#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BRDT	676	hgsc.bcm.edu	37	1	92433718	92433718	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:92433718G>T	ENST00000362005.3	+	5	764	c.346G>T	c.(346-348)Gtt>Ttt	p.V116F	BRDT_ENST00000370389.2_Missense_Mutation_p.V43F|BRDT_ENST00000394530.3_Missense_Mutation_p.V70F|BRDT_ENST00000402388.1_Missense_Mutation_p.V116F|BRDT_ENST00000399546.2_Missense_Mutation_p.V116F	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	116	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AGATGACATTGTTCTTATGGC	0.368																																					p.V116F		Atlas-SNP	.											.	BRDT	133	.	0			c.G346T						.						103.0	102.0	102.0					1																	92433718		2203	4300	6503	SO:0001583	missense	676	exon4			GACATTGTTCTTA	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.346G>T	chr1.hg19:g.92433718G>T	ENSP00000354568:p.Val116Phe	58.0	0.0		50.0	16.0	NM_001242806	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	hg19	CCDS735.1	.	.	.	.	.	.	.	.	.	.	G	31	5.058619	0.93846	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000423434;ENST00000394530;ENST00000440509;ENST00000427104;ENST00000448194;ENST00000426141;ENST00000552654;ENST00000402388	T;T;T;T;T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;2.16;1.46;1.46;1.46;1.46;1.46;1.46	5.66	5.66	0.87406	Bromodomain (5);	0.000000	0.64402	D	0.000011	T	0.51618	0.1685	M	0.71920	2.185	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.992;0.992;1.0;1.0	T	0.53613	-0.8414	10	0.87932	D	0	-14.6225	19.7538	0.96281	0.0:0.0:1.0:0.0	.	70;70;116;116	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	F	116;43;116;116;116;70;116;116;116;116;43;116	ENSP00000354568:V116F;ENSP00000359416:V43F;ENSP00000387822:V116F;ENSP00000396351:V116F;ENSP00000378038:V70F;ENSP00000416714:V116F;ENSP00000400002:V116F;ENSP00000410587:V116F;ENSP00000404969:V116F;ENSP00000446599:V43F;ENSP00000384051:V116F	ENSP00000354568:V116F	V	+	1	0	BRDT	92206306	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.681000	0.98653	2.690000	0.91761	0.655000	0.94253	GTT	.	.		0.368	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
SYCP1	6847	hgsc.bcm.edu	37	1	115401205	115401205	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:115401205A>G	ENST00000369522.3	+	6	569	c.329A>G	c.(328-330)tAt>tGt	p.Y110C	SYCP1_ENST00000369518.1_Missense_Mutation_p.Y110C	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	110					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAAAACTGTATAAGGAGGCT	0.308																																					p.Y110C		Atlas-SNP	.											.	SYCP1	149	.	0			c.A329G						.						66.0	70.0	68.0					1																	115401205		2203	4299	6502	SO:0001583	missense	6847	exon6			AACTGTATAAGGA	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.329A>G	chr1.hg19:g.115401205A>G	ENSP00000358535:p.Tyr110Cys	204.0	0.0		204.0	88.0	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508092	0.27036	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.58210	0.35;0.35;0.35	5.05	3.92	0.45320	.	0.273076	0.37095	N	0.002259	T	0.55862	0.1947	M	0.62723	1.935	0.34251	D	0.678766	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60073	-0.7334	10	0.42905	T	0.14	-3.66	11.0156	0.47687	0.8602:0.0:0.0:0.1397	.	110;110	B7ZLS9;Q15431	.;SYCP1_HUMAN	C	110	ENSP00000358535:Y110C;ENSP00000410011:Y110C;ENSP00000358531:Y110C	ENSP00000358531:Y110C	Y	+	2	0	SYCP1	115202728	1.000000	0.71417	0.965000	0.40720	0.064000	0.16182	5.029000	0.64121	0.776000	0.33473	-0.377000	0.06932	TAT	.	.		0.308	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
MAN1A2	10905	hgsc.bcm.edu	37	1	118035855	118035855	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:118035855G>T	ENST00000356554.3	+	9	1990	c.1255G>T	c.(1255-1257)Gca>Tca	p.A419S		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	419					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		AGACCATGAGGCAAGAAAGAT	0.363																																					p.A419S	Ovarian(33;199 881 8228 13687 31538)	Atlas-SNP	.											.	MAN1A2	50	.	0			c.G1255T						.						142.0	127.0	132.0					1																	118035855		2203	4300	6503	SO:0001583	missense	10905	exon9			CATGAGGCAAGAA	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.1255G>T	chr1.hg19:g.118035855G>T	ENSP00000348959:p.Ala419Ser	91.0	0.0		74.0	24.0	NM_006699	Q9H510	Missense_Mutation	SNP	ENST00000356554.3	hg19	CCDS895.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.031081|4.031081	0.75504|0.75504	.|.	.|.	ENSG00000198162|ENSG00000198162	ENST00000356554;ENST00000369450|ENST00000449370	T|.	0.72051|.	-0.62|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64294|0.64294	0.2585|0.2585	L|L	0.61387|0.61387	1.9|1.9	0.80722|0.80722	D|D	1|1	B;B|.	0.13145|.	0.002;0.007|.	B;B|.	0.20384|.	0.012;0.029|.	T|T	0.63726|0.63726	-0.6572|-0.6572	10|5	0.22706|.	T|.	0.39|.	-15.6666|-15.6666	16.0138|16.0138	0.80422|0.80422	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	183;419|.	A6NLR2;O60476|.	.;MA1A2_HUMAN|.	S|S	419;183|151	ENSP00000348959:A419S|.	ENSP00000348959:A419S|.	A|R	+|+	1|3	0|2	MAN1A2|MAN1A2	117837378|117837378	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.992000|0.992000	0.81027|0.81027	9.313000|9.313000	0.96297|0.96297	2.378000|2.378000	0.81104|0.81104	0.655000|0.655000	0.94253|0.94253	GCA|AGG	.	.		0.363	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	
CEP350	9857	hgsc.bcm.edu	37	1	179989459	179989459	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:179989459C>T	ENST00000367607.3	+	12	2968	c.2550C>T	c.(2548-2550)agC>agT	p.S850S		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	850					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTGGGGCCAGCATTAACTATG	0.453																																					p.S850S		Atlas-SNP	.											.	CEP350	418	.	0			c.C2550T						.						146.0	148.0	148.0					1																	179989459		2203	4300	6503	SO:0001819	synonymous_variant	9857	exon12			GGCCAGCATTAAC	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2550C>T	chr1.hg19:g.179989459C>T		49.0	0.0		81.0	19.0	NM_014810	O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	hg19	CCDS1336.1																																																																																			.	.		0.453	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
OR2G2	81470	hgsc.bcm.edu	37	1	247751732	247751732	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:247751732C>T	ENST00000320065.1	+	1	71	c.71C>T	c.(70-72)cCt>cTt	p.P24L	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	24			P -> A (in dbSNP:rs12737801).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TCTGATTATCCTCAGTTACAG	0.418																																					p.P24L		Atlas-SNP	.											.	OR2G2	88	.	0			c.C71T						.						195.0	188.0	190.0					1																	247751732		2203	4300	6503	SO:0001583	missense	81470	exon1			ATTATCCTCAGTT	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.71C>T	chr1.hg19:g.247751732C>T	ENSP00000326349:p.Pro24Leu	285.0	0.0		372.0	89.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	hg19	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897411	0.52121	.	.	ENSG00000177489	ENST00000320065	T	0.00421	7.46	3.79	3.79	0.43588	.	0.000000	0.33235	U	0.005126	T	0.01353	0.0044	M	0.87097	2.86	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.18999	-1.0319	10	0.66056	D	0.02	.	13.2409	0.59995	0.0:1.0:0.0:0.0	.	24	Q8NGZ5	OR2G2_HUMAN	L	24	ENSP00000326349:P24L	ENSP00000326349:P24L	P	+	2	0	OR2G2	245818355	0.000000	0.05858	0.714000	0.30535	0.942000	0.58702	-0.014000	0.12656	1.925000	0.55765	0.591000	0.81541	CCT	.	.		0.418	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
KCNF1	3754	hgsc.bcm.edu	37	2	11053487	11053487	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:11053487C>T	ENST00000295082.1	+	1	1425	c.935C>T	c.(934-936)aCc>aTc	p.T312I		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	312					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GGCCTGCAGACCCTCACCTAT	0.622																																					p.T312I		Atlas-SNP	.											.	KCNF1	70	.	0			c.C935T						.						61.0	59.0	60.0					2																	11053487		2203	4300	6503	SO:0001583	missense	3754	exon1			TGCAGACCCTCAC	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.935C>T	chr2.hg19:g.11053487C>T	ENSP00000295082:p.Thr312Ile	60.0	0.0		68.0	19.0	NM_002236	O43527|Q585L3	Missense_Mutation	SNP	ENST00000295082.1	hg19	CCDS1676.1	.	.	.	.	.	.	.	.	.	.	c	17.50	3.404087	0.62288	.	.	ENSG00000162975	ENST00000295082	D	0.98684	-5.07	4.74	4.74	0.60224	Ion transport (1);	0.105772	0.64402	D	0.000005	D	0.96642	0.8904	N	0.11427	0.14	0.80722	D	1	D	0.55605	0.972	P	0.57620	0.824	D	0.94414	0.7634	10	0.02654	T	1	.	18.1029	0.89512	0.0:1.0:0.0:0.0	.	312	Q9H3M0	KCNF1_HUMAN	I	312	ENSP00000295082:T312I	ENSP00000295082:T312I	T	+	2	0	KCNF1	10970938	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.348000	0.79779	0.556000	0.70494	ACC	.	.		0.622	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236	
CEBPZ	10153	hgsc.bcm.edu	37	2	37455644	37455644	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:37455644G>C	ENST00000234170.5	-	2	837	c.692C>G	c.(691-693)tCt>tGt	p.S231C		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	231					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				CCAGGTAGAAGAGGCTCCCTT	0.438																																					p.S231C		Atlas-SNP	.											.	CEBPZ	68	.	0			c.C692G						.						131.0	134.0	133.0					2																	37455644		2203	4300	6503	SO:0001583	missense	10153	exon2			GTAGAAGAGGCTC	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.692C>G	chr2.hg19:g.37455644G>C	ENSP00000234170:p.Ser231Cys	82.0	0.0		122.0	30.0	NM_005760	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	hg19	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058717	0.55325	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.02787	4.16	5.45	4.56	0.56223	.	0.235220	0.41294	N	0.000905	T	0.12092	0.0294	M	0.74258	2.255	0.37729	D	0.925204	D	0.89917	1.0	D	0.64144	0.922	T	0.01334	-1.1382	10	0.87932	D	0	.	11.124	0.48306	0.0:0.139:0.7165:0.1444	.	231	Q03701	CEBPZ_HUMAN	C	231	ENSP00000234170:S231C	ENSP00000234170:S231C	S	-	2	0	CEBPZ	37309148	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.406000	0.66357	1.258000	0.44101	0.655000	0.94253	TCT	.	.		0.438	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
LY75	4065	hgsc.bcm.edu	37	2	160737646	160737646	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:160737646T>A	ENST00000263636.4	-	8	1379	c.1352A>T	c.(1351-1353)gAg>gTg	p.E451V	LY75_ENST00000553424.1_Missense_Mutation_p.E451V|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.E451V|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.E451V|LY75_ENST00000554112.1_Missense_Mutation_p.E451V	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	451	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		AACATTTGGCTCATTCTCATC	0.383																																					p.E451V		Atlas-SNP	.											.	LY75	151	.	0			c.A1352T						.						190.0	171.0	177.0					2																	160737646		2203	4300	6503	SO:0001583	missense	4065	exon8			TTTGGCTCATTCT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.1352A>T	chr2.hg19:g.160737646T>A	ENSP00000263636:p.Glu451Val	83.0	0.0		119.0	49.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	hg19	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.717734	0.89205	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3	6.16	6.16	0.99307	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.35646	N	0.003065	T	0.51075	0.1653	M	0.90252	3.1	0.52501	D	0.999959	D;D;D;D	0.89917	0.998;0.999;1.0;0.999	D;D;D;D	0.78314	0.991;0.985;0.991;0.953	T	0.60464	-0.7258	10	0.87932	D	0	-15.7446	16.4795	0.84153	0.0:0.0:0.0:1.0	.	69;451;451;451	Q59H44;O60449-3;O60449;O60449-2	.;.;LY75_HUMAN;.	V	451	ENSP00000451511:E451V;ENSP00000451446:E451V;ENSP00000263636:E451V;ENSP00000423463:E451V;ENSP00000421035:E451V	ENSP00000423463:E451V	E	-	2	0	LY75;LY75-CD302	160445892	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.166000	0.71896	2.367000	0.80283	0.528000	0.53228	GAG	.	.		0.383	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
USP4	7375	hgsc.bcm.edu	37	3	49365180	49365180	+	Missense_Mutation	SNP	G	G	C	rs536745381		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:49365180G>C	ENST00000265560.4	-	3	345	c.299C>G	c.(298-300)gCg>gGg	p.A100G	USP4_ENST00000415188.1_Missense_Mutation_p.A100G|USP4_ENST00000351842.4_Missense_Mutation_p.A100G|USP4_ENST00000416417.1_Missense_Mutation_p.A100G	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	100	DUSP. {ECO:0000255|PROSITE- ProRule:PRU00613}.|Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TTTATTCCACGCCTCGGTAGG	0.438																																					p.A100G		Atlas-SNP	.											.	USP4	72	.	0			c.C299G						.						138.0	125.0	130.0					3																	49365180		2203	4300	6503	SO:0001583	missense	7375	exon3			TTCCACGCCTCGG	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.299C>G	chr3.hg19:g.49365180G>C	ENSP00000265560:p.Ala100Gly	135.0	0.0		167.0	19.0	NM_199443	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	hg19	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141378	0.57044	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.35605	1.78;1.9;1.3	6.07	6.07	0.98685	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (3);	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	L	0.41906	1.305	0.80722	D	1	B;B	0.27656	0.137;0.184	B;B	0.41510	0.123;0.359	T	0.12293	-1.0553	10	0.18276	T	0.48	-24.2326	19.2374	0.93866	0.0:0.0:1.0:0.0	.	100;100	Q13107-2;Q13107	.;UBP4_HUMAN	G	100	ENSP00000341028:A100G;ENSP00000265560:A100G;ENSP00000400623:A100G	ENSP00000265560:A100G	A	-	2	0	USP4	49340184	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.620000	0.83070	2.885000	0.99019	0.655000	0.94253	GCG	.	.		0.438	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
EGFLAM	133584	hgsc.bcm.edu	37	5	38407124	38407124	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:38407124G>T	ENST00000354891.3	+	8	1369	c.1023G>T	c.(1021-1023)agG>agT	p.R341S	EGFLAM_ENST00000322350.5_Missense_Mutation_p.R341S|EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000336740.6_Missense_Mutation_p.R107S	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	341					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					TAATGTCAAGGCTCTTTGACA	0.562																																					p.R341S	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.G1023T						.						139.0	130.0	133.0					5																	38407124		2203	4300	6503	SO:0001583	missense	133584	exon8			GTCAAGGCTCTTT	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1023G>T	chr5.hg19:g.38407124G>T	ENSP00000346964:p.Arg341Ser	90.0	0.0		118.0	30.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	hg19	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305185	0.81247	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.80566	0.74;0.57;-1.39	5.91	5.91	0.95273	.	0.052871	0.64402	D	0.000001	D	0.89420	0.6710	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.996;0.98	D	0.89304	0.3628	10	0.56958	D	0.05	-0.0346	16.7452	0.85470	0.0:0.1373:0.8627:0.0	.	107;341;341	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	S	341;341;107;107	ENSP00000346964:R341S;ENSP00000313084:R341S;ENSP00000337607:R107S	ENSP00000313084:R341S	R	+	3	2	EGFLAM	38442881	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	1.358000	0.34102	2.802000	0.96397	0.655000	0.94253	AGG	.	.		0.562	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
ITGA1	3672	hgsc.bcm.edu	37	5	52233253	52233253	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:52233253C>T	ENST00000282588.6	+	24	3445	c.2987C>T	c.(2986-2988)cCa>cTa	p.P996L	CTD-2175A23.1_ENST00000505701.1_RNA|CTD-2175A23.1_ENST00000503559.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	996					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				GGATCTTTTCCAATGCCAGAG	0.358																																					p.P996L		Atlas-SNP	.											.	ITGA1	112	.	0			c.C2987T						.						183.0	177.0	179.0					5																	52233253		2203	4300	6503	SO:0001583	missense	3672	exon24			CTTTTCCAATGCC	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2987C>T	chr5.hg19:g.52233253C>T	ENSP00000282588:p.Pro996Leu	143.0	0.0		197.0	73.0	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	hg19	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553746	0.86231	.	.	ENSG00000213949	ENST00000282588	T	0.45276	0.9	5.69	5.69	0.88448	Integrin alpha-2 (1);	0.318638	0.33161	N	0.005211	T	0.59115	0.2170	L	0.52573	1.65	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	T	0.55490	-0.8133	10	0.45353	T	0.12	.	16.731	0.85435	0.0:1.0:0.0:0.0	.	996	P56199	ITA1_HUMAN	L	996	ENSP00000282588:P996L	ENSP00000282588:P996L	P	+	2	0	ITGA1	52269010	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.586000	0.60984	2.688000	0.91661	0.585000	0.79938	CCA	.	.		0.358	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
SNCAIP	9627	hgsc.bcm.edu	37	5	121767681	121767681	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:121767681C>T	ENST00000261368.8	+	6	1462	c.1200C>T	c.(1198-1200)tgC>tgT	p.C400C	SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000261367.7_Silent_p.C447C|SNCAIP_ENST00000542191.1_5'UTR|SNCAIP_ENST00000503116.2_Silent_p.C447C|SNCAIP_ENST00000379538.3_Silent_p.C34C|SNCAIP_ENST00000379533.2_Silent_p.C447C|SNCAIP_ENST00000379536.2_Silent_p.C340C|SNCAIP_ENST00000504884.2_3'UTR	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	400					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AGTTGGAGTGCGTACGCTGGA	0.403																																					p.C400C		Atlas-SNP	.											.	SNCAIP	308	.	0			c.C1200T						.						112.0	99.0	103.0					5																	121767681		2203	4300	6503	SO:0001819	synonymous_variant	9627	exon6			GGAGTGCGTACGC	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1200C>T	chr5.hg19:g.121767681C>T		108.0	0.0		150.0	38.0	NM_005460	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	ENST00000261368.8	hg19	CCDS4131.1																																																																																			.	.		0.403	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
FAM13B	51306	hgsc.bcm.edu	37	5	137284796	137284796	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:137284796C>T	ENST00000033079.3	-	17	2393	c.1942G>A	c.(1942-1944)Ggc>Agc	p.G648S	FAM13B_ENST00000425075.2_Missense_Mutation_p.G552S|FAM13B_ENST00000420893.2_Missense_Mutation_p.G648S	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	648					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AGAGAAGAGCCAAAGCTTTTT	0.388																																					p.G648S		Atlas-SNP	.											.	FAM13B	46	.	0			c.G1942A						.						175.0	167.0	169.0					5																	137284796		2203	4300	6503	SO:0001583	missense	51306	exon17			AAGAGCCAAAGCT	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1942G>A	chr5.hg19:g.137284796C>T	ENSP00000033079:p.Gly648Ser	150.0	0.0		180.0	19.0	NM_001101800	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	hg19	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	C	33	5.248572	0.95305	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.26518	2.89;1.73;2.88	5.06	5.06	0.68205	.	0.255560	0.36628	N	0.002484	T	0.49253	0.1546	L	0.56396	1.775	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;P	0.91635	0.939;0.999;0.871	T	0.45145	-0.9281	10	0.52906	T	0.07	-5.838	18.4225	0.90595	0.0:1.0:0.0:0.0	.	552;648;648	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	S	648;552;648	ENSP00000033079:G648S;ENSP00000394669:G552S;ENSP00000388521:G648S	ENSP00000033079:G648S	G	-	1	0	FAM13B	137312695	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.414000	0.80117	2.508000	0.84585	0.650000	0.86243	GGC	.	.		0.388	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
BTNL3	10917	hgsc.bcm.edu	37	5	180432823	180432823	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:180432823A>C	ENST00000342868.6	+	8	1536	c.1352A>C	c.(1351-1353)gAc>gCc	p.D451A	RNU6-1036P_ENST00000383959.1_RNA	NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	451	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			GCGATGTATGACGAGGAAAAG	0.483																																					p.D451A		Atlas-SNP	.											.	BTNL3	55	.	0			c.A1352C						.						68.0	63.0	65.0					5																	180432823		1941	4146	6087	SO:0001583	missense	10917	exon8			TGTATGACGAGGA	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.1352A>C	chr5.hg19:g.180432823A>C	ENSP00000341787:p.Asp451Ala	97.0	0.0		126.0	30.0	NM_197975	Q496L7|Q9Y2C7	Missense_Mutation	SNP	ENST00000342868.6	hg19	CCDS47358.1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811989	0.32053	.	.	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.60797	0.16	2.37	-0.711	0.11230	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.45276	0.1334	L	0.52126	1.63	0.09310	N	1	B;B	0.23650	0.089;0.0	B;B	0.25614	0.062;0.0	T	0.43861	-0.9365	9	0.66056	D	0.02	.	2.1176	0.03718	0.5797:0.0:0.1676:0.2527	.	417;451	C9JDC2;Q6UXE8	.;BTNL3_HUMAN	A	451;417	ENSP00000341787:D451A	ENSP00000341787:D451A	D	+	2	0	BTNL3	180365429	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.006000	0.12833	-0.467000	0.06932	0.164000	0.16699	GAC	.	.		0.483	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2	NM_197975	
PGBD1	84547	hgsc.bcm.edu	37	6	28268801	28268801	+	Missense_Mutation	SNP	G	G	C	rs143874020		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:28268801G>C	ENST00000405948.2	+	7	1590	c.1170G>C	c.(1168-1170)tgG>tgC	p.W390C	PGBD1_ENST00000259883.3_Missense_Mutation_p.W390C	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	390						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						AAAAGAGTTGGACCAAAAGAG	0.413																																					p.W390C		Atlas-SNP	.											.	PGBD1	106	.	0			c.G1170C						.	G	CYS/TRP,CYS/TRP	1,4405	2.1+/-5.4	0,1,2202	65.0	69.0	68.0		1170,1170	4.5	1.0	6	dbSNP_134	68	0,8600		0,0,4300	no	missense,missense	PGBD1	NM_001184743.1,NM_032507.3	215,215	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	390/810,390/810	28268801	1,13005	2203	4300	6503	SO:0001583	missense	84547	exon7			GAGTTGGACCAAA	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1170G>C	chr6.hg19:g.28268801G>C	ENSP00000385213:p.Trp390Cys	44.0	0.0		60.0	24.0	NM_001184743	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	hg19	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.612478	0.46631	2.27E-4	0.0	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.02369	4.32;4.32	4.54	4.54	0.55810	.	0.195133	0.25836	N	0.027990	T	0.04724	0.0128	L	0.32530	0.975	0.58432	D	0.999993	D	0.89917	1.0	D	0.75020	0.985	T	0.42799	-0.9430	10	0.87932	D	0	-16.3181	12.9975	0.58654	0.0:0.0:1.0:0.0	.	390	Q96JS3	PGBD1_HUMAN	C	390	ENSP00000385213:W390C;ENSP00000259883:W390C	ENSP00000259883:W390C	W	+	3	0	PGBD1	28376780	0.998000	0.40836	0.976000	0.42696	0.862000	0.49288	4.406000	0.59748	2.521000	0.84997	0.655000	0.94253	TGG	.	G|1.000;C|0.000		0.413	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
UBE2J1	51465	hgsc.bcm.edu	37	6	90047985	90047985	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:90047985C>T	ENST00000435041.2	-	5	645	c.367G>A	c.(367-369)Gga>Aga	p.G123R		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	123					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		GCTCCCTCTCCTTTTGTTGGC	0.358																																					p.G123R		Atlas-SNP	.											.	UBE2J1	28	.	0			c.G367A						.						145.0	146.0	146.0					6																	90047985		2203	4300	6503	SO:0001583	missense	51465	exon5			CCTCTCCTTTTGT	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.367G>A	chr6.hg19:g.90047985C>T	ENSP00000451261:p.Gly123Arg	113.0	0.0		202.0	11.0	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	ENST00000435041.2	hg19	CCDS5021.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.972914	0.92919	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.40476	1.03	5.55	5.55	0.83447	Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.67804	0.2932	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.72798	-0.4184	10	0.52906	T	0.07	-6.3346	19.4946	0.95067	0.0:1.0:0.0:0.0	.	123	Q9Y385	UB2J1_HUMAN	R	123;108	ENSP00000451261:G123R	ENSP00000354684:G123R	G	-	1	0	UBE2J1	90104704	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.440000	0.80464	2.604000	0.88044	0.650000	0.86243	GGA	.	.		0.358	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
GPR63	81491	hgsc.bcm.edu	37	6	97247241	97247241	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:97247241G>T	ENST00000229955.3	-	2	712	c.367C>A	c.(367-369)Cta>Ata	p.L123I	GPR63_ENST00000417980.1_Missense_Mutation_p.L123I	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GCAAAAGCTAGGCTGGCAAGG	0.438																																					p.L123I		Atlas-SNP	.											.	GPR63	60	.	0			c.C367A						.						84.0	83.0	83.0					6																	97247241		2203	4300	6503	SO:0001583	missense	81491	exon2			AAGCTAGGCTGGC	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.367C>A	chr6.hg19:g.97247241G>T	ENSP00000229955:p.Leu123Ile	45.0	0.0		55.0	13.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	hg19	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276635	0.59758	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	D;D;D	0.91124	-2.79;-2.79;-2.79	5.1	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	0.093957	0.44483	D	0.000441	D	0.93848	0.8032	H	0.96239	3.79	0.53005	D	0.999963	P	0.52170	0.951	P	0.56514	0.8	D	0.93615	0.6942	10	0.87932	D	0	-1.0651	6.1511	0.20313	0.198:0.0:0.6553:0.1468	.	123	Q9BZJ6	GPR63_HUMAN	I	147;123;123;123	ENSP00000393170:L123I;ENSP00000229955:L123I;ENSP00000358273:L123I	ENSP00000229955:L123I	L	-	1	2	GPR63	97353962	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.864000	0.56024	1.267000	0.44247	0.555000	0.69702	CTA	.	.		0.438	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
MAN1A1	4121	hgsc.bcm.edu	37	6	119511012	119511012	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:119511012C>T	ENST00000368468.3	-	10	1804	c.1363G>A	c.(1363-1365)Gga>Aga	p.G455R		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	455					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		TAAGTTAGTCCGCTGCTAGAC	0.468																																					p.G455R	Ovarian(136;8 1825 12608 33541 47587)	Atlas-SNP	.											MAN1A1,NS,carcinoma,0,2	MAN1A1	77	.	0			c.G1363A						.						73.0	67.0	69.0					6																	119511012		2203	4300	6503	SO:0001583	missense	4121	exon10			TTAGTCCGCTGCT	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1363G>A	chr6.hg19:g.119511012C>T	ENSP00000357453:p.Gly455Arg	76.0	1.0		49.0	13.0	NM_005907	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	hg19	CCDS5122.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763928	0.89932	.	.	ENSG00000111885	ENST00000368468	T	0.71817	-0.6	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.85630	0.5741	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87256	0.2276	10	0.62326	D	0.03	-4.2762	19.4267	0.94743	0.0:1.0:0.0:0.0	.	455	P33908	MA1A1_HUMAN	R	455	ENSP00000357453:G455R	ENSP00000357453:G455R	G	-	1	0	MAN1A1	119552711	1.000000	0.71417	0.115000	0.21578	0.729000	0.41735	7.818000	0.86416	2.596000	0.87737	0.655000	0.94253	GGA	.	.		0.468	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907	
THSD7A	221981	hgsc.bcm.edu	37	7	11485864	11485864	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:11485864G>T	ENST00000423059.4	-	13	3139	c.2888C>A	c.(2887-2889)gCa>gAa	p.A963E	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	963	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CACAGGTTGTGCATTATATTT	0.398										HNSCC(18;0.044)																											p.A963E		Atlas-SNP	.											.	THSD7A	219	.	0			c.C2888A						.						213.0	199.0	203.0					7																	11485864		1872	4119	5991	SO:0001583	missense	221981	exon13			GGTTGTGCATTAT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2888C>A	chr7.hg19:g.11485864G>T	ENSP00000406482:p.Ala963Glu	110.0	0.0		142.0	54.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	hg19	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680427	0.88542	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59083	0.29	5.74	4.87	0.63330	.	0.045699	0.85682	D	0.000000	T	0.65913	0.2737	L	0.47716	1.5	0.80722	D	1	D	0.63046	0.992	P	0.61477	0.889	T	0.63102	-0.6712	10	0.29301	T	0.29	.	14.6117	0.68519	0.0698:0.0:0.9302:0.0	.	963	Q9UPZ6	THS7A_HUMAN	E	963	ENSP00000406482:A963E	ENSP00000262042:A963E	A	-	2	0	THSD7A	11452389	1.000000	0.71417	0.867000	0.34043	0.981000	0.71138	8.018000	0.88722	1.434000	0.47414	0.591000	0.81541	GCA	.	.		0.398	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
CCDC136	64753	hgsc.bcm.edu	37	7	128449544	128449544	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:128449544A>T	ENST00000297788.4	+	11	2013	c.1646A>T	c.(1645-1647)aAg>aTg	p.K549M	CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	549						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						TTGCAGGAAAAGTACAAGGCC	0.587																																					p.K549M		Atlas-SNP	.											.	CCDC136	170	.	0			c.A1646T						.						21.0	24.0	23.0					7																	128449544		2027	4107	6134	SO:0001583	missense	64753	exon11			AGGAAAAGTACAA		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1646A>T	chr7.hg19:g.128449544A>T	ENSP00000297788:p.Lys549Met	248.0	0.0		221.0	61.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	hg19	CCDS47704.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.61|18.61	3.660929|3.660929	0.67700|0.67700	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672|ENST00000494552	T;T|.	0.35789|.	1.29;1.29|.	5.95|5.95	2.06|2.06	0.26882|0.26882	.|.	0.737577|.	0.12983|.	N|.	0.423081|.	T|T	0.24314|0.24314	0.0589|0.0589	L|L	0.34521|0.34521	1.04|1.04	0.20703|0.20703	N|N	0.999869|0.999869	B;B|.	0.33171|.	0.206;0.4|.	B;B|.	0.30855|.	0.085;0.121|.	T|T	0.21484|0.21484	-1.0244|-1.0244	10|5	0.62326|.	D|.	0.03|.	-19.2775|-19.2775	1.5329|1.5329	0.02539|0.02539	0.5498:0.1492:0.0917:0.2092|0.5498:0.1492:0.0917:0.2092	.|.	549;549|.	Q96JN2-2;Q96JN2|.	.;CC136_HUMAN|.	M|C	549;549;549;140|426	ENSP00000297788:K549M;ENSP00000417991:K140M|.	ENSP00000297788:K549M|.	K|S	+|+	2|1	0|0	CCDC136|CCDC136	128236780|128236780	0.332000|0.332000	0.24722|0.24722	0.785000|0.785000	0.31869|0.31869	0.968000|0.968000	0.65278|0.65278	0.640000|0.640000	0.24705|0.24705	0.499000|0.499000	0.27970|0.27970	0.533000|0.533000	0.62120|0.62120	AAG|AGT	.	.		0.587	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
RIC1	57589	hgsc.bcm.edu	37	9	5742973	5742973	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:5742973T>G	ENST00000414202.2	+	9	1197	c.1006T>G	c.(1006-1008)Ttt>Gtt	p.F336V	KIAA1432_ENST00000449720.2_Missense_Mutation_p.F257V|KIAA1432_ENST00000418622.3_Missense_Mutation_p.F257V|KIAA1432_ENST00000381532.2_Missense_Mutation_p.F257V|KIAA1432_ENST00000251879.6_Missense_Mutation_p.F336V	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		ATGGAGTGTTTTTGGAGCACA	0.368																																					p.F336V		Atlas-SNP	.											.	KIAA1432	97	.	0			c.T1006G						.						178.0	176.0	176.0					9																	5742973		2203	4300	6503	SO:0001583	missense	57589	exon9			AGTGTTTTTGGAG																												ENST00000414202.2:c.1006T>G	chr9.hg19:g.5742973T>G	ENSP00000416696:p.Phe336Val	253.0	0.0		328.0	115.0	NM_001206557		Missense_Mutation	SNP	ENST00000414202.2	hg19	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.6|25.6	4.657677|4.657677	0.88154|0.88154	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000545641|ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	.|T;T;T;T;T	.|0.56776	.|0.44;0.44;0.44;0.44;0.44	6.17|6.17	6.17|6.17	0.99709|0.99709	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.74084|0.74084	0.3670|0.3670	M|M	0.82716|0.82716	2.605|2.605	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.69479	.|0.941;0.957;0.964	T|T	0.74538|0.74538	-0.3632|-0.3632	6|10	.|0.38643	.|T	.|0.18	-24.1883|-24.1883	16.8222|16.8222	0.85835|0.85835	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|257;336;336	.|B7ZM67;Q4ADV7;G5E932	.|.;RIC1_HUMAN;.	C|V	264|336;336;257;257;257	.|ENSP00000251879:F336V;ENSP00000416696:F336V;ENSP00000370943:F257V;ENSP00000402240:F257V;ENSP00000398823:F257V	.|ENSP00000251879:F336V	F|F	+|+	2|1	0|0	KIAA1432|KIAA1432	5732973|5732973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.838000|0.838000	0.47535|0.47535	7.637000|7.637000	0.83313|0.83313	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	TTT|TTT	.	.		0.368	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
KDM4C	23081	hgsc.bcm.edu	37	9	6793123	6793123	+	Silent	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:6793123T>C	ENST00000381309.3	+	2	700	c.135T>C	c.(133-135)ggT>ggC	p.G45G	KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000543771.1_Silent_p.G45G|KDM4C_ENST00000535193.1_Silent_p.G67G|KDM4C_ENST00000381306.3_Silent_p.G45G|KDM4C_ENST00000401787.3_Silent_p.G45G|KDM4C_ENST00000442236.2_5'UTR|KDM4C_ENST00000489243.1_3'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	45	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATCGTGCGGGTCTTGCAAAGG	0.418																																					p.G67G		Atlas-SNP	.											.	KDM4C	186	.	0			c.T201C						.						81.0	79.0	80.0					9																	6793123		2203	4300	6503	SO:0001819	synonymous_variant	23081	exon2			TGCGGGTCTTGCA	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.135T>C	chr9.hg19:g.6793123T>C		37.0	0.0		74.0	27.0	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	ENST00000381309.3	hg19	CCDS6471.1																																																																																			.	.		0.418	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
RNF20	56254	hgsc.bcm.edu	37	9	104315030	104315030	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:104315030A>T	ENST00000389120.3	+	13	1986	c.1896A>T	c.(1894-1896)gaA>gaT	p.E632D	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	632					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGAAGATTGAACTCAAGTAAG	0.363																																					p.E632D		Atlas-SNP	.											.	RNF20	110	.	0			c.A1896T						.						52.0	55.0	54.0					9																	104315030		2203	4300	6503	SO:0001583	missense	56254	exon13			GATTGAACTCAAG	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1896A>T	chr9.hg19:g.104315030A>T	ENSP00000373772:p.Glu632Asp	180.0	0.0		222.0	57.0	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	hg19	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.248373	0.39797	.	.	ENSG00000155827	ENST00000389120	T	0.33865	1.39	6.17	-2.09	0.07232	.	0.043508	0.85682	D	0.000000	T	0.20536	0.0494	L	0.33485	1.01	0.58432	D	0.99999	B	0.26483	0.15	B	0.25405	0.06	T	0.03394	-1.1041	10	0.29301	T	0.29	-23.1248	6.8613	0.24067	0.3312:0.0:0.4641:0.2047	.	632	Q5VTR2	BRE1A_HUMAN	D	632	ENSP00000373772:E632D	ENSP00000373772:E632D	E	+	3	2	RNF20	103354851	0.669000	0.27502	0.998000	0.56505	0.762000	0.43233	-0.184000	0.09698	-0.027000	0.13873	0.533000	0.62120	GAA	.	.		0.363	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
DYDC1	143241	hgsc.bcm.edu	37	10	82098869	82098869	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:82098869T>C	ENST00000372204.3	-	6	547	c.383A>G	c.(382-384)gAt>gGt	p.D128G	DYDC1_ENST00000421924.2_Missense_Mutation_p.D128G|DYDC1_ENST00000372202.1_Missense_Mutation_p.D128G	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	128										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			ATGTAGAATATCTTCATTCCT	0.264																																					p.D128G		Atlas-SNP	.											.	DYDC1	15	.	0			c.A383G						.						67.0	60.0	62.0					10																	82098869		2186	4279	6465	SO:0001583	missense	143241	exon5			AGAATATCTTCAT	BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.383A>G	chr10.hg19:g.82098869T>C	ENSP00000361278:p.Asp128Gly	151.0	0.0		288.0	28.0	NM_001269053	A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	hg19	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	T	9.869	1.198414	0.22037	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362	.	.	.	4.88	3.74	0.42951	.	0.890365	0.09714	N	0.765370	T	0.19287	0.0463	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.08055	0.003;0.002	T	0.19353	-1.0308	9	0.33141	T	0.24	-7.4756	7.371	0.26802	0.0:0.0983:0.0:0.9017	.	128;128	A8K927;Q8WWB3	.;DYDC1_HUMAN	G	128	.	ENSP00000361276:D128G	D	-	2	0	DYDC1	82088849	0.377000	0.25106	0.092000	0.20876	0.112000	0.19704	1.674000	0.37544	0.989000	0.38761	0.533000	0.62120	GAT	.	.		0.264	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812	
TNKS2	80351	hgsc.bcm.edu	37	10	93609319	93609319	+	Missense_Mutation	SNP	G	G	A	rs556843721		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:93609319G>A	ENST00000371627.4	+	20	3041	c.2662G>A	c.(2662-2664)Gag>Aag	p.E888K		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	888	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				TCTTGGACTTGAGCACCTAAT	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		18403	0.0		0.0	False		,,,				2504	0.001				p.E888K		Atlas-SNP	.											.	TNKS2	103	.	0			c.G2662A						.						114.0	109.0	110.0					10																	93609319		2203	4300	6503	SO:0001583	missense	80351	exon20			GGACTTGAGCACC	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2662G>A	chr10.hg19:g.93609319G>A	ENSP00000360689:p.Glu888Lys	122.0	0.0		147.0	47.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	hg19	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	35	5.451636	0.96205	.	.	ENSG00000107854	ENST00000371627	D	0.88818	-2.43	5.52	5.52	0.82312	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.64402	D	0.000017	D	0.92977	0.7765	M	0.87758	2.905	0.80722	D	1	P	0.42161	0.772	P	0.46940	0.532	D	0.93365	0.6730	10	0.54805	T	0.06	.	19.4315	0.94772	0.0:0.0:1.0:0.0	.	888	Q9H2K2	TNKS2_HUMAN	K	888	ENSP00000360689:E888K	ENSP00000360689:E888K	E	+	1	0	TNKS2	93599299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.954000	0.87848	2.594000	0.87642	0.585000	0.79938	GAG	.	.		0.323	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
VAX1	11023	hgsc.bcm.edu	37	10	118896079	118896079	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:118896079C>G	ENST00000369206.5	-	2	332	c.333G>C	c.(331-333)caG>caC	p.Q111H	VAX1_ENST00000277905.2_Missense_Mutation_p.Q111H	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	111					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		GCCGATAGAGCTGCTCCGCGG	0.647																																					p.Q111H		Atlas-SNP	.											.	VAX1	50	.	0			c.G333C						.						42.0	39.0	40.0					10																	118896079		2203	4300	6503	SO:0001583	missense	11023	exon2			ATAGAGCTGCTCC	AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.333G>C	chr10.hg19:g.118896079C>G	ENSP00000358207:p.Gln111His	48.0	0.0		46.0	31.0	NM_001112704	B1AVW5|Q6ZSX0	Missense_Mutation	SNP	ENST00000369206.5	hg19	CCDS44483.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760083	0.49468	.	.	ENSG00000148704	ENST00000277905;ENST00000369206	D;D	0.98044	-4.68;-4.68	4.03	4.03	0.46877	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99266	0.9744	H	0.98370	4.215	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.83275	0.996;0.995	D	0.98496	1.0612	10	0.87932	D	0	-4.9345	16.3358	0.83060	0.0:1.0:0.0:0.0	.	111;111	Q5SQQ9;Q5SQQ9-2	VAX1_HUMAN;.	H	111	ENSP00000277905:Q111H;ENSP00000358207:Q111H	ENSP00000277905:Q111H	Q	-	3	2	VAX1	118886069	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.499000	0.66937	2.083000	0.62718	0.455000	0.32223	CAG	.	.		0.647	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050559.3	XM_301242	
AHNAK	79026	hgsc.bcm.edu	37	11	62293785	62293785	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:62293785T>C	ENST00000378024.4	-	5	8378	c.8104A>G	c.(8104-8106)Atc>Gtc	p.I2702V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2702					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.I2702F(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGGGCTTTGATATTCATCTCT	0.458																																					p.I2702V		Atlas-SNP	.											AHNAK,colon,carcinoma,+1,1	AHNAK	532	.	1	Substitution - Missense(1)	lung(1)	c.A8104G						.						192.0	190.0	191.0					11																	62293785		2202	4299	6501	SO:0001583	missense	79026	exon5			CTTTGATATTCAT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8104A>G	chr11.hg19:g.62293785T>C	ENSP00000367263:p.Ile2702Val	189.0	0.0		212.0	11.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	t	2.437	-0.329610	0.05314	.	.	ENSG00000124942	ENST00000378024	T	0.09630	2.96	4.65	-3.77	0.04346	.	.	.	.	.	T	0.05914	0.0154	L	0.38953	1.18	0.09310	N	1	B	0.31009	0.303	B	0.27076	0.076	T	0.43702	-0.9375	9	0.07482	T	0.82	-1.5199	6.7912	0.23701	0.5021:0.0:0.1309:0.367	.	2702	Q09666	AHNK_HUMAN	V	2702	ENSP00000367263:I2702V	ENSP00000367263:I2702V	I	-	1	0	AHNAK	62050361	0.000000	0.05858	0.007000	0.13788	0.768000	0.43524	-5.329000	0.00131	-0.529000	0.06358	0.392000	0.25879	ATC	.	.		0.458	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PPP6R3	55291	hgsc.bcm.edu	37	11	68338555	68338555	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:68338555A>C	ENST00000393800.2	+	12	1580	c.1326A>C	c.(1324-1326)gaA>gaC	p.E442D	PPP6R3_ENST00000393799.2_Missense_Mutation_p.E442D|PPP6R3_ENST00000393801.3_Missense_Mutation_p.E442D|PPP6R3_ENST00000534534.1_Missense_Mutation_p.E210D|PPP6R3_ENST00000527403.2_Missense_Mutation_p.E442D|PPP6R3_ENST00000529710.1_Missense_Mutation_p.E391D|PPP6R3_ENST00000524904.1_Missense_Mutation_p.E442D|PPP6R3_ENST00000265636.5_Missense_Mutation_p.E391D|PPP6R3_ENST00000265637.4_Missense_Mutation_p.E442D|PPP6R3_ENST00000524845.1_Missense_Mutation_p.E442D	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	442					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AAGCCTGGGAAATGAATGAGA	0.294																																					p.E442D		Atlas-SNP	.											.	PPP6R3	159	.	0			c.A1326C						.						78.0	90.0	86.0					11																	68338555		2199	4294	6493	SO:0001583	missense	55291	exon12			CTGGGAAATGAAT	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.1326A>C	chr11.hg19:g.68338555A>C	ENSP00000377389:p.Glu442Asp	61.0	0.0		87.0	19.0	NM_001164162	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	hg19	CCDS53672.1	.	.	.	.	.	.	.	.	.	.	A	14.11	2.437276	0.43224	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.27256	1.68;1.68;1.71;1.78;1.78;1.68;1.69;1.73;1.73;1.78;1.77	5.62	-1.36	0.09085	.	0.440687	0.26753	N	0.022672	T	0.15609	0.0376	L	0.43646	1.37	0.26014	N	0.981956	B;B;B;B;B;B;B;B	0.14805	0.0;0.0;0.001;0.011;0.005;0.006;0.002;0.001	B;B;B;B;B;B;B;B	0.26416	0.003;0.003;0.022;0.025;0.041;0.069;0.003;0.008	T	0.13495	-1.0507	10	0.34782	T	0.22	.	0.8448	0.01159	0.1876:0.2696:0.2929:0.2499	.	154;210;391;442;442;442;442;391	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	D	442;442;210;442;442;442;442;391;391;442;178	ENSP00000377388:E442D;ENSP00000377389:E442D;ENSP00000434429:E210D;ENSP00000431415:E442D;ENSP00000265637:E442D;ENSP00000433058:E442D;ENSP00000377390:E442D;ENSP00000265636:E391D;ENSP00000437329:E391D;ENSP00000433565:E442D;ENSP00000436209:E178D	ENSP00000265636:E391D	E	+	3	2	PPP6R3	68095131	0.818000	0.29161	0.991000	0.47740	0.989000	0.77384	-0.047000	0.11963	-0.154000	0.11118	-0.496000	0.04628	GAA	.	.		0.294	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
RPS3	6188	hgsc.bcm.edu	37	11	75110602	75110602	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:75110602A>G	ENST00000531188.1	+	1	73	c.11A>G	c.(10-12)cAa>cGa	p.Q4R	RPS3_ENST00000530164.1_Missense_Mutation_p.Q4R|RPS3_ENST00000534440.1_Missense_Mutation_p.Q4R|RPS3_ENST00000524851.1_Missense_Mutation_p.Q4R|SNORD15A_ENST00000384214.1_RNA|RPS3_ENST00000527446.1_Missense_Mutation_p.Q4R|RPS3_ENST00000526608.1_Missense_Mutation_p.Q4R|RPS3_ENST00000278572.6_Missense_Mutation_p.Q4R	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	4					cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						ATGGCAGTGCAAATATCCAAG	0.662																																					p.Q4R		Atlas-SNP	.											.	RPS3	20	.	0			c.A11G						.						47.0	49.0	48.0					11																	75110602		2200	4293	6493	SO:0001583	missense	6188	exon1			CAGTGCAAATATC		CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.11A>G	chr11.hg19:g.75110602A>G	ENSP00000434643:p.Gln4Arg	110.0	0.0		113.0	31.0	NM_001256802	B2R7N5|J3KN86|Q498B5|Q8NI95	Missense_Mutation	SNP	ENST00000531188.1	hg19	CCDS8236.1	.	.	.	.	.	.	.	.	.	.	a	14.36	2.513561	0.44763	.	.	ENSG00000149273	ENST00000531188;ENST00000530164;ENST00000530689;ENST00000278572;ENST00000534440;ENST00000527446;ENST00000526608;ENST00000527273;ENST00000524851	.	.	.	5.74	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.60431	0.2268	M	0.62266	1.93	0.58432	D	0.999992	B	0.06786	0.001	B	0.27500	0.08	T	0.62905	-0.6755	9	0.72032	D	0.01	-1.5195	10.7726	0.46332	0.8411:0.1589:0.0:0.0	.	4	P23396	RS3_HUMAN	R	4	.	ENSP00000278572:Q4R	Q	+	2	0	RPS3	74788250	1.000000	0.71417	0.949000	0.38748	0.132000	0.20833	6.324000	0.72896	2.194000	0.70268	0.449000	0.29647	CAA	.	.		0.662	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
FAT3	120114	hgsc.bcm.edu	37	11	92531317	92531317	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:92531317T>A	ENST00000298047.6	+	9	5155	c.5138T>A	c.(5137-5139)aTc>aAc	p.I1713N	FAT3_ENST00000409404.2_Missense_Mutation_p.I1713N|FAT3_ENST00000525166.1_Missense_Mutation_p.I1563N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1713	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATTAATGGGATCTTTACCATA	0.398										TCGA Ovarian(4;0.039)																											p.I1713N		Atlas-SNP	.											.	FAT3	1822	.	0			c.T5138A						.						108.0	107.0	107.0					11																	92531317		1957	4143	6100	SO:0001583	missense	120114	exon9			ATGGGATCTTTAC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5138T>A	chr11.hg19:g.92531317T>A	ENSP00000298047:p.Ile1713Asn	104.0	0.0		149.0	56.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	T	12.04	1.818661	0.32145	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.50277	0.75;0.75;0.75	5.93	-2.4	0.06583	.	.	.	.	.	T	0.29458	0.0734	N	0.25485	0.75	0.09310	N	1	B	0.28605	0.217	B	0.24541	0.054	T	0.15206	-1.0445	9	0.30854	T	0.27	.	9.459	0.38772	0.0:0.5162:0.1259:0.3579	.	1713	Q8TDW7-3	.	N	1713;1713;1563	ENSP00000298047:I1713N;ENSP00000387040:I1713N;ENSP00000432586:I1563N	ENSP00000298047:I1713N	I	+	2	0	FAT3	92170965	0.000000	0.05858	0.001000	0.08648	0.809000	0.45718	0.103000	0.15292	-0.421000	0.07416	0.482000	0.46254	ATC	.	.		0.398	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
SCN3B	55800	hgsc.bcm.edu	37	11	123513234	123513234	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:123513234A>T	ENST00000392770.2	-	3	1167	c.365T>A	c.(364-366)gTg>gAg	p.V122E	SCN3B_ENST00000299333.3_Missense_Mutation_p.V122E|SCN3B_ENST00000530277.1_Missense_Mutation_p.V122E	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	122	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCCGGGACACATTGCAGGT	0.602																																					p.V122E		Atlas-SNP	.											.	SCN3B	53	.	0			c.T365A						.						104.0	96.0	99.0					11																	123513234		2202	4299	6501	SO:0001583	missense	55800	exon3			CGGGACACATTGC	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.365T>A	chr11.hg19:g.123513234A>T	ENSP00000376523:p.Val122Glu	54.0	0.0		71.0	18.0	NM_018400	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	ENST00000392770.2	hg19	CCDS8442.1	.	.	.	.	.	.	.	.	.	.	A	32	5.160704	0.94727	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110193	0.64402	D	0.000008	D	0.97430	0.9159	M	0.79805	2.47	0.80722	D	1	D	0.63046	0.992	P	0.62089	0.898	D	0.97985	1.0351	10	0.87932	D	0	-9.7242	16.5655	0.84588	1.0:0.0:0.0:0.0	.	122	Q9NY72	SCN3B_HUMAN	E	122	ENSP00000376523:V122E;ENSP00000299333:V122E;ENSP00000432785:V122E;ENSP00000435554:V122E	ENSP00000299333:V122E	V	-	2	0	SCN3B	123018444	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.285000	0.89914	2.302000	0.77476	0.533000	0.62120	GTG	.	.		0.602	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400	
BAZ2A	11176	hgsc.bcm.edu	37	12	56993854	56993854	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:56993854C>A	ENST00000551812.1	-	25	5118	c.4925G>T	c.(4924-4926)cGt>cTt	p.R1642L	BAZ2A_ENST00000179765.5_Missense_Mutation_p.R1610L|BAZ2A_ENST00000549884.1_Missense_Mutation_p.R1640L|BAZ2A_ENST00000379441.3_Missense_Mutation_p.R1612L|BAZ2A_ENST00000553222.1_5'Flank	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1642					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R1642H(2)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GCGCCAGACACGAATGCGAGG	0.572																																					p.R1642L		Atlas-SNP	.											BAZ2A_ENST00000551812,colon,carcinoma,0,2	BAZ2A	263	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4925T						.						81.0	82.0	82.0					12																	56993854		2002	4179	6181	SO:0001583	missense	11176	exon25			CAGACACGAATGC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.4925G>T	chr12.hg19:g.56993854C>A	ENSP00000446880:p.Arg1642Leu	90.0	0.0		73.0	29.0	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	hg19	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001011	0.93227	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.71698	-0.34;-0.34;-0.36;-0.59;-0.36	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	L	0.47716	1.5	0.80722	D	1	D;P;B;D	0.89917	0.999;0.524;0.272;1.0	D;P;B;D	0.91635	0.996;0.498;0.302;0.999	T	0.77305	-0.2637	10	0.35671	T	0.21	-14.6921	18.5763	0.91155	0.0:1.0:0.0:0.0	.	1640;1638;1642;1615	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	L	1612;1610;1642;574;1640	ENSP00000368754:R1612L;ENSP00000179765:R1610L;ENSP00000446880:R1642L;ENSP00000448760:R574L;ENSP00000447941:R1640L	ENSP00000179765:R1610L	R	-	2	0	BAZ2A	55280121	1.000000	0.71417	0.962000	0.40283	0.989000	0.77384	5.568000	0.67385	2.763000	0.94921	0.650000	0.86243	CGT	.	.		0.572	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
PTPRQ	374462	hgsc.bcm.edu	37	12	81004359	81004359	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:81004359G>C	ENST00000266688.5	+	33	4861	c.4861G>C	c.(4861-4863)Gaa>Caa	p.E1621Q				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1667	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TGCATATGTAGAAGGGAAGTC	0.333																																					p.E1453Q		Atlas-SNP	.											.	PTPRQ	119	.	0			c.G4357C						.						89.0	71.0	76.0					12																	81004359		692	1589	2281	SO:0001583	missense	374462	exon25			TATGTAGAAGGGA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4861G>C	chr12.hg19:g.81004359G>C	ENSP00000266688:p.Glu1621Gln	57.0	0.0		85.0	16.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.28|12.28	1.890434|1.890434	0.33348|0.33348	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.37584|.	1.19|.	6.05|6.05	6.05|6.05	0.98169|0.98169	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|.	0.75946|.	0.3919|.	.|.	.|.	.|.	0.35947|0.35947	D|D	0.833661|0.833661	B|.	0.28713|.	0.22|.	B|.	0.34180|.	0.177|.	T|.	0.76774|.	-0.2835|.	8|.	0.13853|.	T|.	0.58|.	.|.	20.6013|20.6013	0.99457|0.99457	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1667|.	Q9UMZ3|.	PTPRQ_HUMAN|.	Q|Y	1621|1321	ENSP00000266688:E1621Q|.	ENSP00000266688:E1621Q|.	E|X	+|+	1|3	0|2	PTPRQ|PTPRQ	79528490|79528490	1.000000|1.000000	0.71417|0.71417	0.836000|0.836000	0.33094|0.33094	0.183000|0.183000	0.23260|0.23260	4.097000|4.097000	0.57741|0.57741	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GAA|TAG	.	.		0.333	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
UBE2N	7334	hgsc.bcm.edu	37	12	93804590	93804590	+	Missense_Mutation	SNP	C	C	G	rs555116824		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:93804590C>G	ENST00000318066.2	-	3	715	c.338G>C	c.(337-339)aGt>aCt	p.S113T	UBE2N_ENST00000550657.1_3'UTR|UBE2N_ENST00000552442.1_Intron|UBE2N_ENST00000549833.1_Missense_Mutation_p.S50T	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	113					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|DNA double-strand break processing (GO:0000729)|double-strand break repair via homologous recombination (GO:0000724)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone ubiquitination (GO:0016574)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone modification (GO:0031058)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|postreplication repair (GO:0006301)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of DNA repair (GO:0006282)|regulation of histone ubiquitination (GO:0033182)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-MMS2 complex (GO:0031372)|UBC13-UEV1A complex (GO:0035370)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|liver(2)|lung(5)	10						ATTGGGAGCACTTAACAAGGC	0.463								Direct reversal of damage;Rad6 pathway																													p.S113T	Pancreas(197;738 2228 30225 32034 33454)	Atlas-SNP	.											.	UBE2N	20	.	0			c.G338C						.						154.0	134.0	141.0					12																	93804590		2203	4300	6503	SO:0001583	missense	7334	exon3			GGAGCACTTAACA	D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889		"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""			8902611	Standard	NM_003348		Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000318066.2:c.338G>C	chr12.hg19:g.93804590C>G	ENSP00000316176:p.Ser113Thr	147.0	0.0		201.0	24.0	NM_003348	Q16781|Q53Y81	Missense_Mutation	SNP	ENST00000318066.2	hg19	CCDS31875.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675421	0.67928	.	.	ENSG00000177889	ENST00000318066;ENST00000549833	T;T	0.37584	1.19;1.19	5.94	5.94	0.96194	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.43500	0.1250	L	0.49699	1.58	0.80722	D	1	P	0.38617	0.64	P	0.45232	0.474	T	0.05750	-1.0866	9	0.16896	T	0.51	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	113	P61088	UBE2N_HUMAN	T	113;50	ENSP00000316176:S113T;ENSP00000450260:S50T	ENSP00000316176:S113T	S	-	2	0	UBE2N	92328721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.633000	0.67825	2.820000	0.97059	0.650000	0.86243	AGT	.	.		0.463	UBE2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407710.1	NM_003348	
ANO4	121601	hgsc.bcm.edu	37	12	101381373	101381373	+	Missense_Mutation	SNP	T	T	A	rs576854824		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:101381373T>A	ENST00000392977.3	+	8	869	c.659T>A	c.(658-660)cTg>cAg	p.L220Q	ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.L185Q|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	220					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CCAATGAGGCTGGACAAGGAG	0.498										HNSCC(74;0.22)	OREG0022059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L185Q		Atlas-SNP	.											.	ANO4	183	.	0			c.T554A						.						254.0	234.0	241.0					12																	101381373		2203	4300	6503	SO:0001583	missense	121601	exon7			TGAGGCTGGACAA	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.659T>A	chr12.hg19:g.101381373T>A	ENSP00000376703:p.Leu220Gln	47.0	0.0	1358	39.0	17.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	hg19		.	.	.	.	.	.	.	.	.	.	T	17.65	3.442982	0.63067	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.69561	-0.41;-0.41	5.33	5.33	0.75918	.	0.097548	0.42682	D	0.000680	T	0.63873	0.2548	M	0.67953	2.075	0.80722	D	1	P;B	0.39940	0.696;0.343	B;B	0.33799	0.17;0.133	T	0.70472	-0.4862	10	0.72032	D	0.01	.	15.3283	0.74186	0.0:0.0:0.0:1.0	.	220;185	Q32M45;Q32M45-2	ANO4_HUMAN;.	Q	185;220	ENSP00000376705:L185Q;ENSP00000376703:L220Q	ENSP00000376703:L220Q	L	+	2	0	ANO4	99905504	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.817000	0.86213	2.020000	0.59435	0.533000	0.62120	CTG	.	.		0.498	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
SKA3	221150	hgsc.bcm.edu	37	13	21742126	21742126	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:21742126C>A	ENST00000314759.5	-	4	868		c.e4+1		SKA3_ENST00000400018.3_Splice_Site	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3						chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GAGCTGCTTACCTTTTATTAT	0.284																																					.		Atlas-SNP	.											.	SKA3	76	.	0			c.743+1G>T						.						63.0	58.0	60.0					13																	21742126		2203	4297	6500	SO:0001630	splice_region_variant	221150	exon5			TGCTTACCTTTTA	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.743+1G>T	chr13.hg19:g.21742126C>A		65.0	0.0		91.0	8.0	NM_001166017	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Splice_Site	SNP	ENST00000314759.5	hg19	CCDS31946.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052163	0.36181	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6803	0.77364	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SKA3	20640126	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	4.395000	0.59678	2.777000	0.95525	0.655000	0.94253	.	.	.		0.284	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061	Intron
CENPJ	55835	hgsc.bcm.edu	37	13	25466801	25466801	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:25466801C>A	ENST00000381884.4	-	10	3381	c.3196G>T	c.(3196-3198)Gag>Tag	p.E1066*	CENPJ_ENST00000545981.1_Nonsense_Mutation_p.E1066*	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1066					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TCCTTCTTCTCCACCTCGAGG	0.517																																					p.E1066X		Atlas-SNP	.											.	CENPJ	116	.	0			c.G3196T						.						137.0	133.0	135.0					13																	25466801		2203	4300	6503	SO:0001587	stop_gained	55835	exon10			TCTTCTCCACCTC	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3196G>T	chr13.hg19:g.25466801C>A	ENSP00000371308:p.Glu1066*	118.0	0.0		175.0	45.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Nonsense_Mutation	SNP	ENST00000381884.4	hg19	CCDS9310.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.999|8.999	0.979745|0.979745	0.18812|0.18812	.|.	.|.	ENSG00000151849|ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729|ENST00000418179	.|.	.|.	.|.	4.43|4.43	-6.4|-6.4	0.01944|0.01944	.|.	3.307320|.	0.00890|.	N|.	0.002233|.	.|T	.|0.17831	.|0.0428	.|.	.|.	.|.	0.47123|0.47123	A|A	0.999326|0.999326	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.29243	.|-1.0018	.|3	0.10636|.	T|.	0.68|.	.|.	3.1467|3.1467	0.06474|0.06474	0.1362:0.155:0.1234:0.5855|0.1362:0.155:0.1234:0.5855	.|.	.|.	.|.	.|.	X|V	1066|147	.|.	ENSP00000371308:E1066X|.	E|G	-|-	1|2	0|0	CENPJ|CENPJ	24364801|24364801	0.384000|0.384000	0.25164|0.25164	0.000000|0.000000	0.03702|0.03702	0.024000|0.024000	0.10985|0.10985	0.729000|0.729000	0.26028|0.26028	-0.801000|-0.801000	0.04427|0.04427	-0.391000|-0.391000	0.06502|0.06502	GAG|GGA	.	.		0.517	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
RB1	5925	hgsc.bcm.edu	37	13	48953728	48953728	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:48953728A>G	ENST00000267163.4	+	14	1470		c.e14-1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GTTTGTTTGTAGCGATACAAA	0.333		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1_ENST00000267163,NS,carcinoma,0,2	RB1	1068	.	25	Whole gene deletion(15)|Unknown(10)	bone(11)|breast(5)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.1333-2A>G	GRCh37	CS030552	RB1	S		.						18.0	19.0	19.0					13																	48953728		2200	4299	6499	SO:0001630	splice_region_variant	5925	exon14	Familial Cancer Database		GTTTGTAGCGATA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1333-1A>G	chr13.hg19:g.48953728A>G		109.0	0.0		143.0	48.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605344	0.87157	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0294	0.80567	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47851729	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.469000	0.90395	2.185000	0.69588	0.455000	0.32223	.	.	.		0.333	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
LRFN5	145581	hgsc.bcm.edu	37	14	42356583	42356583	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:42356583G>A	ENST00000298119.4	+	3	1944	c.755G>A	c.(754-756)aGg>aAg	p.R252K	LRFN5_ENST00000554171.1_Missense_Mutation_p.R252K|LRFN5_ENST00000554120.1_Missense_Mutation_p.R252K	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	252	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TTGTGGTTGAGGCGTCTGTCC	0.443										HNSCC(30;0.082)																											p.R252K		Atlas-SNP	.											.	LRFN5	269	.	0			c.G755A						.						171.0	170.0	170.0					14																	42356583		2203	4300	6503	SO:0001583	missense	145581	exon3			GGTTGAGGCGTCT	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.755G>A	chr14.hg19:g.42356583G>A	ENSP00000298119:p.Arg252Lys	65.0	0.0		84.0	9.0	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	hg19	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937910	0.73557	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.52057	0.68;0.68;0.68	5.69	5.69	0.88448	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.64402	D	0.000006	T	0.67392	0.2888	M	0.66560	2.04	0.58432	D	0.999999	D;P	0.58970	0.984;0.947	D;D	0.69824	0.966;0.925	T	0.67007	-0.5779	10	0.52906	T	0.07	.	17.3157	0.87224	0.0:0.0:1.0:0.0	.	252;252	G3V364;Q96NI6	.;LRFN5_HUMAN	K	252	ENSP00000298119:R252K;ENSP00000451897:R252K;ENSP00000451067:R252K	ENSP00000298119:R252K	R	+	2	0	LRFN5	41426333	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.676000	0.91093	0.557000	0.71058	AGG	.	.		0.443	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
IL21R	50615	hgsc.bcm.edu	37	16	27460454	27460454	+	Silent	SNP	G	G	T	rs56002407	byFrequency	TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:27460454G>T	ENST00000337929.3	+	9	1940	c.1467G>T	c.(1465-1467)acG>acT	p.T489T	IL21R_ENST00000395755.1_Silent_p.T489T|IL21R_ENST00000395754.4_Silent_p.T489T|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Silent_p.T489T	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	489					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						ATATGGACACGTTTGACAGTG	0.677			T	BCL6	NHL																																p.T511T		Atlas-SNP	.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95	.	0			c.G1533T						.						47.0	41.0	43.0					16																	27460454		2196	4298	6494	SO:0001819	synonymous_variant	50615	exon10			GGACACGTTTGAC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1467G>T	chr16.hg19:g.27460454G>T		48.0	0.0		22.0	11.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	ENST00000337929.3	hg19	CCDS10630.1																																																																																			.	G|0.999;A|0.001		0.677	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
SLC38A7	55238	hgsc.bcm.edu	37	16	58706093	58706093	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:58706093G>T	ENST00000570101.1	-	8	1821	c.938C>A	c.(937-939)tCc>tAc	p.S313Y	SLC38A7_ENST00000566953.1_5'UTR|SLC38A7_ENST00000564100.1_Intron|SLC38A7_ENST00000219320.4_Missense_Mutation_p.S313Y|SLC38A7_ENST00000564010.1_Missense_Mutation_p.S224Y			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	313					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						CGAGGGATAGGACAGGAGCAC	0.622																																					p.S313Y		Atlas-SNP	.											.	SLC38A7	26	.	0			c.C938A						.						50.0	40.0	43.0					16																	58706093		2187	4289	6476	SO:0001583	missense	55238	exon9			GGATAGGACAGGA	BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.938C>A	chr16.hg19:g.58706093G>T	ENSP00000454646:p.Ser313Tyr	80.0	0.0		52.0	26.0	NM_018231	Q53GJ9|Q9H9I5	Missense_Mutation	SNP	ENST00000570101.1	hg19	CCDS10800.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151293	0.94645	.	.	ENSG00000103042	ENST00000219320	T	0.02812	4.15	5.36	5.36	0.76844	.	0.110975	0.64402	D	0.000004	T	0.16428	0.0395	M	0.77313	2.365	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.00215	-1.1911	9	.	.	.	.	18.0759	0.89427	0.0:0.0:1.0:0.0	.	313	Q9NVC3	S38A7_HUMAN	Y	313	ENSP00000219320:S313Y	.	S	-	2	0	SLC38A7	57263594	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.360000	0.97119	2.497000	0.84241	0.591000	0.81541	TCC	.	.		0.622	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231	
TMEM106A	113277	hgsc.bcm.edu	37	17	41368750	41368750	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:41368750A>C	ENST00000331615.3	+	7	842	c.605A>C	c.(604-606)gAa>gCa	p.E202A	TMEM106A_ENST00000588659.1_Missense_Mutation_p.E202A|LINC00854_ENST00000595400.1_RNA|LINC00854_ENST00000593624.1_RNA|LINC00854_ENST00000427995.1_RNA|TMEM106A_ENST00000541594.1_Missense_Mutation_p.E154A|TMEM106A_ENST00000536052.1_Missense_Mutation_p.E155A	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	202						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		ATACGGGATGAAAACACATAG	0.498																																					p.E202A		Atlas-SNP	.											.	TMEM106A	20	.	0			c.A605C						.						256.0	220.0	233.0					17																	41368750		2203	4296	6499	SO:0001583	missense	113277	exon7			GGGATGAAAACAC	AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.605A>C	chr17.hg19:g.41368750A>C	ENSP00000330774:p.Glu202Ala	104.0	0.0		151.0	19.0	NM_145041	A8K2X2|B7Z698	Missense_Mutation	SNP	ENST00000331615.3	hg19	CCDS11462.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.825993	0.50739	.	.	ENSG00000184988	ENST00000331615;ENST00000536052;ENST00000541594	T;T;T	0.24350	1.86;1.86;1.86	5.07	3.99	0.46301	.	0.694941	0.14548	N	0.312806	T	0.41073	0.1143	M	0.80982	2.52	0.31795	N	0.629097	P;P;P	0.51449	0.945;0.818;0.945	P;B;P	0.52672	0.706;0.3;0.706	T	0.50955	-0.8766	10	0.44086	T	0.13	13.3063	8.2242	0.31560	0.9073:0.0:0.0927:0.0	.	155;154;202	B7Z779;B7Z698;Q96A25	.;.;T106A_HUMAN	A	202;155;154	ENSP00000330774:E202A;ENSP00000439835:E155A;ENSP00000439844:E154A	ENSP00000330774:E202A	E	+	2	0	TMEM106A	38724276	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	2.384000	0.44362	2.028000	0.59812	0.533000	0.62120	GAA	.	.		0.498	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2	NM_145041	
SPATA20	64847	hgsc.bcm.edu	37	17	48629417	48629417	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:48629417G>A	ENST00000356488.4	+	13	1868	c.1785G>A	c.(1783-1785)gcG>gcA	p.A595A	SPATA20_ENST00000393244.3_Silent_p.A551A|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Silent_p.A611A	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	595					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGGAGAGTGCGTGGCTCGAGT	0.657																																					p.A611A		Atlas-SNP	.											.	SPATA20	59	.	0			c.G1833A						.						31.0	35.0	33.0					17																	48629417		2202	4299	6501	SO:0001819	synonymous_variant	64847	exon14			GAGTGCGTGGCTC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1785G>A	chr17.hg19:g.48629417G>A		108.0	0.0		121.0	20.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	hg19	CCDS58563.1																																																																																			.	.		0.657	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
GH2	2689	hgsc.bcm.edu	37	17	61957832	61957832	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:61957832G>T	ENST00000423893.2	-	5	564	c.503C>A	c.(502-504)tCc>tAc	p.S168Y	GH2_ENST00000332800.7_Silent_p.V252V|GH2_ENST00000449787.2_Missense_Mutation_p.S153Y|GH2_ENST00000456543.2_Missense_Mutation_p.P167T			P01242	SOM2_HUMAN	growth hormone 2	168					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						CTTGCTGTAGGACTGATTGAA	0.542																																					p.S168Y		Atlas-SNP	.											.	GH2	73	.	0			c.C503A						.						189.0	157.0	168.0					17																	61957832		2203	4300	6503	SO:0001583	missense	2689	exon5			CTGTAGGACTGAT	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.503C>A	chr17.hg19:g.61957832G>T	ENSP00000409294:p.Ser168Tyr	216.0	0.0		241.0	48.0	NM_002059	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	hg19	CCDS11647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.41|11.41	1.631433|1.631433	0.28978|0.28978	.|.	.|.	ENSG00000136487|ENSG00000136487	ENST00000456543|ENST00000423893;ENST00000449787	D|D;D	0.90844|0.87029	-2.74|-2.2;-2.2	2.74|2.74	2.74|2.74	0.32292|0.32292	.|Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.|.	.|.	.|.	.|.	D|D	0.88291|0.88291	0.6397|0.6397	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|B;B	0.12630|0.26744	0.006|0.158;0.013	B|B;B	0.12156|0.42495	0.007|0.389;0.06	D|D	0.88642|0.88642	0.3176|0.3176	8|8	0.54805|0.87932	T|D	0.06|0	.|.	12.4782|12.4782	0.55827|0.55827	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	167|168;153	O14644|P01242;O14643	.|SOM2_HUMAN;.	T|Y	167|168;153	ENSP00000394122:P167T|ENSP00000409294:S168Y;ENSP00000410618:S153Y	ENSP00000394122:P167T|ENSP00000409294:S168Y	P|S	-|-	1|2	0|0	GH2|GH2	59311564|59311564	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.022000|0.022000	0.10575|0.10575	6.244000|6.244000	0.72391|0.72391	1.531000|1.531000	0.49152|0.49152	0.306000|0.306000	0.20318|0.20318	CCT|TCC	.	.		0.542	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
EVPL	2125	hgsc.bcm.edu	37	17	74019605	74019605	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:74019605G>T	ENST00000301607.3	-	3	582	c.329C>A	c.(328-330)cCg>cAg	p.P110Q	EVPL_ENST00000586740.1_Missense_Mutation_p.P110Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	110	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTCAGCCTGCGGGTGCTTGAG	0.667																																					p.P110Q		Atlas-SNP	.											.	EVPL	155	.	0			c.C329A						.						33.0	42.0	39.0					17																	74019605		2202	4299	6501	SO:0001583	missense	2125	exon3			GCCTGCGGGTGCT	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.329C>A	chr17.hg19:g.74019605G>T	ENSP00000301607:p.Pro110Gln	65.0	0.0		68.0	23.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	hg19	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914910	0.72983	.	.	ENSG00000167880	ENST00000301607	T	0.66280	-0.2	4.66	3.67	0.42095	.	0.056975	0.64402	D	0.000001	T	0.73992	0.3658	M	0.64170	1.965	0.46701	D	0.999163	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75505	-0.3294	10	0.87932	D	0	-40.3397	10.5343	0.44994	0.0756:0.1326:0.7918:0.0	.	110;110	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	110	ENSP00000301607:P110Q	ENSP00000301607:P110Q	P	-	2	0	EVPL	71531200	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	6.067000	0.71193	1.070000	0.40811	0.561000	0.74099	CCG	.	.		0.667	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
GATA6	2627	hgsc.bcm.edu	37	18	19780725	19780725	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr18:19780725C>T	ENST00000269216.3	+	7	2004	c.1727C>T	c.(1726-1728)tCg>tTg	p.S576L	GATA6_ENST00000581694.1_Missense_Mutation_p.S576L|RP11-627G18.1_ENST00000583442.1_RNA	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	576					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			AGTCTCGCCTCGCCGGCCGAA	0.682																																					p.S576L	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	Atlas-SNP	.											.	GATA6	35	.	0			c.C1727T						.						68.0	52.0	57.0					18																	19780725		2203	4300	6503	SO:0001583	missense	2627	exon7			TCGCCTCGCCGGC	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1727C>T	chr18.hg19:g.19780725C>T	ENSP00000269216:p.Ser576Leu	41.0	0.0		45.0	12.0	NM_005257	B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	hg19	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278368	0.80692	.	.	ENSG00000141448	ENST00000269216	D	0.98075	-4.7	5.81	4.94	0.65067	.	0.295719	0.33057	N	0.005323	D	0.96349	0.8809	M	0.66939	2.045	0.54753	D	0.999981	B	0.24768	0.111	B	0.14578	0.011	D	0.94761	0.7936	10	0.66056	D	0.02	-15.671	14.8494	0.70284	0.0:0.9314:0.0:0.0686	.	576	Q92908	GATA6_HUMAN	L	576	ENSP00000269216:S576L	ENSP00000269216:S576L	S	+	2	0	GATA6	18034723	0.998000	0.40836	0.729000	0.30791	0.967000	0.64934	3.730000	0.55006	1.467000	0.48044	0.655000	0.94253	TCG	.	.		0.682	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257	
DOCK6	57572	hgsc.bcm.edu	37	19	11339690	11339690	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:11339690G>A	ENST00000294618.7	-	23	2751	c.2740C>T	c.(2740-2742)Ctg>Ttg	p.L914L	DOCK6_ENST00000319867.7_Silent_p.L253L	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	914					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						ACCCACTGCAGAGCCAGCTCC	0.647																																					p.L914L		Atlas-SNP	.											.	DOCK6	104	.	0			c.C2740T						.						32.0	37.0	35.0					19																	11339690		2139	4249	6388	SO:0001819	synonymous_variant	57572	exon23			ACTGCAGAGCCAG		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2740C>T	chr19.hg19:g.11339690G>A		51.0	0.0		37.0	15.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	hg19	CCDS45975.1																																																																																			.	.		0.647	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
PDGFB	5155	hgsc.bcm.edu	37	22	39621841	39621841	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr22:39621841G>A	ENST00000331163.6	-	6	1400	c.613C>T	c.(613-615)Caa>Taa	p.Q205*	PDGFB_ENST00000381551.4_Nonsense_Mutation_p.Q190*	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	205					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)		COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					ACCCGAGTTTGGGGCGTTTTG	0.592			T	COL1A1	DFSP																																p.Q205X		Atlas-SNP	.		Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	.	PDGFB	91	.	0			c.C613T						.						81.0	69.0	73.0					22																	39621841		2203	4300	6503	SO:0001587	stop_gained	5155	exon6			GAGTTTGGGGCGT		CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.613C>T	chr22.hg19:g.39621841G>A	ENSP00000330382:p.Gln205*	69.0	0.0		81.0	13.0	NM_002608	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Nonsense_Mutation	SNP	ENST00000331163.6	hg19	CCDS13987.1	.	.	.	.	.	.	.	.	.	.	G	43	10.183253	0.99354	.	.	ENSG00000100311	ENST00000331163;ENST00000381551	.	.	.	5.04	4.01	0.46588	.	0.531612	0.19911	N	0.103299	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-16.7667	11.9389	0.52888	0.0:0.0:0.8258:0.1742	.	.	.	.	X	205;190	.	ENSP00000330382:Q205X	Q	-	1	0	PDGFB	37951787	1.000000	0.71417	0.987000	0.45799	0.934000	0.57294	4.089000	0.57685	1.350000	0.45770	-0.181000	0.13052	CAA	.	.		0.592	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321043.1	NM_002608	
TLR8	51311	hgsc.bcm.edu	37	X	12937428	12937428	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:12937428C>G	ENST00000218032.6	+	2	356	c.269C>G	c.(268-270)aCt>aGt	p.T90S	TLR8_ENST00000311912.5_Missense_Mutation_p.T108S	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	90					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	CAAAATCTCACTAAAATAAAT	0.418																																					p.T90S		Atlas-SNP	.											.	TLR8	134	.	0			c.C269G						.						113.0	113.0	113.0					X																	12937428		2203	4300	6503	SO:0001583	missense	51311	exon2			ATCTCACTAAAAT	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.269C>G	chrX.hg19:g.12937428C>G	ENSP00000218032:p.Thr90Ser	112.0	0.0		144.0	49.0	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	hg19	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615897	0.46631	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.57107	0.42;0.42	5.2	3.41	0.39046	.	0.199084	0.25388	N	0.031036	T	0.57446	0.2054	L	0.45051	1.395	0.09310	N	1	D;D	0.67145	0.982;0.996	P;D	0.66979	0.823;0.948	T	0.47749	-0.9093	10	0.59425	D	0.04	.	4.9567	0.14044	0.1425:0.5564:0.0:0.301	.	90;108	Q9NR97;D1CS70	TLR8_HUMAN;.	S	90;108	ENSP00000218032:T90S;ENSP00000312082:T108S	ENSP00000218032:T90S	T	+	2	0	TLR8	12847349	0.094000	0.21725	0.002000	0.10522	0.908000	0.53690	0.887000	0.28254	0.418000	0.25898	0.523000	0.50628	ACT	.	.		0.418	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
GLUD2	2747	hgsc.bcm.edu	37	X	120182439	120182439	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:120182439G>A	ENST00000328078.1	+	1	978	c.901G>A	c.(901-903)Gat>Aat	p.D301N		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	301					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AGGGTTTAGAGATAAAACATT	0.408																																					p.D301N		Atlas-SNP	.											.	GLUD2	89	.	0			c.G901A						.						198.0	178.0	185.0					X																	120182439		2203	4300	6503	SO:0001583	missense	2747	exon1			TTTAGAGATAAAA	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.901G>A	chrX.hg19:g.120182439G>A	ENSP00000327589:p.Asp301Asn	298.0	0.0		379.0	96.0	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	hg19	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996636	0.35226	.	.	ENSG00000182890	ENST00000328078	D	0.96522	-4.04	2.3	0.373	0.16178	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.091849	0.64402	D	0.000001	D	0.92041	0.7478	L	0.41124	1.26	0.43593	D	0.995942	B	0.20052	0.041	B	0.27262	0.078	D	0.83479	0.0063	10	0.54805	T	0.06	-2.2924	5.9678	0.19334	0.3085:0.0:0.6915:0.0	.	301	P49448	DHE4_HUMAN	N	301	ENSP00000327589:D301N	ENSP00000327589:D301N	D	+	1	0	GLUD2	120010120	1.000000	0.71417	0.720000	0.30636	0.938000	0.57974	6.619000	0.74219	-0.116000	0.11893	0.472000	0.43445	GAT	.	.		0.408	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
NCOR2	9612	hgsc.bcm.edu	37	12	124821719	124821753	+	Splice_Site	DEL	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	-	rs373637496|rs368900171		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:124821719_124821753delAGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	ENST00000405201.1	-	38	5688_5695	c.5688_5695delGCCTGACCGCCTTCTCTCCTCCCCCAGGTCCACCT	c.(5686-5697)aggcctgaccgc>aggc	p.RPDR1896fs	NCOR2_ENST00000397355.1_Splice_Site_p.RPDR1887fs|NCOR2_ENST00000404621.1_Splice_Site_p.RPDR1886fs|NCOR2_ENST00000429285.2_Splice_Site_p.RPDR1886fs|NCOR2_ENST00000356219.3_Splice_Site_p.RPDR1903fs|NCOR2_ENST00000404121.2_Splice_Site_p.RPDR1457fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1907					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GAGGAGGTGGAGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGCAGTCATGGGA	0.647																																					p.1896_1899del		Atlas-Indel,Pindel	.											.	NCOR2	475	.	0			c.5688_5696del						.																																			SO:0001630	splice_region_variant	9612	exon40			.	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5688-1GCCTGACCGCCTTCTCTCCTCCCCCAGGTCCACCT>-	chr12.hg19:g.124821719_124821753delAGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC		298.0	0.0		129.0	16.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Del	DEL	ENST00000405201.1	hg19	CCDS41858.2																																																																																			.	.		0.647	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	Frame_Shift_Del
UNC13B	10497	hgsc.bcm.edu	37	9	35403876	35403926	+	In_Frame_Del	DEL	GCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	GCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	-			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	GCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	GCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:35403876_35403926delGCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	ENST00000378495.3	+	39	4844_4894	c.4622_4672delGCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	c.(4621-4674)agctgtgcctgctggtgccccttgggccggaagatccatatggatgagacaggc>agc	p.CACWCPLGRKIHMDETG1542del	UNC13B_ENST00000378496.4_In_Frame_Del_p.CACWCPLGRKIHMDETG1561del|ATP8B5P_ENST00000430846.1_RNA|UNC13B_ENST00000396787.1_In_Frame_Del_p.CACWCPLGRKIHMDETG1573del	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1542					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.H1553H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GCCAAGGGCAGCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAGGCCTGACCAT	0.55																																					p.1541_1557del		Pindel	.											.	UNC13B	153	.	1	Substitution - coding silent(1)	prostate(1)	c.4621_4671del						.																																			SO:0001651	inframe_deletion	10497	exon39			.	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4622_4672delGCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	chr9.hg19:g.35403876_35403926delGCTGTGCCTGCTGGTGCCCCTTGGGCCGGAAGATCCATATGGATGAGACAG	ENSP00000367756:p.Cys1542_Gly1558del	63.0	0.0		48.0	15.0	NM_006377	Q5VYM8	In_Frame_Del	DEL	ENST00000378495.3	hg19	CCDS6579.1																																																																																			.	.		0.550	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
PLEKHM1	9842	hgsc.bcm.edu	37	17	43559816	43559835	+	Frame_Shift_Del	DEL	TGGGGGTCCAGTCCATTCTC	TGGGGGTCCAGTCCATTCTC	-	rs201283261		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	TGGGGGTCCAGTCCATTCTC	TGGGGGTCCAGTCCATTCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:43559816_43559835delTGGGGGTCCAGTCCATTCTC	ENST00000430334.3	-	2	149_168	c.16_35delGAGAATGGACTGGACCCCCA	c.(16-36)gagaatggactggacccccagfs	p.ENGLDPQ6fs	PLEKHM1_ENST00000421073.2_Start_Codon_Del	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	6					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GATGGCAGCCTGGGGGTCCAGTCCATTCTCCACCACTGAA	0.582																																					p.6_12del		Pindel	.											.	PLEKHM1	69	.	0			c.17_36del						.																																			SO:0001589	frameshift_variant	9842	exon2			.	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.16_35delGAGAATGGACTGGACCCCCA	chr17.hg19:g.43559816_43559835delTGGGGGTCCAGTCCATTCTC	ENSP00000389913:p.Glu6fs	140.0	0.0		142.0	10.0	NM_014798	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Frame_Shift_Del	DEL	ENST00000430334.3	hg19	CCDS32671.1																																																																																			.	.		0.582	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
