HUMAN	FK506 binding protein 8, 38kDa	199	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				apoptotic process (GO:0006915)|camera-type eye development (GO:0043010)|cell fate specification (GO:0001708)|chaperone-mediated protein folding (GO:0061077)|dorsal/ventral neural tube patterning (GO:0021904)|intracellular signal transduction (GO:0035556)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|positive regulation of BMP signaling pathway (GO:0030513)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of gene expression (GO:0010468)|smoothened signaling pathway (GO:0007224)|viral process (GO:0016032)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	FK506 binding (GO:0005528)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	15						GTCTTCAGGGTCACCTCCAGG	0.682																																					p.T200A		Atlas-SNP	.											.	FKBP8	69	.	0			c.A598G						.						22.0	24.0	23.0					19																	18649200		2203	4298	6501	SO:0001583	missense	23770	exon5			TCAGGGTCACCTC	L37033	CCDS32961.1	19p12	2013-01-10	2002-08-29		ENSG00000105701	ENSG00000105701		"""Tetratricopeptide (TTC) repeat domain containing"""	3724	protein-coding gene	gene with protein product	"""FK506-binding protein 8 (38kD)"""	604840	"""FK506-binding protein 8 (38kD)"""			7543869	Standard	NM_012181		Approved	FKBP38, FKBPr38	uc002njj.1	Q14318		ENST00000596558.2:c.595A>G	chr19.hg19:g.18649200T>C	ENSP00000472302:p.Thr199Ala	118.0	0.0		113.0	5.0	NM_012181	C8C9T5|Q53GU3|Q7Z349|Q86YK6	Missense_Mutation	SNP	ENST00000596558.2	hg19		.	.	.	.	.	.	.	.	.	.	T	9.304	1.053800	0.19907	.	.	ENSG00000105701	ENST00000222308;ENST00000453489	T;T	0.55930	0.49;0.49	3.79	1.48	0.22813	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.376195	0.26631	N	0.023302	T	0.31231	0.0790	N	0.26042	0.785	0.80722	D	1	B;B;B;B	0.31026	0.001;0.008;0.304;0.014	B;B;B;B	0.29785	0.001;0.007;0.107;0.002	T	0.12734	-1.0536	10	0.56958	D	0.05	-42.0738	1.4621	0.02398	0.3049:0.2869:0.0:0.4082	.	228;143;199;200	B7Z6M0;B2R8G6;Q14318;Q14318-2	.;.;FKBP8_HUMAN;.	A	200;228	ENSP00000222308:T200A;ENSP00000388891:T228A	ENSP00000222308:T200A	T	-	1	0	FKBP8	18510200	1.000000	0.71417	0.992000	0.48379	0.598000	0.36846	0.618000	0.24373	0.507000	0.28148	-0.496000	0.04628	ACC	.	.		0.682	FKBP8-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000466374.3	NM_012181	
ZNF681	148213	hgsc.bcm.edu	37	19	23938330	23938330	+	Silent	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:23938330C>A	ENST00000402377.3	-	2	168	c.27G>T	c.(25-27)gtG>gtT	p.V9V	ZNF681_ENST00000395385.3_Intron	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	9	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATTCTATGGCCACATCCCTAA	0.418																																					p.V9V		Atlas-SNP	.											.	ZNF681	76	.	0			c.G27T						.						64.0	70.0	68.0					19																	23938330		2203	4300	6503	SO:0001819	synonymous_variant	148213	exon2			TATGGCCACATCC	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.27G>T	chr19.hg19:g.23938330C>A		36.0	0.0		36.0	10.0	NM_138286	B3KVF7	Silent	SNP	ENST00000402377.3	hg19	CCDS12414.2																																																																																			.	.		0.418	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
KMT2B	9757	hgsc.bcm.edu	37	19	36229022	36229022	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:36229022T>C	ENST00000222270.7	+	36	7802	c.7802T>C	c.(7801-7803)gTc>gCc	p.V2601A	IGFLR1_ENST00000587101.1_5'Flank|KMT2B_ENST00000420124.1_Missense_Mutation_p.V2601A|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	2601	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GGGGAGATGGTCATCGAGTAC	0.597																																					p.V2601A		Atlas-SNP	.											.	MLL4	229	.	0			c.T7802C						.						86.0	93.0	90.0					19																	36229022		2114	4215	6329	SO:0001583	missense	8085	exon36			AGATGGTCATCGA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7802T>C	chr19.hg19:g.36229022T>C	ENSP00000222270:p.Val2601Ala	68.0	0.0		100.0	6.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.903623	0.33628	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.88201	-2.35;-2.35	4.83	4.83	0.62350	SET domain (3);	0.000000	0.40469	N	0.001091	D	0.96355	0.8811	H	0.97440	4.005	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.97524	1.0075	10	0.87932	D	0	.	13.504	0.61474	0.0:0.0:0.0:1.0	.	2601	Q9UMN6	MLL4_HUMAN	A	2601	ENSP00000222270:V2601A;ENSP00000398837:V2601A	ENSP00000222270:V2601A	V	+	2	0	AD000671.1	40920862	1.000000	0.71417	1.000000	0.80357	0.151000	0.21798	6.112000	0.71547	2.034000	0.60081	0.379000	0.24179	GTC	.	.		0.597	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
NPHS1	4868	hgsc.bcm.edu	37	19	36342181	36342181	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:36342181A>T	ENST00000378910.5	-	3	379	c.380T>A	c.(379-381)gTg>gAg	p.V127E	NPHS1_ENST00000591817.1_5'Flank|NPHS1_ENST00000353632.6_Missense_Mutation_p.V127E	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	127	Ig-like C2-type 1.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGAGAGGATCACTCTGGGAGA	0.637																																					p.V127E		Atlas-SNP	.											.	NPHS1	165	.	0			c.T380A						.						37.0	40.0	39.0					19																	36342181		2203	4300	6503	SO:0001583	missense	4868	exon3			AGGATCACTCTGG		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.380T>A	chr19.hg19:g.36342181A>T	ENSP00000368190:p.Val127Glu	82.0	0.0		110.0	26.0	NM_004646	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	hg19	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.734747	0.48939	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.51325	0.71;0.71	5.92	4.9	0.64082	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.328619	0.27518	N	0.019013	T	0.51873	0.1700	L	0.36672	1.1	0.36219	D	0.851889	D	0.67145	0.996	D	0.63957	0.92	T	0.61618	-0.7026	10	0.72032	D	0.01	-14.0379	6.1768	0.20449	0.7554:0.1642:0.0804:0.0	.	127	O60500	NPHN_HUMAN	E	127	ENSP00000368190:V127E;ENSP00000343634:V127E	ENSP00000343634:V127E	V	-	2	0	NPHS1	41034021	0.997000	0.39634	1.000000	0.80357	0.190000	0.23558	2.197000	0.42696	1.050000	0.40346	0.529000	0.55759	GTG	.	.		0.637	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
C19orf33	64073	hgsc.bcm.edu	37	19	38795554	38795554	+	Missense_Mutation	SNP	A	A	G	rs79297344|rs369605535|rs201239475	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:38795554A>G	ENST00000301246.5	+	4	372	c.271A>G	c.(271-273)Aag>Gag	p.K91E	C19orf33_ENST00000588605.1_3'UTR	NM_033520.1	NP_277055.1	Q9GZP8	IMUP_HUMAN	chromosome 19 open reading frame 33	91						nucleus (GO:0005634)						all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AGTgaagaagaaggagaaggg	0.597																																					p.K91E		Atlas-SNP	.											.	C19orf33	9	.	0			c.A271G						.						89.0	91.0	90.0					19																	38795554		2203	4300	6503	SO:0001583	missense	64073	exon4			AAGAAGAAGGAGA	AF213678	CCDS12511.1	19q13.2	2012-10-26			ENSG00000167644	ENSG00000167644			16668	protein-coding gene	gene with protein product	"""immortalization-upregulated protein"", ""HAI-2 related small protein"", ""hepatocyte growth factor activator inhibitor type 2-related small protein"""					11080599	Standard	NM_033520		Approved	IMUP-1, IMUP-2, H2RSP, IMUP	uc002ohu.1	Q9GZP8	OTTHUMG00000181894	ENST00000301246.5:c.271A>G	chr19.hg19:g.38795554A>G	ENSP00000301246:p.Lys91Glu	226.0	0.0		310.0	14.0	NM_033520	Q0P6G2|Q96H58|Q9HCR4	Missense_Mutation	SNP	ENST00000301246.5	hg19	CCDS12511.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172420	0.38315	.	.	ENSG00000167644	ENST00000301246	.	.	.	4.25	-6.0	0.02206	.	.	.	.	.	T	0.14013	0.0339	N	0.03608	-0.345	0.09310	N	0.999997	B	0.14012	0.009	B	0.09377	0.004	T	0.30650	-0.9971	8	0.87932	D	0	-21.5778	7.463	0.27306	0.3041:0.1311:0.5648:0.0	.	91	Q9GZP8	IMUP_HUMAN	E	91	.	ENSP00000301246:K91E	K	+	1	0	C19orf33	43487394	0.991000	0.36638	0.001000	0.08648	0.349000	0.29174	2.688000	0.46984	-1.165000	0.02786	0.454000	0.30748	AAG	.	.		0.597	C19orf33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458168.1	NM_033520	
KCNK6	9424	hgsc.bcm.edu	37	19	38817935	38817935	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:38817935T>C	ENST00000263372.3	+	3	941	c.834T>C	c.(832-834)agT>agC	p.S278S		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	278					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	GCCCTGCCAGTTTCAATGCGG	0.662																																					p.S278S		Atlas-SNP	.											.	KCNK6	37	.	0			c.T834C						.						67.0	62.0	64.0					19																	38817935		2203	4300	6503	SO:0001819	synonymous_variant	9424	exon3			TGCCAGTTTCAAT	AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.834T>C	chr19.hg19:g.38817935T>C		94.0	0.0		114.0	6.0	NM_004823	Q9HB47	Silent	SNP	ENST00000263372.3	hg19	CCDS12513.1																																																																																			.	.		0.662	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460524.1	NM_004823	
RYR1	6261	hgsc.bcm.edu	37	19	38939069	38939069	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:38939069T>C	ENST00000359596.3	+	10	875	c.875T>C	c.(874-876)cTc>cCc	p.L292P	RYR1_ENST00000355481.4_Missense_Mutation_p.L292P|RYR1_ENST00000360985.3_Missense_Mutation_p.L292P			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	292	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TACCTAGCGCTCACCGAGGAC	0.647																																					p.L292P		Atlas-SNP	.											.	RYR1	708	.	0			c.T875C						.						114.0	109.0	111.0					19																	38939069		2203	4300	6503	SO:0001583	missense	6261	exon10			TAGCGCTCACCGA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.875T>C	chr19.hg19:g.38939069T>C	ENSP00000352608:p.Leu292Pro	68.0	0.0		82.0	4.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	T	6.625	0.483843	0.12581	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.87334	-2.24;-2.24;-2.24	4.43	4.43	0.53597	MIR motif (2);MIR (2);	0.112548	0.36665	U	0.002462	D	0.91774	0.7398	M	0.73962	2.25	0.58432	D	0.999993	D;D	0.89917	0.999;1.0	D;D	0.81914	0.952;0.995	D	0.92029	0.5632	10	0.87932	D	0	.	9.1714	0.37083	0.0:0.0:0.1836:0.8164	.	292;292	P21817-2;P21817	.;RYR1_HUMAN	P	292	ENSP00000352608:L292P;ENSP00000347667:L292P;ENSP00000354254:L292P	ENSP00000347667:L292P	L	+	2	0	RYR1	43630909	1.000000	0.71417	0.978000	0.43139	0.268000	0.26511	5.596000	0.67570	1.867000	0.54127	0.402000	0.26972	CTC	.	.		0.647	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SPTBN4	57731	hgsc.bcm.edu	37	19	41029483	41029483	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:41029483T>C	ENST00000352632.3	+	17	3880	c.3794T>C	c.(3793-3795)cTg>cCg	p.L1265P	SPTBN4_ENST00000595535.1_Missense_Mutation_p.L1265P|SPTBN4_ENST00000392025.1_5'Flank|SPTBN4_ENST00000598249.1_Missense_Mutation_p.L1265P|SPTBN4_ENST00000338932.3_Missense_Mutation_p.L1265P|SPTBN4_ENST00000344104.3_Missense_Mutation_p.L1265P			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1265					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCAGAGGGCCTGCTGAGGCAG	0.632																																					p.L1265P		Atlas-SNP	.											.	SPTBN4	213	.	0			c.T3794C						.						59.0	50.0	53.0					19																	41029483		2203	4300	6503	SO:0001583	missense	57731	exon17			AGGGCCTGCTGAG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3794T>C	chr19.hg19:g.41029483T>C	ENSP00000263373:p.Leu1265Pro	62.0	0.0		86.0	5.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	t	17.41	3.382082	0.61845	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.55413	0.53;0.52;0.52	4.31	4.31	0.51392	.	0.000000	0.48286	U	0.000182	T	0.65984	0.2744	M	0.65677	2.01	0.80722	D	1	D;D	0.61080	0.989;0.957	P;P	0.61003	0.726;0.882	T	0.70317	-0.4905	10	0.72032	D	0.01	.	12.6154	0.56573	0.0:0.0:0.0:1.0	.	1265;1265	Q9H254;Q71S06	SPTN4_HUMAN;.	P	1265	ENSP00000263373:L1265P;ENSP00000340345:L1265P;ENSP00000340741:L1265P	ENSP00000340345:L1265P	L	+	2	0	SPTBN4	45721323	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	7.684000	0.84104	1.819000	0.53055	0.139000	0.15985	CTG	.	.		0.632	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
SPTBN4	57731	hgsc.bcm.edu	37	19	41066144	41066144	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:41066144A>G	ENST00000352632.3	+	27	5836	c.5750A>G	c.(5749-5751)gAg>gGg	p.E1917G	SPTBN4_ENST00000595535.1_Missense_Mutation_p.E1917G|SPTBN4_ENST00000392025.1_Missense_Mutation_p.E660G|SPTBN4_ENST00000598249.1_Missense_Mutation_p.E1917G|SPTBN4_ENST00000338932.3_Missense_Mutation_p.E1917G|SPTBN4_ENST00000392023.1_Missense_Mutation_p.E593G			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1917					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTAGCCGGGAGCAGGAGGTG	0.667																																					p.E1917G		Atlas-SNP	.											.	SPTBN4	213	.	0			c.A5750G						.						75.0	63.0	67.0					19																	41066144		2203	4300	6503	SO:0001583	missense	57731	exon27			GCCGGGAGCAGGA	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5750A>G	chr19.hg19:g.41066144A>G	ENSP00000263373:p.Glu1917Gly	145.0	0.0		156.0	7.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694104	0.88735	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.66	4.66	0.58398	.	0.000000	0.64402	U	0.000008	T	0.69504	0.3118	M	0.83223	2.63	0.48236	D	0.999613	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.998;0.993	T	0.73531	-0.3953	10	0.52906	T	0.07	.	13.2011	0.59769	1.0:0.0:0.0:0.0	.	660;593;1917;1917	C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;SPTN4_HUMAN;.	G	1917;1917;1917;660;593	ENSP00000263373:E1917G;ENSP00000340345:E1917G;ENSP00000375879:E660G;ENSP00000375877:E593G	ENSP00000340345:E1917G	E	+	2	0	SPTBN4	45757984	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.981000	0.93465	1.962000	0.57031	0.482000	0.46254	GAG	.	.		0.667	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41800283	41800283	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:41800283C>A	ENST00000392006.3	+	9	1480	c.1307C>A	c.(1306-1308)aCa>aAa	p.T436K	HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.T436K|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.T347K|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.T336K|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.T322K|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.T336K|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.T336K	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	436	Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GGCAAGACCACATGGGCCATC	0.542																																					p.T436K		Atlas-SNP	.											.	HNRNPUL1	73	.	0			c.C1307A						.						176.0	128.0	144.0					19																	41800283		2203	4300	6503	SO:0001583	missense	11100	exon9			AGACCACATGGGC	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1307C>A	chr19.hg19:g.41800283C>A	ENSP00000375863:p.Thr436Lys	190.0	0.0		235.0	82.0	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	hg19	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505392	0.85282	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	5.46	3.35	0.38373	.	0.050683	0.85682	D	0.000000	T	0.75384	0.3842	M	0.85462	2.755	0.48975	D	0.999737	D;D;D;P;D;D	0.63046	0.985;0.969;0.968;0.934;0.992;0.981	D;D;P;P;D;P	0.70935	0.944;0.944;0.66;0.517;0.971;0.835	T	0.77736	-0.2476	10	0.62326	D	0.03	-11.1853	11.2933	0.49263	0.0:0.8505:0.0:0.1495	.	347;336;436;322;436;336	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	K	336;436;322;347	ENSP00000340857:T336K;ENSP00000375863:T436K;ENSP00000367460:T322K;ENSP00000263367:T347K	ENSP00000263367:T347K	T	+	2	0	HNRNPUL1	46492123	1.000000	0.71417	0.727000	0.30756	0.994000	0.84299	5.833000	0.69349	0.872000	0.35775	0.655000	0.94253	ACA	.	.		0.542	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
CIC	23152	hgsc.bcm.edu	37	19	42798458	42798458	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:42798458T>C	ENST00000575354.2	+	18	4367		c.e18+2		CIC_ENST00000572681.2_Splice_Site|CIC_ENST00000160740.3_Splice_Site	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				ACCGTACAGGTGCCGTGGTGG	0.612			"""Mis, F, S"""		oligodendroglioma																																.		Atlas-SNP	.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC	249	.	0			c.4327+2T>C						.						57.0	60.0	59.0					19																	42798458		2203	4300	6503	SO:0001630	splice_region_variant	23152	exon18			TACAGGTGCCGTG	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.4327+2T>C	chr19.hg19:g.42798458T>C		71.0	0.0		69.0	4.0	NM_015125	Q7LGI1|Q9UEG5|Q9Y6T1	Splice_Site	SNP	ENST00000575354.2	hg19	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	T	9.724	1.160352	0.21454	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.19	3.18	0.36537	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0498	0.30570	0.0:0.099:0.0:0.901	.	.	.	.	.	-1	.	.	.	+	.	.	CIC	47490298	1.000000	0.71417	0.123000	0.21794	0.692000	0.40212	6.651000	0.74372	0.968000	0.38212	0.482000	0.46254	.	.	.		0.612	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		Intron
MEGF8	1954	hgsc.bcm.edu	37	19	42855634	42855634	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:42855634A>G	ENST00000251268.6	+	17	2909	c.2909A>G	c.(2908-2910)cAg>cGg	p.Q970R	MEGF8_ENST00000334370.4_Missense_Mutation_p.Q903R	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	970					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GCCTGGTGCCAGTCCACCCAC	0.662																																					p.Q970R		Atlas-SNP	.											.	MEGF8	358	.	0			c.A2909G						.						53.0	40.0	44.0					19																	42855634		2203	4299	6502	SO:0001583	missense	1954	exon17			GGTGCCAGTCCAC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2909A>G	chr19.hg19:g.42855634A>G	ENSP00000251268:p.Gln970Arg	76.0	0.0		81.0	4.0	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	A	17.93	3.508461	0.64410	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.21734	1.99;1.99	5.26	5.26	0.73747	.	0.075489	0.53938	D	0.000047	T	0.25680	0.0625	L	0.55990	1.75	0.80722	D	1	B;P	0.46512	0.329;0.879	B;P	0.45167	0.065;0.472	T	0.01706	-1.1291	10	0.35671	T	0.21	-18.4302	13.15	0.59484	1.0:0.0:0.0:0.0	.	970;903	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	R	903;970	ENSP00000334219:Q903R;ENSP00000251268:Q970R	ENSP00000251268:Q970R	Q	+	2	0	MEGF8	47547474	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.187000	0.72039	1.996000	0.58369	0.533000	0.62120	CAG	.	.		0.662	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
CADM4	199731	hgsc.bcm.edu	37	19	44127546	44127546	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:44127546T>C	ENST00000222374.2	-	9	1151	c.1103A>G	c.(1102-1104)gAa>gGa	p.E368G	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	368					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				TTCTCTTGCTTCTCCCTGTTC	0.587																																					p.E368G		Atlas-SNP	.											.	CADM4	26	.	0			c.A1103G						.						150.0	148.0	149.0					19																	44127546		2203	4300	6503	SO:0001583	missense	199731	exon9			CTTGCTTCTCCCT	AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.1103A>G	chr19.hg19:g.44127546T>C	ENSP00000222374:p.Glu368Gly	91.0	0.0		126.0	9.0	NM_145296	B2R7L5|Q9Y4A4	Missense_Mutation	SNP	ENST00000222374.2	hg19	CCDS12627.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.851232	0.71719	.	.	ENSG00000105767	ENST00000222374	T	0.62498	0.02	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.68842	0.3045	L	0.36672	1.1	0.46901	D	0.999245	D	0.71674	0.998	D	0.70227	0.968	T	0.71948	-0.4438	10	0.72032	D	0.01	.	12.2052	0.54348	0.0:0.0:0.0:1.0	.	368	Q8NFZ8	CADM4_HUMAN	G	368	ENSP00000222374:E368G	ENSP00000222374:E368G	E	-	2	0	CADM4	48819386	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.513000	0.73742	1.842000	0.53543	0.378000	0.23410	GAA	.	.		0.587	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	NM_145296	
CEACAM20	125931	hgsc.bcm.edu	37	19	45026890	45026890	+	RNA	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:45026890T>C	ENST00000454753.1	-	0	802							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				CTCAACCACCTCCCCACTGGC	0.498																																					p.E175G		Atlas-SNP	.											.	CEACAM20	31	.	0			c.A524G						.						77.0	84.0	81.0					19																	45026890		2113	4235	6348			125931	exon4			ACCACCTCCCCAC	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		chr19.hg19:g.45026890T>C		90.0	0.0		121.0	6.0	NM_001102600		Missense_Mutation	SNP	ENST00000454753.1	hg19																																																																																				.	.		0.498	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
SLC1A5	6510	hgsc.bcm.edu	37	19	47280496	47280496	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:47280496A>G	ENST00000542575.2	-	6	1853	c.1225T>C	c.(1225-1227)Ttg>Ctg	p.L409L	SLC1A5_ENST00000412532.2_Silent_p.L181L|SLC1A5_ENST00000594991.1_Silent_p.L233L|SLC1A5_ENST00000434726.2_Silent_p.L207L	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	409					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	ACGAAGTCCAAGGACTGCTGG	0.612																																					p.L409L		Atlas-SNP	.											.	SLC1A5	31	.	0			c.T1225C						.						66.0	60.0	62.0					19																	47280496		2203	4300	6503	SO:0001819	synonymous_variant	6510	exon6			AGTCCAAGGACTG	U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1225T>C	chr19.hg19:g.47280496A>G		49.0	0.0		82.0	5.0	NM_005628	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Silent	SNP	ENST00000542575.2	hg19	CCDS12692.1																																																																																			.	.		0.612	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1		
PLA2G4C	8605	hgsc.bcm.edu	37	19	48565265	48565265	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:48565265T>C	ENST00000599921.1	-	14	1604	c.1247A>G	c.(1246-1248)gAt>gGt	p.D416G	CTD-2265M8.2_ENST00000601548.1_RNA|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.D416G|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.D426G|CTD-2265M8.2_ENST00000596552.1_RNA|CTD-2265M8.2_ENST00000601950.1_RNA|PLA2G4C_ENST00000413144.2_Missense_Mutation_p.D416G			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	416	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CTCGAAAGGATCTCCGGCACT	0.627																																					p.D426G		Atlas-SNP	.											.	PLA2G4C	76	.	0			c.A1277G						.						90.0	88.0	89.0					19																	48565265		2203	4300	6503	SO:0001583	missense	8605	exon14			AAAGGATCTCCGG	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1247A>G	chr19.hg19:g.48565265T>C	ENSP00000469473:p.Asp416Gly	45.0	0.0		59.0	26.0	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	hg19	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274278	0.40194	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.11063	2.81;2.81	2.79	2.79	0.32731	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.174869	0.36482	U	0.002575	T	0.08358	0.0208	L	0.31664	0.95	0.27953	N	0.93709	P;P	0.45428	0.858;0.835	B;B	0.43867	0.434;0.363	T	0.16394	-1.0404	10	0.27082	T	0.32	-5.1386	7.4822	0.27411	0.0:0.0:0.0:1.0	.	426;416	B4DI40;Q9UP65	.;PA24C_HUMAN	G	416	ENSP00000346228:D416G;ENSP00000400036:D416G	ENSP00000346228:D416G	D	-	2	0	PLA2G4C	53257077	1.000000	0.71417	0.386000	0.26170	0.550000	0.35303	3.354000	0.52254	1.045000	0.40225	0.333000	0.21579	GAT	.	.		0.627	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
HRC	3270	hgsc.bcm.edu	37	19	49657886	49657886	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:49657886C>T	ENST00000252825.4	-	1	795	c.609G>A	c.(607-609)gaG>gaA	p.E203E	HRC_ENST00000595625.1_Silent_p.E203E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	203	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TGGAGGcctcctcttcctcct	0.572																																					p.E203E	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.	HRC	85	.	0			c.G609A						.						123.0	91.0	102.0					19																	49657886		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			GGCCTCCTCTTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.609G>A	chr19.hg19:g.49657886C>T		137.0	0.0		158.0	10.0	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	hg19	CCDS12759.1																																																																																			.	.		0.572	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
HRC	3270	hgsc.bcm.edu	37	19	49657916	49657916	+	Silent	SNP	T	T	C	rs7409255		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:49657916T>C	ENST00000252825.4	-	1	765	c.579A>G	c.(577-579)gaA>gaG	p.E193E	HRC_ENST00000595625.1_Silent_p.E193E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	193	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cctcctcctcttcTCCTTCAT	0.557																																					p.E193E	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.	HRC	85	.	0			c.A579G						.						119.0	95.0	103.0					19																	49657916		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCTCCT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.579A>G	chr19.hg19:g.49657916T>C		129.0	0.0		173.0	16.0	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	hg19	CCDS12759.1																																																																																			.	.		0.557	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
BRSK1	84446	hgsc.bcm.edu	37	19	55815939	55815939	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:55815939A>G	ENST00000309383.1	+	14	1645	c.1368A>G	c.(1366-1368)tcA>tcG	p.S456S	BRSK1_ENST00000590333.1_Silent_p.S472S|BRSK1_ENST00000326848.7_Silent_p.S151S|BRSK1_ENST00000588584.1_3'UTR	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	456					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TTTCCTTTTCACCGGAGCCGG	0.652																																					p.S456S		Atlas-SNP	.											.	BRSK1	192	.	0			c.A1368G						.						7.0	8.0	8.0					19																	55815939		2151	4218	6369	SO:0001819	synonymous_variant	84446	exon14			CTTTTCACCGGAG	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1368A>G	chr19.hg19:g.55815939A>G		46.0	0.0		73.0	5.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	hg19	CCDS12921.1																																																																																			.	.		0.652	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
ZNF835	90485	hgsc.bcm.edu	37	19	57175640	57175640	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:57175640C>A	ENST00000537055.2	-	2	1158	c.927G>T	c.(925-927)caG>caT	p.Q309H		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	309					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CGCCGCAGTCCTGGCACGTGT	0.711																																					p.Q309H		Atlas-SNP	.											.	ZNF835	106	.	0			c.G927T						.						17.0	17.0	17.0					19																	57175640		2196	4298	6494	SO:0001583	missense	90485	exon2			GCAGTCCTGGCAC	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.927G>T	chr19.hg19:g.57175640C>A	ENSP00000444747:p.Gln309His	16.0	0.0		21.0	12.0	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	hg19	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236947	0.22711	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.07800	3.16	2.12	-3.63	0.04529	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04724	0.0128	N	0.21097	0.63	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39820	-0.9595	9	0.54805	T	0.06	.	3.6697	0.08269	0.1257:0.5286:0.1992:0.1465	.	331	Q9Y2P0	ZN835_HUMAN	H	331;309	ENSP00000444747:Q309H	ENSP00000341756:Q331H	Q	-	3	2	ZNF835	61867452	0.000000	0.05858	0.001000	0.08648	0.271000	0.26615	-5.498000	0.00118	-0.746000	0.04766	-0.258000	0.10820	CAG	.	.		0.711	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
ZNF264	9422	hgsc.bcm.edu	37	19	57723920	57723920	+	Silent	SNP	C	C	T	rs145421065		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:57723920C>T	ENST00000263095.6	+	4	1869	c.1455C>T	c.(1453-1455)tgC>tgT	p.C485C	ZNF264_ENST00000536056.1_Silent_p.C485C	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	485					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C485C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CCTATGAGTGCGTGGAGTGTG	0.522																																					p.C485C		Atlas-SNP	.											ZNF264,colon,carcinoma,0,1	ZNF264	65	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1455T						.	T		0,4406		0,0,2203	64.0	64.0	64.0		1455	0.1	0.3	19	dbSNP_134	64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF264	NM_003417.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		485/628	57723920	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9422	exon4			TGAGTGCGTGGAG	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1455C>T	chr19.hg19:g.57723920C>T		50.0	0.0		72.0	3.0	NM_003417	A8K8Y9|Q9P1V0	Silent	SNP	ENST00000263095.6	hg19	CCDS33127.1																																																																																			.	C|1.000;T|0.000		0.522	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
PSMF1	9491	hgsc.bcm.edu	37	20	1145055	1145055	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:1145055T>C	ENST00000335877.6	+	6	875	c.699T>C	c.(697-699)ccT>ccC	p.P233P	PSMF1_ENST00000381898.4_Silent_p.P145P|PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000333082.3_Silent_p.P233P|PSMF1_ENST00000246015.4_Silent_p.P233P|PSMF1_ENST00000438768.2_Silent_p.P171P	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	233	Pro-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						ACCGACTTCCTCCAGGCGCTG	0.602																																					p.P233P		Atlas-SNP	.											.	PSMF1	27	.	0			c.T699C						.						146.0	157.0	153.0					20																	1145055		2203	4300	6503	SO:0001819	synonymous_variant	9491	exon6			ACTTCCTCCAGGC	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.699T>C	chr20.hg19:g.1145055T>C		111.0	0.0		118.0	6.0	NM_006814	A0AVQ9|D3DVW3|Q9H4I1	Silent	SNP	ENST00000335877.6	hg19	CCDS13010.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.571433	0.28003	.	.	ENSG00000125818	ENST00000435720	.	.	.	6.07	-0.646	0.11472	.	.	.	.	.	T	0.40297	0.1111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25467	-1.0131	4	.	.	.	-11.7571	1.6783	0.02827	0.1123:0.1958:0.2565:0.4353	.	.	.	.	P	75	.	.	S	+	1	0	PSMF1	1093055	0.888000	0.30383	1.000000	0.80357	0.937000	0.57800	-0.156000	0.10100	0.161000	0.19458	-0.333000	0.08304	TCC	.	.		0.602	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077504.2	NM_178578	
CST5	1473	hgsc.bcm.edu	37	20	23860229	23860229	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:23860229T>C	ENST00000304710.4	-	1	158	c.85A>G	c.(85-87)Acc>Gcc	p.T29A		NM_001900.4	NP_001891.2	P28325	CYTD_HUMAN	cystatin D	29					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11						CCTGCCAAGGTCCTAGATTGG	0.562																																					p.T29A		Atlas-SNP	.											.	CST5	24	.	0			c.A85G						.						109.0	100.0	103.0					20																	23860229		2203	4300	6503	SO:0001583	missense	1473	exon1			CCAAGGTCCTAGA		CCDS13162.1	20p11.21	2008-04-15			ENSG00000170367	ENSG00000170367			2477	protein-coding gene	gene with protein product		123858				1939105	Standard	NM_001900		Approved		uc002wtr.1	P28325	OTTHUMG00000032089	ENST00000304710.4:c.85A>G	chr20.hg19:g.23860229T>C	ENSP00000307132:p.Thr29Ala	63.0	0.0		99.0	4.0	NM_001900	Q5JRF5|Q9UCA0	Missense_Mutation	SNP	ENST00000304710.4	hg19	CCDS13162.1	.	.	.	.	.	.	.	.	.	.	t	0.005	-2.131770	0.00338	.	.	ENSG00000170367	ENST00000304710	T	0.09723	2.95	1.25	-2.49	0.06403	Proteinase inhibitor I25, cystatin (1);	1.234540	0.06060	N	0.658135	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.37911	-0.9685	10	0.06494	T	0.89	.	2.8229	0.05477	0.0:0.3238:0.2528:0.4234	.	29	P28325	CYTD_HUMAN	A	29	ENSP00000307132:T29A	ENSP00000307132:T29A	T	-	1	0	CST5	23808229	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.492000	0.06467	-1.140000	0.02877	-0.497000	0.04613	ACC	.	.		0.562	CST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078355.2	NM_001900	
NINL	22981	hgsc.bcm.edu	37	20	25478915	25478915	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:25478915A>G	ENST00000278886.6	-	9	1173	c.1100T>C	c.(1099-1101)cTc>cCc	p.L367P	NINL_ENST00000422516.1_Missense_Mutation_p.L367P	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	367					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CACTGTCATGAGCTCGTTGTC	0.617																																					p.L367P		Atlas-SNP	.											.	NINL	148	.	0			c.T1100C						.						104.0	77.0	86.0					20																	25478915		2203	4300	6503	SO:0001583	missense	22981	exon9			GTCATGAGCTCGT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1100T>C	chr20.hg19:g.25478915A>G	ENSP00000278886:p.Leu367Pro	86.0	0.0		108.0	6.0	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	hg19	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150665	0.78001	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.48201	1.09;0.82	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000017	T	0.69151	0.3079	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.73668	-0.3910	10	0.87932	D	0	-17.8188	14.3876	0.66956	1.0:0.0:0.0:0.0	.	367;367	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	P	367	ENSP00000278886:L367P;ENSP00000410431:L367P	ENSP00000278886:L367P	L	-	2	0	NINL	25426915	1.000000	0.71417	0.941000	0.38009	0.915000	0.54546	7.128000	0.77217	2.234000	0.73211	0.460000	0.39030	CTC	.	.		0.617	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
ID1	3397	hgsc.bcm.edu	37	20	30193564	30193564	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:30193564T>C	ENST00000376112.3	+	1	479	c.374T>C	c.(373-375)gTc>gCc	p.V125A	ID1_ENST00000376105.3_Missense_Mutation_p.V125A|MIR3193_ENST00000578262.1_RNA	NM_002165.3	NP_002156.2	P41134	ID1_HUMAN	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	125					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|collagen metabolic process (GO:0032963)|endothelial cell morphogenesis (GO:0001886)|heart development (GO:0007507)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein destabilization (GO:0031648)|regulation of angiogenesis (GO:0045765)|regulation of MAPK cascade (GO:0043408)|response to antibiotic (GO:0046677)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|ovary(1)|pancreas(1)	4	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			GGGCTGCCGGTCCGGGCTCCG	0.612																																					p.V125A	NSCLC(123;1618 1779 21803 28680 33854)	Atlas-SNP	.											.	ID1	12	.	0			c.T374C						.						12.0	16.0	15.0					20																	30193564		2201	4299	6500	SO:0001583	missense	3397	exon1			TGCCGGTCCGGGC		CCDS13185.1, CCDS13186.1	20q11	2013-05-21			ENSG00000125968	ENSG00000125968		"""Basic helix-loop-helix proteins"""	5360	protein-coding gene	gene with protein product	"""DNA-binding protein inhibitor ID-1"""	600349				8294468	Standard	NM_002165		Approved	dJ857M17.1.2, bHLHb24	uc002wwg.2	P41134	OTTHUMG00000032181	ENST00000376112.3:c.374T>C	chr20.hg19:g.30193564T>C	ENSP00000365280:p.Val125Ala	121.0	0.0		108.0	5.0	NM_002165	A8K537|E1P5L4|O00651|O00652|Q16371|Q16377|Q5TE66|Q5TE67|Q969Z7|Q9H0Z5|Q9H109	Missense_Mutation	SNP	ENST00000376112.3	hg19	CCDS13185.1	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.597810	0.00857	.	.	ENSG00000125968	ENST00000376112;ENST00000376105	T;T	0.40225	1.08;1.04	4.97	0.418	0.16429	Helix-loop-helix DNA-binding (1);	1.230310	0.05808	N	0.613462	T	0.19886	0.0478	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.20840	-1.0263	10	0.10636	T	0.68	-7.1757	5.2237	0.15383	0.0:0.4539:0.1556:0.3905	.	125;125	P41134-2;P41134	.;ID1_HUMAN	A	125	ENSP00000365280:V125A;ENSP00000365273:V125A	ENSP00000365273:V125A	V	+	2	0	ID1	29657225	0.188000	0.23250	0.017000	0.16124	0.002000	0.02628	2.757000	0.47557	-0.013000	0.14199	-0.250000	0.11733	GTC	.	.		0.612	ID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078550.1	NM_002165	
RBM12	10137	hgsc.bcm.edu	37	20	34240764	34240764	+	Silent	SNP	A	A	G	rs201125389		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:34240764A>G	ENST00000374114.3	-	3	2744	c.2481T>C	c.(2479-2481)ccT>ccC	p.P827P	CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397442.1_Intron|RBM12_ENST00000359646.1_Silent_p.P827P|RBM12_ENST00000374104.3_Silent_p.P827P	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	827	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			ggccggggccaggCCCAAAAG	0.627																																					p.P827P		Atlas-SNP	.											RBM12,rectum,NS,0,2	RBM12	93	.	0			c.T2481C						.						12.0	14.0	13.0					20																	34240764		2147	4263	6410	SO:0001819	synonymous_variant	10137	exon2			GGGGCCAGGCCCA	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2481T>C	chr20.hg19:g.34240764A>G		39.0	0.0		41.0	3.0	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	hg19	CCDS13261.1																																																																																			.	A|0.996;G|0.004		0.627	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
SNX21	90203	hgsc.bcm.edu	37	20	44469288	44469288	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:44469288T>C	ENST00000491381.1	+	4	526	c.458T>C	c.(457-459)cTc>cCc	p.L153P	SNX21_ENST00000462307.1_Missense_Mutation_p.S157P|SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000372541.1_Missense_Mutation_p.S148P|SNX21_ENST00000372542.1_Missense_Mutation_p.L144P|SNX21_ENST00000342644.5_Missense_Mutation_p.L153P			Q969T3	SNX21_HUMAN	sorting nexin family member 21	153	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	7		Myeloproliferative disorder(115;0.0122)				CTCTACACCCTCGCCGTGATC	0.637																																					p.S157P		Atlas-SNP	.											.	SNX21	23	.	0			c.T469C						.						83.0	87.0	85.0					20																	44469288		2203	4300	6503	SO:0001583	missense	90203	exon5			ACACCCTCGCCGT	AK095851	CCDS13376.1, CCDS13377.1, CCDS42883.1	20q13.12	2013-01-10	2006-07-24	2006-07-24	ENSG00000124104	ENSG00000124104		"""Sorting nexins"", ""Tetratricopeptide (TTC) repeat domain containing"""	16154	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 161"""	C20orf161		12461558, 12459172	Standard	NM_152897		Approved	dJ337O18.4, SNX-L	uc002xpv.1	Q969T3	OTTHUMG00000032624	ENST00000491381.1:c.458T>C	chr20.hg19:g.44469288T>C	ENSP00000418593:p.Leu153Pro	76.0	0.0		86.0	4.0	NM_001042633	Q5JZH5|Q5JZH6|Q5JZH7|Q8WUR6|Q9BR16	Missense_Mutation	SNP	ENST00000491381.1	hg19	CCDS13377.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.8|20.8	4.053847|4.053847	0.75960|0.75960	.|.	.|.	ENSG00000124104|ENSG00000124104	ENST00000491381;ENST00000342644;ENST00000372542|ENST00000462307;ENST00000372541;ENST00000372545	T;T;T|.	0.33438|.	1.41;1.41;1.41|.	4.34|4.34	4.34|4.34	0.51931|0.51931	Phox homologous domain (4);|.	0.057080|.	0.64402|.	D|.	0.000003|.	T|T	0.59797|0.59797	0.2220|0.2220	L|L	0.43152|0.43152	1.355|1.355	0.29353|0.29353	N|N	0.865224|0.865224	D;D;D|D;D	0.61080|0.76494	0.963;0.963;0.989|0.999;0.999	P;P;P|D;D	0.61070|0.85130	0.576;0.691;0.883|0.997;0.997	T|T	0.54649|0.54649	-0.8262|-0.8262	10|7	0.87932|.	D|.	0|.	-14.7447|-14.7447	12.8601|12.8601	0.57908|0.57908	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	144;153;153|148;157	Q5JZH3;Q969T3;Q5JZH5|Q5JZH4;Q5JZH7	.;SNX21_HUMAN;.|.;.	P|P	153;153;144|157;148;149	ENSP00000418593:L153P;ENSP00000344586:L153P;ENSP00000361620:L144P|.	ENSP00000344586:L153P|.	L|S	+|+	2|1	0|0	SNX21|SNX21	43902695|43902695	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	6.505000|6.505000	0.73708|0.73708	1.828000|1.828000	0.53243|0.53243	0.379000|0.379000	0.24179|0.24179	CTC|TCG	.	.		0.637	SNX21-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079534.1	NM_033421	
LRRC3	81543	hgsc.bcm.edu	37	21	45877204	45877204	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr21:45877204T>C	ENST00000291592.4	+	2	994	c.677T>C	c.(676-678)gTg>gCg	p.V226A	LRRC3-AS1_ENST00000426578.1_RNA|LRRC3DN_ENST00000596691.1_5'Flank	NM_030891.3	NP_112153.1	Q9BY71	LRRC3_HUMAN	leucine rich repeat containing 3	226						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		GTGTACTATGTGCGCCACAAC	0.667																																					p.V226A		Atlas-SNP	.											.	LRRC3	22	.	0			c.T677C						.						69.0	71.0	70.0					21																	45877204		2203	4300	6503	SO:0001583	missense	81543	exon2			ACTATGTGCGCCA	AB058646	CCDS13711.1	21q22.3	2011-12-07	2002-06-20		ENSG00000160233	ENSG00000160233			14965	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 102"""	C21orf102		12036297	Standard	NM_030891		Approved		uc002zfa.3	Q9BY71	OTTHUMG00000040847	ENST00000291592.4:c.677T>C	chr21.hg19:g.45877204T>C	ENSP00000291592:p.Val226Ala	84.0	0.0		77.0	5.0	NM_030891	Q0VDJ2	Missense_Mutation	SNP	ENST00000291592.4	hg19	CCDS13711.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.789267	0.90367	.	.	ENSG00000160233	ENST00000291592	T	0.59906	0.23	4.87	4.87	0.63330	.	0.078166	0.50627	D	0.000106	T	0.74718	0.3753	M	0.74881	2.28	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	T	0.78730	-0.2090	10	0.87932	D	0	-36.4029	14.48	0.67576	0.0:0.0:0.0:1.0	.	226	Q9BY71	LRRC3_HUMAN	A	226	ENSP00000291592:V226A	ENSP00000291592:V226A	V	+	2	0	LRRC3	44701632	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	4.935000	0.63498	1.969000	0.57287	0.402000	0.26972	GTG	.	.		0.667	LRRC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098095.3		
PCBP3	54039	hgsc.bcm.edu	37	21	47360058	47360058	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr21:47360058A>G	ENST00000400314.1	+	15	1362	c.1024A>G	c.(1024-1026)Acc>Gcc	p.T342A	PCBP3_ENST00000400304.1_Missense_Mutation_p.T332A|PCBP3_ENST00000400310.1_Missense_Mutation_p.T322A|PCBP3_ENST00000449640.1_Missense_Mutation_p.T342A|PCBP3_ENST00000400308.1_Missense_Mutation_p.T316A|PCBP3_ENST00000400309.1_Missense_Mutation_p.T341A			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	342	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		GCGTCAGATCACCATCACGGG	0.557																																					p.T342A		Atlas-SNP	.											.	PCBP3	82	.	0			c.A1024G						.						64.0	73.0	70.0					21																	47360058		2141	4254	6395	SO:0001583	missense	54039	exon13			CAGATCACCATCA	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.1024A>G	chr21.hg19:g.47360058A>G	ENSP00000383168:p.Thr342Ala	73.0	0.0		90.0	4.0	NM_020528	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	ENST00000400314.1	hg19	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730733	0.89390	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000346743;ENST00000400305;ENST00000400304	T;T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36;1.36	4.08	4.08	0.47627	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.65502	0.2697	M	0.89968	3.075	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0	D;D;D;D;D	0.87578	0.998;0.994;0.985;0.998;0.985	T	0.74188	-0.3746	10	0.87932	D	0	-2.4496	13.2327	0.59953	1.0:0.0:0.0:0.0	.	332;316;341;342;322	E9PFP8;P57721-2;P57721-4;P57721;P57721-5	.;.;.;PCBP3_HUMAN;.	A	342;322;341;316;342;322;293;332	ENSP00000383168:T342A;ENSP00000383165:T322A;ENSP00000383164:T341A;ENSP00000383163:T316A;ENSP00000401198:T342A;ENSP00000383160:T293A;ENSP00000383159:T332A	ENSP00000330225:T322A	T	+	1	0	PCBP3	46184486	1.000000	0.71417	0.988000	0.46212	0.985000	0.73830	8.532000	0.90613	1.705000	0.51264	0.448000	0.29417	ACC	.	.		0.557	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
SUSD2	56241	hgsc.bcm.edu	37	22	24582054	24582054	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:24582054G>A	ENST00000358321.3	+	9	1671	c.1410G>A	c.(1408-1410)gaG>gaA	p.E470E		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	470	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						GGCGCGGAGAGTACGTGCTGC	0.662																																					p.E470E		Atlas-SNP	.											.	SUSD2	68	.	0			c.G1410A						.						31.0	32.0	32.0					22																	24582054		2203	4300	6503	SO:0001819	synonymous_variant	56241	exon9			CGGAGAGTACGTG	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1410G>A	chr22.hg19:g.24582054G>A		136.0	0.0		220.0	52.0	NM_019601	Q9H5Y6	Silent	SNP	ENST00000358321.3	hg19	CCDS13824.1																																																																																			.	.		0.662	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
MORC2	22880	hgsc.bcm.edu	37	22	31333805	31333805	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:31333805T>C	ENST00000397641.3	-	14	1774	c.1366A>G	c.(1366-1368)Atc>Gtc	p.I456V	MORC2_ENST00000215862.4_Missense_Mutation_p.I394V|MORC2_ENST00000469915.1_Intron			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	456						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CCATTACCGATGGCAATATCC	0.547																																					p.I394V		Atlas-SNP	.											.	MORC2	78	.	0			c.A1180G						.						92.0	88.0	89.0					22																	31333805		2203	4300	6503	SO:0001583	missense	22880	exon15			TACCGATGGCAAT	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.1366A>G	chr22.hg19:g.31333805T>C	ENSP00000380763:p.Ile456Val	140.0	0.0		228.0	110.0	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	hg19		.	.	.	.	.	.	.	.	.	.	T	13.73	2.323669	0.41096	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.13420	2.59;2.59	5.33	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.10337	0.0253	L	0.40543	1.245	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.18241	-1.0343	10	0.21014	T	0.42	.	8.2169	0.31516	0.0:0.1606:0.0:0.8394	.	456	Q9Y6X9	MORC2_HUMAN	V	456;394	ENSP00000380763:I456V;ENSP00000215862:I394V	ENSP00000215862:I394V	I	-	1	0	MORC2	29663805	1.000000	0.71417	0.997000	0.53966	0.712000	0.41017	5.909000	0.69923	0.398000	0.25338	0.413000	0.27773	ATC	.	.		0.547	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
TNRC6B	23112	hgsc.bcm.edu	37	22	40660706	40660706	+	Missense_Mutation	SNP	G	G	A	rs367663125		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:40660706G>A	ENST00000454349.2	+	5	683	c.472G>A	c.(472-474)Ggt>Agt	p.G158S	TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.G158S	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	158	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AACCCTTGGAGGTGCTGCTGC	0.493																																					p.G158S		Atlas-SNP	.											.	TNRC6B	195	.	0			c.G472A						.						41.0	39.0	40.0					22																	40660706		1889	4121	6010	SO:0001583	missense	23112	exon5			CTTGGAGGTGCTG	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.472G>A	chr22.hg19:g.40660706G>A	ENSP00000401946:p.Gly158Ser	94.0	0.0		138.0	36.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	hg19	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758997	0.31137	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	T;T	0.11495	2.78;2.77	5.44	5.44	0.79542	.	0.327663	0.32736	N	0.005701	T	0.08537	0.0212	N	0.14661	0.345	0.45837	D	0.998709	P;P	0.46784	0.884;0.705	B;B	0.41466	0.358;0.271	T	0.41251	-0.9519	10	0.22706	T	0.39	-4.8462	18.2777	0.90088	0.0:0.0:1.0:0.0	.	158;158	Q9UPQ9;Q9UPQ9-1	TNR6B_HUMAN;.	S	158	ENSP00000401946:G158S;ENSP00000338371:G158S	ENSP00000338371:G158S	G	+	1	0	TNRC6B	38990652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.979000	0.63806	2.559000	0.86315	0.650000	0.86243	GGT	.	.		0.493	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
ZBED4	9889	hgsc.bcm.edu	37	22	50280096	50280096	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:50280096T>C	ENST00000216268.5	+	2	3263	c.2786T>C	c.(2785-2787)gTc>gCc	p.V929A		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	929						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		CAGTGGGAGGTCATGCAGTCC	0.587																																					p.V929A		Atlas-SNP	.											.	ZBED4	102	.	0			c.T2786C						.						110.0	85.0	94.0					22																	50280096		2203	4300	6503	SO:0001583	missense	9889	exon2			GGGAGGTCATGCA	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2786T>C	chr22.hg19:g.50280096T>C	ENSP00000216268:p.Val929Ala	165.0	0.0		111.0	5.0	NM_014838	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	hg19	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711297	0.68730	.	.	ENSG00000100426	ENST00000216268	T	0.22336	1.96	5.95	5.95	0.96441	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	M	0.73598	2.24	0.80722	D	1	P	0.36282	0.546	B	0.32211	0.142	T	0.03863	-1.0997	10	0.42905	T	0.14	-28.266	16.4046	0.83654	0.0:0.0:0.0:1.0	.	929	O75132	ZBED4_HUMAN	A	929	ENSP00000216268:V929A	ENSP00000216268:V929A	V	+	2	0	ZBED4	48666100	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.509000	0.81698	2.277000	0.76020	0.533000	0.62120	GTC	.	.		0.587	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838	
PIM3	415116	hgsc.bcm.edu	37	22	50355358	50355358	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:50355358A>G	ENST00000360612.4	+	4	950	c.515A>G	c.(514-516)aAg>aGg	p.K172R		NM_001001852.3	NP_001001852.2	Q86V86	PIM3_HUMAN	Pim-3 proto-oncogene, serine/threonine kinase	172	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|histone phosphorylation (GO:0016572)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)						all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		CGCGACATTAAGGACGAAAAT	0.667																																					p.K172R		Atlas-SNP	.											PIM3_ENST00000360612,NS,carcinoma,0,1	PIM3	15	.	0			c.A515G						.						27.0	24.0	25.0					22																	50355358		2202	4297	6499	SO:0001583	missense	415116	exon4			ACATTAAGGACGA	BC052239	CCDS33678.1	22q13	2014-06-25	2014-06-25		ENSG00000198355	ENSG00000198355			19310	protein-coding gene	gene with protein product		610580	"""pim-3 oncogene"""			12477932	Standard	NM_001001852		Approved		uc003bjb.3	Q86V86	OTTHUMG00000150290	ENST00000360612.4:c.515A>G	chr22.hg19:g.50355358A>G	ENSP00000353824:p.Lys172Arg	109.0	0.0		74.0	4.0	NM_001001852	A5D8X8|A8K7J0|B1B0P0|Q68BM2	Missense_Mutation	SNP	ENST00000360612.4	hg19	CCDS33678.1	.	.	.	.	.	.	.	.	.	.	a	17.56	3.419246	0.62622	.	.	ENSG00000198355	ENST00000360612	D	0.90900	-2.75	3.59	2.54	0.30619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.187158	0.44483	U	0.000456	D	0.95900	0.8665	H	0.95850	3.73	0.50039	D	0.999843	D	0.76494	0.999	D	0.77557	0.99	D	0.94870	0.8029	10	0.87932	D	0	.	7.3647	0.26766	0.8887:0.0:0.1113:0.0	.	172	Q86V86	PIM3_HUMAN	R	172	ENSP00000353824:K172R	ENSP00000353824:K172R	K	+	2	0	PIM3	48741362	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	5.519000	0.67074	1.258000	0.44101	0.378000	0.23410	AAG	.	.		0.667	PIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317406.1	NM_001001852	
STS	412	hgsc.bcm.edu	37	X	7177425	7177425	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:7177425A>G	ENST00000217961.4	+	5	653	c.433A>G	c.(433-435)Act>Gct	p.T145A		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	145					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	TCACAGCAAGACTGACTTCTG	0.483									Ichthyosis																												p.T145A		Atlas-SNP	.											.	STS	64	.	0			c.A433G						.						152.0	125.0	134.0					X																	7177425		2203	4299	6502	SO:0001583	missense	412	exon5	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	AGCAAGACTGACT	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.433A>G	chrX.hg19:g.7177425A>G	ENSP00000217961:p.Thr145Ala	60.0	0.0		98.0	4.0	NM_000351	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	hg19	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	A	1.900	-0.453277	0.04540	.	.	ENSG00000101846	ENST00000217961	D	0.98684	-5.07	3.83	-0.286	0.12862	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	1.562600	0.03793	N	0.263203	D	0.95023	0.8389	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	D	0.90215	0.4267	10	0.19147	T	0.46	.	3.4685	0.07558	0.3877:0.0:0.4126:0.1997	.	145	P08842	STS_HUMAN	A	145	ENSP00000217961:T145A	ENSP00000217961:T145A	T	+	1	0	STS	7187425	0.000000	0.05858	0.000000	0.03702	0.404000	0.30871	0.286000	0.18902	-0.102000	0.12197	0.486000	0.48141	ACT	.	.		0.483	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
DMD	1756	hgsc.bcm.edu	37	X	31497178	31497178	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:31497178T>C	ENST00000357033.4	-	58	8796	c.8590A>G	c.(8590-8592)Agt>Ggt	p.S2864G	DMD_ENST00000541735.1_Missense_Mutation_p.S404G|DMD_ENST00000378677.2_Missense_Mutation_p.S2860G|DMD_ENST00000343523.2_Missense_Mutation_p.S404G|DMD_ENST00000378707.3_Missense_Mutation_p.S404G|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000359836.1_Missense_Mutation_p.S404G|DMD_ENST00000474231.1_Missense_Mutation_p.S404G	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2864					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCAAGAGTACTCATGATTACA	0.393																																					p.S2864G		Atlas-SNP	.											.	DMD	2127	.	0			c.A8590G						.						96.0	85.0	89.0					X																	31497178		2202	4300	6502	SO:0001583	missense	1756	exon58			GAGTACTCATGAT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8590A>G	chrX.hg19:g.31497178T>C	ENSP00000354923:p.Ser2864Gly	72.0	0.0		93.0	4.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.00|11.00	1.511477|1.511477	0.27036|0.27036	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000465285|ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	.|T;T;T;T;T;T;T;T	.|0.36157	.|1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.159222	.|0.28533	.|U	.|0.015006	T|T	0.42854|0.42854	0.1221|0.1221	L|L	0.37850|0.37850	1.14|1.14	0.31735|0.31735	N|N	0.636534|0.636534	.|P;B;B;B;B;B;B;B;B;B;B	.|0.42337	.|0.776;0.001;0.001;0.001;0.001;0.002;0.001;0.001;0.0;0.001;0.007	.|P;B;B;B;B;B;B;B;B;B;B	.|0.51615	.|0.675;0.001;0.003;0.001;0.001;0.02;0.003;0.002;0.001;0.001;0.011	T|T	0.52873|0.52873	-0.8517|-0.8517	5|10	.|0.52906	.|T	.|0.07	.|.	14.2317|14.2317	0.65898|0.65898	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|2856;2864;2860;1523;1520;404;404;404;404;404;2741	.|P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.|.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	G|G	592|2856;1523;1520;560;2860;2864;404;404;2864;2741;404;404;404	.|ENSP00000350765:S560G;ENSP00000367948:S2860G;ENSP00000354923:S2864G;ENSP00000352894:S404G;ENSP00000340057:S404G;ENSP00000367979:S404G;ENSP00000444119:S404G;ENSP00000417123:S404G	.|ENSP00000340057:S404G	E|S	-|-	2|1	0|0	DMD|DMD	31407099|31407099	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.244000|4.244000	0.58728|0.58728	1.807000|1.807000	0.52817|0.52817	0.486000|0.486000	0.48141|0.48141	GAG|AGT	.	.		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CHDC2	286464	hgsc.bcm.edu	37	X	36156122	36156122	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:36156122T>C	ENST00000313548.4	+	9	1279	c.1093T>C	c.(1093-1095)Tca>Cca	p.S365P		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	365	CH.					integral component of membrane (GO:0016021)											CAAAGACCTTTCAGATGGTCT	0.313																																					p.S365P		Atlas-SNP	.											.	.	.	.	0			c.T1093C						.						88.0	78.0	82.0					X																	36156122		2202	4298	6500	SO:0001583	missense	286464	exon9			GACCTTTCAGATG	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1093T>C	chrX.hg19:g.36156122T>C	ENSP00000324767:p.Ser365Pro	98.0	0.0		91.0	4.0	NM_173695		Missense_Mutation	SNP	ENST00000313548.4	hg19	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	T	6.114	0.389327	0.11581	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	D;D	0.95821	-3.82;-3.82	5.22	-2.22	0.06952	Calponin homology domain (3);	2.060390	0.02581	N	0.098904	D	0.89047	0.6604	N	0.14661	0.345	0.09310	N	1	D	0.62365	0.991	P	0.44447	0.45	T	0.82108	-0.0620	10	0.62326	D	0.03	2.1806	0.3007	0.00273	0.2519:0.1604:0.254:0.3337	.	365	Q8N9S7	CX059_HUMAN	P	365	ENSP00000367929:S365P;ENSP00000324767:S365P	ENSP00000324767:S365P	S	+	1	0	CXorf59	36066043	0.023000	0.18921	0.005000	0.12908	0.013000	0.08279	0.026000	0.13599	-0.859000	0.04105	-0.549000	0.04216	TCA	.	.		0.313	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
KDM5C	8242	hgsc.bcm.edu	37	X	53226132	53226132	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:53226132T>C	ENST00000375401.3	-	19	3249	c.2717A>G	c.(2716-2718)gAg>gGg	p.E906G	KDM5C_ENST00000375379.3_Missense_Mutation_p.E906G|KDM5C_ENST00000375383.3_Missense_Mutation_p.E865G|KDM5C_ENST00000404049.3_Missense_Mutation_p.E905G|KDM5C_ENST00000452825.3_Missense_Mutation_p.E839G	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	906					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CCGCCCCCTCTCCAACAGGGA	0.667			"""N, F, S"""		clear cell renal carcinoma																																p.E906G		Atlas-SNP	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C	385	.	0			c.A2717G						.						20.0	18.0	19.0					X																	53226132		2197	4291	6488	SO:0001583	missense	8242	exon19			CCCCTCTCCAACA	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2717A>G	chrX.hg19:g.53226132T>C	ENSP00000364550:p.Glu906Gly	68.0	0.0		76.0	6.0	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	hg19	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.923702	0.73213	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	4.44	4.44	0.53790	Lysine-specific demethylase-like domain (1);	0.244325	0.38959	N	0.001501	T	0.60766	0.2294	M	0.80847	2.515	0.46654	D	0.99914	P;P;P	0.46142	0.846;0.873;0.873	P;P;P	0.51945	0.557;0.685;0.685	T	0.66085	-0.6011	10	0.72032	D	0.01	-11.5249	10.9016	0.47056	0.0:0.0:0.0:1.0	.	839;905;906	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	G	839;906;905;906;865	ENSP00000445176:E839G;ENSP00000364550:E906G;ENSP00000385394:E905G;ENSP00000364528:E906G;ENSP00000364532:E865G	ENSP00000364528:E906G	E	-	2	0	KDM5C	53242857	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.765000	0.55272	1.466000	0.48025	0.481000	0.45027	GAG	.	.		0.667	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
FOXR2	139628	hgsc.bcm.edu	37	X	55650773	55650773	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:55650773A>G	ENST00000339140.3	+	1	941	c.629A>G	c.(628-630)cAc>cGc	p.H210R		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	210					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						AACAACCCCCACTGTGGCCTC	0.493																																					p.H210R		Atlas-SNP	.											.	FOXR2	42	.	0			c.A629G						.						86.0	82.0	83.0					X																	55650773		2203	4300	6503	SO:0001583	missense	139628	exon1			ACCCCCACTGTGG	BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.629A>G	chrX.hg19:g.55650773A>G	ENSP00000427329:p.His210Arg	59.0	0.0		86.0	4.0	NM_198451		Missense_Mutation	SNP	ENST00000339140.3	hg19	CCDS35308.1	.	.	.	.	.	.	.	.	.	.	A	3.516	-0.098815	0.07010	.	.	ENSG00000189299	ENST00000339140	D	0.95205	-3.64	3.26	0.147	0.14838	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.399896	0.24957	N	0.034244	D	0.82870	0.5131	N	0.04090	-0.28	0.09310	N	1	P	0.45283	0.855	B	0.41510	0.359	T	0.78534	-0.2167	10	0.34782	T	0.22	.	4.8913	0.13728	0.6006:0.2772:0.0:0.1221	.	210	Q6PJQ5	FOXR2_HUMAN	R	210	ENSP00000427329:H210R	ENSP00000427329:H210R	H	+	2	0	FOXR2	55667498	0.001000	0.12720	0.001000	0.08648	0.092000	0.18411	1.135000	0.31454	-0.075000	0.12798	-0.371000	0.07208	CAC	.	.		0.493	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056877.2	NM_198451	
PJA1	64219	hgsc.bcm.edu	37	X	68382107	68382107	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:68382107T>C	ENST00000361478.1	-	2	1352	c.975A>G	c.(973-975)aaA>aaG	p.K325K	PJA1_ENST00000374584.3_Silent_p.K137K|PJA1_ENST00000374583.1_Silent_p.K325K|PJA1_ENST00000477231.1_5'Flank|PJA1_ENST00000374571.4_Silent_p.K270K	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	325					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						TCGCTTCCCGTTTGTCTTCAG	0.552																																					p.K325K		Atlas-SNP	.											.	PJA1	106	.	0			c.A975G						.						110.0	64.0	79.0					X																	68382107		2203	4300	6503	SO:0001819	synonymous_variant	64219	exon2			TTCCCGTTTGTCT	AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.975A>G	chrX.hg19:g.68382107T>C		68.0	0.0		88.0	5.0	NM_145119	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Silent	SNP	ENST00000361478.1	hg19	CCDS14393.1																																																																																			.	.		0.552	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
ERCC6L	54821	hgsc.bcm.edu	37	X	71426725	71426725	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:71426725T>C	ENST00000334463.3	-	2	2027	c.1892A>G	c.(1891-1893)gAg>gGg	p.E631G	ERCC6L_ENST00000373657.1_Missense_Mutation_p.E508G|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	631					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					CTGAAGATCCTCGATTGTAAA	0.383																																					p.E631G		Atlas-SNP	.											.	ERCC6L	98	.	0			c.A1892G						.						67.0	63.0	64.0					X																	71426725		2203	4300	6503	SO:0001583	missense	54821	exon2			AGATCCTCGATTG	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1892A>G	chrX.hg19:g.71426725T>C	ENSP00000334675:p.Glu631Gly	82.0	0.0		83.0	6.0	NM_017669	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	hg19	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	T	8.600	0.886525	0.17540	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	T;T	0.24908	1.83;1.83	5.46	-0.0729	0.13737	.	.	.	.	.	T	0.11922	0.0290	N	0.11364	0.135	0.35020	D	0.757755	B	0.12013	0.005	B	0.12156	0.007	T	0.26224	-1.0109	9	0.23302	T	0.38	-1.9592	9.0927	0.36621	0.0:0.4003:0.0:0.5997	.	631	Q2NKX8	ERC6L_HUMAN	G	508;631	ENSP00000362761:E508G;ENSP00000334675:E631G	ENSP00000334675:E631G	E	-	2	0	ERCC6L	71343450	1.000000	0.71417	0.753000	0.31225	0.978000	0.69477	2.744000	0.47450	-0.028000	0.13850	0.481000	0.45027	GAG	.	.		0.383	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
IL1RAPL2	26280	hgsc.bcm.edu	37	X	104728324	104728324	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:104728324T>C	ENST00000372582.1	+	6	1473	c.717T>C	c.(715-717)ccT>ccC	p.P239P	IL1RAPL2_ENST00000344799.4_Silent_p.P239P	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	239	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CAGACAAGCCTCCCAAGCCAT	0.393																																					p.P239P		Atlas-SNP	.											.	IL1RAPL2	105	.	0			c.T717C						.						103.0	92.0	96.0					X																	104728324		2203	4300	6503	SO:0001819	synonymous_variant	26280	exon6			CAAGCCTCCCAAG	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.717T>C	chrX.hg19:g.104728324T>C		180.0	0.0		431.0	23.0	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	hg19	CCDS14517.1																																																																																			.	.		0.393	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
KIAA1210	57481	hgsc.bcm.edu	37	X	118221124	118221124	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:118221124T>C	ENST00000402510.2	-	11	4068	c.4069A>G	c.(4069-4071)Aag>Gag	p.K1357E		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1357										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CTGCTCTGCTTTACAGGTACA	0.473																																					p.K1357E		Atlas-SNP	.											.	KIAA1210	171	.	0			c.A4069G						.						201.0	192.0	195.0					X																	118221124		1967	4139	6106	SO:0001583	missense	57481	exon11			TCTGCTTTACAGG	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4069A>G	chrX.hg19:g.118221124T>C	ENSP00000384670:p.Lys1357Glu	43.0	0.0		92.0	4.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	hg19	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.488|0.488	-0.876829|-0.876829	0.02550|0.02550	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.08370|.	3.1|.	4.34|4.34	-2.17|-2.17	0.07059|0.07059	.|.	.|.	.|.	.|.	.|.	T|T	0.13798|0.13798	0.0334|0.0334	N|N	0.05124|0.05124	-0.11|-0.11	0.09310|0.09310	N|N	1|1	B|.	0.12630|.	0.006|.	B|.	0.14023|.	0.01|.	T|T	0.27331|0.27331	-1.0077|-1.0077	9|5	0.07030|.	T|.	0.85|.	.|.	5.429|5.429	0.16442|0.16442	0.0:0.2972:0.155:0.5478|0.0:0.2972:0.155:0.5478	.|.	1357|.	Q9ULL0|.	K1210_HUMAN|.	E|R	1357|763	ENSP00000384670:K1357E|.	ENSP00000384670:K1357E|.	K|K	-|-	1|2	0|0	RP13-347D8.6|KIAA1210	118105152|118105152	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.726000|-0.726000	0.04936|0.04936	-0.654000|-0.654000	0.05394|0.05394	-0.700000|-0.700000	0.03674|0.03674	AAG|AAA	.	.		0.473	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
GRIA3	2892	hgsc.bcm.edu	37	X	122336604	122336604	+	Intron	SNP	C	C	G	rs72609489		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:122336604C>G	ENST00000371251.1	+	2	320				GRIA3_ENST00000541091.1_Intron|GRIA3_ENST00000371266.1_Missense_Mutation_p.P129A|GRIA3_ENST00000264357.5_Intron|GRIA3_ENST00000371264.3_Missense_Mutation_p.P129A|GRIA3_ENST00000542149.1_Intron|GRIA3_ENST00000371256.5_Intron|GRIA3_ENST00000479118.1_Intron			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	ACCAGGTGGGCCCGCCAAAAC	0.502																																					p.P129A		Atlas-SNP	.											.	GRIA3	386	.	0			c.C385G						.																																			SO:0001627	intron_variant	2892	exon3			GGTGGGCCCGCCA	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.268+16762C>G	chrX.hg19:g.122336604C>G		67.0	0.0		133.0	15.0	NM_001256743	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	hg19	CCDS14604.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.14|13.14	2.147978|2.147978	0.37923|0.37923	.|.	.|.	ENSG00000125675|ENSG00000125675	ENST00000335161|ENST00000371266;ENST00000371264	.|.	.|.	.|.	4.06|4.06	-2.54|-2.54	0.06307|0.06307	.|.	.|.	.|.	.|.	.|.	.|T	.|0.25717	.|0.0626	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.25257	.|-1.0137	.|7	.|0.87932	.|D	.|0	.|.	2.4135|2.4135	0.04430|0.04430	0.1408:0.2377:0.4271:0.1944|0.1408:0.2377:0.4271:0.1944	rs11452643|rs11452643	.|129	.|Q4TT43	.|.	.|A	-1|129	.|.	.|ENSP00000360311:P129A	.|P	+|+	.|1	.|0	GRIA3|GRIA3	122164285|122164285	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-0.972000|-0.972000	0.03802|0.03802	-0.750000|-0.750000	0.04740|0.04740	-0.278000|-0.278000	0.10074|0.10074	.|CCC	.	.		0.502	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
HCFC1	3054	hgsc.bcm.edu	37	X	153230097	153230097	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:153230097T>C	ENST00000310441.7	-	2	1240	c.274A>G	c.(274-276)Act>Gct	p.T92A	HCFC1_ENST00000354233.3_Missense_Mutation_p.T92A|HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000369984.4_Missense_Mutation_p.T92A	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	92					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGGCGAGTCCCGTCACAC	0.582																																					p.T92A		Atlas-SNP	.											.	HCFC1	284	.	0			c.A274G						.						116.0	127.0	123.0					X																	153230097		2162	4245	6407	SO:0001583	missense	3054	exon2			GGCGAGTCCCGTC		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.274A>G	chrX.hg19:g.153230097T>C	ENSP00000309555:p.Thr92Ala	97.0	0.0		250.0	11.0	NM_005334	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	hg19	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582380	0.86748	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.66460	-0.21;-0.21;1.0	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.82986	0.5156	M	0.87328	2.875	0.58432	D	0.999997	D	0.61697	0.99	D	0.71870	0.975	D	0.85997	0.1492	10	0.72032	D	0.01	.	13.4587	0.61214	0.0:0.0:0.0:1.0	.	92	P51610	HCFC1_HUMAN	A	92	ENSP00000309555:T92A;ENSP00000359001:T92A;ENSP00000346174:T92A	ENSP00000309555:T92A	T	-	1	0	HCFC1	152883291	1.000000	0.71417	0.597000	0.28824	0.948000	0.59901	7.607000	0.82883	1.821000	0.53095	0.381000	0.24937	ACT	.	.		0.582	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
G6PD	2539	hgsc.bcm.edu	37	X	153774307	153774307	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:153774307G>A	ENST00000393564.2	-	2	176	c.64C>T	c.(64-66)Cag>Tag	p.Q22*	IKBKG_ENST00000369609.5_Intron|G6PD_ENST00000393562.2_Nonsense_Mutation_p.Q52*|IKBKG_ENST00000263518.6_5'Flank|IKBKG_ENST00000369601.3_5'Flank|IKBKG_ENST00000470142.1_5'Flank|IKBKG_ENST00000393549.2_5'Flank|G6PD_ENST00000497281.1_5'UTR|IKBKG_ENST00000455588.2_5'Flank|IKBKG_ENST00000369602.3_5'Flank|IKBKG_ENST00000369606.4_5'Flank|IKBKG_ENST00000369607.1_Intron|G6PD_ENST00000369620.2_Nonsense_Mutation_p.Q22*	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	22					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCATCGCCCTGGAAAAGCTCT	0.562																																					p.Q52X		Atlas-SNP	.											.	G6PD	73	.	0			c.C154T						.						161.0	143.0	149.0					X																	153774307		2203	4300	6503	SO:0001587	stop_gained	2539	exon2			CGCCCTGGAAAAG	X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.64C>T	chrX.hg19:g.153774307G>A	ENSP00000377194:p.Gln22*	33.0	0.0		60.0	4.0	NM_000402	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Nonsense_Mutation	SNP	ENST00000393564.2	hg19	CCDS44023.1	.	.	.	.	.	.	.	.	.	.	G	32	5.178082	0.94846	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620;ENST00000439227;ENST00000440967;ENST00000433845	.	.	.	5.78	5.78	0.91487	.	0.318081	0.34223	N	0.004148	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	14.2085	0.65750	0.0:0.0:1.0:0.0	.	.	.	.	X	52;22;22;22;22;22;22	.	ENSP00000291567:Q22X	Q	-	1	0	G6PD	153427501	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	5.134000	0.64770	2.429000	0.82318	0.600000	0.82982	CAG	.	.		0.562	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402	
USP9Y	8287	hgsc.bcm.edu	37	Y	14928278	14928278	+	Splice_Site	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrY:14928278A>G	ENST00000338981.3	+	32	5774	c.4829A>G	c.(4828-4830)gAg>gGg	p.E1610G	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1610	USP.				BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CAGGACAGTGAGGTAAATTTT	0.388																																					p.E1610G		Atlas-SNP	.											.	USP9Y	49	.	0			c.A4829G						.						38.0	37.0	37.0					Y																	14928278		583	1911	2494	SO:0001630	splice_region_variant	8287	exon32			ACAGTGAGGTAAA	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.4830+1A>G	chrY.hg19:g.14928278A>G		54.0	0.0		87.0	4.0	NM_004654	O14601	Missense_Mutation	SNP	ENST00000338981.3	hg19	CCDS14781.1																																																																																			.	.		0.388	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	Missense_Mutation
USP9Y	8287	hgsc.bcm.edu	37	Y	14951989	14951989	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrY:14951989A>G	ENST00000338981.3	+	36	6482	c.5537A>G	c.(5536-5538)aAt>aGt	p.N1846S	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1846	USP.				BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AACTCAGAAAATGAGTTGATT	0.418																																					p.N1846S		Atlas-SNP	.											.	USP9Y	49	.	0			c.A5537G						.						77.0	68.0	70.0					Y																	14951989		593	1952	2545	SO:0001583	missense	8287	exon36			CAGAAAATGAGTT	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.5537A>G	chrY.hg19:g.14951989A>G	ENSP00000342812:p.Asn1846Ser	48.0	0.0		68.0	4.0	NM_004654	O14601	Missense_Mutation	SNP	ENST00000338981.3	hg19	CCDS14781.1																																																																																			.	.		0.418	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
SRP72	6731	hgsc.bcm.edu	37	4	57340266	57340277	+	In_Frame_Del	DEL	ATCTCGTCCGAA	ATCTCGTCCGAA	-	rs201653221|rs145817936		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	ATCTCGTCCGAA	ATCTCGTCCGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:57340266_57340277delATCTCGTCCGAA	ENST00000342756.5	+	4	1122_1133	c.401_412delATCTCGTCCGAA	c.(400-414)gatctcgtccgaaac>gac	p.LVRN135del	SRP72_ENST00000510663.1_In_Frame_Del_p.LVRN135del|SRP72_ENST00000504757.1_In_Frame_Del_p.LVRN135del	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	135					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					GTGTATAGAGATCTCGTCCGAAACTCCCAAGA	0.377																																					p.134_137del		Atlas-Indel,Pindel	.											.	SRP72	59	.	0			c.400_411del						.																																			SO:0001651	inframe_deletion	6731	exon4			.	AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.401_412delATCTCGTCCGAA	chr4.hg19:g.57340266_57340277delATCTCGTCCGAA	ENSP00000342181:p.Leu135_Asn138del	124.0	0.0		122.0	20.0	NM_001267722	G5E9Z8|Q7Z3C0	In_Frame_Del	DEL	ENST00000342756.5	hg19	CCDS3506.1																																																																																			.	.		0.377	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7		
ZIC1	7545	hgsc.bcm.edu	37	3	147128512	147128526	+	In_Frame_Del	DEL	GCCGCGCATCACGGC	GCCGCGCATCACGGC	-	rs370404401		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	GCCGCGCATCACGGC	GCCGCGCATCACGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:147128512_147128526delGCCGCGCATCACGGC	ENST00000282928.4	+	1	1342_1356	c.613_627delGCCGCGCATCACGGC	c.(613-627)gccgcgcatcacggcdel	p.AAHHG205del		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	205					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G209C(1)|p.H208N(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CGTGAACATGGCCGCGCATCACGGCGCCGGCGCCT	0.647																																					p.204_209del		Atlas-Indel,Pindel	.											.	ZIC1	141	.	2	Substitution - Missense(2)	lung(1)|prostate(1)	c.612_626del						.																																			SO:0001651	inframe_deletion	7545	exon1			.	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.613_627delGCCGCGCATCACGGC	chr3.hg19:g.147128512_147128526delGCCGCGCATCACGGC	ENSP00000282928:p.Ala205_Gly209del	116.0	0.0		49.0	15.0	NM_003412	Q2M3N1	In_Frame_Del	DEL	ENST00000282928.4	hg19	CCDS3136.1																																																																																			.	.		0.647	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
SLC24A4	123041	hgsc.bcm.edu	37	14	92953018	92953024	+	Frame_Shift_Del	DEL	TATCGGA	TATCGGA	-			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	TATCGGA	TATCGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:92953018_92953024delTATCGGA	ENST00000532405.1	+	14	1657_1663	c.1431_1437delTATCGGA	c.(1429-1437)attatcggafs	p.IIG477fs	SLC24A4_ENST00000393265.2_Frame_Shift_Del_p.IIG413fs|SLC24A4_ENST00000298877.1_Frame_Shift_Del_p.IIG460fs|SLC24A4_ENST00000351924.5_Frame_Shift_Del_p.IIG441fs|SLC24A4_ENST00000531433.1_Frame_Shift_Del_p.IIG458fs			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	477					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.I461I(1)|p.G462R(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AGGTGACTATTATCGGATACACACTTG	0.478																																					p.477_479del	NSCLC(10;315 435 10383 28450 38798)	Atlas-Indel,Pindel	.											.	SLC24A4	112	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	c.1430_1436del						.																																			SO:0001589	frameshift_variant	123041	exon14			.	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1431_1437delTATCGGA	chr14.hg19:g.92953018_92953024delTATCGGA	ENSP00000431840:p.Ile477fs	224.0	0.0		240.0	38.0	NM_153646	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Frame_Shift_Del	DEL	ENST00000532405.1	hg19	CCDS9903.2																																																																																			.	.		0.478	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
BRCA2	675	hgsc.bcm.edu	37	13	32953916	32953924	+	In_Frame_Del	DEL	GATTTATAT	GATTTATAT	-	rs397508026|rs397508027|rs80359736|rs80359737|rs397508028		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	GATTTATAT	GATTTATAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:32953916_32953924delGATTTATAT	ENST00000380152.3	+	23	9216_9224	c.8983_8991delGATTTATAT	c.(8983-8991)gatttatatdel	p.DLY2995del	BRCA2_ENST00000544455.1_In_Frame_Del_p.DLY2995del			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2995					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.Y2997*(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TCCATCATCAGATTTATATTCTCTGTTAA	0.311			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.2994_2997del	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-Indel,Pindel	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.8982_8990del	GRCh37	CM070045	BRCA2	M		.																																			SO:0001651	inframe_deletion	675	exon23	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	.	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8983_8991delGATTTATAT	chr13.hg19:g.32953916_32953924delGATTTATAT	ENSP00000369497:p.Asp2995_Tyr2997del	175.0	0.0		162.0	17.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	In_Frame_Del	DEL	ENST00000380152.3	hg19	CCDS9344.1																																																																																			.	.		0.311	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
KDM4D	55693	hgsc.bcm.edu	37	11	94732090	94732104	+	In_Frame_Del	DEL	CTGGGCCCCTGTGCC	CTGGGCCCCTGTGCC	-	rs373516844		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	CTGGGCCCCTGTGCC	CTGGGCCCCTGTGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:94732090_94732104delCTGGGCCCCTGTGCC	ENST00000335080.5	+	3	2386_2400	c.1554_1568delCTGGGCCCCTGTGCC	c.(1552-1569)agctgggcccctgtgccc>agc	p.WAPVP519del	KDM4D_ENST00000536741.1_In_Frame_Del_p.WAPVP519del	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	519					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTGGGTGCAGCTGGGCCCCTGTGCCCTAAGTCCAC	0.549																																					p.518_523del		Atlas-Indel,Pindel	.											.	KDM4D	58	.	0			c.1553_1567del						.																																			SO:0001651	inframe_deletion	55693	exon3			.	AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.1554_1568delCTGGGCCCCTGTGCC	chr11.hg19:g.94732090_94732104delCTGGGCCCCTGTGCC	ENSP00000334181:p.Trp519_Pro523del	125.0	0.0		135.0	20.0	NM_018039	B3KPC4|Q0VF39|Q9NT41|Q9NW76	In_Frame_Del	DEL	ENST00000335080.5	hg19	CCDS8302.1																																																																																			.	.		0.549	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396558.2	NM_018039	
RBM6	10180	hgsc.bcm.edu	37	3	50103698	50103698	+	Frame_Shift_Del	DEL	C	C	-	rs150609021		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:50103698delC	ENST00000266022.4	+	17	2965	c.2706delC	c.(2704-2706)atcfs	p.I902fs	RBM6_ENST00000539992.1_Frame_Shift_Del_p.I244fs|RBM6_ENST00000422955.1_Frame_Shift_Del_p.I380fs|RBM6_ENST00000443081.1_Frame_Shift_Del_p.I770fs|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000442092.1_Frame_Shift_Del_p.I380fs|RBM6_ENST00000421682.1_5'Flank	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	902					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ACCCACTGATCGGCCTCTTGG	0.498																																					p.I902fs		Atlas-Indel,Pindel	.											.	RBM6	85	.	0			c.2705delT						.						38.0	42.0	41.0					3																	50103698		2203	4300	6503	SO:0001589	frameshift_variant	10180	exon17			.	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2706delC	chr3.hg19:g.50103698delC	ENSP00000266022:p.Ile902fs	44.0	0.0		52.0	16.0	NM_005777	O60549|O75524|Q86SS3	Frame_Shift_Del	DEL	ENST00000266022.4	hg19	CCDS2809.1																																																																																			.	.		0.498	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
ZFAT	57623	hgsc.bcm.edu	37	8	135545117	135545124	+	Frame_Shift_Del	DEL	CACGTTGG	CACGTTGG	-	rs554415466|rs374006917		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	CACGTTGG	CACGTTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:135545117_135545124delCACGTTGG	ENST00000377838.3	-	12	3242_3249	c.3068_3075delCCAACGTG	c.(3067-3075)gccaacgtgfs	p.ANV1023fs	ZFAT_ENST00000520214.1_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000520727.1_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000429442.2_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000520356.1_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000523399.1_Frame_Shift_Del_p.ANV961fs	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1023					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCCCGGTGCCCACGTTGGCATACTCCTC	0.615																																					p.1023_1026del		Atlas-Indel,Pindel	.											.	ZFAT	265	.	0			c.3069_3076del						.																																			SO:0001589	frameshift_variant	57623	exon12			.	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3068_3075delCCAACGTG	chr8.hg19:g.135545117_135545124delCACGTTGG	ENSP00000367069:p.Ala1023fs	66.0	0.0		63.0	10.0	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Frame_Shift_Del	DEL	ENST00000377838.3	hg19	CCDS47924.1																																																																																			.	.		0.615	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
GSE1	23199	hgsc.bcm.edu	37	16	85687882	85687996	+	Splice_Site	DEL	ATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC	ATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC	-	rs199907438|rs139026945|rs533754397|rs200326373|rs548173812|rs141495598|rs371288703|rs201414196|rs374027374|rs200380779|rs372447672|rs368790892|rs375693569|rs146142460|rs567937313|rs370331390|rs368266182|rs373938537|rs370775268	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	ATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC	ATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:85687882_85687996delATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC	ENST00000253458.7	+	4	602_715	c.426_539delATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC	c.(424-540)caatctagcgccttcccgtgagtcaggagacctggctgtgtcctgtggtcagtggcctataccaggctcctgccctgactggacgctctcctcccgcaggatgccggctccaggagc>cac	p.QSSAFP*VRRPGCVLWSVAYTRLLP*LDALLPQDAGSRS142fs	GSE1_ENST00000405402.2_Splice_Site_p.QSSAFP*VRRPGCVLWSVAYTRLLP*LDALLPQDAGSRS38fs|GSE1_ENST00000393243.1_Splice_Site_p.QSSAFP*VRRPGCVLWSVAYTRLLP*LDALLPQDAGSRS69fs	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	142																	CTCCTCCCGCAGGATGCCGGCTCCAGGAGCAGCAGTGGAGGTCGGGAACGCCTCATTGTGGAGCCCCCGCTCCCTCAGGAGAAGGCAGGGGGACCAGCCATCCCCTCGCACCTGCTCAGCACCCCCTACCCCTTC	0.648																																					p.143_148del		Pindel	.											.	.	.	.	0			c.427_443del						.																																			SO:0001630	splice_region_variant	23199	exon4			.	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.427-1ATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC>-	chr16.hg19:g.85687882_85687996delATCTAGCGCCTTCCCGTGAGTCAGGAGACCTGGCTGTGTCCTGTGGTCAGTGGCCTATACCAGGCTCCTGCCCTGACTGGACGCTCTCCTCCCGCAGGATGCCGGCTCCAGGAGC		0.0	0.0		75.0	19.0	NM_014615	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Frame_Shift_Del	DEL	ENST00000253458.7	hg19	CCDS10952.1																																																																																			.	.		0.648	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	Frame_Shift_Del
XRCC6	2547	hgsc.bcm.edu	37	22	42057392	42057407	+	Frame_Shift_Del	DEL	AGCTTGTTTACCCACC	AGCTTGTTTACCCACC	-			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	AGCTTGTTTACCCACC	AGCTTGTTTACCCACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:42057392_42057407delAGCTTGTTTACCCACC	ENST00000359308.4	+	11	2235_2250	c.1580_1595delAGCTTGTTTACCCACC	c.(1579-1596)gagcttgtttacccaccafs	p.ELVYPP527fs	XRCC6_ENST00000405506.1_Frame_Shift_Del_p.ELVYPP477fs|XRCC6_ENST00000405878.1_Frame_Shift_Del_p.ELVYPP527fs|XRCC6_ENST00000428575.2_Frame_Shift_Del_p.ELVYPP394fs|XRCC6_ENST00000360079.3_Frame_Shift_Del_p.ELVYPP527fs|XRCC6_ENST00000402580.3_Frame_Shift_Del_p.ELVYPP486fs			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	527					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						GAGTTTAAGGAGCTTGTTTACCCACCAGATTACAAT	0.417								Non-homologous end-joining																													p.527_532del		Pindel	.											.	XRCC6	64	.	0			c.1579_1594del						.																																			SO:0001589	frameshift_variant	2547	exon12			.	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1580_1595delAGCTTGTTTACCCACC	chr22.hg19:g.42057392_42057407delAGCTTGTTTACCCACC	ENSP00000352257:p.Glu527fs	0.0	0.0		101.0	14.0	NM_001469	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Frame_Shift_Del	DEL	ENST00000359308.4	hg19	CCDS14021.1																																																																																			.	.		0.417	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469	
EPN2	22905	hgsc.bcm.edu	37	17	19186829	19186873	+	In_Frame_Del	DEL	CTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	CTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	-	rs377337201		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	CTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	CTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:19186829_19186873delCTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	ENST00000314728.5	+	3	881_925	c.397_441delCTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	c.(397-441)ctcctcaaggacgaggaacggttgaaggctgagagggcccaggctdel	p.LLKDEERLKAERAQA133del	EPN2_ENST00000395618.3_Intron|EPN2_ENST00000571254.1_In_Frame_Del_p.LLKDEERLKAERAQA133del|EPN2_ENST00000575595.1_Intron|EPN2_ENST00000347697.2_In_Frame_Del_p.LLKDEERLKAERAQA133del|EPN2_ENST00000395626.1_In_Frame_Del_p.LLKDEERLKAERAQA133del|EPN2_ENST00000395620.2_In_Frame_Del_p.LLKDEERLKAERAQA133del	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	133	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					ACTGGTGGCTCTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCTCTCAAAACCA	0.584																																					p.132_147del		Pindel	.											.	EPN2	52	.	0			c.396_440del						.																																			SO:0001651	inframe_deletion	22905	exon3			.	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.397_441delCTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	chr17.hg19:g.19186829_19186873delCTCCTCAAGGACGAGGAACGGTTGAAGGCTGAGAGGGCCCAGGCT	ENSP00000320543:p.Leu133_Ala147del	0.0	0.0		50.0	15.0	NM_148921	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	In_Frame_Del	DEL	ENST00000314728.5	hg19	CCDS11203.1																																																																																			.	.		0.584	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964	
