#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CELF3	11189	hgsc.bcm.edu	37	1	151679702	151679702	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:151679702C>T	ENST00000290583.4	-	8	1634	c.841G>A	c.(841-843)Ggc>Agc	p.G281S	CELF3_ENST00000290585.4_Intron|CELF3_ENST00000470688.1_5'UTR|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_Missense_Mutation_p.G98S	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	281					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						GGGCTGTAGCCGTTGACGCCC	0.672																																					p.G281S		Atlas-SNP	.											.	CELF3	49	.	0			c.G841A						.						24.0	24.0	24.0					1																	151679702		2183	4275	6458	SO:0001583	missense	11189	exon8			TGTAGCCGTTGAC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.841G>A	chr1.hg19:g.151679702C>T	ENSP00000290583:p.Gly281Ser	103.0	0.0		125.0	17.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	hg19	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	15.75	2.924379	0.52653	.	.	ENSG00000159409	ENST00000290583;ENST00000392706	T;T	0.16196	2.36;3.38	3.86	3.86	0.44501	.	0.193448	0.47093	D	0.000260	T	0.13200	0.0320	N	0.24115	0.695	0.41455	D	0.988006	D;P;B;P	0.76494	0.999;0.468;0.444;0.761	P;B;B;B	0.58520	0.84;0.18;0.035;0.145	T	0.06972	-1.0797	10	0.33940	T	0.23	-6.5762	14.5324	0.67936	0.0:1.0:0.0:0.0	.	98;281;281;280	B4DQL3;Q5SZQ8-2;Q5SZQ8;Q5SZQ8-3	.;.;CELF3_HUMAN;.	S	281;98	ENSP00000290583:G281S;ENSP00000376470:G98S	ENSP00000290583:G281S	G	-	1	0	CELF3	149946326	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.643000	0.37217	2.008000	0.58898	0.555000	0.69702	GGC	.	.		0.672	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
PBX1	5087	hgsc.bcm.edu	37	1	164768969	164768969	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:164768969C>T	ENST00000420696.2	+	4	732	c.544C>T	c.(544-546)Ctc>Ttc	p.L182F	PBX1_ENST00000560641.1_Missense_Mutation_p.L77F|PBX1_ENST00000540246.1_Missense_Mutation_p.L77F|PBX1_ENST00000540236.1_Missense_Mutation_p.L182F|PBX1_ENST00000559240.1_Missense_Mutation_p.L182F|PBX1_ENST00000401534.1_Missense_Mutation_p.L182F|PBX1_ENST00000367897.1_Missense_Mutation_p.L182F	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	182					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CGTGATGAATCTCCTGCGAGA	0.552			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.L182F		Atlas-SNP	.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	60	.	0			c.C544T						.						90.0	82.0	84.0					1																	164768969		2203	4300	6503	SO:0001583	missense	5087	exon4			ATGAATCTCCTGC	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.544C>T	chr1.hg19:g.164768969C>T	ENSP00000405890:p.Leu182Phe	58.0	0.0		83.0	16.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	hg19	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	C	34	5.333251	0.95758	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.76	5.76	0.90799	PBX (1);	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D	0.71674	0.996;0.998;0.995;0.998;0.996	D;D;D;D;D	0.78314	0.985;0.991;0.974;0.991;0.985	T	0.69412	-0.5152	10	0.54805	T	0.06	-11.2331	19.571	0.95419	0.0:1.0:0.0:0.0	.	77;182;182;182;182	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	F	182;182;182;182;77	ENSP00000405890:L182F;ENSP00000356872:L182F;ENSP00000439943:L182F;ENSP00000384856:L182F;ENSP00000440869:L77F	ENSP00000356872:L182F	L	+	1	0	PBX1	163035593	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	7.380000	0.79704	2.713000	0.92767	0.655000	0.94253	CTC	.	.		0.552	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
DHX9	1660	hgsc.bcm.edu	37	1	182852382	182852382	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:182852382A>T	ENST00000367549.3	+	25	3133	c.3023A>T	c.(3022-3024)gAa>gTa	p.E1008V	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1008					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TATCATAAGGAAAAGAGGAAG	0.413																																					p.E1008V	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A3023T						.						155.0	132.0	139.0					1																	182852382		1900	4120	6020	SO:0001583	missense	1660	exon25			ATAAGGAAAAGAG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3023A>T	chr1.hg19:g.182852382A>T	ENSP00000356520:p.Glu1008Val	129.0	0.0		156.0	83.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.848970	0.91277	.	.	ENSG00000135829	ENST00000367549	T	0.04275	3.66	5.39	5.39	0.77823	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.18964	0.0455	M	0.85197	2.74	0.80722	D	1	P;P	0.47604	0.898;0.885	P;P	0.53722	0.733;0.665	T	0.00728	-1.1591	10	0.48119	T	0.1	.	15.4176	0.74983	1.0:0.0:0.0:0.0	.	287;1008	B3KU66;Q08211	.;DHX9_HUMAN	V	1008	ENSP00000356520:E1008V	ENSP00000356520:E1008V	E	+	2	0	DHX9	181119005	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.699000	0.91316	2.027000	0.59764	0.533000	0.62120	GAA	.	.		0.413	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
YOD1	55432	hgsc.bcm.edu	37	1	207224106	207224106	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:207224106G>A	ENST00000315927.4	-	1	316	c.270C>T	c.(268-270)ctC>ctT	p.L90L	YOD1_ENST00000391927.1_Silent_p.L46L|PFKFB2_ENST00000367079.2_5'Flank|PFKFB2_ENST00000411990.2_Intron|YOD1_ENST00000367084.1_Silent_p.L46L|PFKFB2_ENST00000367080.3_5'Flank	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	90	UBX-like.			L -> F (in Ref. 1; BAC87233). {ECO:0000305}.	cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					GGTATCCGACGAGGATTCGCT	0.627																																					p.L90L		Atlas-SNP	.											.	YOD1	24	.	0			c.C270T						.						48.0	55.0	52.0					1																	207224106		2203	4299	6502	SO:0001819	synonymous_variant	55432	exon1			TCCGACGAGGATT		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.270C>T	chr1.hg19:g.207224106G>A		68.0	0.0		123.0	11.0	NM_018566	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Silent	SNP	ENST00000315927.4	hg19	CCDS31002.1																																																																																			.	.		0.627	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566	
CR2	1380	hgsc.bcm.edu	37	1	207641906	207641906	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:207641906C>T	ENST00000367058.3	+	3	669	c.480C>T	c.(478-480)atC>atT	p.I160I	CR2_ENST00000458541.2_Silent_p.I160I|CR2_ENST00000367059.3_Silent_p.I160I|CR2_ENST00000367057.3_Silent_p.I160I|CR2_ENST00000485707.1_3'UTR	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	160	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TTCCTATGATCCACAATGGAC	0.433																																					p.I160I		Atlas-SNP	.											.	CR2	164	.	0			c.C480T						.						202.0	188.0	192.0					1																	207641906		2203	4300	6503	SO:0001819	synonymous_variant	1380	exon3			TATGATCCACAAT	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.480C>T	chr1.hg19:g.207641906C>T		239.0	0.0		293.0	160.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	hg19	CCDS1478.1																																																																																			.	.		0.433	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
PCNXL2	80003	hgsc.bcm.edu	37	1	233397906	233397906	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:233397906T>C	ENST00000258229.9	-	3	599	c.365A>G	c.(364-366)aAt>aGt	p.N122S	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	122						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AATCTGCCTATTATTGCTAAC	0.448																																					p.N122S		Atlas-SNP	.											.	PCNXL2	204	.	0			c.A365G						.						183.0	192.0	189.0					1																	233397906		1949	4139	6088	SO:0001583	missense	80003	exon3			TGCCTATTATTGC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.365A>G	chr1.hg19:g.233397906T>C	ENSP00000258229:p.Asn122Ser	108.0	0.0		144.0	19.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	11.91	1.779032	0.31502	.	.	ENSG00000135749	ENST00000258229	T	0.62232	0.04	5.2	-0.286	0.12862	.	.	.	.	.	T	0.42585	0.1209	N	0.22421	0.69	0.18873	N	0.999985	B	0.29162	0.235	B	0.29077	0.098	T	0.23868	-1.0176	9	0.23891	T	0.37	.	7.4045	0.26983	0.0:0.0763:0.4036:0.5201	.	122	A6NKB5	PCX2_HUMAN	S	122	ENSP00000258229:N122S	ENSP00000258229:N122S	N	-	2	0	PCNXL2	231464529	0.593000	0.26840	0.000000	0.03702	0.543000	0.35085	0.748000	0.26305	-0.226000	0.09899	0.533000	0.62120	AAT	.	.		0.448	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
PLD5	200150	hgsc.bcm.edu	37	1	242451667	242451667	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:242451667A>T	ENST00000536534.2	-	3	733	c.492T>A	c.(490-492)tgT>tgA	p.C164*	PLD5_ENST00000427495.1_Nonsense_Mutation_p.C102*|PLD5_ENST00000442594.2_Nonsense_Mutation_p.C72*			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	164						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AGCTTACCTGACATGCTGATG	0.423																																					p.C164X		Atlas-SNP	.											.	PLD5	216	.	0			c.T492A						.						176.0	151.0	160.0					1																	242451667		2203	4300	6503	SO:0001587	stop_gained	200150	exon4			TACCTGACATGCT	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.492T>A	chr1.hg19:g.242451667A>T	ENSP00000440896:p.Cys164*	424.0	0.0		559.0	59.0	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Nonsense_Mutation	SNP	ENST00000536534.2	hg19	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	A	38	6.957052	0.97964	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534;ENST00000459864	.	.	.	4.33	3.17	0.36434	.	0.173929	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-18.0311	6.029	0.19669	0.8142:0.0:0.1858:0.0	.	.	.	.	X	102;72;164;102	.	ENSP00000401285:C102X	C	-	3	2	PLD5	240518290	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.486000	0.35530	1.733000	0.51620	0.482000	0.46254	TGT	.	.		0.423	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
ADSS	159	hgsc.bcm.edu	37	1	244595870	244595870	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:244595870A>T	ENST00000366535.3	-	4	699	c.383T>A	c.(382-384)aTt>aAt	p.I128N		NM_001126.3	NP_001117.2			adenylosuccinate synthase											endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			GTCAGATATAATAAGCCTTTT	0.254																																					p.I128N		Atlas-SNP	.											.	ADSS	49	.	0			c.T383A						.						61.0	69.0	66.0					1																	244595870		2198	4276	6474	SO:0001583	missense	159	exon4			GATATAATAAGCC	BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.383T>A	chr1.hg19:g.244595870A>T	ENSP00000355493:p.Ile128Asn	572.0	0.0		783.0	32.0	NM_001126		Missense_Mutation	SNP	ENST00000366535.3	hg19	CCDS1624.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041942	0.75732	.	.	ENSG00000035687	ENST00000366535;ENST00000449326;ENST00000430700	T	0.44881	0.91	5.58	5.58	0.84498	.	0.257041	0.43416	D	0.000577	T	0.59142	0.2172	M	0.75777	2.31	0.53688	D	0.999976	P	0.51240	0.943	P	0.56788	0.806	T	0.57347	-0.7827	10	0.30078	T	0.28	-4.3992	15.7221	0.77721	1.0:0.0:0.0:0.0	.	128	P30520	PURA2_HUMAN	N	128;107;68	ENSP00000355493:I128N	ENSP00000355493:I128N	I	-	2	0	ADSS	242662493	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.521000	0.73778	2.253000	0.74438	0.455000	0.32223	ATT	.	.		0.254	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096697.1	NM_001126	
OR2T4	127074	hgsc.bcm.edu	37	1	248524908	248524908	+	Missense_Mutation	SNP	G	G	A	rs140989725		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:248524908G>A	ENST00000366475.1	+	1	26	c.26G>A	c.(25-27)aGc>aAc	p.S9N		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGATGGCCAGCCACACTGGA	0.483																																					p.S9N		Atlas-SNP	.											OR2T4,NS,carcinoma,0,1	OR2T4	126	.	0			c.G26A						.						78.0	74.0	76.0					1																	248524908		2203	4300	6503	SO:0001583	missense	127074	exon1			TGGCCAGCCACAC	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.26G>A	chr1.hg19:g.248524908G>A	ENSP00000355431:p.Ser9Asn	321.0	1.0		388.0	16.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.037779	0.00402	.	.	ENSG00000196944	ENST00000366475	T	0.01821	4.62	1.77	-1.13	0.09775	.	.	.	.	.	T	0.00815	0.0027	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47156	-0.9139	9	0.05351	T	0.99	.	4.3443	0.11126	0.6047:0.0:0.3953:0.0	.	9	Q8NH00	OR2T4_HUMAN	N	9	ENSP00000355431:S9N	ENSP00000355431:S9N	S	+	2	0	OR2T4	246591531	0.000000	0.05858	0.009000	0.14445	0.059000	0.15707	-0.336000	0.07863	-0.221000	0.09973	-0.745000	0.03516	AGC	.	.		0.483	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
SEMA4F	10505	hgsc.bcm.edu	37	2	74901762	74901762	+	Silent	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:74901762G>C	ENST00000357877.2	+	8	1109	c.960G>C	c.(958-960)ggG>ggC	p.G320G	SEMA4F_ENST00000339773.5_Silent_p.G165G	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	320	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						CTGAGCTTGGGGCAGGGACTC	0.567																																					p.G320G		Atlas-SNP	.											.	SEMA4F	89	.	0			c.G960C						.						162.0	156.0	158.0					2																	74901762		2203	4300	6503	SO:0001819	synonymous_variant	10505	exon8			GCTTGGGGCAGGG	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.960G>C	chr2.hg19:g.74901762G>C		140.0	0.0		93.0	27.0	NM_004263	Q542Y7|Q9NS35	Silent	SNP	ENST00000357877.2	hg19	CCDS1955.1																																																																																			.	.		0.567	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
REG1B	5968	hgsc.bcm.edu	37	2	79314699	79314699	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:79314699G>T	ENST00000305089.3	-	2	120	c.40C>A	c.(40-42)Ctg>Atg	p.L14M		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	14					cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						AGGAACATCAGGGAGGAGATC	0.483																																					p.L14M		Atlas-SNP	.											REG1B,right_lower_lobe,carcinoma,0,1	REG1B	83	.	0			c.C40A						.						143.0	118.0	126.0					2																	79314699		2203	4300	6503	SO:0001583	missense	5968	exon2			ACATCAGGGAGGA		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.40C>A	chr2.hg19:g.79314699G>T	ENSP00000303206:p.Leu14Met	148.0	0.0		106.0	30.0	NM_006507		Missense_Mutation	SNP	ENST00000305089.3	hg19	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	15.90	2.969208	0.53614	.	.	ENSG00000172023	ENST00000305089	T	0.05382	3.45	2.71	1.8	0.24995	.	0.000000	0.29126	N	0.013075	T	0.22859	0.0552	M	0.86740	2.835	0.21627	N	0.999616	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.02307	-1.1179	10	0.72032	D	0.01	.	5.8691	0.18793	0.1547:0.0:0.8453:0.0	.	14;14	Q6ICS1;P48304	.;REG1B_HUMAN	M	14	ENSP00000303206:L14M	ENSP00000303206:L14M	L	-	1	2	REG1B	79168207	0.990000	0.36364	0.646000	0.29493	0.459000	0.32528	0.857000	0.27831	0.678000	0.31325	0.555000	0.69702	CTG	.	.		0.483	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507	
DNAH6	1768	hgsc.bcm.edu	37	2	84852030	84852030	+	Missense_Mutation	SNP	G	G	T	rs368034415		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:84852030G>T	ENST00000237449.6	+	28	4366	c.4358G>T	c.(4357-4359)cGc>cTc	p.R1453L	DNAH6_ENST00000389394.3_Missense_Mutation_p.R1453L|DNAH6_ENST00000398278.2_Missense_Mutation_p.R1453L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1453	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTTCAGGATCGCTGCTATCTT	0.468																																					p.R1453L		Atlas-SNP	.											.	DNAH6	194	.	0			c.G4358T						.						43.0	39.0	40.0					2																	84852030		692	1591	2283	SO:0001583	missense	1768	exon29			AGGATCGCTGCTA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.4358G>T	chr2.hg19:g.84852030G>T	ENSP00000237449:p.Arg1453Leu	129.0	0.0		86.0	34.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888389	0.91814	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.14640	2.49;2.49;2.49	5.73	5.73	0.89815	.	.	.	.	.	T	0.49287	0.1548	M	0.92219	3.285	0.52501	D	0.999957	D	0.89917	1.0	D	0.74023	0.982	T	0.60347	-0.7281	9	0.87932	D	0	.	18.6778	0.91535	0.0:0.0:1.0:0.0	.	1453	Q9C0G6	DYH6_HUMAN	L	1453	ENSP00000374045:R1453L;ENSP00000381326:R1453L;ENSP00000237449:R1453L	ENSP00000237449:R1453L	R	+	2	0	DNAH6	84705541	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.483000	0.81158	2.693000	0.91896	0.655000	0.94253	CGC	.	.		0.468	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
XIRP2	129446	hgsc.bcm.edu	37	2	168097234	168097234	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:168097234G>T	ENST00000409728.1	+	8	1218	c.1129G>T	c.(1129-1131)Gtt>Ttt	p.V377F	XIRP2_ENST00000409273.1_Missense_Mutation_p.V122F|XIRP2_ENST00000409605.1_Missense_Mutation_p.V122F|XIRP2_ENST00000409043.1_Missense_Mutation_p.V344F|XIRP2_ENST00000409195.1_Missense_Mutation_p.V344F|XIRP2_ENST00000295237.9_Missense_Mutation_p.V344F|XIRP2_ENST00000409756.2_Missense_Mutation_p.V344F|XIRP2_ENST00000420519.1_Missense_Mutation_p.V377F	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	169					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TCATCAATATGTTCAAGAAAC	0.348																																					p.V377F		Atlas-SNP	.											.	XIRP2	914	.	0			c.G1129T						.						119.0	115.0	116.0					2																	168097234		1853	4082	5935	SO:0001583	missense	129446	exon8			CAATATGTTCAAG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1129G>T	chr2.hg19:g.168097234G>T	ENSP00000386619:p.Val377Phe	184.0	0.0		164.0	71.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	hg19	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468899	0.84533	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	T;T;T;T;T;T;T;T	0.78816	-1.21;-1.21;4.1;-1.21;-1.21;4.1;4.11;-1.21	5.81	5.81	0.92471	.	0.325101	0.29321	N	0.012484	D	0.85600	0.5734	M	0.62723	1.935	0.39531	D	0.968665	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.998	D;D;D;D;D	0.87578	0.943;0.997;0.998;0.996;0.935	T	0.81300	-0.0995	10	0.15499	T	0.54	-17.2181	17.5701	0.87933	0.0:0.0:1.0:0.0	.	169;344;377;169;122	A4UGR9;A4UGR9-4;A4UGR9-6;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.;.;.	F	344;377;344;344;377;344;122;122	ENSP00000386454:V344F;ENSP00000386619:V377F;ENSP00000386840:V344F;ENSP00000386724:V344F;ENSP00000415541:V377F;ENSP00000295237:V344F;ENSP00000387255:V122F;ENSP00000386981:V122F	ENSP00000295237:V344F	V	+	1	0	XIRP2	167805480	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.927000	0.56499	2.756000	0.94617	0.655000	0.94253	GTT	.	.		0.348	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
CHL1	10752	hgsc.bcm.edu	37	3	423911	423911	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:423911G>T	ENST00000256509.2	+	17	2568	c.1926G>T	c.(1924-1926)agG>agT	p.R642S	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.R626S	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GACAGAACAGGAGTGTTCGGC	0.408																																					p.R642S		Atlas-SNP	.											.	CHL1	242	.	0			c.G1926T						.						89.0	94.0	92.0					3																	423911		2203	4300	6503	SO:0001583	missense	10752	exon15			GAACAGGAGTGTT	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1926G>T	chr3.hg19:g.423911G>T	ENSP00000256509:p.Arg642Ser	95.0	0.0		78.0	27.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876548	0.72180	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.54479	0.57;0.57	5.13	2.09	0.27110	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.166021	0.49916	D	0.000128	T	0.58538	0.2129	L	0.47716	1.5	0.45464	D	0.998435	P;P;D	0.76494	0.954;0.954;0.999	P;P;D	0.74023	0.87;0.87;0.982	T	0.54609	-0.8268	10	0.52906	T	0.07	.	5.5079	0.16864	0.2909:0.25:0.4591:0.0	.	626;626;642	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	S	642;626	ENSP00000256509:R642S;ENSP00000380628:R626S	ENSP00000256509:R642S	R	+	3	2	CHL1	398911	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.575000	0.23729	0.187000	0.20147	0.591000	0.81541	AGG	.	.		0.408	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
BSN	8927	hgsc.bcm.edu	37	3	49694892	49694892	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:49694892C>T	ENST00000296452.4	+	5	8017	c.7903C>T	c.(7903-7905)Cgc>Tgc	p.R2635C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2635					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.R2635S(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCGTCTTCCCCGCCACTCAGA	0.647																																					p.R2635C		Atlas-SNP	.											.	BSN	272	.	1	Substitution - Missense(1)	lung(1)	c.C7903T						.						38.0	45.0	43.0					3																	49694892		2203	4300	6503	SO:0001583	missense	8927	exon5			CTTCCCCGCCACT	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.7903C>T	chr3.hg19:g.49694892C>T	ENSP00000296452:p.Arg2635Cys	54.0	0.0		34.0	7.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	hg19	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576314	0.28092	.	.	ENSG00000164061	ENST00000296452	T	0.25085	1.82	6.04	6.04	0.98038	.	0.120057	0.56097	D	0.000038	T	0.50051	0.1593	L	0.55481	1.735	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.40001	-0.9586	10	0.87932	D	0	-16.6587	20.1896	0.98226	0.0:1.0:0.0:0.0	.	2635	Q9UPA5	BSN_HUMAN	C	2635	ENSP00000296452:R2635C	ENSP00000296452:R2635C	R	+	1	0	BSN	49669896	0.706000	0.27856	1.000000	0.80357	0.994000	0.84299	1.335000	0.33839	2.873000	0.98535	0.561000	0.74099	CGC	.	.		0.647	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
TMPRSS7	344805	hgsc.bcm.edu	37	3	111764780	111764780	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:111764780G>A	ENST00000452346.2	+	5	684	c.681G>A	c.(679-681)gtG>gtA	p.V227V	TMPRSS7_ENST00000419127.1_Silent_p.V114V			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	227	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGGACTCTGTGGTACTAAATG	0.463																																					p.V114V		Atlas-SNP	.											.	TMPRSS7	126	.	0			c.G342A						.						260.0	226.0	236.0					3																	111764780		692	1591	2283	SO:0001819	synonymous_variant	344805	exon4			CTCTGTGGTACTA	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.681G>A	chr3.hg19:g.111764780G>A		372.0	0.0		322.0	117.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Silent	SNP	ENST00000452346.2	hg19																																																																																				.	.		0.463	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
CCDC14	64770	hgsc.bcm.edu	37	3	123665744	123665744	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:123665744A>T	ENST00000488653.2	-	8	1341	c.1251T>A	c.(1249-1251)gaT>gaA	p.D417E	CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000489746.1_Missense_Mutation_p.D217E|CCDC14_ENST00000310351.4_Missense_Mutation_p.D257E|CCDC14_ENST00000433542.2_Missense_Mutation_p.D376E|CCDC14_ENST00000485727.1_Missense_Mutation_p.D217E			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	417					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		CCTTCTGTACATCCTTCACTG	0.378																																					p.D376E		Atlas-SNP	.											.	CCDC14	97	.	0			c.T1128A						.						194.0	198.0	197.0					3																	123665744		2203	4300	6503	SO:0001583	missense	64770	exon7			CTGTACATCCTTC	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1251T>A	chr3.hg19:g.123665744A>T	ENSP00000420180:p.Asp417Glu	74.0	0.0		63.0	9.0	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	hg19		.	.	.	.	.	.	.	.	.	.	A	12.74	2.029283	0.35797	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000426152	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.65	1.96	0.26148	.	0.499970	0.20011	N	0.101136	T	0.30324	0.0761	L	0.53249	1.67	0.09310	N	1	B;B;B	0.28850	0.225;0.225;0.091	B;B;B	0.26094	0.048;0.048;0.066	T	0.15037	-1.0451	10	0.15952	T	0.53	.	5.7785	0.18294	0.6498:0.1321:0.218:0.0	.	417;376;217	Q49A88;Q49A88-6;Q49A88-4	CCD14_HUMAN;.;.	E	417;257;217;217;376;398;143	ENSP00000420180:D417E;ENSP00000312031:D257E;ENSP00000418002:D217E;ENSP00000418403:D217E;ENSP00000395706:D376E;ENSP00000386866:D398E;ENSP00000414655:D143E	ENSP00000312031:D257E	D	-	3	2	CCDC14	125148434	0.794000	0.28838	0.704000	0.30370	0.960000	0.62799	0.720000	0.25896	0.567000	0.29293	0.533000	0.62120	GAT	.	.		0.378	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
MBD4	8930	hgsc.bcm.edu	37	3	129155490	129155490	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:129155490T>A	ENST00000249910.1	-	3	1172	c.997A>T	c.(997-999)Ata>Tta	p.I333L	MBD4_ENST00000429544.2_Missense_Mutation_p.I333L|MBD4_ENST00000509587.1_Intron|MBD4_ENST00000393278.2_Intron|MBD4_ENST00000503197.1_Missense_Mutation_p.I333L|MBD4_ENST00000507208.1_Missense_Mutation_p.I333L	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	333					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						AATTTGTTTATGATGCCAGAA	0.348								Base excision repair (BER), DNA glycosylases																													p.I333L		Atlas-SNP	.											.	MBD4	53	.	0			c.A997T						.						88.0	96.0	93.0					3																	129155490		2202	4300	6502	SO:0001583	missense	8930	exon3			TGTTTATGATGCC	AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.997A>T	chr3.hg19:g.129155490T>A	ENSP00000249910:p.Ile333Leu	179.0	0.0		143.0	23.0	NM_003925	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	hg19	CCDS3058.1	.	.	.	.	.	.	.	.	.	.	T	6.389	0.439882	0.12104	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000507208	D;D;D;D	0.92647	-2.88;-2.88;-3.08;-3.08	5.27	-2.26	0.06867	.	1.310070	0.04720	N	0.419243	D	0.82536	0.5058	L	0.27053	0.805	0.20074	N	0.999931	B;B;B;B	0.24920	0.07;0.114;0.048;0.07	B;B;B;B	0.20955	0.024;0.032;0.022;0.014	T	0.67569	-0.5637	10	0.20519	T	0.43	-0.255	1.3947	0.02258	0.1389:0.2731:0.1424:0.4455	.	333;333;333;333	E9PEE4;O95243-2;O95243-3;O95243	.;.;.;MBD4_HUMAN	L	333	ENSP00000394080:I333L;ENSP00000249910:I333L;ENSP00000424873:I333L;ENSP00000422327:I333L	ENSP00000249910:I333L	I	-	1	0	MBD4	130638180	0.001000	0.12720	0.012000	0.15200	0.201000	0.24016	-0.239000	0.08965	-0.254000	0.09500	-0.256000	0.11100	ATA	.	.		0.348	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925	
COL6A6	131873	hgsc.bcm.edu	37	3	130289820	130289820	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:130289820G>A	ENST00000358511.6	+	6	2591	c.2560G>A	c.(2560-2562)Gct>Act	p.A854T	COL6A6_ENST00000453409.2_Missense_Mutation_p.A854T	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	854	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCTGAAGTATGCTGATGACCC	0.433																																					p.A854T		Atlas-SNP	.											.	COL6A6	497	.	0			c.G2560A						.						75.0	76.0	76.0					3																	130289820		1880	4118	5998	SO:0001583	missense	131873	exon6			AAGTATGCTGATG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2560G>A	chr3.hg19:g.130289820G>A	ENSP00000351310:p.Ala854Thr	93.0	0.0		88.0	16.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507212	0.64410	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.79454	-1.27;-1.27	4.87	3.85	0.44370	von Willebrand factor, type A (3);	0.108239	0.41294	D	0.000905	T	0.64832	0.2634	N	0.25380	0.74	0.29826	N	0.830448	P	0.34462	0.454	B	0.38156	0.266	T	0.65401	-0.6177	10	0.87932	D	0	.	5.8236	0.18540	0.0996:0.0:0.5249:0.3754	.	854	A6NMZ7	CO6A6_HUMAN	T	854	ENSP00000351310:A854T;ENSP00000399236:A854T	ENSP00000351310:A854T	A	+	1	0	COL6A6	131772510	0.002000	0.14202	0.932000	0.37286	0.924000	0.55760	0.555000	0.23422	2.424000	0.82194	0.561000	0.74099	GCT	.	.		0.433	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
NLGN1	22871	hgsc.bcm.edu	37	3	173322666	173322666	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:173322666G>T	ENST00000457714.1	+	3	707	c.278G>T	c.(277-279)cGt>cTt	p.R93L	NLGN1_ENST00000545397.1_Missense_Mutation_p.R93L|NLGN1_ENST00000361589.4_Missense_Mutation_p.R93L|NLGN1_ENST00000401917.3_Missense_Mutation_p.R93L	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	93					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.R93L(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACAGGGGAACGTCGTTTTCAG	0.453																																					p.R93L		Atlas-SNP	.											NLGN1,caecum,adenoma,0,3	NLGN1	209	.	2	Substitution - Missense(2)	lung(2)	c.G278T						.						130.0	129.0	129.0					3																	173322666		2203	4300	6503	SO:0001583	missense	22871	exon3			GGGAACGTCGTTT	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.278G>T	chr3.hg19:g.173322666G>T	ENSP00000392500:p.Arg93Leu	102.0	0.0		94.0	39.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	hg19	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	G	6.574	0.474179	0.12521	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.62	3.23	0.37069	.	0.229124	0.34314	N	0.004077	T	0.22666	0.0547	N	0.01410	-0.885	0.32782	N	0.502396	B;B	0.26195	0.004;0.144	B;B	0.18561	0.022;0.016	T	0.16630	-1.0396	10	0.23891	T	0.37	.	6.2449	0.20811	0.6324:0.0:0.3676:0.0	.	93;93	D2X2H5;Q8N2Q7-2	.;.	L	93	ENSP00000392500:R93L;ENSP00000354541:R93L;ENSP00000410374:R93L;ENSP00000441108:R93L;ENSP00000385750:R93L	ENSP00000354541:R93L	R	+	2	0	NLGN1	174805360	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.321000	0.43805	1.069000	0.40788	-0.373000	0.07131	CGT	.	.		0.453	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NLGN1	22871	hgsc.bcm.edu	37	3	173525610	173525610	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:173525610C>A	ENST00000457714.1	+	4	1063	c.634C>A	c.(634-636)Ctt>Att	p.L212I	NLGN1_ENST00000545397.1_Missense_Mutation_p.L212I|NLGN1_ENST00000361589.4_Missense_Mutation_p.L212I|NLGN1_ENST00000401917.3_Missense_Mutation_p.L252I	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	229					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CAACTATCGACTTGGAGTACT	0.388																																					p.L212I		Atlas-SNP	.											.	NLGN1	209	.	0			c.C634A						.						140.0	132.0	135.0					3																	173525610		2203	4300	6503	SO:0001583	missense	22871	exon4			TATCGACTTGGAG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.634C>A	chr3.hg19:g.173525610C>A	ENSP00000392500:p.Leu212Ile	137.0	0.0		97.0	52.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	hg19	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987790	0.93106	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.74947	-0.6;-0.6;-0.89;-0.6;-0.6	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	D	0.85128	0.5626	M	0.88377	2.95	0.80722	D	1	P;P	0.50066	0.931;0.605	P;P	0.50934	0.654;0.619	D	0.87424	0.2384	10	0.62326	D	0.03	.	19.6981	0.96039	0.0:1.0:0.0:0.0	.	252;212	D2X2H5;Q8N2Q7-2	.;.	I	212;212;252;212;252	ENSP00000392500:L212I;ENSP00000354541:L212I;ENSP00000410374:L252I;ENSP00000441108:L212I;ENSP00000385750:L252I	ENSP00000354541:L212I	L	+	1	0	NLGN1	175008304	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.085000	0.71343	2.665000	0.90641	0.557000	0.71058	CTT	.	.		0.388	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
CD38	952	hgsc.bcm.edu	37	4	15839760	15839760	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:15839760T>C	ENST00000226279.3	+	5	768	c.631T>C	c.(631-633)Tcc>Ccc	p.S211P		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	211					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						GCTCAATGGATCCCGCAGTAA	0.383																																					p.S211P		Atlas-SNP	.											.	CD38	36	.	0			c.T631C						.						143.0	133.0	136.0					4																	15839760		2203	4300	6503	SO:0001583	missense	952	exon5			AATGGATCCCGCA	D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.631T>C	chr4.hg19:g.15839760T>C	ENSP00000226279:p.Ser211Pro	59.0	0.0		53.0	33.0	NM_001775	O00121|O00122|Q96HY4	Missense_Mutation	SNP	ENST00000226279.3	hg19	CCDS3417.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.312152	0.40895	.	.	ENSG00000004468	ENST00000226279;ENST00000510674	T;T	0.53857	0.6;0.6	5.4	5.4	0.78164	NAD(P)-binding domain (1);	0.112478	0.64402	D	0.000007	T	0.74703	0.3751	M	0.87381	2.88	0.40730	D	0.982734	D	0.89917	1.0	D	0.91635	0.999	T	0.80169	-0.1494	10	0.87932	D	0	-28.9521	12.0932	0.53739	0.0:0.0:0.0:1.0	.	211	P28907	CD38_HUMAN	P	211;99	ENSP00000226279:S211P;ENSP00000423047:S99P	ENSP00000226279:S211P	S	+	1	0	CD38	15448858	0.010000	0.17322	0.355000	0.25773	0.161000	0.22273	0.907000	0.28531	2.178000	0.69098	0.533000	0.62120	TCC	.	.		0.383	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250322.2	NM_001775	
ZNF827	152485	hgsc.bcm.edu	37	4	146859553	146859553	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:146859553T>A	ENST00000508784.1	-	1	234	c.7A>T	c.(7-9)Agg>Tgg	p.R3W	ZNF827_ENST00000513320.1_Missense_Mutation_p.R3W|ZNF827_ENST00000379448.4_Missense_Mutation_p.R3W			Q17R98	ZN827_HUMAN	zinc finger protein 827	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					TGCTTCCTCCTGGGCATTTTC	0.572																																					p.R3W		Atlas-SNP	.											.	ZNF827	102	.	0			c.A7T						.						277.0	212.0	234.0					4																	146859553		2203	4300	6503	SO:0001583	missense	152485	exon1			TCCTCCTGGGCAT	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.7A>T	chr4.hg19:g.146859553T>A	ENSP00000421863:p.Arg3Trp	160.0	0.0		96.0	68.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	hg19		.	.	.	.	.	.	.	.	.	.	t	12.81	2.049397	0.36181	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000440280	T;T;T	0.09723	2.95;3.14;2.98	4.53	3.29	0.37713	.	0.376195	0.24303	U	0.039706	T	0.16854	0.0405	N	0.19112	0.55	0.42996	D	0.9945	B;D;D	0.76494	0.098;0.999;0.999	B;D;D	0.79784	0.221;0.984;0.993	T	0.02345	-1.1173	10	0.72032	D	0.01	.	9.5955	0.39571	0.0:0.0:0.177:0.823	.	3;3;3	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	W	3	ENSP00000421863:R3W;ENSP00000423130:R3W;ENSP00000368761:R3W	ENSP00000368761:R3W	R	-	1	2	ZNF827	147079003	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.285000	0.65633	0.673000	0.31224	0.228000	0.17796	AGG	.	.		0.572	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
ZNF131	7690	hgsc.bcm.edu	37	5	43161948	43161948	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:43161948T>C	ENST00000399534.1	+	5	1013	c.969T>C	c.(967-969)acT>acC	p.T323T	ZNF131_ENST00000509634.1_Silent_p.T289T|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000306938.4_Silent_p.T289T|ZNF131_ENST00000505606.2_Silent_p.T289T|ZNF131_ENST00000509156.1_Silent_p.T323T			P52739	ZN131_HUMAN	zinc finger protein 131	323					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						AGCAAAGAACTGGGAAAAAAA	0.368																																					p.T289T		Atlas-SNP	.											.	ZNF131	51	.	0			c.T867C						.						63.0	59.0	60.0					5																	43161948		1871	4106	5977	SO:0001819	synonymous_variant	7690	exon6			AAGAACTGGGAAA	U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.969T>C	chr5.hg19:g.43161948T>C		169.0	0.0		145.0	78.0	NM_003432	B4DRL3|Q6PIF0	Silent	SNP	ENST00000399534.1	hg19																																																																																				.	.		0.368	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000367982.1	NM_003432	
ELL2	22936	hgsc.bcm.edu	37	5	95226823	95226823	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:95226823C>A	ENST00000237853.4	-	10	2094	c.1745G>T	c.(1744-1746)gGc>gTc	p.G582V	ELL2_ENST00000431061.2_Missense_Mutation_p.G332V	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	582					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CTCTTTTGAGCCTGGAGAAAG	0.428																																					p.G582V		Atlas-SNP	.											.	ELL2	63	.	0			c.G1745T						.						198.0	195.0	196.0					5																	95226823		2203	4300	6503	SO:0001583	missense	22936	exon10			TTTGAGCCTGGAG	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1745G>T	chr5.hg19:g.95226823C>A	ENSP00000237853:p.Gly582Val	119.0	0.0		145.0	86.0	NM_012081	B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	hg19	CCDS4080.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.888928|4.888928	0.91814|0.91814	.|.	.|.	ENSG00000118985|ENSG00000118985	ENST00000508757|ENST00000237853;ENST00000431061	.|T;T	.|0.26223	.|1.75;1.75	6.16|6.16	6.16|6.16	0.99307|0.99307	.|Occludin/RNA polymerase II elongation factor, ELL domain (1);	.|0.043393	.|0.85682	.|D	.|0.000000	T|T	0.62490|0.62490	0.2432|0.2432	M|M	0.90369|0.90369	3.11|3.11	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.67225|0.67225	-0.5724|-0.5724	5|10	.|0.87932	.|D	.|0	-1.8572|-1.8572	20.4549|20.4549	0.99139|0.99139	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|582	.|O00472	.|ELL2_HUMAN	S|V	100|582;332	.|ENSP00000237853:G582V;ENSP00000399704:G332V	.|ENSP00000237853:G582V	A|G	-|-	1|2	0|0	ELL2|ELL2	95252579|95252579	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.989000|0.989000	0.77384|0.77384	6.066000|6.066000	0.71185|0.71185	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCT|GGC	.	.		0.428	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
DMXL1	1657	hgsc.bcm.edu	37	5	118485268	118485268	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:118485268C>T	ENST00000311085.8	+	18	3826	c.3746C>T	c.(3745-3747)cCt>cTt	p.P1249L	DMXL1_ENST00000539542.1_Missense_Mutation_p.P1249L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1249										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AAACAAGAACCTGTTATAACA	0.423																																					p.P1249L		Atlas-SNP	.											.	DMXL1	268	.	0			c.C3746T						.						85.0	79.0	81.0					5																	118485268		2202	4300	6502	SO:0001583	missense	1657	exon18			AAGAACCTGTTAT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3746C>T	chr5.hg19:g.118485268C>T	ENSP00000309690:p.Pro1249Leu	56.0	0.0		56.0	35.0	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	hg19	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	1.114	-0.657206	0.03480	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.09350	2.99;2.99	5.39	3.61	0.41365	.	0.469142	0.25487	N	0.030325	T	0.07683	0.0193	N	0.25647	0.755	0.34149	D	0.667335	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.17592	-1.0364	10	0.27785	T	0.31	-4.4666	9.6826	0.40078	0.0:0.7593:0.0:0.2407	.	1249;1249	F5H269;Q9Y485	.;DMXL1_HUMAN	L	1249	ENSP00000309690:P1249L;ENSP00000439479:P1249L	ENSP00000309690:P1249L	P	+	2	0	DMXL1	118513167	0.001000	0.12720	0.922000	0.36590	0.995000	0.86356	1.124000	0.31320	0.773000	0.33404	0.655000	0.94253	CCT	.	.		0.423	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
PRR16	51334	hgsc.bcm.edu	37	5	120022233	120022233	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:120022233C>T	ENST00000407149.2	+	2	953	c.744C>T	c.(742-744)ggC>ggT	p.G248G	PRR16_ENST00000446965.1_Silent_p.G178G|PRR16_ENST00000505123.1_Silent_p.G178G|PRR16_ENST00000379551.2_Silent_p.G225G			Q569H4	LARGN_HUMAN	proline rich 16	248	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CTCACCAAGGCCCTCCCCTCC	0.522																																					p.G225G		Atlas-SNP	.											.	PRR16	71	.	0			c.C675T						.						91.0	85.0	87.0					5																	120022233		2203	4300	6503	SO:0001819	synonymous_variant	51334	exon3			CCAAGGCCCTCCC	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.744C>T	chr5.hg19:g.120022233C>T		100.0	0.0		118.0	28.0	NM_016644	D3DSZ0|Q8IXY1|Q9NYI5	Silent	SNP	ENST00000407149.2	hg19																																																																																				.	.		0.522	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
FSTL4	23105	hgsc.bcm.edu	37	5	132585166	132585166	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:132585166C>T	ENST00000265342.7	-	7	1079	c.830G>A	c.(829-831)aGg>aAg	p.R277K	FSTL4_ENST00000507112.1_5'UTR|CTB-49A3.5_ENST00000515122.1_RNA|CTB-49A3.5_ENST00000504312.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	277	Ig-like 1.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GATTGGTGGCCTCAGGTCTCC	0.587																																					p.R277K		Atlas-SNP	.											.	FSTL4	74	.	0			c.G830A						.						115.0	89.0	97.0					5																	132585166		2203	4300	6503	SO:0001583	missense	23105	exon7			GGTGGCCTCAGGT	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.830G>A	chr5.hg19:g.132585166C>T	ENSP00000265342:p.Arg277Lys	74.0	0.0		91.0	13.0	NM_015082	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	hg19	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	31	5.103453	0.94245	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.11821	2.74	5.51	5.51	0.81932	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.27489	0.0675	L	0.35542	1.07	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.01532	-1.1331	10	0.22706	T	0.39	-35.463	18.4076	0.90541	0.0:1.0:0.0:0.0	.	277	Q6MZW2	FSTL4_HUMAN	K	277;108	ENSP00000265342:R277K	ENSP00000265342:R277K	R	-	2	0	FSTL4	132613065	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.729000	0.68538	2.590000	0.87494	0.467000	0.42956	AGG	.	.		0.587	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
DNAJC18	202052	hgsc.bcm.edu	37	5	138764241	138764241	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:138764241G>T	ENST00000302060.5	-	3	439	c.359C>A	c.(358-360)aCa>aAa	p.T120K		NM_152686.3	NP_689899.1	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18	120	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAAGCATCTGTTGCTCCAGG	0.443																																					p.T120K		Atlas-SNP	.											.	DNAJC18	30	.	0			c.C359A						.						260.0	262.0	261.0					5																	138764241		2203	4300	6503	SO:0001583	missense	202052	exon3			GCATCTGTTGCTC	AK024054	CCDS4214.1	5q31.2	2011-09-02		2005-08-09	ENSG00000170464	ENSG00000170464		"""Heat shock proteins / DNAJ (HSP40)"""	28429	protein-coding gene	gene with protein product							Standard	NM_152686		Approved	MGC29463	uc003len.3	Q9H819	OTTHUMG00000129225	ENST00000302060.5:c.359C>A	chr5.hg19:g.138764241G>T	ENSP00000302843:p.Thr120Lys	60.0	0.0		81.0	26.0	NM_152686		Missense_Mutation	SNP	ENST00000302060.5	hg19	CCDS4214.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124859	0.94429	.	.	ENSG00000170464	ENST00000302060;ENST00000515581;ENST00000515277	T;T;T	0.72505	-0.66;-0.66;-0.66	6.04	6.04	0.98038	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.76955	0.4060	L	0.31804	0.96	0.80722	D	1	D;D	0.67145	0.996;0.993	D;P	0.70487	0.969;0.883	T	0.73219	-0.4052	10	0.32370	T	0.25	-12.0825	19.1586	0.93522	0.0:0.0:1.0:0.0	.	120;120	D6RB03;Q9H819	.;DJC18_HUMAN	K	120	ENSP00000302843:T120K;ENSP00000424572:T120K;ENSP00000425523:T120K	ENSP00000302843:T120K	T	-	2	0	DNAJC18	138792140	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.777000	0.99008	2.873000	0.98535	0.563000	0.77884	ACA	.	.		0.443	DNAJC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374191.1	NM_152686	
MYLK4	340156	hgsc.bcm.edu	37	6	2685624	2685624	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:2685624C>T	ENST00000274643.7	-	6	793	c.451G>A	c.(451-453)Gag>Aag	p.E151K	MYLK4_ENST00000268446.5_Missense_Mutation_p.E151K	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				ACGCTGATCTCGTTCTTCACC	0.552																																					p.E151K		Atlas-SNP	.											.	MYLK4	74	.	0			c.G451A						.						233.0	183.0	200.0					6																	2685624		2203	4300	6503	SO:0001583	missense	340156	exon6			TGATCTCGTTCTT		CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.451G>A	chr6.hg19:g.2685624C>T	ENSP00000274643:p.Glu151Lys	75.0	0.0		92.0	25.0	NM_001012418	A2RUC0|Q5TAW2	Missense_Mutation	SNP	ENST00000274643.7	hg19	CCDS34330.1	.	.	.	.	.	.	.	.	.	.	C	36	5.741166	0.96873	.	.	ENSG00000145949	ENST00000268446;ENST00000274643	T;T	0.73469	-0.75;-0.75	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.46442	D	0.000299	D	0.89795	0.6818	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92270	0.5824	10	0.87932	D	0	.	18.6673	0.91495	0.0:1.0:0.0:0.0	.	151	Q86YV6	MYLK4_HUMAN	K	151	ENSP00000268446:E151K;ENSP00000274643:E151K	ENSP00000268446:E151K	E	-	1	0	MYLK4	2630623	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.805000	0.86005	2.649000	0.89929	0.603000	0.83216	GAG	.	.		0.552	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418	
PRL	5617	hgsc.bcm.edu	37	6	22294684	22294684	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:22294684A>T	ENST00000306482.1	-	2	676	c.158T>A	c.(157-159)cTg>cAg	p.L53Q	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	53					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					GTAGTGGGACAGGACGACGGC	0.587																																					p.L53Q		Atlas-SNP	.											.	PRL	41	.	0			c.T158A						.						103.0	93.0	96.0					6																	22294684		2203	4300	6503	SO:0001583	missense	5617	exon2			TGGGACAGGACGA	D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.158T>A	chr6.hg19:g.22294684A>T	ENSP00000302150:p.Leu53Gln	142.0	0.0		270.0	56.0	NM_000948	Q15199|Q92996	Missense_Mutation	SNP	ENST00000306482.1	hg19	CCDS4548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.1|22.1	4.242959|4.242959	0.79912|0.79912	.|.	.|.	ENSG00000172179|ENSG00000172179	ENST00000438606|ENST00000306482	.|D	.|0.89939	.|-2.59	6.04|6.04	4.86|4.86	0.63082|0.63082	.|Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.|0.256840	.|0.40222	.|N	.|0.001143	.|D	.|0.92652	.|0.7665	M|M	0.82323|0.82323	2.585|2.585	0.54753|0.54753	D|D	0.999985|0.999985	.|B;D	.|0.89917	.|0.222;1.0	.|P;D	.|0.81914	.|0.814;0.995	.|D	.|0.92698	.|0.6172	.|10	.|0.49607	.|T	.|0.09	.|-0.0438	12.5677|12.5677	0.56318|0.56318	0.8753:0.0:0.0:0.1247|0.8753:0.0:0.0:0.1247	.|.	.|53;54	.|P01236;Q5I0G2	.|PRL_HUMAN;.	.|Q	-1|53	.|ENSP00000302150:L53Q	.|ENSP00000302150:L53Q	.|L	-|-	.|2	.|0	PRL|PRL	22402663|22402663	0.999000|0.999000	0.42202|0.42202	0.943000|0.943000	0.38184|0.38184	0.954000|0.954000	0.61252|0.61252	4.588000|4.588000	0.60999|0.60999	1.068000|1.068000	0.40764|0.40764	0.460000|0.460000	0.39030|0.39030	.|CTG	.	.		0.587	PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043327.1	NM_000948	
CDKN1A	1026	hgsc.bcm.edu	37	6	36651881	36651881	+	Start_Codon_SNP	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:36651881G>T	ENST00000405375.1	+	2	238	c.3G>T	c.(1-3)atG>atT	p.M1I	CDKN1A_ENST00000244741.5_Start_Codon_SNP_p.M1I|CDKN1A_ENST00000373711.2_Start_Codon_SNP_p.M1I|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000448526.2_Missense_Mutation_p.M35I	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	1					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CAGGCGCCATGTCAGAACCGG	0.632																																					p.M1I		Atlas-SNP	.											.	CDKN1A	27	.	0			c.G3T						.						27.0	28.0	27.0					6																	36651881		2203	4300	6503	SO:0001582	initiator_codon_variant	1026	exon2			CGCCATGTCAGAA	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.3G>T	chr6.hg19:g.36651881G>T	ENSP00000384849:p.Met1Ile	56.0	0.0		50.0	45.0	NM_001220778	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	ENST00000405375.1	hg19	CCDS4824.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516090	0.64634	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	T;T;T;T	0.81330	-1.48;-1.39;-1.39;-1.39	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000008	T	0.69958	0.3169	.	.	.	0.80722	D	1	P;P;P	0.42692	0.787;0.634;0.649	B;B;B	0.41917	0.37;0.231;0.293	T	0.73244	-0.4044	9	0.44086	T	0.13	-31.4636	13.8081	0.63246	0.0:0.0:1.0:0.0	.	35;1;1	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	I	35;1;1;1	ENSP00000409259:M35I;ENSP00000244741:M1I;ENSP00000384849:M1I;ENSP00000362815:M1I	ENSP00000244741:M1I	M	+	3	0	CDKN1A	36759859	1.000000	0.71417	0.997000	0.53966	0.151000	0.21798	3.643000	0.54374	2.642000	0.89623	0.561000	0.74099	ATG	.	.		0.632	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	Missense_Mutation
CRIP3	401262	hgsc.bcm.edu	37	6	43274043	43274043	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:43274043C>T	ENST00000274990.4	-	6	413	c.409G>A	c.(409-411)Gtg>Atg	p.V137M	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.V137M			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	137	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AATGACATCACCTTCTCAGCT	0.572																																					p.V137M		Atlas-SNP	.											.	CRIP3	30	.	0			c.G409A						.						99.0	92.0	95.0					6																	43274043		2203	4300	6503	SO:0001583	missense	401262	exon6			ACATCACCTTCTC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.409G>A	chr6.hg19:g.43274043C>T	ENSP00000274990:p.Val137Met	43.0	0.0		53.0	50.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.343643|4.343643	0.82022|0.82022	.|.	.|.	ENSG00000146215|ENSG00000146215	ENST00000416431|ENST00000372569;ENST00000451294;ENST00000274990	.|D;D;D	.|0.89050	.|-2.46;-2.46;-2.46	4.94|4.94	4.94|4.94	0.65067|0.65067	.|Zinc finger, LIM-type (5);	.|0.000000	.|0.64402	.|D	.|0.000009	D|D	0.91942|0.91942	0.7448|0.7448	M|M	0.68952|0.68952	2.095|2.095	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	D|D	0.90761|0.90761	0.4665|0.4665	5|10	.|0.34782	.|T	.|0.22	-0.8605|-0.8605	15.6476|15.6476	0.77068|0.77068	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|137;137	.|Q6Q6R5;Q6Q6R5-3	.|CRIP3_HUMAN;.	D|M	60|137;9;137	.|ENSP00000361650:V137M;ENSP00000397775:V9M;ENSP00000274990:V137M	.|ENSP00000274990:V137M	G|V	-|-	2|1	0|0	CRIP3|CRIP3	43382021|43382021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	6.947000|6.947000	0.75959|0.75959	2.283000|2.283000	0.76528|0.76528	0.561000|0.561000	0.74099|0.74099	GGT|GTG	.	.		0.572	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
CRIP3	401262	hgsc.bcm.edu	37	6	43274045	43274046	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:43274045_43274046TT>AC	ENST00000274990.4	-	6	410_411	c.406_407AA>GT	c.(406-408)AAg>GTg	p.K136V	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.K136V			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	136	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TGACATCACCTTCTCAGCTGGT	0.569																																					p.K136M|p.K136E		Atlas-SNP	.											.	CRIP3	30	.	0			c.A407T|c.A406G						.																																			SO:0001583	missense	401262	exon6			ATCACCTTCTCAG|TCACCTTCTCAGC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.406_407delinsAC	chr6.hg19:g.43274045_43274046delinsAC	ENSP00000274990:p.Lys136Val	43.0	0.0		50.0	47.0|48.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	hg19																																																																																				.	.		0.569	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
GPR115	221393	hgsc.bcm.edu	37	6	47681793	47681793	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:47681793G>A	ENST00000283303.2	+	6	1070	c.812G>A	c.(811-813)gGa>gAa	p.G271E	GPR115_ENST00000371220.1_Missense_Mutation_p.G328E|GPR115_ENST00000327753.3_Missense_Mutation_p.G271E|RN7SKP116_ENST00000516902.1_RNA	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	271					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						GATATCTTAGGAATGGTACAG	0.443																																					p.G271E	GBM(22;431 510 9010 26644 32828)	Atlas-SNP	.											.	GPR115	140	.	0			c.G812A						.						60.0	61.0	61.0					6																	47681793		2203	4300	6503	SO:0001583	missense	221393	exon6			TCTTAGGAATGGT	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.812G>A	chr6.hg19:g.47681793G>A	ENSP00000283303:p.Gly271Glu	61.0	0.0		93.0	24.0	NM_153838	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	hg19	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540544	0.27563	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.37752	1.41;1.18;1.18	5.19	4.3	0.51218	.	0.085998	0.50627	D	0.000110	T	0.47691	0.1459	M	0.81497	2.545	0.19775	N	0.999958	D	0.76494	0.999	D	0.71414	0.973	T	0.47849	-0.9085	10	0.72032	D	0.01	-6.2359	12.3905	0.55356	0.0:0.0:0.8257:0.1743	.	271	Q8IZF3	GP115_HUMAN	E	328;271;271	ENSP00000360264:G328E;ENSP00000328319:G271E;ENSP00000283303:G271E	ENSP00000283303:G271E	G	+	2	0	GPR115	47789752	0.996000	0.38824	0.205000	0.23548	0.010000	0.07245	3.133000	0.50531	1.250000	0.43966	0.655000	0.94253	GGA	.	.		0.443	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
PKHD1	5314	hgsc.bcm.edu	37	6	51824795	51824795	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:51824795T>A	ENST00000371117.3	-	36	6056	c.5781A>T	c.(5779-5781)agA>agT	p.R1927S	PKHD1_ENST00000340994.4_Missense_Mutation_p.R1927S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1927					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCTGGACCATCTCCGGCAGA	0.517											OREG0017492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1927S		Atlas-SNP	.											.	PKHD1	927	.	0			c.A5781T						.						115.0	104.0	108.0					6																	51824795		2203	4300	6503	SO:0001583	missense	5314	exon36			GGACCATCTCCGG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5781A>T	chr6.hg19:g.51824795T>A	ENSP00000360158:p.Arg1927Ser	60.0	0.0	980	122.0	13.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.018562	0.35606	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88896	-2.23;-2.44	5.54	-1.88	0.07713	.	0.169465	0.38663	N	0.001612	T	0.67961	0.2949	L	0.27053	0.805	0.27444	N	0.953639	P;D	0.53151	0.922;0.958	P;B	0.45610	0.487;0.386	T	0.69323	-0.5175	10	0.33940	T	0.23	.	7.4349	0.27150	0.0:0.4524:0.1792:0.3684	.	1927;1927	P08F94-2;P08F94	.;PKHD1_HUMAN	S	1927	ENSP00000360158:R1927S;ENSP00000341097:R1927S	ENSP00000341097:R1927S	R	-	3	2	PKHD1	51932754	0.004000	0.15560	0.992000	0.48379	0.959000	0.62525	-1.021000	0.03615	-0.351000	0.08249	0.533000	0.62120	AGA	.	.		0.517	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
HTR1B	3351	hgsc.bcm.edu	37	6	78172410	78172410	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:78172410G>A	ENST00000369947.2	-	1	1080	c.711C>T	c.(709-711)tcC>tcT	p.S237S		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	237					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TCAAAATCCGGGAGCGGGCTT	0.597																																					p.S237S		Atlas-SNP	.											.	HTR1B	55	.	0			c.C711T						.						51.0	57.0	55.0					6																	78172410		2203	4300	6503	SO:0001819	synonymous_variant	3351	exon1			AATCCGGGAGCGG	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.711C>T	chr6.hg19:g.78172410G>A		37.0	0.0		23.0	19.0	NM_000863	Q4VAY7	Silent	SNP	ENST00000369947.2	hg19	CCDS4986.1																																																																																			.	.		0.597	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
GPR63	81491	hgsc.bcm.edu	37	6	97246970	97246970	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:97246970A>G	ENST00000229955.3	-	2	983	c.638T>C	c.(637-639)tTa>tCa	p.L213S	GPR63_ENST00000417980.1_Missense_Mutation_p.L213S	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		TCCTACGGCTAAAGGAAAAGC	0.458																																					p.L213S		Atlas-SNP	.											.	GPR63	60	.	0			c.T638C						.						75.0	75.0	75.0					6																	97246970		2203	4300	6503	SO:0001583	missense	81491	exon2			ACGGCTAAAGGAA	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.638T>C	chr6.hg19:g.97246970A>G	ENSP00000229955:p.Leu213Ser	58.0	0.0		25.0	15.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	hg19	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	A	11.24	1.580195	0.28180	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.38560	1.13;1.13;1.13	5.3	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.10337	0.0253	N	0.12422	0.21	0.54753	D	0.999985	B	0.32526	0.374	B	0.28991	0.097	T	0.08889	-1.0700	10	0.22109	T	0.4	-0.8812	11.3705	0.49697	0.9282:0.0:0.0718:0.0	.	213	Q9BZJ6	GPR63_HUMAN	S	237;213;213;213	ENSP00000393170:L213S;ENSP00000229955:L213S;ENSP00000358273:L213S	ENSP00000229955:L213S	L	-	2	0	GPR63	97353691	1.000000	0.71417	0.840000	0.33206	0.724000	0.41520	8.910000	0.92685	0.957000	0.37930	0.528000	0.53228	TTA	.	.		0.458	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
RADIL	55698	hgsc.bcm.edu	37	7	4874647	4874647	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:4874647G>A	ENST00000399583.3	-	4	1194	c.1007C>T	c.(1006-1008)aCc>aTc	p.T336I	RADIL_ENST00000538469.1_Missense_Mutation_p.T96I|RADIL_ENST00000536091.1_Missense_Mutation_p.T336I	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	336	FHA.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CAGCACCACGGTCCTGTGCCC	0.716																																					p.T336I		Atlas-SNP	.											.	RADIL	110	.	0			c.C1007T						.						13.0	17.0	16.0					7																	4874647		1949	4134	6083	SO:0001583	missense	55698	exon4			ACCACGGTCCTGT	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.1007C>T	chr7.hg19:g.4874647G>A	ENSP00000382492:p.Thr336Ile	41.0	0.0		35.0	20.0	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	hg19	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	-	12.21	1.870496	0.33069	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000544486;ENST00000536091;ENST00000538469	T;T;T	0.06371	3.31;3.31;3.31	4.45	4.45	0.53987	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.452476	0.23889	N	0.043575	T	0.08358	0.0208	L	0.47716	1.5	0.09310	N	1	B	0.16396	0.017	B	0.15870	0.014	T	0.15321	-1.0441	10	0.66056	D	0.02	-2.6864	14.2662	0.66121	0.0:0.0:1.0:0.0	.	336	Q96JH8	RADIL_HUMAN	I	336;307;70;336;96	ENSP00000382492:T336I;ENSP00000442533:T336I;ENSP00000442966:T96I	ENSP00000320946:T307I	T	-	2	0	RADIL	4841173	0.988000	0.35896	0.003000	0.11579	0.811000	0.45836	5.874000	0.69652	2.046000	0.60703	0.651000	0.88453	ACC	.	.		0.716	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
FIGNL1	63979	hgsc.bcm.edu	37	7	50514900	50514900	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:50514900G>A	ENST00000419119.1	-	2	1639	c.86C>T	c.(85-87)cCg>cTg	p.P29L	FIGNL1_ENST00000356889.4_Missense_Mutation_p.P29L|FIGNL1_ENST00000395556.2_Missense_Mutation_p.P29L|FIGNL1_ENST00000433017.1_Missense_Mutation_p.P29L|FIGNL1_ENST00000435566.1_Missense_Mutation_p.P29L			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	29					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				ATCTGCCTTCGGTCCGGTACA	0.438																																					p.P29L		Atlas-SNP	.											.	FIGNL1	73	.	0			c.C86T						.						66.0	56.0	59.0					7																	50514900		2203	4300	6503	SO:0001583	missense	63979	exon4			GCCTTCGGTCCGG	AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.86C>T	chr7.hg19:g.50514900G>A	ENSP00000410811:p.Pro29Leu	82.0	0.0		70.0	20.0	NM_001042762	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	hg19	CCDS5510.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764053	0.49574	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119;ENST00000435566;ENST00000436590;ENST00000422854;ENST00000440350;ENST00000420829;ENST00000448788	T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04	5.21	1.32	0.21799	.	0.129212	0.53938	D	0.000056	T	0.09905	0.0243	N	0.08118	0	0.24380	N	0.994792	B	0.09022	0.002	B	0.01281	0.0	T	0.22977	-1.0201	10	0.72032	D	0.01	-0.8423	8.2317	0.31601	0.0:0.1318:0.1152:0.753	.	29	Q6PIW4	FIGL1_HUMAN	L	29	ENSP00000349356:P29L;ENSP00000378924:P29L;ENSP00000399997:P29L;ENSP00000410811:P29L;ENSP00000394070:P29L;ENSP00000403012:P29L;ENSP00000388471:P29L	ENSP00000349356:P29L	P	-	2	0	FIGNL1	50482394	1.000000	0.71417	0.417000	0.26559	0.236000	0.25371	3.222000	0.51223	0.070000	0.16634	-2.631000	0.00153	CCG	.	.		0.438	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762	
SEMA3A	10371	hgsc.bcm.edu	37	7	83590805	83590805	+	Missense_Mutation	SNP	C	C	A	rs318240753		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:83590805C>A	ENST00000265362.4	-	17	2512	c.2198G>T	c.(2197-2199)cGt>cTt	p.R733L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.R733L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	733	Arg/Lys-rich (basic).		R -> H (in HH16; phenotype consistent with Kallmann syndrome; dbSNP:rs318240753). {ECO:0000269|PubMed:22927827}.		apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CCTTTGCCGACGTTGTTTTCG	0.458																																					p.R733L		Atlas-SNP	.											.	SEMA3A	121	.	0			c.G2198T						.						222.0	197.0	206.0					7																	83590805		2203	4300	6503	SO:0001583	missense	10371	exon17			TGCCGACGTTGTT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.2198G>T	chr7.hg19:g.83590805C>A	ENSP00000265362:p.Arg733Leu	234.0	0.0		182.0	76.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.537539	0.45176	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.28255	1.62;1.62	6.08	6.08	0.98989	.	0.048367	0.85682	D	0.000000	T	0.23649	0.0572	N	0.13235	0.315	0.58432	D	0.999996	B	0.30563	0.285	B	0.28385	0.089	T	0.03739	-1.1008	10	0.44086	T	0.13	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	733	Q14563	SEM3A_HUMAN	L	733	ENSP00000265362:R733L;ENSP00000415260:R733L	ENSP00000265362:R733L	R	-	2	0	SEMA3A	83428741	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	4.589000	0.61006	2.894000	0.99253	0.655000	0.94253	CGT	.	.		0.458	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
OR2AE1	81392	hgsc.bcm.edu	37	7	99474046	99474046	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:99474046A>G	ENST00000316368.2	-	1	634	c.611T>C	c.(610-612)aTt>aCt	p.I204T		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GAGGAGGAGAATGCTGCTGAT	0.473																																					p.I204T		Atlas-SNP	.											.	OR2AE1	32	.	0			c.T611C						.						142.0	117.0	126.0					7																	99474046		2203	4300	6503	SO:0001583	missense	81392	exon1			AGGAGAATGCTGC	AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.611T>C	chr7.hg19:g.99474046A>G	ENSP00000313936:p.Ile204Thr	59.0	0.0		51.0	16.0	NM_001005276	B2RPD2	Missense_Mutation	SNP	ENST00000316368.2	hg19	CCDS34696.1	.	.	.	.	.	.	.	.	.	.	A	1.190	-0.635584	0.03584	.	.	ENSG00000244623	ENST00000316368	T	0.00107	8.72	3.62	2.45	0.29901	GPCR, rhodopsin-like superfamily (1);	0.838313	0.09926	N	0.737781	T	0.00144	0.0004	L	0.42744	1.35	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.38023	-0.9680	10	0.72032	D	0.01	.	4.0514	0.09796	0.6773:0.2099:0.1128:0.0	.	204	Q8NHA4	O2AE1_HUMAN	T	204	ENSP00000313936:I204T	ENSP00000313936:I204T	I	-	2	0	OR2AE1	99311982	0.002000	0.14202	0.001000	0.08648	0.012000	0.07955	2.012000	0.40932	0.739000	0.32628	0.405000	0.27470	ATT	.	.		0.473	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345053.1		
INSIG1	3638	hgsc.bcm.edu	37	7	155094019	155094019	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:155094019G>A	ENST00000340368.4	+	4	807	c.596G>A	c.(595-597)gGc>gAc	p.G199D	INSIG1_ENST00000344756.4_Missense_Mutation_p.G47D|INSIG1_ENST00000342407.5_Intron	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	199					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTATCTTTGGGCCTTTGGTGG	0.433																																					p.G199D		Atlas-SNP	.											.	INSIG1	20	.	0			c.G596A						.						109.0	103.0	105.0					7																	155094019		2203	4300	6503	SO:0001583	missense	3638	exon4			CTTTGGGCCTTTG		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.596G>A	chr7.hg19:g.155094019G>A	ENSP00000344741:p.Gly199Asp	246.0	0.0		209.0	41.0	NM_005542	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	hg19	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921890	0.92319	.	.	ENSG00000186480	ENST00000340368;ENST00000344756	T;T	0.50001	0.76;0.81	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.982;1.0	T	0.66697	-0.5858	10	0.35671	T	0.21	.	19.8944	0.96949	0.0:0.0:1.0:0.0	.	47;199	F5H6P3;O15503	.;INSI1_HUMAN	D	199;47	ENSP00000344741:G199D;ENSP00000340010:G47D	ENSP00000344741:G199D	G	+	2	0	INSIG1	154724954	1.000000	0.71417	0.958000	0.39756	0.644000	0.38419	9.113000	0.94321	2.695000	0.91970	0.650000	0.86243	GGC	.	.		0.433	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
ZBTB6	10773	hgsc.bcm.edu	37	9	125674263	125674263	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:125674263T>C	ENST00000373659.3	-	2	177	c.89A>G	c.(88-90)aAt>aGt	p.N30S		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	30					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						ACAAAATAAATTCTGCTGTCT	0.388																																					p.N30S		Atlas-SNP	.											.	ZBTB6	32	.	0			c.A89G						.						104.0	113.0	110.0					9																	125674263		2203	4300	6503	SO:0001583	missense	10773	exon2			AATAAATTCTGCT	X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.89A>G	chr9.hg19:g.125674263T>C	ENSP00000362763:p.Asn30Ser	112.0	0.0		65.0	56.0	NM_006626	A8K8N6	Missense_Mutation	SNP	ENST00000373659.3	hg19	CCDS6846.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.186360	0.57909	.	.	ENSG00000186130	ENST00000373659	T	0.70399	-0.48	6.17	6.17	0.99709	BTB/POZ (1);BTB/POZ fold (2);	0.141133	0.64402	D	0.000006	T	0.75554	0.3865	L	0.33710	1.025	0.36865	D	0.888606	D	0.53151	0.958	P	0.60012	0.867	T	0.80625	-0.1299	10	0.62326	D	0.03	.	16.0034	0.80327	0.0:0.0:0.0:1.0	.	30	Q15916	ZBTB6_HUMAN	S	30	ENSP00000362763:N30S	ENSP00000362763:N30S	N	-	2	0	ZBTB6	124714084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.824000	0.55723	2.371000	0.80710	0.533000	0.62120	AAT	.	.		0.388	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053962.1	NM_006626	
CDK9	1025	hgsc.bcm.edu	37	9	130550943	130550943	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:130550943G>T	ENST00000373264.4	+	6	825	c.725G>T	c.(724-726)aGt>aTt	p.S242I	MIR3960_ENST00000583311.1_RNA|CDK9_ENST00000373265.2_Missense_Mutation_p.S359I	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			lung(1)	1						GCCCTCATCAGTCAGCTCTGC	0.652																																					p.S242I		Atlas-SNP	.											.	CDK9	22	.	0			c.G725T						.						60.0	54.0	56.0					9																	130550943		2203	4300	6503	SO:0001583	missense	1025	exon6			TCATCAGTCAGCT	L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.725G>T	chr9.hg19:g.130550943G>T	ENSP00000362361:p.Ser242Ile	144.0	1.0		59.0	44.0	NM_001261	Q5JU24|Q5JU25|Q5U006|Q96TF1	Missense_Mutation	SNP	ENST00000373264.4	hg19	CCDS6879.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.877895	0.72294	.	.	ENSG00000136807	ENST00000373265;ENST00000373264	T;T	0.40225	1.04;1.04	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40423	0.1116	N	0.04508	-0.205	0.80722	D	1	D	0.56521	0.976	D	0.65323	0.934	T	0.44711	-0.9310	10	0.22109	T	0.4	-13.7553	17.5564	0.87890	0.0:0.0:1.0:0.0	.	242	P50750	CDK9_HUMAN	I	359;242	ENSP00000362362:S359I;ENSP00000362361:S242I	ENSP00000362361:S242I	S	+	2	0	CDK9	129590764	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.571000	0.98176	2.385000	0.81259	0.491000	0.48974	AGT	.	.		0.652	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054235.1		
TACR2	6865	hgsc.bcm.edu	37	10	71175879	71175879	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:71175879G>A	ENST00000373306.4	-	1	744	c.201C>T	c.(199-201)gtC>gtT	p.V67V		NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	67					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						AGTAGTTGGTGACTGTGCGCA	0.577																																					p.V67V		Atlas-SNP	.											.	TACR2	37	.	0			c.C201T						.						140.0	103.0	115.0					10																	71175879		2203	4300	6503	SO:0001819	synonymous_variant	6865	exon1			GTTGGTGACTGTG		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.201C>T	chr10.hg19:g.71175879G>A		50.0	0.0		82.0	27.0	NM_001057	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Silent	SNP	ENST00000373306.4	hg19	CCDS7293.1																																																																																			.	.		0.577	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1		
CPN1	1369	hgsc.bcm.edu	37	10	101802222	101802222	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:101802222C>T	ENST00000370418.3	-	9	1590	c.1339G>A	c.(1339-1341)Gaa>Aaa	p.E447K		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	447					response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		ATCTCCATTTCTTTCTTTCTG	0.552																																					p.E447K		Atlas-SNP	.											.	CPN1	62	.	0			c.G1339A						.						97.0	86.0	90.0					10																	101802222		2203	4300	6503	SO:0001583	missense	1369	exon9			CCATTTCTTTCTT	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.1339G>A	chr10.hg19:g.101802222C>T	ENSP00000359446:p.Glu447Lys	80.0	0.0		83.0	35.0	NM_001308	B1AP59	Missense_Mutation	SNP	ENST00000370418.3	hg19	CCDS7486.1	.	.	.	.	.	.	.	.	.	.	C	7.828	0.719197	0.15372	.	.	ENSG00000120054	ENST00000370418	T	0.16457	2.34	4.02	1.14	0.20703	.	.	.	.	.	T	0.06142	0.0159	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.14578	0.011	T	0.42310	-0.9459	9	0.07990	T	0.79	-13.8138	3.3415	0.07120	0.2046:0.5783:0.0:0.2171	.	447	P15169	CBPN_HUMAN	K	447	ENSP00000359446:E447K	ENSP00000359446:E447K	E	-	1	0	CPN1	101792212	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.022000	0.12480	0.252000	0.21531	-0.145000	0.13849	GAA	.	.		0.552	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135099037	135099037	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:135099037C>A	ENST00000252936.3	-	11	1857	c.1818G>T	c.(1816-1818)acG>acT	p.T606T	TUBGCP2_ENST00000368563.2_Silent_p.T606T|TUBGCP2_ENST00000543663.1_Silent_p.T634T|TUBGCP2_ENST00000368562.1_Silent_p.T199T|TUBGCP2_ENST00000417178.2_Silent_p.T476T			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	606					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCGCCAGCTCCGTGGGGTCGG	0.632																																					p.T634T		Atlas-SNP	.											.	TUBGCP2	79	.	0			c.G1902T						.						39.0	41.0	40.0					10																	135099037		2203	4300	6503	SO:0001819	synonymous_variant	10844	exon13			CAGCTCCGTGGGG	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1818G>T	chr10.hg19:g.135099037C>A		49.0	0.0		39.0	16.0	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	ENST00000252936.3	hg19	CCDS7676.1																																																																																			.	.		0.632	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
MUC6	4588	hgsc.bcm.edu	37	11	1026952	1026952	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:1026952C>T	ENST00000421673.2	-	19	2433	c.2383G>A	c.(2383-2385)Ggt>Agt	p.G795S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	795					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGGCAACACCGGTGGCCAGC	0.657																																					p.G795S		Atlas-SNP	.											.	MUC6	408	.	0			c.G2383A						.						15.0	17.0	16.0					11																	1026952		1986	4142	6128	SO:0001583	missense	4588	exon19			CAACACCGGTGGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2383G>A	chr11.hg19:g.1026952C>T	ENSP00000406861:p.Gly795Ser	60.0	0.0		84.0	30.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	17.51	3.407709	0.62399	.	.	ENSG00000184956	ENST00000421673	D	0.90069	-2.61	4.66	4.66	0.58398	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.92737	0.7691	L	0.49350	1.555	0.35727	D	0.817651	D	0.89917	1.0	D	0.97110	1.0	D	0.94712	0.7893	9	0.49607	T	0.09	.	17.9246	0.88979	0.0:1.0:0.0:0.0	.	795	Q6W4X9	MUC6_HUMAN	S	795	ENSP00000406861:G795S	ENSP00000406861:G795S	G	-	1	0	MUC6	1016952	0.979000	0.34478	0.235000	0.24058	0.030000	0.12068	2.897000	0.48664	2.302000	0.77476	0.556000	0.70494	GGT	.	.		0.657	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CHRM4	1132	hgsc.bcm.edu	37	11	46406927	46406927	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:46406927C>T	ENST00000433765.2	-	1	1180	c.1181G>A	c.(1180-1182)cGg>cAg	p.R394Q		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	394					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TTTGCGCTCCCGGGCCGCCAT	0.637																																					p.R394Q	Esophageal Squamous(171;1020 1936 4566 30205 42542)	Atlas-SNP	.											.	CHRM4	47	.	0			c.G1181A						.						73.0	78.0	76.0					11																	46406927		2187	4290	6477	SO:0001583	missense	1132	exon1			CGCTCCCGGGCCG	M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.1181G>A	chr11.hg19:g.46406927C>T	ENSP00000409378:p.Arg394Gln	73.0	0.0		89.0	23.0	NM_000741	B2RPP4|Q0VD60|Q4VBK7	Missense_Mutation	SNP	ENST00000433765.2	hg19	CCDS44581.1	.	.	.	.	.	.	.	.	.	.	c	24.6	4.552364	0.86127	.	.	ENSG00000180720	ENST00000433765	T	0.72505	-0.66	4.58	4.58	0.56647	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.83394	0.5245	M	0.77820	2.39	0.58432	D	0.999993	D	0.69078	0.997	D	0.64877	0.93	D	0.86282	0.1668	9	0.87932	D	0	-12.9181	17.5685	0.87927	0.0:1.0:0.0:0.0	.	394	P08173	ACM4_HUMAN	Q	394	ENSP00000409378:R394Q	ENSP00000409378:R394Q	R	-	2	0	CHRM4	46363503	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.640000	0.83355	2.395000	0.81488	0.457000	0.33378	CGG	.	.		0.637	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334985.1	NM_000741	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57080609	57080609	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:57080609G>A	ENST00000532437.1	-	4	1864	c.1553C>T	c.(1552-1554)tCc>tTc	p.S518F	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.S518F|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	518	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TTCCCTGCTGGAAACGGCCAA	0.652																																					p.S518F		Atlas-SNP	.											.	TNKS1BP1	148	.	0			c.C1553T						.						34.0	31.0	32.0					11																	57080609		2174	4245	6419	SO:0001583	missense	85456	exon5			CTGCTGGAAACGG	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1553C>T	chr11.hg19:g.57080609G>A	ENSP00000437271:p.Ser518Phe	28.0	0.0		85.0	21.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	hg19	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591782	0.46214	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.37058	1.22;1.22	2.93	2.93	0.34026	.	0.557718	0.13538	N	0.380456	T	0.39886	0.1095	L	0.27053	0.805	0.09310	N	1	D	0.61697	0.99	P	0.60345	0.873	T	0.10567	-1.0624	10	0.54805	T	0.06	.	9.558	0.39351	0.0:0.0:1.0:0.0	.	518	Q9C0C2	TB182_HUMAN	F	518	ENSP00000350990:S518F;ENSP00000437271:S518F	ENSP00000350990:S518F	S	-	2	0	TNKS1BP1	56837185	0.039000	0.19947	0.017000	0.16124	0.072000	0.16883	1.973000	0.40550	1.964000	0.57103	0.462000	0.41574	TCC	.	.		0.652	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
CNIH2	254263	hgsc.bcm.edu	37	11	66050758	66050758	+	Nonsense_Mutation	SNP	T	T	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:66050758T>G	ENST00000311445.6	+	5	609	c.351T>G	c.(349-351)taT>taG	p.Y117*	CNIH2_ENST00000528852.1_Nonsense_Mutation_p.Y117*|CNIH2_ENST00000530519.1_3'UTR|YIF1A_ENST00000526497.1_5'Flank	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	117					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						AGGTCATGTATGATGCGGTCT	0.547											OREG0021100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y117X		Atlas-SNP	.											.	CNIH2	15	.	0			c.T351G						.						223.0	207.0	213.0					11																	66050758		2200	4295	6495	SO:0001587	stop_gained	254263	exon5			CATGTATGATGCG	BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.351T>G	chr11.hg19:g.66050758T>G	ENSP00000310003:p.Tyr117*	62.0	0.0	1088	33.0	19.0	NM_182553		Nonsense_Mutation	SNP	ENST00000311445.6	hg19	CCDS8131.1	.	.	.	.	.	.	.	.	.	.	T	35	5.492071	0.96339	.	.	ENSG00000174871	ENST00000528852;ENST00000311445	.	.	.	5.63	3.04	0.35103	.	0.307408	0.36482	N	0.002566	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5909	6.963	0.24608	0.0:0.2879:0.0:0.7121	.	.	.	.	X	117	.	ENSP00000310003:Y117X	Y	+	3	2	CNIH2	65807334	0.978000	0.34361	1.000000	0.80357	0.990000	0.78478	0.151000	0.16283	1.075000	0.40932	-0.256000	0.11100	TAT	.	.		0.547	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391892.1	NM_182553	
CASP4	837	hgsc.bcm.edu	37	11	104820474	104820474	+	Missense_Mutation	SNP	T	T	C	rs559503139		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:104820474T>C	ENST00000444739.2	-	5	1487	c.577A>G	c.(577-579)Acc>Gcc	p.T193A	CASP4_ENST00000531333.1_5'UTR|CASP4_ENST00000393150.3_Missense_Mutation_p.T137A	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	193					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TCTGGTCTGGTAGCAAATGCC	0.463													.|||	1	0.000199681	0.0008	0.0	5008	,	,		20995	0.0		0.0	False		,,,				2504	0.0				p.T193A		Atlas-SNP	.											.	CASP4	57	.	0			c.A577G						.						139.0	123.0	128.0					11																	104820474		2202	4299	6501	SO:0001583	missense	837	exon5			GTCTGGTAGCAAA	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.577A>G	chr11.hg19:g.104820474T>C	ENSP00000388566:p.Thr193Ala	101.0	0.0		50.0	10.0	NM_001225	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	hg19	CCDS8327.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.352862	0.00217	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546	T;T	0.18810	2.19;2.19	4.57	1.56	0.23342	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.561699	0.19933	N	0.102811	T	0.01976	0.0062	N	0.00014	-2.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.45963	-0.9225	10	0.02654	T	1	.	4.8181	0.13376	0.1489:0.6143:0.1457:0.0911	.	193;193	B4E2D2;P49662	.;CASP4_HUMAN	A	193;137;146	ENSP00000388566:T193A;ENSP00000376857:T137A	ENSP00000347741:T146A	T	-	1	0	CASP4	104325684	0.006000	0.16342	0.524000	0.27887	0.002000	0.02628	0.797000	0.26999	1.135000	0.42183	-0.147000	0.13772	ACC	.	.		0.463	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
KBTBD3	143879	hgsc.bcm.edu	37	11	105925003	105925003	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:105925003G>C	ENST00000526793.1	-	3	572	c.413C>G	c.(412-414)tCc>tGc	p.S138C	KBTBD3_ENST00000534815.1_Missense_Mutation_p.S59C|KBTBD3_ENST00000531837.1_Missense_Mutation_p.S138C	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	134										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		GCAAGCTTTGGATAGGAAGGA	0.318																																					p.S138C		Atlas-SNP	.											.	KBTBD3	59	.	0			c.C413G						.						66.0	70.0	68.0					11																	105925003		2200	4298	6498	SO:0001583	missense	143879	exon3			GCTTTGGATAGGA	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.413C>G	chr11.hg19:g.105925003G>C	ENSP00000436262:p.Ser138Cys	138.0	0.0		72.0	26.0	NM_152433	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	hg19	CCDS8334.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785454	0.49997	.	.	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	T;T;T	0.70869	-0.52;-0.52;-0.52	5.36	5.36	0.76844	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.163800	0.56097	D	0.000028	T	0.67869	0.2939	N	0.13098	0.295	0.38045	D	0.935583	B;P	0.42456	0.347;0.78	P;P	0.49999	0.505;0.628	T	0.75263	-0.3379	10	0.72032	D	0.01	.	19.0932	0.93238	0.0:0.0:1.0:0.0	.	138;134	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	C	59;138;138	ENSP00000431910:S59C;ENSP00000436262:S138C;ENSP00000432163:S138C	ENSP00000436262:S138C	S	-	2	0	KBTBD3	105430213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.923000	0.56469	2.511000	0.84671	0.650000	0.86243	TCC	.	.		0.318	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
OR8B8	26493	hgsc.bcm.edu	37	11	124310110	124310110	+	Missense_Mutation	SNP	C	C	T	rs147220624	byFrequency	TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:124310110C>T	ENST00000328064.2	-	1	944	c.872G>A	c.(871-873)aGc>aAc	p.S291N		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	291					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ATTCCTCAGGCTATAAATTAA	0.408																																					p.S291N		Atlas-SNP	.											.	OR8B8	76	.	0			c.G872A						.						107.0	98.0	101.0					11																	124310110		2201	4299	6500	SO:0001583	missense	26493	exon1			CTCAGGCTATAAA	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.872G>A	chr11.hg19:g.124310110C>T	ENSP00000330280:p.Ser291Asn	66.0	0.0		35.0	16.0	NM_012378	A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	hg19	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379611	0.42207	.	.	ENSG00000197125	ENST00000328064	T	0.39056	1.1	3.81	3.81	0.43845	.	0.000000	0.56097	D	0.000036	T	0.76870	0.4048	H	0.98559	4.265	0.25578	N	0.98683	D	0.71674	0.998	D	0.66847	0.947	T	0.75889	-0.3158	10	0.87932	D	0	.	16.615	0.84904	0.0:1.0:0.0:0.0	.	291	Q15620	OR8B8_HUMAN	N	291	ENSP00000330280:S291N	ENSP00000330280:S291N	S	-	2	0	OR8B8	123815320	0.017000	0.18338	0.749000	0.31150	0.468000	0.32798	1.191000	0.32138	2.412000	0.81896	0.655000	0.94253	AGC	.	C|0.999;A|0.001		0.408	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
OR8B8	26493	hgsc.bcm.edu	37	11	124310343	124310343	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:124310343G>T	ENST00000328064.2	-	1	711	c.639C>A	c.(637-639)acC>acA	p.T213T		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	213					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AAATGAAGATGGTGACTGTGG	0.488																																					p.T213T		Atlas-SNP	.											.	OR8B8	76	.	0			c.C639A						.						187.0	159.0	169.0					11																	124310343		2201	4299	6500	SO:0001819	synonymous_variant	26493	exon1			GAAGATGGTGACT	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.639C>A	chr11.hg19:g.124310343G>T		86.0	0.0		40.0	18.0	NM_012378	A1L446|Q96RC8	Silent	SNP	ENST00000328064.2	hg19	CCDS8446.1																																																																																			.	.		0.488	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
NRIP2	83714	hgsc.bcm.edu	37	12	2944113	2944113	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:2944113G>A	ENST00000337508.4	-	1	77	c.37C>T	c.(37-39)Ccc>Tcc	p.P13S		NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	13					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CAACAGGAGGGTCTCCACGGG	0.587																																					p.P13S		Atlas-SNP	.											.	NRIP2	21	.	0			c.C37T						.						48.0	44.0	45.0					12																	2944113		2203	4300	6503	SO:0001583	missense	83714	exon1			AGGAGGGTCTCCA	AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.37C>T	chr12.hg19:g.2944113G>A	ENSP00000337501:p.Pro13Ser	88.0	0.0		64.0	14.0	NM_031474	A2RRE3|B4DV61	Missense_Mutation	SNP	ENST00000337508.4	hg19	CCDS8514.1	.	.	.	.	.	.	.	.	.	.	G	9.806	1.181895	0.21787	.	.	ENSG00000053702	ENST00000337508;ENST00000546074	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	T	0.49695	0.1572	L	0.43152	1.355	0.26649	N	0.972146	D	0.64830	0.994	P	0.56127	0.792	T	0.40979	-0.9534	8	0.87932	D	0	-12.3098	12.2247	0.54453	0.0:0.0:1.0:0.0	.	13	Q9BQI9	NRIP2_HUMAN	S	13	.	ENSP00000337501:P13S	P	-	1	0	NRIP2	2814374	0.998000	0.40836	0.942000	0.38095	0.031000	0.12232	1.929000	0.40114	2.259000	0.74868	0.484000	0.47621	CCC	.	.		0.587	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253090.4	NM_031474	
DNAH10	196385	hgsc.bcm.edu	37	12	124257438	124257438	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:124257438C>T	ENST00000409039.3	+	4	296	c.271C>T	c.(271-273)Ccc>Tcc	p.P91S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	91	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TACCCCTCTTCCCGAGGAGTT	0.463																																					p.P91S		Atlas-SNP	.											.	DNAH10	888	.	0			c.C271T						.						174.0	169.0	170.0					12																	124257438		1943	4158	6101	SO:0001583	missense	196385	exon4			CCTCTTCCCGAGG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.271C>T	chr12.hg19:g.124257438C>T	ENSP00000386770:p.Pro91Ser	53.0	0.0		59.0	32.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905933	0.33628	.	.	ENSG00000197653	ENST00000409039	T	0.23552	1.9	5.93	4.09	0.47781	.	.	.	.	.	T	0.16727	0.0402	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.25082	-1.0142	9	0.26408	T	0.33	.	8.4702	0.32980	0.0:0.7595:0.0:0.2405	.	91	Q8IVF4	DYH10_HUMAN	S	91	ENSP00000386770:P91S	ENSP00000386770:P91S	P	+	1	0	DNAH10	122823391	0.198000	0.23374	0.042000	0.18584	0.003000	0.03518	1.018000	0.30002	0.820000	0.34516	0.655000	0.94253	CCC	.	.		0.463	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH10	196385	hgsc.bcm.edu	37	12	124257449	124257449	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:124257449C>T	ENST00000409039.3	+	4	307	c.282C>T	c.(280-282)ttC>ttT	p.F94F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	94	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCGAGGAGTTCCTGGACCAAA	0.468																																					p.F94F		Atlas-SNP	.											.	DNAH10	888	.	0			c.C282T						.						165.0	162.0	163.0					12																	124257449		1950	4163	6113	SO:0001819	synonymous_variant	196385	exon4			GGAGTTCCTGGAC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.282C>T	chr12.hg19:g.124257449C>T		58.0	0.0		58.0	33.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	hg19	CCDS9255.2																																																																																			.	.		0.468	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
FREM2	341640	hgsc.bcm.edu	37	13	39265055	39265055	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:39265055G>T	ENST00000280481.7	+	1	3790	c.3574G>T	c.(3574-3576)Gag>Tag	p.E1192*		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1192					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGAACAGCCAGAGATGTTTAT	0.418																																					p.E1192X		Atlas-SNP	.											.	FREM2	385	.	0			c.G3574T						.						229.0	219.0	222.0					13																	39265055		2203	4300	6503	SO:0001587	stop_gained	341640	exon1			CAGCCAGAGATGT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3574G>T	chr13.hg19:g.39265055G>T	ENSP00000280481:p.Glu1192*	136.0	0.0		55.0	44.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Nonsense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	44	11.144798	0.99522	.	.	ENSG00000150893	ENST00000280481	.	.	.	6.07	6.07	0.98685	.	0.199491	0.52532	D	0.000079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	1192	.	ENSP00000280481:E1192X	E	+	1	0	FREM2	38163055	1.000000	0.71417	0.997000	0.53966	0.788000	0.44548	9.864000	0.99589	2.890000	0.99128	0.650000	0.86243	GAG	.	.		0.418	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
COL4A2	1284	hgsc.bcm.edu	37	13	111082761	111082761	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:111082761A>G	ENST00000360467.5	+	9	869	c.563A>G	c.(562-564)gAg>gGg	p.E188G	COL4A2_ENST00000462309.1_3'UTR	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	188	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GAACCTGGAGAGCCTGGATTG	0.358																																					p.E188G		Atlas-SNP	.											.	COL4A2	178	.	0			c.A563G						.						86.0	85.0	85.0					13																	111082761		1807	4070	5877	SO:0001583	missense	1284	exon9			CTGGAGAGCCTGG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.563A>G	chr13.hg19:g.111082761A>G	ENSP00000353654:p.Glu188Gly	114.0	0.0		76.0	27.0	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	hg19	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	A	9.789	1.177348	0.21787	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93906	-3.31	5.19	5.19	0.71726	.	0.504141	0.17796	N	0.161738	D	0.94039	0.8090	M	0.76838	2.35	0.38545	D	0.949315	P	0.41784	0.762	P	0.48063	0.565	D	0.92822	0.6273	10	0.16896	T	0.51	.	13.6015	0.62022	1.0:0.0:0.0:0.0	.	188	P08572	CO4A2_HUMAN	G	188	ENSP00000353654:E188G	ENSP00000257309:E188G	E	+	2	0	COL4A2	109880762	0.899000	0.30636	0.967000	0.41034	0.394000	0.30568	2.243000	0.43115	1.943000	0.56356	0.528000	0.53228	GAG	.	.		0.358	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
NFATC4	4776	hgsc.bcm.edu	37	14	24844908	24844908	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:24844908T>A	ENST00000250373.4	+	7	2057	c.1916T>A	c.(1915-1917)cTg>cAg	p.L639Q	NFATC4_ENST00000557767.1_5'UTR|NFATC4_ENST00000555393.1_5'UTR|NFATC4_ENST00000555590.1_Missense_Mutation_p.L652Q|NFATC4_ENST00000555453.1_Missense_Mutation_p.L627Q|NFATC4_ENST00000554050.1_Missense_Mutation_p.L639Q|NFATC4_ENST00000554661.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000553469.1_Missense_Mutation_p.L671Q|NFATC4_ENST00000422617.3_Missense_Mutation_p.L627Q|NFATC4_ENST00000555802.1_5'UTR|NFATC4_ENST00000554591.1_Missense_Mutation_p.L702Q|NFATC4_ENST00000557451.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000553708.1_Missense_Mutation_p.L639Q|NFATC4_ENST00000556169.1_Missense_Mutation_p.L627Q|NFATC4_ENST00000554344.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000554966.1_Missense_Mutation_p.L652Q|NFATC4_ENST00000554473.1_Missense_Mutation_p.L174Q|NFATC4_ENST00000553879.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000556279.1_Missense_Mutation_p.L671Q|NFATC4_ENST00000556759.1_Missense_Mutation_p.L174Q|NFATC4_ENST00000539237.2_Missense_Mutation_p.L671Q|NFATC4_ENST00000555167.1_Missense_Mutation_p.L174Q|NFATC4_ENST00000424781.2_Missense_Mutation_p.L652Q|NFATC4_ENST00000413692.2_Missense_Mutation_p.L702Q	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	639	IPT/TIG.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		GTGAACCGACTGCAGAGCAAC	0.627																																					p.L702Q		Atlas-SNP	.											.	NFATC4	115	.	0			c.T2105A						.						56.0	39.0	45.0					14																	24844908		2195	4288	6483	SO:0001583	missense	4776	exon8			ACCGACTGCAGAG	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1916T>A	chr14.hg19:g.24844908T>A	ENSP00000250373:p.Leu639Gln	96.0	0.0		53.0	17.0	NM_001198967	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	hg19	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	T	19.31	3.803041	0.70682	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000555167	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.29655	3.29;3.31;3.31;3.32;3.3;3.3;3.31;3.32;3.33;3.31;3.31;2.99;2.99;3.0;3.0;2.98;2.98;2.98;1.6;1.56;1.56	5.41	5.41	0.78517	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.290828	0.28730	N	0.014323	T	0.33265	0.0857	N	0.14661	0.345	0.80722	D	1	P;D;P;D;P;P;D;D;D;D;P;P;P	0.63880	0.936;0.981;0.935;0.993;0.935;0.935;0.981;0.993;0.993;0.981;0.935;0.935;0.947	P;P;P;P;P;P;P;P;P;P;P;P;P	0.59889	0.556;0.813;0.775;0.865;0.713;0.837;0.813;0.865;0.865;0.813;0.837;0.775;0.856	T	0.11616	-1.0580	10	0.40728	T	0.16	-1.8492	13.4467	0.61144	0.0:0.0:0.0:1.0	.	627;627;671;671;652;652;652;702;702;627;671;702;639	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	Q	702;702;652;652;652;671;671;671;639;639;639;569;569;569;627;569;627;627;174;174;174	ENSP00000388910:L702Q;ENSP00000452039:L702Q;ENSP00000451224:L652Q;ENSP00000450644:L652Q;ENSP00000388668:L652Q;ENSP00000439350:L671Q;ENSP00000452270:L671Q;ENSP00000451502:L671Q;ENSP00000451151:L639Q;ENSP00000250373:L639Q;ENSP00000450590:L639Q;ENSP00000452349:L569Q;ENSP00000450469:L569Q;ENSP00000450733:L569Q;ENSP00000451454:L627Q;ENSP00000451284:L569Q;ENSP00000396788:L627Q;ENSP00000450686:L627Q;ENSP00000450810:L174Q;ENSP00000451183:L174Q;ENSP00000451395:L174Q	ENSP00000250373:L639Q	L	+	2	0	NFATC4	23914748	1.000000	0.71417	0.968000	0.41197	0.989000	0.77384	4.773000	0.62331	2.272000	0.75746	0.460000	0.39030	CTG	.	.		0.627	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
RHCG	51458	hgsc.bcm.edu	37	15	90023512	90023512	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:90023512G>T	ENST00000268122.4	-	4	718	c.650C>A	c.(649-651)tCg>tAg	p.S217*	RHCG_ENST00000544600.1_Nonsense_Mutation_p.S217*	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	217					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					AAAGAGGTCCGACTGGTACAC	0.547																																					p.S217X		Atlas-SNP	.											.	RHCG	49	.	0			c.C650A						.						205.0	179.0	188.0					15																	90023512		2200	4299	6499	SO:0001587	stop_gained	51458	exon4			AGGTCCGACTGGT	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.650C>A	chr15.hg19:g.90023512G>T	ENSP00000268122:p.Ser217*	44.0	0.0		44.0	19.0	NM_016321	A8K4D4|Q6X3Y4	Nonsense_Mutation	SNP	ENST00000268122.4	hg19	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	G	38	6.998013	0.97990	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	.	.	.	5.59	5.59	0.84812	.	0.107977	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.7037	19.6374	0.95740	0.0:0.0:1.0:0.0	.	.	.	.	X	217;217;208	.	.	S	-	2	0	RHCG	87824516	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.830000	0.99415	2.647000	0.89833	0.558000	0.71614	TCG	.	.		0.547	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
IQGAP1	8826	hgsc.bcm.edu	37	15	91020941	91020941	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:91020941C>T	ENST00000268182.5	+	26	3273	c.3149C>T	c.(3148-3150)aCg>aTg	p.T1050M	IQGAP1_ENST00000560738.1_Missense_Mutation_p.T478M	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1050	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GGAAATCCTACGGTTATTAAA	0.398																																					p.T1050M		Atlas-SNP	.											.	IQGAP1	140	.	0			c.C3149T						.						93.0	97.0	96.0					15																	91020941		2198	4298	6496	SO:0001583	missense	8826	exon26			ATCCTACGGTTAT	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3149C>T	chr15.hg19:g.91020941C>T	ENSP00000268182:p.Thr1050Met	63.0	0.0		66.0	15.0	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	hg19	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929800	0.92389	.	.	ENSG00000140575	ENST00000268182	T	0.79749	-1.3	5.86	5.86	0.93980	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.89399	0.6704	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87909	0.2696	10	0.42905	T	0.14	-16.0744	19.1654	0.93555	0.0:1.0:0.0:0.0	.	1050	P46940	IQGA1_HUMAN	M	1050	ENSP00000268182:T1050M	ENSP00000268182:T1050M	T	+	2	0	IQGAP1	88821945	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	7.755000	0.85180	2.778000	0.95560	0.655000	0.94253	ACG	.	.		0.398	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
TMC7	79905	hgsc.bcm.edu	37	16	19049310	19049310	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:19049310G>T	ENST00000304381.5	+	8	1250	c.1120G>T	c.(1120-1122)Ggg>Tgg	p.G374W	TMC7_ENST00000569532.1_Missense_Mutation_p.G374W|TMC7_ENST00000421369.3_Missense_Mutation_p.G264W|TMC7_ENST00000561963.1_3'UTR	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	374					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						GGCTGTTTTAGGGGCATGCTT	0.398																																					p.G374W		Atlas-SNP	.											.	TMC7	75	.	0			c.G1120T						.						214.0	185.0	195.0					16																	19049310		2197	4300	6497	SO:0001583	missense	79905	exon8			GTTTTAGGGGCAT	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1120G>T	chr16.hg19:g.19049310G>T	ENSP00000304710:p.Gly374Trp	177.0	0.0		161.0	85.0	NM_024847	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	hg19	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886793	0.33348	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.53640	0.61;0.61	5.5	3.51	0.40186	.	0.422877	0.25319	N	0.031530	T	0.37293	0.0998	L	0.52126	1.63	0.22601	N	0.998941	B;B	0.33904	0.229;0.431	B;B	0.31290	0.08;0.127	T	0.36040	-0.9764	10	0.59425	D	0.04	.	6.4874	0.22097	0.085:0.0:0.5074:0.4076	.	374;374	Q7Z402;B3KSZ3	TMC7_HUMAN;.	W	374;264	ENSP00000304710:G374W;ENSP00000397081:G264W	ENSP00000304710:G374W	G	+	1	0	TMC7	18956811	0.998000	0.40836	0.051000	0.19133	0.548000	0.35241	4.618000	0.61211	1.284000	0.44531	0.650000	0.86243	GGG	.	.		0.398	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
WBP2	23558	hgsc.bcm.edu	37	17	73851333	73851333	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:73851333T>C	ENST00000591399.1	-	2	470	c.46A>G	c.(46-48)Aat>Gat	p.N16D	WBP2_ENST00000344296.4_5'UTR|WBP2_ENST00000590450.1_5'UTR|WBP2_ENST00000590221.1_Missense_Mutation_p.N16D|WBP2_ENST00000254806.3_Missense_Mutation_p.N16D|WBP2_ENST00000585462.1_5'UTR|WBP2_ENST00000433525.2_Missense_Mutation_p.N16D			Q969T9	WBP2_HUMAN	WW domain binding protein 2	16	GRAM.				cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCGGTGTTATTGACGATCACT	0.577																																					p.N16D		Atlas-SNP	.											.	WBP2	17	.	0			c.A46G						.						170.0	171.0	170.0					17																	73851333		2203	4300	6503	SO:0001583	missense	23558	exon1			TGTTATTGACGAT	U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.46A>G	chr17.hg19:g.73851333T>C	ENSP00000467579:p.Asn16Asp	85.0	0.0		105.0	98.0	NM_012478	O95638	Missense_Mutation	SNP	ENST00000591399.1	hg19	CCDS11731.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.847164	0.91277	.	.	ENSG00000132471	ENST00000254806;ENST00000433525;ENST00000431190;ENST00000416574	D;D	0.88354	-2.37;-2.37	4.21	4.21	0.49690	GRAM (1);	0.117941	0.64402	D	0.000001	D	0.92364	0.7577	L	0.61036	1.89	0.80722	D	1	D;D;D;D	0.76494	0.988;0.999;0.998;0.998	P;D;D;D	0.71414	0.825;0.973;0.963;0.963	D	0.91452	0.5182	10	0.35671	T	0.21	-19.4032	13.7292	0.62776	0.0:0.0:0.0:1.0	.	16;16;16;16	B4DV07;B4DFG2;Q7Z511;Q969T9	.;.;.;WBP2_HUMAN	D	16	ENSP00000254806:N16D;ENSP00000415251:N16D	ENSP00000254806:N16D	N	-	1	0	WBP2	71362928	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.631000	0.54280	1.891000	0.54761	0.460000	0.39030	AAT	.	.		0.577	WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448862.1	NM_012478	
YES1	7525	hgsc.bcm.edu	37	18	742994	742994	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:742994T>C	ENST00000584307.1	-	8	1154	c.984A>G	c.(982-984)agA>agG	p.R328R	YES1_ENST00000577961.1_Silent_p.R333R|YES1_ENST00000314574.4_Silent_p.R328R			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	328	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GTTTATCATGTCTTAATTTTT	0.343																																					p.R328R		Atlas-SNP	.											.	YES1	50	.	0			c.A984G						.						107.0	105.0	106.0					18																	742994		2202	4300	6502	SO:0001819	synonymous_variant	7525	exon8			ATCATGTCTTAAT	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.984A>G	chr18.hg19:g.742994T>C		184.0	0.0		132.0	69.0	NM_005433	A6NLB3|D3DUH1	Silent	SNP	ENST00000584307.1	hg19	CCDS11824.1																																																																																			.	.		0.343	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
LAMA1	284217	hgsc.bcm.edu	37	18	6975955	6975955	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:6975955T>A	ENST00000389658.3	-	45	6563	c.6470A>T	c.(6469-6471)tAc>tTc	p.Y2157F	RN7SL537P_ENST00000584392.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2157	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCTACCGAGGTAGAAGAGAAG	0.413																																					p.Y2157F		Atlas-SNP	.											.	LAMA1	458	.	0			c.A6470T						.						157.0	157.0	157.0					18																	6975955		2203	4300	6503	SO:0001583	missense	284217	exon45			CCGAGGTAGAAGA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6470A>T	chr18.hg19:g.6975955T>A	ENSP00000374309:p.Tyr2157Phe	109.0	0.0		89.0	24.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	hg19	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.450028	0.63290	.	.	ENSG00000101680	ENST00000389658	T	0.81415	-1.49	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.074260	0.56097	D	0.000032	T	0.82185	0.4982	L	0.53249	1.67	0.42293	D	0.992142	P	0.48162	0.906	P	0.48400	0.576	D	0.84025	0.0356	10	0.56958	D	0.05	.	16.1482	0.81586	0.0:0.0:0.0:1.0	.	2157	P25391	LAMA1_HUMAN	F	2157	ENSP00000374309:Y2157F	ENSP00000374309:Y2157F	Y	-	2	0	LAMA1	6965955	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	5.803000	0.69129	2.272000	0.75746	0.523000	0.50628	TAC	.	.		0.413	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
MALT1	10892	hgsc.bcm.edu	37	18	56415027	56415027	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:56415027G>A	ENST00000348428.3	+	17	2686	c.2428G>A	c.(2428-2430)Gaa>Aaa	p.E810K	MALT1_ENST00000345724.3_Missense_Mutation_p.E799K|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	810					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						GACAACTGATGAAATACCATT	0.378			T	BIRC3	MALT																																p.E810K		Atlas-SNP	.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	MALT1	55	.	0			c.G2428A						.						109.0	114.0	112.0					18																	56415027		2203	4300	6503	SO:0001583	missense	10892	exon17			ACTGATGAAATAC		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.2428G>A	chr18.hg19:g.56415027G>A	ENSP00000319279:p.Glu810Lys	100.0	0.0		81.0	35.0	NM_006785	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	hg19	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438445	0.83885	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.13901	2.55;2.56	5.77	5.77	0.91146	.	0.052727	0.64402	D	0.000001	T	0.21307	0.0513	L	0.56769	1.78	0.48185	D	0.999602	P;P	0.42692	0.787;0.682	B;B	0.41510	0.359;0.197	T	0.00536	-1.1683	10	0.66056	D	0.02	.	19.5879	0.95497	0.0:0.0:1.0:0.0	.	799;810	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	K	810;799	ENSP00000319279:E810K;ENSP00000304161:E799K	ENSP00000304161:E799K	E	+	1	0	MALT1	54566007	1.000000	0.71417	0.800000	0.32199	0.962000	0.63368	7.196000	0.77805	2.745000	0.94114	0.650000	0.86243	GAA	.	.		0.378	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		
PLCB1	23236	hgsc.bcm.edu	37	20	8626827	8626827	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:8626827G>A	ENST00000338037.6	+	5	490	c.463G>A	c.(463-465)Gcc>Acc	p.A155T	PLCB1_ENST00000378641.3_Splice_Site_p.A155T|PLCB1_ENST00000378637.2_Splice_Site_p.A155T	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	155					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCTGGAAAAAGCGTAAGTCAC	0.408																																					p.S155S		Atlas-SNP	.											.	PLCB1	394	.	0			c.A463A						.						116.0	113.0	114.0					20																	8626827		2203	4300	6503	SO:0001630	splice_region_variant	23236	exon5			GAAAAAGCGTAAG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.464+1G>A	chr20.hg19:g.8626827G>A		137.0	0.0		121.0	16.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	hg19	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929190	0.73327	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098;ENST00000441163;ENST00000535719	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	6.07	6.07	0.98685	.	0.044969	0.85682	D	0.000000	T	0.67401	0.2889	M	0.80746	2.51	0.80722	D	1	P;B;D;D	0.76494	0.632;0.19;0.986;0.999	B;B;P;D	0.81914	0.271;0.05;0.828;0.995	T	0.60372	-0.7276	10	0.22706	T	0.39	.	20.2389	0.98366	0.0:0.0:1.0:0.0	.	54;155;155;154	B4DRC6;Q9NQ66;Q9NQ66-2;B1AK73	.;PLCB1_HUMAN;.;.	T	155;155;155;154;75;75	ENSP00000367908:A155T;ENSP00000338185:A155T;ENSP00000367904:A155T;ENSP00000384001:A154T	ENSP00000338185:A155T	A	+	1	0	PLCB1	8574827	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.109000	0.89561	2.890000	0.99128	0.650000	0.86243	GCC	.	.		0.408	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		Missense_Mutation
GDF5	8200	hgsc.bcm.edu	37	20	34022378	34022378	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:34022378C>T	ENST00000374372.1	-	4	1338	c.835G>A	c.(835-837)Gat>Aat	p.D279N	GDF5OS_ENST00000374375.1_Missense_Mutation_p.S141F|GDF5_ENST00000374369.3_Missense_Mutation_p.D279N			P43026	GDF5_HUMAN	growth differentiation factor 5	279					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GAGCGCACATCCAGCAAGGAG	0.687																																					p.D279N		Atlas-SNP	.											.	GDF5	66	.	0			c.G835A						.						12.0	14.0	13.0					20																	34022378		2179	4278	6457	SO:0001583	missense	8200	exon2			GCACATCCAGCAA	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.835G>A	chr20.hg19:g.34022378C>T	ENSP00000363492:p.Asp279Asn	50.0	0.0		51.0	12.0	NM_000557	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	hg19	CCDS13254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.736835|4.736835	0.89482|0.89482	.|.	.|.	ENSG00000125965|ENSG00000204183	ENST00000374369;ENST00000374372|ENST00000374375	T;T|.	0.68903|.	-0.36;-0.36|.	4.56|4.56	4.56|4.56	0.56223|0.56223	Transforming growth factor-beta, N-terminal (1);|.	0.126917|.	0.50627|.	D|.	0.000104|.	T|T	0.76786|0.76786	0.4036|0.4036	M|M	0.74647|0.74647	2.275|2.275	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.71674|.	0.976;0.998|.	D;D|.	0.70935|.	0.926;0.971|.	T|T	0.80799|0.80799	-0.1221|-0.1221	10|6	0.66056|0.87932	D|D	0.02|0	.|.	17.5149|17.5149	0.87770|0.87770	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	279;279|.	F1T0J1;P43026|.	.;GDF5_HUMAN|.	N|F	279|141	ENSP00000363489:D279N;ENSP00000363492:D279N|.	ENSP00000363489:D279N|ENSP00000363495:S141F	D|S	-|+	1|2	0|0	GDF5|GDF5OS	33485792|33485792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.774000|4.774000	0.62339|0.62339	2.353000|2.353000	0.79882|0.79882	0.491000|0.491000	0.48974|0.48974	GAT|TCC	.	.		0.687	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
ZNF831	128611	hgsc.bcm.edu	37	20	57767023	57767023	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:57767023C>A	ENST00000371030.2	+	1	949	c.949C>A	c.(949-951)Cgg>Agg	p.R317R		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	317							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CGCCCTGCAGCGGCAGCAGGC	0.711																																					p.R317R		Atlas-SNP	.											.	ZNF831	287	.	0			c.C949A						.						13.0	16.0	15.0					20																	57767023		1691	3870	5561	SO:0001819	synonymous_variant	128611	exon1			CTGCAGCGGCAGC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.949C>A	chr20.hg19:g.57767023C>A		19.0	0.0		16.0	10.0	NM_178457	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	hg19	CCDS42894.1																																																																																			.	.		0.711	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
USP25	29761	hgsc.bcm.edu	37	21	17197365	17197365	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:17197365A>G	ENST00000285679.6	+	12	1658	c.1289A>G	c.(1288-1290)cAa>cGa	p.Q430R	USP25_ENST00000400183.2_Missense_Mutation_p.Q430R|USP25_ENST00000285681.2_Missense_Mutation_p.Q430R|USP25_ENST00000351097.5_Intron	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	430	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ACGGTATTACAACAAAGGCTA	0.303																																					p.Q430R		Atlas-SNP	.											.	USP25	156	.	0			c.A1289G						.						97.0	97.0	97.0					21																	17197365		2203	4300	6503	SO:0001583	missense	29761	exon12			TATTACAACAAAG	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1289A>G	chr21.hg19:g.17197365A>G	ENSP00000285679:p.Gln430Arg	275.0	0.0		156.0	36.0	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	hg19	CCDS33515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.0|23.0	4.367884|4.367884	0.82463|0.82463	.|.	.|.	ENSG00000155313|ENSG00000155313	ENST00000453553|ENST00000285681;ENST00000285679;ENST00000400183	.|T;T;T	.|0.74002	.|-0.8;-0.8;-0.8	5.74|5.74	5.74|5.74	0.90152|0.90152	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.106920	.|0.64402	.|D	.|0.000003	D|D	0.82664|0.82664	0.5086|0.5086	L|L	0.52905|0.52905	1.665|1.665	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.984;0.998;0.982	.|D;D;P	.|0.70487	.|0.917;0.969;0.828	T|T	0.82494|0.82494	-0.0429|-0.0429	5|10	.|0.45353	.|T	.|0.12	.|.	15.3343|15.3343	0.74238|0.74238	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|430;430;430	.|Q9UHP3-3;Q9UHP3-1;Q9UHP3	.|.;.;UBP25_HUMAN	D|R	13|430	.|ENSP00000285681:Q430R;ENSP00000285679:Q430R;ENSP00000383044:Q430R	.|ENSP00000285679:Q430R	N|Q	+|+	1|2	0|0	USP25|USP25	16119236|16119236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	8.621000|8.621000	0.90949|0.90949	2.330000|2.330000	0.79161|0.79161	0.528000|0.528000	0.53228|0.53228	AAC|CAA	.	.		0.303	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
TTC3	7267	hgsc.bcm.edu	37	21	38538901	38538901	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:38538901A>G	ENST00000399017.2	+	33	7132	c.4385A>G	c.(4384-4386)cAg>cGg	p.Q1462R	TTC3_ENST00000355666.1_Missense_Mutation_p.Q1462R|TTC3_ENST00000354749.2_Missense_Mutation_p.Q1462R|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1462					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				CCACACGTGCAGATGGTTGCC	0.348																																					p.Q1462R	Ovarian(38;194 1649 35661)	Atlas-SNP	.											.	TTC3	182	.	0			c.A4385G						.						40.0	38.0	38.0					21																	38538901		2203	4300	6503	SO:0001583	missense	7267	exon33			ACGTGCAGATGGT	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.4385A>G	chr21.hg19:g.38538901A>G	ENSP00000381981:p.Gln1462Arg	108.0	0.0		67.0	21.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	hg19	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	A	3.781	-0.045728	0.07452	.	.	ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749	T;T;T	0.07800	3.16;3.16;3.16	4.96	2.15	0.27550	.	0.452951	0.20187	N	0.097386	T	0.04092	0.0114	L	0.31065	0.9	0.09310	N	0.999997	B;P	0.35433	0.201;0.501	B;B	0.25140	0.032;0.058	T	0.36915	-0.9728	9	.	.	.	-3.6352	2.6852	0.05105	0.5413:0.2717:0.187:0.0	.	520;1462	Q5GIT6;P53804	.;TTC3_HUMAN	R	1462	ENSP00000347889:Q1462R;ENSP00000381981:Q1462R;ENSP00000346791:Q1462R	.	Q	+	2	0	TTC3	37460771	0.002000	0.14202	0.010000	0.14722	0.142000	0.21351	1.121000	0.31283	0.796000	0.33947	0.460000	0.39030	CAG	.	.		0.348	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
REPS2	9185	hgsc.bcm.edu	37	X	17095520	17095520	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:17095520C>T	ENST00000357277.3	+	13	1677	c.1506C>T	c.(1504-1506)ccC>ccT	p.P502P	REPS2_ENST00000469714.1_Intron|REPS2_ENST00000303843.7_Silent_p.P501P|REPS2_ENST00000380064.4_Intron	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	502	Pro-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					TCTTCCAGCCCAGTGTGCCAG	0.602																																					p.P502P		Atlas-SNP	.											.	REPS2	76	.	0			c.C1506T						.						61.0	55.0	57.0					X																	17095520		2203	4300	6503	SO:0001819	synonymous_variant	9185	exon13			CCAGCCCAGTGTG	AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1506C>T	chrX.hg19:g.17095520C>T		26.0	0.0		33.0	15.0	NM_004726	A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Silent	SNP	ENST00000357277.3	hg19	CCDS14180.2																																																																																			.	.		0.602	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1	NM_004726	
MT-ND5	4540	hgsc.bcm.edu	37	M	12610	12610	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrM:12610G>A	ENST00000361567.2	+	1	274	c.274G>A	c.(274-276)Gta>Ata	p.V92I	MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	92					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TATTCATCCCTGTAGCATTGT	0.383																																					p.V92M		Atlas-SNP	.											.	.	.	.	0			c.G274A						.																																			SO:0001583	missense	0	exon1			ATCCCTGTAGCAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.274G>A	chrM.hg19:g.12610G>A	ENSP00000354813:p.Val92Ile	252.0	0.0		456.0	184.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	C|0.009;T|0.991		0.383	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
KIF3B	9371	hgsc.bcm.edu	37	20	30897746	30897746	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:30897746delA	ENST00000375712.3	+	2	333	c.166delA	c.(166-168)accfs	p.T56fs	KIF3B_ENST00000418717.2_5'Flank	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	56	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AATGCCCAAGACCTTCACCTT	0.502																																					p.K55fs		Atlas-Indel,Pindel	.											.	KIF3B	75	.	0			c.165delG						.						159.0	135.0	143.0					20																	30897746		2203	4300	6503	SO:0001589	frameshift_variant	9371	exon2			.	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.166delA	chr20.hg19:g.30897746delA	ENSP00000364864:p.Thr56fs	95.0	0.0		68.0	19.0	NM_004798	B2RMP4|B4DSR5|E1P5M5	Frame_Shift_Del	DEL	ENST00000375712.3	hg19	CCDS13200.1																																																																																			.	.		0.502	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1	NM_004798	
SIN3B	23309	hgsc.bcm.edu	37	19	16989085	16989085	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:16989085delG	ENST00000248054.5	+	18	3067	c.3046delG	c.(3046-3048)gtgfs	p.V1016fs	SIN3B_ENST00000595541.1_Frame_Shift_Del_p.V606fs|SIN3B_ENST00000594235.1_3'UTR|SIN3B_ENST00000379803.1_Frame_Shift_Del_p.V1048fs					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						GCTGGTGGGCGTGGAGAGCGC	0.667																																					p.G1047fs		Atlas-INDEL	.											.	SIN3B	90	.	0			c.3141delC						.						20.0	16.0	17.0					19																	16989085		2192	4289	6481	SO:0001589	frameshift_variant	23309	exon19			.	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.3046delG	chr19.hg19:g.16989085delG	ENSP00000248054:p.Val1016fs	20.0	0.0		16.0	16.0	NM_015260		Frame_Shift_Del	DEL	ENST00000248054.5	hg19																																																																																				.	.		0.667	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
ALB	213	hgsc.bcm.edu	37	4	74283386	74283387	+	Splice_Site	DEL	TG	TG	-	rs78527483		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:74283386_74283387delTG	ENST00000503124.1	+	9	1185	c.978delTG	c.(976-978)tat>ta	p.Y326fs	ALB_ENST00000505649.1_Intron|ALB_ENST00000415165.2_Splice_Site_p.Y284fs|ALB_ENST00000401494.3_Splice_Site_p.Y361fs|ALB_ENST00000509063.1_Splice_Site_p.Y476fs|ALB_ENST00000295897.4_Splice_Site_p.Y476fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGAAGACTATGTGAGTCttta	0.332																																					p.476_476del		Atlas-Indel,Pindel	.											.	ALB	132	.	0			c.1427_1428del						.																																			SO:0001630	splice_region_variant	213	exon11			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.978+1TG>-	chr4.hg19:g.74283388_74283389delTG		59.0	0.0		23.0	20.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.332	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	Frame_Shift_Del
L3MBTL1	26013	hgsc.bcm.edu	37	20	42143656	42143656	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:42143656delC	ENST00000427442.2	+	5	603	c.444delC	c.(442-444)cacfs	p.H148fs	L3MBTL1_ENST00000444063.1_Frame_Shift_Del_p.H80fs|L3MBTL1_ENST00000373134.1_Frame_Shift_Del_p.H80fs|L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000418998.1_Frame_Shift_Del_p.H148fs|L3MBTL1_ENST00000373135.3_Frame_Shift_Del_p.H80fs			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	80					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CAGAGGACCACCCCCAGAATC	0.682																																					p.H148fs		Atlas-Indel,Pindel	.											.	L3MBTL1	105	.	0			c.443delA						.						37.0	36.0	36.0					20																	42143656		2203	4300	6503	SO:0001589	frameshift_variant	26013	exon5			.	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.444delC	chr20.hg19:g.42143656delC	ENSP00000402107:p.His148fs	42.0	0.0		65.0	22.0	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Frame_Shift_Del	DEL	ENST00000427442.2	hg19	CCDS46602.2																																																																																			.	.		0.682	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
TTLL3	26140	hgsc.bcm.edu	37	3	9870684	9870685	+	Frame_Shift_Del	DEL	GA	GA	-	rs201240908		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:9870684_9870685delGA	ENST00000547186.1	+	10	1375_1376	c.1159_1160delGA	c.(1159-1161)gagfs	p.E387fs	TTLL3_ENST00000466245.1_3'UTR|TTLL3_ENST00000383827.1_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000426895.4_Frame_Shift_Del_p.E530fs|TTLL3_ENST00000455274.1_Frame_Shift_Del_p.E175fs|ARPC4-TTLL3_ENST00000397256.1_Frame_Shift_Del_p.E448fs|TTLL3_ENST00000427853.3_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000397241.1_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000430793.1_Frame_Shift_Del_p.E175fs	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	387	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					GAAGCACCTGGAGAACTCATGC	0.569																																					p.529_530del		Atlas-Indel,Pindel	.											.	TTLL3	51	.	0			c.1587_1588del						.																																			SO:0001589	frameshift_variant	26140	exon10			.		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.1159_1160delGA	chr3.hg19:g.9870686_9870687delGA	ENSP00000446659:p.Glu387fs	50.0	0.0		36.0	15.0	NM_001025930	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Frame_Shift_Del	DEL	ENST00000547186.1	hg19																																																																																				.	.		0.569	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
NBEA	26960	hgsc.bcm.edu	37	13	36229035	36229036	+	Frame_Shift_Ins	INS	-	-	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:36229035_36229036insC	ENST00000400445.3	+	53	8550_8551	c.8016_8017insC	c.(8017-8019)gacfs	p.D2673fs	NBEA_ENST00000379922.3_Frame_Shift_Ins_p.D251fs|NBEA_ENST00000310336.4_Frame_Shift_Ins_p.D2673fs|NBEA_ENST00000379939.2_Frame_Shift_Ins_p.D2670fs|NBEA_ENST00000540320.1_Frame_Shift_Ins_p.D2673fs|NBEA_ENST00000537702.1_Frame_Shift_Ins_p.D466fs	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2673					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGACCTCGTTGACCAGAGTAT	0.366																																					p.V2672fs		Atlas-INDEL	.											.	NBEA	340	.	0			c.8016_8017insC						.																																			SO:0001589	frameshift_variant	26960	exon53			.	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	Exception_encountered	chr13.hg19:g.36229035_36229036insC	ENSP00000383295:p.Asp2673fs	73.0	0.0		45.0	30.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Frame_Shift_Ins	INS	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.		0.366	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
TRNT1	51095	hgsc.bcm.edu	37	3	3186326	3186329	+	Frame_Shift_Del	DEL	AGTT	AGTT	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	AGTT	AGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:3186326_3186329delAGTT	ENST00000251607.6	+	5	642_645	c.540_543delAGTT	c.(538-543)aaagttfs	p.KV180fs	TRNT1_ENST00000280591.6_Frame_Shift_Del_p.KV180fs	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	180					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		AAAATAAGAAAGTTAGATTTGTTG	0.26																																					p.180_181del		Atlas-Indel,Pindel	.											.	TRNT1	34	.	0			c.539_542del						.			0,4250		0,0,2125						5.7	1.0			56	1,8237		0,1,4118	no	frameshift	TRNT1	NM_182916.2		0,1,6243	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12487				SO:0001589	frameshift_variant	51095	exon5			.	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.540_543delAGTT	chr3.hg19:g.3186326_3186329delAGTT	ENSP00000251607:p.Lys180fs	204.0	0.0		151.0	23.0	NM_182916	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Frame_Shift_Del	DEL	ENST00000251607.6	hg19	CCDS2561.2																																																																																			.	.		0.260	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
ALB	213	hgsc.bcm.edu	37	4	74283297	74283298	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:74283297_74283298insT	ENST00000503124.1	+	9	1096_1097	c.889_890insT	c.(889-891)cttfs	p.L297fs	ALB_ENST00000505649.1_Intron|ALB_ENST00000415165.2_Frame_Shift_Ins_p.L255fs|ALB_ENST00000401494.3_Frame_Shift_Ins_p.L332fs|ALB_ENST00000509063.1_Frame_Shift_Ins_p.L447fs|ALB_ENST00000295897.4_Frame_Shift_Ins_p.L447fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AACTCCAACTCTTGTAGAGGTC	0.401																																					p.L447fs		Atlas-INDEL	.											.	ALB	132	.	0			c.1339_1340insT						.																																			SO:0001589	frameshift_variant	213	exon11			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.891dupT	chr4.hg19:g.74283299_74283299dupT	ENSP00000421027:p.Leu297fs	112.0	0.0		51.0	42.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Ins	INS	ENST00000503124.1	hg19																																																																																				.	.		0.401	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
