#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SESN2	83667	hgsc.bcm.edu	37	1	28598805	28598805	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr1:28598805G>A	ENST00000253063.3	+	4	686	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	122					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGCCGCCCGCCATCAGTGT	0.642																																					p.R122H		Atlas-SNP	.											SESN2,NS,carcinoma,0,2	SESN2	51	.	0			c.G365A						.						61.0	62.0	62.0					1																	28598805		2203	4300	6503	SO:0001583	missense	83667	exon4			CCGCCCGCCATCA	AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.365G>A	chr1.hg19:g.28598805G>A	ENSP00000253063:p.Arg122His	68.0	0.0		51.0	10.0	NM_031459	Q5T7D0|Q96SI5	Missense_Mutation	SNP	ENST00000253063.3	hg19	CCDS321.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059292	0.93846	.	.	ENSG00000130766	ENST00000253063	T	0.52295	0.67	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78071	-0.2347	10	0.87932	D	0	-31.6762	18.9052	0.92458	0.0:0.0:1.0:0.0	.	122	P58004	SESN2_HUMAN	H	122	ENSP00000253063:R122H	ENSP00000253063:R122H	R	+	2	0	SESN2	28471392	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.557000	0.82243	2.568000	0.86640	0.591000	0.81541	CGC	.	.		0.642	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1		
TTF2	8458	hgsc.bcm.edu	37	1	117644020	117644020	+	Silent	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr1:117644020A>G	ENST00000369466.4	+	23	3407	c.3363A>G	c.(3361-3363)acA>acG	p.T1121T	TTF2_ENST00000480701.1_3'UTR	NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	1121	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GTGAGGGAACAGTAGAAGAAA	0.338																																					p.T1121T		Atlas-SNP	.											.	TTF2	92	.	0			c.A3363G						.						88.0	101.0	97.0					1																	117644020		2203	4300	6503	SO:0001819	synonymous_variant	8458	exon23			GGGAACAGTAGAA	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.3363A>G	chr1.hg19:g.117644020A>G		21.0	0.0		24.0	8.0	NM_003594	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Silent	SNP	ENST00000369466.4	hg19	CCDS892.1																																																																																			.	.		0.338	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3		
AXDND1	126859	hgsc.bcm.edu	37	1	179504037	179504037	+	Missense_Mutation	SNP	G	G	C	rs200097954|rs368406759|rs6425573	byFrequency	TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr1:179504037G>C	ENST00000367618.3	+	25	3358	c.2971G>C	c.(2971-2973)Gaa>Caa	p.E991Q		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	991	Glu-rich.		E -> Q (in dbSNP:rs6425573).					p.E991_Q992delEQ(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agaagaagaagaacaacaaga	0.318													G|||	14	0.00279553	0.0	0.0058	5008	,	,		17137	0.002		0.004	False		,,,				2504	0.0041				p.E991Q		Atlas-SNP	.											.	AXDND1	142	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.G2971C						.						49.0	51.0	50.0					1																	179504037		2152	4286	6438	SO:0001583	missense	126859	exon25			GAAGAAGAACAAC	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2971G>C	chr1.hg19:g.179504037G>C	ENSP00000356590:p.Glu991Gln	220.0	0.0		268.0	20.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	G	9.300	1.052898	0.19907	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.19105	2.17;2.17	4.89	-6.02	0.02192	.	0.508747	0.16499	N	0.211773	T	0.08980	0.0222	N	0.24115	0.695	0.09310	N	1	B;B	0.24186	0.099;0.099	B;B	0.10450	0.003;0.005	T	0.15838	-1.0423	10	0.28530	T	0.3	-2.8152	6.1976	0.20557	0.4456:0.3814:0.173:0.0	rs6425573	875;991	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	Q	991;875;851	ENSP00000356590:E991Q;ENSP00000391716:E851Q	ENSP00000353471:E875Q	E	+	1	0	AXDND1	177770660	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.365000	0.20348	-1.164000	0.02790	-1.047000	0.02352	GAA	.	G|1.000;|0.000		0.318	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
CR2	1380	hgsc.bcm.edu	37	1	207644362	207644362	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr1:207644362G>A	ENST00000367058.3	+	8	1612	c.1423G>A	c.(1423-1425)Gga>Aga	p.G475R	CR2_ENST00000367059.3_Missense_Mutation_p.G475R|CR2_ENST00000458541.2_Missense_Mutation_p.G475R|CR2_ENST00000367057.3_Missense_Mutation_p.G475R	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	475	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TGAAGCTACAGGAAGGCAACT	0.433																																					p.G475R		Atlas-SNP	.											.	CR2	164	.	0			c.G1423A						.						157.0	151.0	153.0					1																	207644362		2203	4300	6503	SO:0001583	missense	1380	exon8			GCTACAGGAAGGC	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1423G>A	chr1.hg19:g.207644362G>A	ENSP00000356025:p.Gly475Arg	192.0	0.0		238.0	27.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067016	0.36470	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.35048	1.39;1.33;1.4;1.39	4.89	4.89	0.63831	Sushi/SCR/CCP (1);	.	.	.	.	T	0.48768	0.1518	L	0.51422	1.61	0.09310	N	1	P;P;P	0.47191	0.644;0.458;0.891	P;P;P	0.55222	0.585;0.532;0.771	T	0.34925	-0.9809	9	0.49607	T	0.09	.	14.284	0.66232	0.0:0.0:1.0:0.0	.	475;475;475	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	R	475	ENSP00000356025:G475R;ENSP00000356024:G475R;ENSP00000356026:G475R;ENSP00000404222:G475R	ENSP00000356024:G475R	G	+	1	0	CR2	205710985	0.175000	0.23083	0.008000	0.14137	0.002000	0.02628	3.872000	0.56085	2.646000	0.89796	0.655000	0.94253	GGA	.	.		0.433	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
KIF26B	55083	hgsc.bcm.edu	37	1	245849809	245849809	+	Missense_Mutation	SNP	C	C	T	rs202113373		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr1:245849809C>T	ENST00000407071.2	+	12	3964	c.3524C>T	c.(3523-3525)aCg>aTg	p.T1175M	KIF26B_ENST00000366518.4_Missense_Mutation_p.T794M	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1175					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ACGATGGTGACGGTGCAGCAG	0.627																																					p.T1175M		Atlas-SNP	.											.	KIF26B	343	.	0			c.C3524T						.	C	MET/THR	0,4374		0,0,2187	27.0	34.0	32.0		3524	5.8	1.0	1		32	1,8533		0,1,4266	yes	missense	KIF26B	NM_018012.3	81	0,1,6453	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	1175/2109	245849809	1,12907	2187	4267	6454	SO:0001583	missense	55083	exon12			TGGTGACGGTGCA	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3524C>T	chr1.hg19:g.245849809C>T	ENSP00000385545:p.Thr1175Met	134.0	0.0		177.0	17.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827666	0.50845	0.0	1.17E-4	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.81659	-1.52;-1.52	5.77	5.77	0.91146	.	.	.	.	.	T	0.77864	0.4194	M	0.62088	1.915	0.39707	D	0.97127	D;D	0.53312	0.959;0.959	B;B	0.35655	0.207;0.207	T	0.82252	-0.0549	9	0.54805	T	0.06	.	19.9961	0.97386	0.0:1.0:0.0:0.0	.	794;1175	B7WPD9;Q2KJY2	.;KI26B_HUMAN	M	1175;794;791	ENSP00000385545:T1175M;ENSP00000355475:T794M	ENSP00000355475:T794M	T	+	2	0	KIF26B	243916432	0.997000	0.39634	0.957000	0.39632	0.974000	0.67602	3.441000	0.52893	2.744000	0.94065	0.561000	0.74099	ACG	.	.		0.627	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
EXOC6B	23233	hgsc.bcm.edu	37	2	72692418	72692418	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:72692418C>A	ENST00000272427.6	-	18	1981	c.1851G>T	c.(1849-1851)aaG>aaT	p.K617N	EXOC6B_ENST00000410104.1_Missense_Mutation_p.K617N	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	617					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						ACTGGTCAATCTTCTGGTTTA	0.398																																					p.K617N		Atlas-SNP	.											.	EXOC6B	93	.	0			c.G1851T						.						120.0	116.0	118.0					2																	72692418		1925	4131	6056	SO:0001583	missense	23233	exon18			GTCAATCTTCTGG	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1851G>T	chr2.hg19:g.72692418C>A	ENSP00000272427:p.Lys617Asn	149.0	0.0		136.0	57.0	NM_015189	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	hg19	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700731	0.68501	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.59364	0.27;0.27	5.33	2.55	0.30701	.	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	M	0.85859	2.78	0.80722	D	1	P;D	0.76494	0.503;0.999	B;D	0.81914	0.175;0.995	T	0.75235	-0.3389	10	0.87932	D	0	.	9.7205	0.40300	0.0:0.7715:0.0:0.2285	.	617;617	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	N	617	ENSP00000272427:K617N;ENSP00000386698:K617N	ENSP00000272427:K617N	K	-	3	2	EXOC6B	72545926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.111000	0.41883	0.328000	0.23435	0.591000	0.81541	AAG	.	.		0.398	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
RGPD4	285190	hgsc.bcm.edu	37	2	108488192	108488192	+	Silent	SNP	G	G	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:108488192G>C	ENST00000408999.3	+	20	3809	c.3732G>C	c.(3730-3732)ggG>ggC	p.G1244G	RGPD4_ENST00000354986.4_Silent_p.G1244G	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1244					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AAAACACTGGGCCCACATTAG	0.448																																					p.G1244G		Atlas-SNP	.											.	RGPD4	112	.	0			c.G3732C						.						57.0	44.0	48.0					2																	108488192		692	1590	2282	SO:0001819	synonymous_variant	285190	exon20			CACTGGGCCCACA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3732G>C	chr2.hg19:g.108488192G>C		493.0	0.0		508.0	80.0	NM_182588	B9A029	Silent	SNP	ENST00000408999.3	hg19	CCDS46381.1																																																																																			.	.		0.448	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
DAPL1	92196	hgsc.bcm.edu	37	2	159651944	159651944	+	Splice_Site	SNP	T	T	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:159651944T>A	ENST00000309950.3	+	1	114		c.e1+2		DAPL1_ENST00000409042.1_Splice_Site	NM_001017920.2	NP_001017920.2	A0PJW8	DAPL1_HUMAN	death associated protein-like 1						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)					prostate(1)	1						CTCCTGCAGGTAGGCTGCCAC	0.607																																					.		Atlas-SNP	.											.	DAPL1	11	.	0			c.58+2T>A						.						60.0	36.0	44.0					2																	159651944		2190	4270	6460	SO:0001630	splice_region_variant	92196	exon1			TGCAGGTAGGCTG		CCDS33307.1	2q24	2007-06-26			ENSG00000163331	ENSG00000163331			21490	protein-coding gene	gene with protein product							Standard	NM_001017920		Approved		uc002uaf.3	A0PJW8	OTTHUMG00000153970	ENST00000309950.3:c.58+2T>A	chr2.hg19:g.159651944T>A		271.0	0.0		237.0	32.0	NM_001017920	A0PJW9|B9EIK6	Splice_Site	SNP	ENST00000309950.3	hg19	CCDS33307.1	.	.	.	.	.	.	.	.	.	.	T	18.10	3.549625	0.65311	.	.	ENSG00000163331	ENST00000309950;ENST00000409042	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6221	0.56610	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DAPL1	159360190	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	3.736000	0.55052	2.233000	0.73108	0.533000	0.62120	.	.	.		0.607	DAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333265.1	NM_001017920	Intron
LY75	4065	hgsc.bcm.edu	37	2	160664981	160664981	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:160664981C>T	ENST00000263636.4	-	33	4828	c.4801G>A	c.(4801-4803)Gga>Aga	p.G1601R	LY75_ENST00000554112.1_Missense_Mutation_p.G1601R|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.G1601R|LY75_ENST00000553424.1_Missense_Mutation_p.G1601R|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.G1601R	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1601	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TGAGATAATCCAAGCCAAACT	0.348																																					p.G1601R		Atlas-SNP	.											.	LY75	151	.	0			c.G4801A						.						209.0	203.0	205.0					2																	160664981		2202	4299	6501	SO:0001583	missense	4065	exon33			ATAATCCAAGCCA	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4801G>A	chr2.hg19:g.160664981C>T	ENSP00000263636:p.Gly1601Arg	94.0	0.0		104.0	20.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	hg19	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.452915	0.84209	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	5.55	5.55	0.83447	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.33057	U	0.005337	T	0.72374	0.3452	H	0.94620	3.56	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.80701	-0.1265	10	0.87932	D	0	-17.6567	19.0954	0.93248	0.0:1.0:0.0:0.0	.	1601;1601;1601	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	R	1601	ENSP00000451511:G1601R;ENSP00000451446:G1601R;ENSP00000263636:G1601R;ENSP00000423463:G1601R;ENSP00000421035:G1601R	ENSP00000423463:G1601R	G	-	1	0	LY75;LY75-CD302	160373227	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.165000	0.64959	2.606000	0.88127	0.491000	0.48974	GGA	.	.		0.348	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
TTN	7273	hgsc.bcm.edu	37	2	179560835	179560835	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:179560835C>T	ENST00000591111.1	-	112	30237	c.30013G>A	c.(30013-30015)Gac>Aac	p.D10005N	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D10322N|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D9078N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCAGTTCGTCATAAGGTTCT	0.373																																					p.D10322N		Atlas-SNP	.											.	TTN	18412	.	0			c.G30964A						.						131.0	110.0	117.0					2																	179560835		1781	3897	5678	SO:0001583	missense	7273	exon114			GTTCGTCATAAGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30013G>A	chr2.hg19:g.179560835C>T	ENSP00000465570:p.Asp10005Asn	140.0	0.0		116.0	38.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.96	3.516402	0.64634	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T	0.64438	-0.1	5.78	5.78	0.91487	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.60366	0.2263	L	0.47716	1.5	0.80722	D	1	B;P	0.37330	0.048;0.59	B;B	0.39904	0.031;0.313	T	0.64343	-0.6430	9	0.87932	D	0	.	15.5205	0.75862	0.0:1.0:0.0:0.0	.	10005;10005	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	N	9078;200	ENSP00000343764:D9078N	ENSP00000343764:D9078N	D	-	1	0	TTN	179269080	0.995000	0.38212	0.765000	0.31456	0.871000	0.50021	3.839000	0.55835	2.729000	0.93468	0.650000	0.86243	GAC	.	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CRYGD	1421	hgsc.bcm.edu	37	2	208988981	208988981	+	Missense_Mutation	SNP	G	G	A	rs200234608		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:208988981G>A	ENST00000264376.4	-	2	134	c.107C>T	c.(106-108)gCg>gTg	p.A36V		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	36	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		GTCCACGCGCGCCGAGTTGCA	0.652																																					p.A36V		Atlas-SNP	.											CRYGD,NS,neuroblastoma,0,1	CRYGD	18	.	0			c.C107T						.						11.0	13.0	12.0					2																	208988981		2179	4274	6453	SO:0001583	missense	1421	exon2			ACGCGCGCCGAGT		CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.107C>T	chr2.hg19:g.208988981G>A	ENSP00000264376:p.Ala36Val	187.0	2.0		135.0	8.0	NM_006891	Q17RF7|Q53R51|Q99681	Missense_Mutation	SNP	ENST00000264376.4	hg19	CCDS2378.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627591	0.28978	.	.	ENSG00000118231	ENST00000264376	T	0.72051	-0.62	4.35	3.19	0.36642	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.184420	0.36703	N	0.002444	T	0.29389	0.0732	N	0.00166	-1.94	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.34875	-0.9811	10	0.32370	T	0.25	.	8.1681	0.31239	0.9021:0.0:0.0979:0.0	.	36	P07320	CRGD_HUMAN	V	36	ENSP00000264376:A36V	ENSP00000264376:A36V	A	-	2	0	CRYGD	208697226	0.280000	0.24249	0.067000	0.19924	0.966000	0.64601	2.073000	0.41519	0.695000	0.31675	-0.573000	0.04149	GCG	.	G|0.998;A|0.002		0.652	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256476.2	NM_006891	
CHRND	1144	hgsc.bcm.edu	37	2	233390976	233390976	+	Splice_Site	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr2:233390976T>C	ENST00000258385.3	+	1	83	c.51T>C	c.(49-51)tgT>tgC	p.C17C	CHRND_ENST00000457943.2_5'UTR|CHRND_ENST00000536614.1_Splice_Site_p.C17C|CHRND_ENST00000543200.1_Splice_Site_p.C17C	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	17					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	TGGCGGTGTGTGGTAAGGGAA	0.657																																					p.C17C		Atlas-SNP	.											.	CHRND	67	.	0			c.T51C						.						56.0	54.0	55.0					2																	233390976		2203	4300	6503	SO:0001630	splice_region_variant	1144	exon1			GGTGTGTGGTAAG	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.52+1T>C	chr2.hg19:g.233390976T>C		197.0	0.0		214.0	24.0	NM_000751	A8K661|B4DT92|Q52LH4	Silent	SNP	ENST00000258385.3	hg19	CCDS2494.1																																																																																			.	.		0.657	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2		Silent
CHL1	10752	hgsc.bcm.edu	37	3	403447	403447	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:403447T>C	ENST00000256509.2	+	13	2014	c.1372T>C	c.(1372-1374)Ttc>Ctc	p.F458L	CHL1-AS1_ENST00000608098.1_RNA|CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.F442L	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GTACAGTGCTTTCTTACATTG	0.403																																					p.F458L		Atlas-SNP	.											.	CHL1	242	.	0			c.T1372C						.						239.0	224.0	229.0					3																	403447		2203	4300	6503	SO:0001583	missense	10752	exon11			AGTGCTTTCTTAC	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1372T>C	chr3.hg19:g.403447T>C	ENSP00000256509:p.Phe458Leu	126.0	0.0		126.0	59.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	T	6.380	0.438243	0.12104	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.25912	1.77;1.77	5.24	5.24	0.73138	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.103501	0.64402	D	0.000002	T	0.13927	0.0337	N	0.21097	0.63	0.33495	D	0.589144	B;B;B	0.24186	0.008;0.008;0.099	B;B;B	0.25291	0.034;0.034;0.059	T	0.15206	-1.0445	10	0.02654	T	1	.	9.0535	0.36392	0.0:0.0846:0.0:0.9153	.	442;442;458	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	L	458;442	ENSP00000256509:F458L;ENSP00000380628:F442L	ENSP00000256509:F458L	F	+	1	0	CHL1	378447	0.922000	0.31269	0.607000	0.28956	0.912000	0.54170	2.115000	0.41921	2.095000	0.63458	0.460000	0.39030	TTC	.	.		0.403	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
FGD5	152273	hgsc.bcm.edu	37	3	14862981	14862981	+	Silent	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:14862981G>T	ENST00000285046.5	+	1	2513	c.2403G>T	c.(2401-2403)acG>acT	p.T801T	FGD5_ENST00000543601.1_Silent_p.T560T	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	801					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GCGCGTTCACGAAGCTGTTTG	0.522																																					p.T801T		Atlas-SNP	.											.	FGD5	248	.	0			c.G2403T						.						86.0	90.0	89.0					3																	14862981		2076	4234	6310	SO:0001819	synonymous_variant	152273	exon1			GTTCACGAAGCTG	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.2403G>T	chr3.hg19:g.14862981G>T		81.0	0.0		80.0	32.0	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	ENST00000285046.5	hg19	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	4.897	0.166768	0.09339	.	.	ENSG00000154783	ENST00000457774	.	.	.	5.03	-7.79	0.01218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-25.8753	1.4612	0.02396	0.3217:0.3005:0.2279:0.1499	.	.	.	.	X	15	.	.	E	+	1	0	FGD5	14837985	0.000000	0.05858	0.775000	0.31657	0.710000	0.40934	-5.607000	0.00110	-1.205000	0.02645	-0.229000	0.12294	GAA	.	.		0.522	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
SLC22A14	9389	hgsc.bcm.edu	37	3	38357904	38357904	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:38357904C>A	ENST00000273173.4	+	9	1713	c.1622C>A	c.(1621-1623)cCc>cAc	p.P541H	SLC22A14_ENST00000448498.1_Missense_Mutation_p.P541H	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	541					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		TCCCTCCTGCCCATCTTTCTC	0.617																																					p.P541H		Atlas-SNP	.											.	SLC22A14	64	.	0			c.C1622A						.						121.0	91.0	101.0					3																	38357904		2203	4300	6503	SO:0001583	missense	9389	exon9			TCCTGCCCATCTT	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.1622C>A	chr3.hg19:g.38357904C>A	ENSP00000273173:p.Pro541His	87.0	0.0		125.0	25.0	NM_004803	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	ENST00000273173.4	hg19	CCDS2677.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845781	0.51164	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.74209	-0.82;-0.82	4.2	4.2	0.49525	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.380298	0.29668	N	0.011513	D	0.86986	0.6065	M	0.88512	2.96	0.09310	N	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.78971	-0.1993	10	0.87932	D	0	.	12.3339	0.55056	0.0:1.0:0.0:0.0	.	541	Q9Y267	S22AE_HUMAN	H	541;526;541	ENSP00000396283:P541H;ENSP00000273173:P541H	ENSP00000273173:P541H	P	+	2	0	SLC22A14	38332908	0.006000	0.16342	0.006000	0.13384	0.005000	0.04900	1.816000	0.38992	2.610000	0.88304	0.655000	0.94253	CCC	.	.		0.617	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3	NM_004803	
KIF15	56992	hgsc.bcm.edu	37	3	44843455	44843455	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:44843455C>A	ENST00000326047.4	+	13	1647	c.1498C>A	c.(1498-1500)Ctg>Atg	p.L500M	KIF15_ENST00000425755.1_Missense_Mutation_p.L135M	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	500					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		GATTCAAACTCTGCGAGAACA	0.378																																					p.L500M		Atlas-SNP	.											.	KIF15	103	.	0			c.C1498A						.						25.0	28.0	27.0					3																	44843455		2203	4300	6503	SO:0001583	missense	56992	exon13			CAAACTCTGCGAG	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.1498C>A	chr3.hg19:g.44843455C>A	ENSP00000324020:p.Leu500Met	88.0	0.0		107.0	23.0	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	hg19	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127473	0.56721	.	.	ENSG00000163808	ENST00000326047;ENST00000481166;ENST00000396031;ENST00000425755	T;D;T	0.83506	-0.88;-1.73;0.17	5.32	3.54	0.40534	Kinesin-like, KLP2 (1);	0.000000	0.41097	D	0.000959	D	0.88325	0.6406	M	0.66939	2.045	0.41210	D	0.986435	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87087	0.2170	10	0.59425	D	0.04	.	9.1616	0.37025	0.0:0.7772:0.0:0.2228	.	135;500	C9JKA9;Q9NS87	.;KIF15_HUMAN	M	500;272;499;135	ENSP00000324020:L500M;ENSP00000425499:L272M;ENSP00000389982:L135M	ENSP00000324020:L500M	L	+	1	2	KIF15	44818459	0.326000	0.24669	0.966000	0.40874	0.963000	0.63663	0.870000	0.28010	0.633000	0.30452	-0.379000	0.06801	CTG	.	.		0.378	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
OR5K4	403278	hgsc.bcm.edu	37	3	98073262	98073262	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:98073262T>A	ENST00000354924.2	+	1	565	c.565T>A	c.(565-567)Tgt>Agt	p.C189S	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						TAGACTCTCCTGTACAGATCC	0.328																																					p.C189S		Atlas-SNP	.											.	OR5K4	75	.	0			c.T565A						.						75.0	82.0	80.0					3																	98073262		2203	4300	6503	SO:0001583	missense	403278	exon1			CTCTCCTGTACAG		CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.565T>A	chr3.hg19:g.98073262T>A	ENSP00000347003:p.Cys189Ser	79.0	0.0		94.0	21.0	NM_001005517		Missense_Mutation	SNP	ENST00000354924.2	hg19	CCDS33802.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962589	0.53400	.	.	ENSG00000196098	ENST00000354924	T	0.00450	7.36	4.82	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35466	U	0.003181	T	0.01156	0.0038	M	0.87617	2.895	0.32590	N	0.527343	D	0.67145	0.996	D	0.72075	0.976	T	0.17077	-1.0381	10	0.72032	D	0.01	-37.8397	8.734	0.34516	0.0:0.0914:0.0:0.9086	.	189	A6NMS3	OR5K4_HUMAN	S	189	ENSP00000347003:C189S	ENSP00000347003:C189S	C	+	1	0	OR5K4	99555952	1.000000	0.71417	0.872000	0.34217	0.752000	0.42762	7.116000	0.77119	0.950000	0.37743	0.491000	0.48974	TGT	.	.		0.328	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359114.1		
BBX	56987	hgsc.bcm.edu	37	3	107491987	107491987	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:107491987C>T	ENST00000325805.8	+	11	1706	c.1419C>T	c.(1417-1419)tgC>tgT	p.C473C	BBX_ENST00000402543.1_Silent_p.C473C|BBX_ENST00000406780.1_Silent_p.C473C|BBX_ENST00000415149.2_Silent_p.C473C|BBX_ENST00000416476.2_Intron			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	473	Lys-rich.				bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			AGAAGACTTGCAAAAAGAGGC	0.418																																					p.C473C		Atlas-SNP	.											.	BBX	156	.	0			c.C1419T						.						64.0	67.0	66.0					3																	107491987		2203	4299	6502	SO:0001819	synonymous_variant	56987	exon11			GACTTGCAAAAAG	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.1419C>T	chr3.hg19:g.107491987C>T		255.0	0.0		265.0	101.0	NM_001142568	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Silent	SNP	ENST00000325805.8	hg19	CCDS46881.1																																																																																			.	.		0.418	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
SPICE1	152185	hgsc.bcm.edu	37	3	113212077	113212077	+	Silent	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:113212077A>G	ENST00000295872.4	-	6	727	c.468T>C	c.(466-468)ttT>ttC	p.F156F		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	156					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						CAGACTCATTAAAGATAGATT	0.408																																					p.F156F		Atlas-SNP	.											.	SPICE1	130	.	0			c.T468C						.						109.0	107.0	107.0					3																	113212077		2203	4300	6503	SO:0001819	synonymous_variant	152185	exon6			CTCATTAAAGATA	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.468T>C	chr3.hg19:g.113212077A>G		104.0	0.0		98.0	4.0	NM_144718	D3DN72|Q8WUX6	Silent	SNP	ENST00000295872.4	hg19	CCDS2973.1																																																																																			.	.		0.408	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
CLSTN2	64084	hgsc.bcm.edu	37	3	140123517	140123517	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:140123517G>A	ENST00000458420.3	+	4	736	c.546G>A	c.(544-546)gaG>gaA	p.E182E	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	182	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						TGCAGGTGGAGGCCATTGACG	0.517										HNSCC(16;0.037)																											p.E182E	GBM(45;858 913 3709 36904 37282)	Atlas-SNP	.											.	CLSTN2	190	.	0			c.G546A						.						153.0	123.0	133.0					3																	140123517		2203	4300	6503	SO:0001819	synonymous_variant	64084	exon4			GGTGGAGGCCATT	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.546G>A	chr3.hg19:g.140123517G>A		260.0	0.0		235.0	84.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Silent	SNP	ENST00000458420.3	hg19	CCDS3112.1																																																																																			.	.		0.517	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
MECOM	2122	hgsc.bcm.edu	37	3	168810745	168810745	+	Splice_Site	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr3:168810745C>A	ENST00000464456.1	-	12	3774		c.e12+1		MECOM_ENST00000468789.1_Splice_Site|MECOM_ENST00000472280.1_Splice_Site|MECOM_ENST00000392736.3_Splice_Site|MECOM_ENST00000460814.1_Splice_Site|MECOM_ENST00000494292.1_Splice_Site|MECOM_ENST00000433243.2_Splice_Site|MECOM_ENST00000264674.3_Splice_Site	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus						regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GACAGCTTTACCTCTCCTCCA	0.388																																					.		Atlas-SNP	.											.	MECOM	216	.	0			c.2795+1G>T						.						108.0	99.0	102.0					3																	168810745		2203	4300	6503	SO:0001630	splice_region_variant	2122	exon15			GCTTTACCTCTCC	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2573+1G>T	chr3.hg19:g.168810745C>A		43.0	0.0		78.0	13.0	NM_001105077	Q13466|Q6FH90	Splice_Site	SNP	ENST00000464456.1	hg19	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963671	0.53507	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2024	0.93715	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MECOM	170293439	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	7.163000	0.77524	2.527000	0.85204	0.460000	0.39030	.	.	.		0.388	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	Intron
HTRA3	94031	hgsc.bcm.edu	37	4	8295868	8295868	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr4:8295868G>T	ENST00000307358.2	+	6	1195	c.991G>T	c.(991-993)Gcc>Tcc	p.A331S	HTRA3_ENST00000382512.3_Missense_Mutation_p.A331S	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	331	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A331T(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CATCTCCTTTGCCATCCCCTC	0.592																																					p.A331S		Atlas-SNP	.											HTRA3,NS,carcinoma,0,1	HTRA3	39	.	1	Substitution - Missense(1)	ovary(1)	c.G991T						.						135.0	90.0	106.0					4																	8295868		2203	4299	6502	SO:0001583	missense	94031	exon6			TCCTTTGCCATCC	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.991G>T	chr4.hg19:g.8295868G>T	ENSP00000303766:p.Ala331Ser	121.0	0.0		139.0	17.0	NM_053044	Q7Z7A2	Missense_Mutation	SNP	ENST00000307358.2	hg19	CCDS3400.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790384	0.70337	.	.	ENSG00000170801	ENST00000307358;ENST00000382512	D;D	0.90620	-2.7;-2.7	3.33	3.33	0.38152	Peptidase cysteine/serine, trypsin-like (1);	0.000000	0.85682	U	0.000000	D	0.94703	0.8291	M	0.85777	2.775	0.80722	D	1	D;P	0.56287	0.975;0.843	P;P	0.61070	0.883;0.798	D	0.95592	0.8655	10	0.87932	D	0	-10.3834	14.6368	0.68696	0.0:0.0:1.0:0.0	.	331;331	P83110;P83110-2	HTRA3_HUMAN;.	S	331	ENSP00000303766:A331S;ENSP00000371952:A331S	ENSP00000303766:A331S	A	+	1	0	HTRA3	8346768	1.000000	0.71417	0.999000	0.59377	0.665000	0.39181	8.992000	0.93519	1.410000	0.46936	0.313000	0.20887	GCC	.	.		0.592	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
HTRA3	94031	hgsc.bcm.edu	37	4	8295870	8295870	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr4:8295870C>T	ENST00000307358.2	+	6	1197	c.993C>T	c.(991-993)gcC>gcT	p.A331A	HTRA3_ENST00000382512.3_Silent_p.A331A	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	331	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						TCTCCTTTGCCATCCCCTCAG	0.592																																					p.A331A		Atlas-SNP	.											.	HTRA3	39	.	0			c.C993T						.						135.0	90.0	106.0					4																	8295870		2203	4299	6502	SO:0001819	synonymous_variant	94031	exon6			CTTTGCCATCCCC	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.993C>T	chr4.hg19:g.8295870C>T		121.0	0.0		136.0	17.0	NM_053044	Q7Z7A2	Silent	SNP	ENST00000307358.2	hg19	CCDS3400.1																																																																																			.	.		0.592	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
PCDH7	5099	hgsc.bcm.edu	37	4	30726251	30726251	+	Intron	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr4:30726251C>T	ENST00000361762.2	+	1	4182				PCDH7_ENST00000543491.1_Intron	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7						homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TTAAATATCCCAGGGAGGGCT	0.318																																					p.P1069P		Atlas-SNP	.											.	PCDH7	215	.	0			c.C3207T						.						32.0	32.0	32.0					4																	30726251		1975	4186	6161	SO:0001627	intron_variant	5099	exon1			ATATCCCAGGGAG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.3174+33C>T	chr4.hg19:g.30726251C>T		49.0	0.0		39.0	12.0	NM_032456	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	hg19	CCDS33971.1																																																																																			.	.		0.318	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
N4BP2	55728	hgsc.bcm.edu	37	4	40103840	40103840	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr4:40103840T>G	ENST00000261435.6	+	4	791	c.375T>G	c.(373-375)agT>agG	p.S125R		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	125					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AAGAAGAGAGTGAAGATTCAA	0.373																																					p.S125R		Atlas-SNP	.											.	N4BP2	166	.	0			c.T375G						.						98.0	94.0	96.0					4																	40103840		2203	4300	6503	SO:0001583	missense	55728	exon4			AGAGAGTGAAGAT	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.375T>G	chr4.hg19:g.40103840T>G	ENSP00000261435:p.Ser125Arg	117.0	0.0		98.0	38.0	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	T	8.463	0.855782	0.17106	.	.	ENSG00000078177	ENST00000261435;ENST00000381804;ENST00000515550	T;T	0.78707	-1.2;-1.2	5.55	-3.76	0.04359	.	1.043650	0.07522	N	0.910740	T	0.52645	0.1747	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.30475	-0.9977	10	0.23302	T	0.38	0.0651	1.8642	0.03195	0.1084:0.2008:0.2164:0.4745	.	125;125	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	R	125;45;45	ENSP00000261435:S125R;ENSP00000422057:S45R	ENSP00000261435:S125R	S	+	3	2	N4BP2	39780235	0.001000	0.12720	0.008000	0.14137	0.553000	0.35397	-0.087000	0.11215	-0.303000	0.08856	0.482000	0.46254	AGT	.	.		0.373	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
GABRG1	2565	hgsc.bcm.edu	37	4	46060284	46060284	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr4:46060284C>A	ENST00000295452.4	-	7	1033	c.866G>T	c.(865-867)tGg>tTg	p.W289L		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	289					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAAAGACACCCAAGAAAGAAC	0.343																																					p.W289L		Atlas-SNP	.											.	GABRG1	172	.	0			c.G866T						.						102.0	100.0	101.0					4																	46060284		2203	4300	6503	SO:0001583	missense	2565	exon7			GACACCCAAGAAA	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.866G>T	chr4.hg19:g.46060284C>A	ENSP00000295452:p.Trp289Leu	196.0	0.0		185.0	39.0	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	hg19	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724255	0.89298	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.84298	-1.83	5.38	5.38	0.77491	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94974	0.8374	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96078	0.9051	10	0.87932	D	0	.	18.5473	0.91052	0.0:1.0:0.0:0.0	.	289	Q8N1C3	GBRG1_HUMAN	L	289	ENSP00000295452:W289L	ENSP00000295452:W289L	W	-	2	0	GABRG1	45755041	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	5.983000	0.70540	2.702000	0.92279	0.549000	0.68633	TGG	.	.		0.343	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
TRPC3	7222	hgsc.bcm.edu	37	4	122836092	122836092	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr4:122836092G>A	ENST00000379645.3	-	4	1257	c.1184C>T	c.(1183-1185)gCt>gTt	p.A395V	TRPC3_ENST00000264811.5_Missense_Mutation_p.A322V|TRPC3_ENST00000513531.1_Intron	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	310					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GTTGGGATGAGCCACAAACTA	0.463																																					p.A395V		Atlas-SNP	.											.	TRPC3	201	.	0			c.C1184T						.						77.0	62.0	67.0					4																	122836092		2203	4300	6503	SO:0001583	missense	7222	exon4			GGATGAGCCACAA	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1184C>T	chr4.hg19:g.122836092G>A	ENSP00000368966:p.Ala395Val	104.0	0.0		69.0	13.0	NM_001130698	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	hg19	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829710	0.91036	.	.	ENSG00000138741	ENST00000264811;ENST00000379645	T;T	0.73258	-0.73;-0.73	5.5	5.5	0.81552	.	0.146455	0.47093	D	0.000243	D	0.84754	0.5542	M	0.92649	3.33	0.80722	D	1	D;P	0.55800	0.973;0.864	P;P	0.51974	0.686;0.456	D	0.88696	0.3212	10	0.87932	D	0	-5.8817	19.3937	0.94596	0.0:0.0:1.0:0.0	.	310;395	Q13507;Q5G1L5	TRPC3_HUMAN;.	V	322;395	ENSP00000264811:A322V;ENSP00000368966:A395V	ENSP00000264811:A322V	A	-	2	0	TRPC3	123055542	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.753000	0.98904	2.586000	0.87340	0.655000	0.94253	GCT	.	.		0.463	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
SLC6A18	348932	hgsc.bcm.edu	37	5	1244795	1244795	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr5:1244795C>T	ENST00000324642.3	+	11	1692	c.1569C>T	c.(1567-1569)gtC>gtT	p.V523V		NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	523					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGAGGGTGGTCAGTCCCCTGC	0.592																																					p.V523V		Atlas-SNP	.											.	SLC6A18	84	.	0			c.C1569T						.						62.0	61.0	62.0					5																	1244795		2203	4300	6503	SO:0001819	synonymous_variant	348932	exon11			GGTGGTCAGTCCC	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1569C>T	chr5.hg19:g.1244795C>T		118.0	0.0		142.0	33.0	NM_182632		Silent	SNP	ENST00000324642.3	hg19	CCDS3860.1																																																																																			.	.		0.592	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632	
FBXO4	26272	hgsc.bcm.edu	37	5	41927119	41927119	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr5:41927119A>T	ENST00000281623.3	+	2	250	c.194A>T	c.(193-195)gAt>gTt	p.D65V	FBXO4_ENST00000509134.1_Missense_Mutation_p.D65V|FBXO4_ENST00000296812.2_Missense_Mutation_p.D65V	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	65	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				TTTCAGATTGATGTACAGCTA	0.333																																					p.D65V		Atlas-SNP	.											.	FBXO4	42	.	0			c.A194T						.						107.0	106.0	106.0					5																	41927119		2203	4300	6503	SO:0001583	missense	26272	exon2			AGATTGATGTACA	AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.194A>T	chr5.hg19:g.41927119A>T	ENSP00000281623:p.Asp65Val	70.0	0.0		67.0	10.0	NM_033484	Q68CU8|Q86VT8|Q9UK98	Missense_Mutation	SNP	ENST00000281623.3	hg19	CCDS3938.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.223973	0.79576	.	.	ENSG00000151876	ENST00000296812;ENST00000281623;ENST00000509134	T;T;T	0.58652	0.32;0.32;0.32	5.3	5.3	0.74995	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.098369	0.64402	D	0.000002	T	0.75932	0.3917	M	0.81341	2.54	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.992	D;D;P	0.65874	0.939;0.919;0.868	T	0.79985	-0.1572	10	0.72032	D	0.01	-5.4731	15.2454	0.73502	1.0:0.0:0.0:0.0	.	65;65;65	D6RAJ6;Q9UKT5;Q9UKT5-2	.;FBX4_HUMAN;.	V	65	ENSP00000296812:D65V;ENSP00000281623:D65V;ENSP00000421749:D65V	ENSP00000281623:D65V	D	+	2	0	FBXO4	41962876	1.000000	0.71417	0.995000	0.50966	0.949000	0.60115	6.839000	0.75364	2.010000	0.58986	0.533000	0.62120	GAT	.	.		0.333	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1		
HMGCR	3156	hgsc.bcm.edu	37	5	74646693	74646693	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr5:74646693C>A	ENST00000287936.4	+	9	1016	c.860C>A	c.(859-861)tCt>tAt	p.S287Y	HMGCR_ENST00000343975.5_Missense_Mutation_p.S287Y|HMGCR_ENST00000511206.1_Missense_Mutation_p.S287Y	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	287					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	GCAGATACTTCTAAGGTTTCA	0.373																																					p.S287Y		Atlas-SNP	.											.	HMGCR	53	.	0			c.C860A						.						116.0	116.0	116.0					5																	74646693		2203	4300	6503	SO:0001583	missense	3156	exon9			ATACTTCTAAGGT		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.860C>A	chr5.hg19:g.74646693C>A	ENSP00000287936:p.Ser287Tyr	88.0	0.0		64.0	18.0	NM_001130996	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	hg19	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841321	0.51057	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.46819	0.88;0.88;0.86	5.92	5.92	0.95590	.	0.587928	0.19863	N	0.104367	T	0.41328	0.1154	L	0.43152	1.355	0.29215	N	0.874344	B;B;B;B	0.34181	0.44;0.44;0.224;0.116	B;B;B;B	0.29353	0.086;0.034;0.101;0.034	T	0.49021	-0.8982	10	0.59425	D	0.04	-2.9611	15.0866	0.72158	0.1417:0.8583:0.0:0.0	.	287;287;287;287	B2R649;A8KA27;P04035-2;P04035	.;.;.;HMDH_HUMAN	Y	287;218;287;287	ENSP00000426745:S287Y;ENSP00000287936:S287Y;ENSP00000340816:S287Y	ENSP00000287936:S287Y	S	+	2	0	HMGCR	74682449	0.979000	0.34478	0.480000	0.27341	0.780000	0.44128	4.741000	0.62095	2.818000	0.97014	0.655000	0.94253	TCT	.	.		0.373	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
BRD8	10902	hgsc.bcm.edu	37	5	137501703	137501703	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr5:137501703G>A	ENST00000254900.5	-	11	1463	c.1092C>T	c.(1090-1092)atC>atT	p.I364I	BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000402931.1_Silent_p.I364I|BRD8_ENST00000455658.2_Silent_p.I323I|BRD8_ENST00000411594.2_Silent_p.I367I|BRD8_ENST00000230901.5_Silent_p.I437I	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	364					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGATAGAATTGATGATCATGG	0.478																																					p.I437I		Atlas-SNP	.											.	BRD8	192	.	0			c.C1311T						.						149.0	142.0	144.0					5																	137501703		2203	4300	6503	SO:0001819	synonymous_variant	10902	exon12			AGAATTGATGATC	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1092C>T	chr5.hg19:g.137501703G>A		79.0	0.0		61.0	18.0	NM_006696	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Silent	SNP	ENST00000254900.5	hg19	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	G	6.476	0.456051	0.12283	.	.	ENSG00000112983	ENST00000441656	.	.	.	5.65	1.28	0.21552	.	.	.	.	.	T	0.51669	0.1688	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35871	-0.9771	4	.	.	.	-11.4674	5.5038	0.16842	0.3681:0.0:0.4923:0.1396	.	.	.	.	L	358	.	.	S	-	2	0	BRD8	137529602	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	0.854000	0.27791	0.059000	0.16252	-1.004000	0.02495	TCA	.	.		0.478	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
PCDHB8	56128	hgsc.bcm.edu	37	5	140558833	140558833	+	Silent	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr5:140558833A>G	ENST00000239444.2	+	1	1463	c.1218A>G	c.(1216-1218)acA>acG	p.T406T	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTACTAACAGAGACACCAC	0.468																																					p.T406T		Atlas-SNP	.											.	PCDHB8	199	.	0			c.A1218G						.						118.0	152.0	140.0					5																	140558833		2203	4300	6503	SO:0001819	synonymous_variant	56128	exon1			ACTAACAGAGACA	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1218A>G	chr5.hg19:g.140558833A>G		533.0	0.0		508.0	98.0	NM_019120	B9EGV1	Silent	SNP	ENST00000239444.2	hg19	CCDS4250.1																																																																																			.	.		0.468	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140871340	140871340	+	Intron	SNP	T	T	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr5:140871340T>A	ENST00000252085.3	+	2	2566				PCDHGC4_ENST00000306593.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGC5_ENST00000252087.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATAAGGGATTGAACTTGCA	0.672																																					p.L845M		Atlas-SNP	.											.	PCDHGC5	199	.	0			c.T2533A						.						11.0	15.0	13.0					5																	140871340		1092	2139	3231	SO:0001627	intron_variant	56097	exon1			AAGGGATTGAACT	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2425-3034T>A	chr5.hg19:g.140871340T>A		144.0	0.0		119.0	11.0	NM_032407	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	hg19	CCDS4260.1																																																																																			.	.		0.672	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
DHX16	8449	hgsc.bcm.edu	37	6	30627550	30627550	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr6:30627550T>A	ENST00000376442.3	-	11	2012	c.1817A>T	c.(1816-1818)cAg>cTg	p.Q606L	DHX16_ENST00000376437.5_Missense_Mutation_p.Q125L|DHX16_ENST00000480966.1_5'UTR	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	606	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CCCAGGGGGCTGGGTCACATG	0.582																																					p.Q606L		Atlas-SNP	.											.	DHX16	119	.	0			c.A1817T						.						90.0	86.0	87.0					6																	30627550		2203	4300	6503	SO:0001583	missense	8449	exon11			GGGGGCTGGGTCA	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.1817A>T	chr6.hg19:g.30627550T>A	ENSP00000365625:p.Gln606Leu	109.0	0.0		72.0	10.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	hg19	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.718166	0.89205	.	.	ENSG00000204560	ENST00000376442;ENST00000376437	T;T	0.08102	3.13;3.13	4.96	4.96	0.65561	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.15912	0.0383	L	0.58969	1.84	0.80722	D	1	D;D;D	0.76494	0.999;0.968;0.996	D;P;P	0.69142	0.962;0.749;0.776	T	0.00411	-1.1756	10	0.87932	D	0	.	14.0286	0.64601	0.0:0.0:0.0:1.0	.	546;606;125	B4DZ28;O60231;Q5SQH5	.;DHX16_HUMAN;.	L	606;125	ENSP00000365625:Q606L;ENSP00000365620:Q125L	ENSP00000365620:Q125L	Q	-	2	0	DHX16	30735529	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.825000	0.55730	2.212000	0.71576	0.374000	0.22700	CAG	.	.		0.582	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
TTBK1	84630	hgsc.bcm.edu	37	6	43220563	43220563	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr6:43220563G>A	ENST00000259750.4	+	3	278	c.195G>A	c.(193-195)gaG>gaA	p.E65E	TTBK1_ENST00000304139.5_Silent_p.E14E	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	65	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TCAAGGTGGAGTCAGCCCAGC	0.592																																					p.E65E		Atlas-SNP	.											.	TTBK1	124	.	0			c.G195A						.						101.0	94.0	96.0					6																	43220563		2203	4300	6503	SO:0001819	synonymous_variant	84630	exon3			GGTGGAGTCAGCC	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.195G>A	chr6.hg19:g.43220563G>A		77.0	0.0		62.0	13.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	hg19	CCDS34455.1																																																																																			.	.		0.592	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
SYNE1	23345	hgsc.bcm.edu	37	6	152768757	152768757	+	Splice_Site	SNP	C	C	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr6:152768757C>G	ENST00000367255.5	-	29	4106	c.3505G>C	c.(3505-3507)Gag>Cag	p.E1169Q	SYNE1_ENST00000341594.5_Splice_Site_p.E1235Q|SYNE1_ENST00000448038.1_Splice_Site_p.E1176Q|SYNE1_ENST00000265368.4_Splice_Site_p.E1169Q|SYNE1_ENST00000423061.1_Splice_Site_p.E1176Q|SYNE1_ENST00000367253.4_Splice_Site_p.E1169Q|SYNE1_ENST00000413186.2_Splice_Site_p.E1169Q|SYNE1_ENST00000367248.3_Splice_Site_p.E1159Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1169					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTCTGATCTCCTGAAATGAG	0.423										HNSCC(10;0.0054)																											p.E1176Q		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G3526C						.						102.0	100.0	101.0					6																	152768757		2203	4300	6503	SO:0001630	splice_region_variant	23345	exon29			TGATCTCCTGAAA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3505-1G>C	chr6.hg19:g.152768757C>G		52.0	0.0		36.0	6.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856819	0.71834	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24	6.05	6.05	0.98169	.	0.191068	0.36444	N	0.002592	T	0.42720	0.1215	L	0.51422	1.61	0.80722	D	1	D;P;D;D;P;P	0.67145	0.991;0.5;0.987;0.996;0.5;0.633	P;B;P;D;B;B	0.63703	0.77;0.156;0.854;0.917;0.156;0.417	T	0.02789	-1.1110	10	0.19590	T	0.45	.	18.7818	0.91937	0.0:1.0:0.0:0.0	.	1152;1169;1159;1169;1169;1176	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	Q	1169;1176;1169;1176;1235;1169;1159;1169	ENSP00000356224:E1169Q;ENSP00000396024:E1176Q;ENSP00000265368:E1169Q;ENSP00000390975:E1176Q;ENSP00000341887:E1235Q;ENSP00000356222:E1169Q;ENSP00000356217:E1159Q;ENSP00000414510:E1169Q	ENSP00000265368:E1169Q	E	-	1	0	SYNE1	152810450	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	2.935000	0.48963	2.878000	0.98634	0.650000	0.86243	GAG	.	.		0.423	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	Missense_Mutation
FNDC1	84624	hgsc.bcm.edu	37	6	159655441	159655441	+	Silent	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr6:159655441C>A	ENST00000297267.9	+	11	4097	c.3897C>A	c.(3895-3897)cgC>cgA	p.R1299R	FNDC1_ENST00000340366.6_Silent_p.R1236R	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1299					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TGTCCTTGCGCCAGAGGATGA	0.597																																					p.R1299R		Atlas-SNP	.											.	FNDC1	250	.	0			c.C3897A						.						27.0	29.0	28.0					6																	159655441		2067	4151	6218	SO:0001819	synonymous_variant	84624	exon11			CTTGCGCCAGAGG	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.3897C>A	chr6.hg19:g.159655441C>A		189.0	0.0		154.0	15.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	hg19	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	C	7.331	0.618973	0.14129	.	.	ENSG00000164694	ENST00000329629	.	.	.	5.43	-2.5	0.06384	.	.	.	.	.	T	0.31199	0.0789	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35051	-0.9804	4	.	.	.	-19.8688	4.6058	0.12376	0.1199:0.2471:0.5018:0.1312	.	.	.	.	T	1195	.	.	P	+	1	0	FNDC1	159575431	0.989000	0.36119	1.000000	0.80357	0.499000	0.33736	-0.009000	0.12765	-0.312000	0.08741	0.557000	0.71058	CCA	.	.		0.597	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
PCLO	27445	hgsc.bcm.edu	37	7	82791801	82791801	+	Silent	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr7:82791801C>A	ENST00000333891.9	-	1	445	c.108G>T	c.(106-108)gcG>gcT	p.A36A	PCLO_ENST00000423517.2_Silent_p.A36A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CGGCCGGGATCGCGGTGTGAG	0.697																																					p.A36A		Atlas-SNP	.											.	PCLO	1506	.	0			c.G108T						.						17.0	21.0	20.0					7																	82791801		1980	4130	6110	SO:0001819	synonymous_variant	27445	exon1			CGGGATCGCGGTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.108G>T	chr7.hg19:g.82791801C>A		110.0	0.0		75.0	41.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.697	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
NRCAM	4897	hgsc.bcm.edu	37	7	107799966	107799966	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr7:107799966G>A	ENST00000425651.2	-	29	3618	c.3619C>T	c.(3619-3621)Cat>Tat	p.H1207Y	NRCAM_ENST00000413765.2_Missense_Mutation_p.H1083Y|NRCAM_ENST00000379028.3_Missense_Mutation_p.H1207Y|NRCAM_ENST00000379024.4_Missense_Mutation_p.H1095Y|NRCAM_ENST00000379022.4_Missense_Mutation_p.H1207Y|NRCAM_ENST00000351718.4_Missense_Mutation_p.H1086Y|NRCAM_ENST00000522550.2_5'Flank	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1207					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GGGTCAGCATGGGCATCTTCC	0.403																																					p.H1207Y		Atlas-SNP	.											.	NRCAM	267	.	0			c.C3619T						.						170.0	153.0	159.0					7																	107799966		2203	4299	6502	SO:0001583	missense	4897	exon29			CAGCATGGGCATC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3619C>T	chr7.hg19:g.107799966G>A	ENSP00000401244:p.His1207Tyr	89.0	0.0		90.0	38.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	hg19	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883682	0.91740	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000437386;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022	D;D;D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03;-2.03;-2.03	5.74	5.74	0.90152	.	0.097095	0.64402	D	0.000001	D	0.91613	0.7350	M	0.73598	2.24	0.80722	D	1	D;P;D;D;D;D	0.64830	0.991;0.832;0.966;0.984;0.98;0.994	P;P;P;P;P;D	0.64506	0.786;0.625;0.786;0.808;0.786;0.926	D	0.89107	0.3493	10	0.28530	T	0.3	.	19.9187	0.97077	0.0:0.0:1.0:0.0	.	1207;53;1083;1095;1086;1207	Q92823-5;B4DFP9;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;.;NRCAM_HUMAN	Y	1207;1207;1083;1114;51;1086;1095;1207;1207	ENSP00000368314:H1207Y;ENSP00000407858:H1083Y;ENSP00000325269:H1086Y;ENSP00000368310:H1095Y;ENSP00000401244:H1207Y;ENSP00000368308:H1207Y	ENSP00000325269:H1086Y	H	-	1	0	NRCAM	107587202	1.000000	0.71417	0.753000	0.31225	0.932000	0.56968	9.869000	0.99810	2.702000	0.92279	0.591000	0.81541	CAT	.	.		0.403	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
TMEM176A	55365	hgsc.bcm.edu	37	7	150501448	150501448	+	Splice_Site	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr7:150501448A>G	ENST00000484928.1	+	6	1136		c.e6-1		TMEM176A_ENST00000461345.1_Splice_Site|TMEM176A_ENST00000004103.3_Splice_Site|TMEM176B_ENST00000447204.2_5'Flank			Q96HP8	T176A_HUMAN	transmembrane protein 176A						negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCTGTCCCCAGGCCTTGTTC	0.547																																					.		Atlas-SNP	.											.	TMEM176A	35	.	0			c.556-2A>G						.						136.0	111.0	119.0					7																	150501448		2203	4300	6503	SO:0001630	splice_region_variant	55365	exon6			GTCCCCAGGCCTT	AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.556-1A>G	chr7.hg19:g.150501448A>G		104.0	0.0		112.0	21.0	NM_018487	D3DX00|Q9NYC7	Splice_Site	SNP	ENST00000484928.1	hg19	CCDS5909.1	.	.	.	.	.	.	.	.	.	.	A	15.08	2.727426	0.48833	.	.	ENSG00000002933	ENST00000484928;ENST00000004103;ENST00000461345;ENST00000475536	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5109	0.44862	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM176A	150132381	1.000000	0.71417	0.998000	0.56505	0.822000	0.46500	3.199000	0.51043	1.804000	0.52760	0.533000	0.62120	.	.	.		0.547	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350222.1	NM_018487	Intron
KMT2C	58508	hgsc.bcm.edu	37	7	151860411	151860411	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr7:151860411C>T	ENST00000262189.6	-	43	10469	c.10251G>A	c.(10249-10251)caG>caA	p.Q3417Q	KMT2C_ENST00000355193.2_Silent_p.Q3417Q	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3417	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TATCTACCTCCTGCATGAGTT	0.448																																					p.Q3417Q		Atlas-SNP	.											.	MLL3	1564	.	0			c.G10251A						.						316.0	275.0	289.0					7																	151860411		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon43			TACCTCCTGCATG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.10251G>A	chr7.hg19:g.151860411C>T		200.0	0.0		230.0	87.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	5.430	0.264411	0.10294	.	.	ENSG00000055609	ENST00000360104	.	.	.	5.18	-5.15	0.02866	.	.	.	.	.	T	0.52917	0.1764	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53107	-0.8485	4	.	.	.	.	10.172	0.42915	0.0:0.5193:0.1106:0.3701	.	.	.	.	R	923	.	.	G	-	1	0	MLL3	151491344	0.021000	0.18746	0.432000	0.26747	0.846000	0.48090	-0.827000	0.04424	-1.345000	0.02214	-0.238000	0.12139	GGA	.	.		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
RP1L1	94137	hgsc.bcm.edu	37	8	10468548	10468548	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:10468548C>T	ENST00000382483.3	-	4	3283	c.3060G>A	c.(3058-3060)caG>caA	p.Q1020Q		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1020					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCTCTGGGTCCTGGCCGGGGT	0.672																																					p.Q1020Q		Atlas-SNP	.											.	RP1L1	453	.	0			c.G3060A						.						21.0	23.0	23.0					8																	10468548		1834	4027	5861	SO:0001819	synonymous_variant	94137	exon4			TGGGTCCTGGCCG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3060G>A	chr8.hg19:g.10468548C>T		104.0	0.0		85.0	40.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	hg19	CCDS43708.1																																																																																			.	.		0.672	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
TTI2	80185	hgsc.bcm.edu	37	8	33370119	33370119	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:33370119T>C	ENST00000431156.2	-	2	631	c.13A>G	c.(13-15)Agc>Ggc	p.S5G	SNORD13_ENST00000459299.1_RNA|TTI2_ENST00000519356.1_5'Flank|TTI2_ENST00000520636.1_Missense_Mutation_p.S5G|TTI2_ENST00000360742.5_Missense_Mutation_p.S5G	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	5																	TCCAGAGCGCTGTCAAGCTCC	0.557																																					p.S5G		Atlas-SNP	.											.	.	.	.	0			c.A13G						.						48.0	50.0	49.0					8																	33370119		2203	4294	6497	SO:0001583	missense	80185	exon2			GAGCGCTGTCAAG	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.13A>G	chr8.hg19:g.33370119T>C	ENSP00000411169:p.Ser5Gly	39.0	0.0		38.0	18.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	T	8.203	0.798525	0.16397	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636;ENST00000520397;ENST00000523305	T;T;T;T	0.58940	0.33;0.33;0.3;0.68	3.54	-7.07	0.01563	.	1.511920	0.04180	N	0.326383	T	0.35970	0.0950	L	0.28400	0.85	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.10917	-1.0609	10	0.33141	T	0.24	-0.8541	0.7161	0.00932	0.2238:0.1332:0.2251:0.4179	.	5;5;5	E5RH83;Q6NXR4;E5RIH5	.;TTI2_HUMAN;.	G	5	ENSP00000353971:S5G;ENSP00000411169:S5G;ENSP00000428401:S5G;ENSP00000428569:S5G	ENSP00000353971:S5G	S	-	1	0	C8orf41	33489661	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-6.566000	0.00061	-2.317000	0.00644	-0.366000	0.07423	AGC	.	.		0.557	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
CHD7	55636	hgsc.bcm.edu	37	8	61764754	61764754	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:61764754G>A	ENST00000423902.2	+	29	6321	c.5842G>A	c.(5842-5844)Gtg>Atg	p.V1948M	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1948					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TCGAGAGGAAGTGAGAGCTCT	0.537																																					p.V1948M		Atlas-SNP	.											.	CHD7	534	.	0			c.G5842A						.						54.0	58.0	57.0					8																	61764754		1886	4091	5977	SO:0001583	missense	55636	exon29			GAGGAAGTGAGAG	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.5842G>A	chr8.hg19:g.61764754G>A	ENSP00000392028:p.Val1948Met	112.0	0.0		127.0	53.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	hg19	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209770	0.39003	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.86956	-2.19	5.18	5.18	0.71444	.	0.152794	0.42548	D	0.000689	D	0.85630	0.5741	N	0.25332	0.735	0.39940	D	0.974391	D	0.54772	0.968	P	0.50860	0.652	D	0.85789	0.1366	10	0.36615	T	0.2	-19.0624	19.0585	0.93076	0.0:0.0:1.0:0.0	.	1948	Q9P2D1	CHD7_HUMAN	M	1948	ENSP00000392028:V1948M	ENSP00000307304:V1948M	V	+	1	0	CHD7	61927308	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.139000	0.71728	2.583000	0.87209	0.655000	0.94253	GTG	.	.		0.537	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
PPP1R42	286187	hgsc.bcm.edu	37	8	67926750	67926750	+	Silent	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:67926750A>G	ENST00000324682.5	-	3	351	c.207T>C	c.(205-207)aaT>aaC	p.N69N	PPP1R42_ENST00000522909.1_Silent_p.N69N|PPP1R42_ENST00000517834.1_Intron	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	69					regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										TTGTGGCATAATTCAGGTTAG	0.313																																					p.N69N		Atlas-SNP	.											.	PPP1R42	2	.	0			c.T207C						.						96.0	107.0	103.0					8																	67926750		2203	4289	6492	SO:0001819	synonymous_variant	286187	exon3			GGCATAATTCAGG	BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.207T>C	chr8.hg19:g.67926750A>G		89.0	0.0		83.0	11.0	NM_001013626		Silent	SNP	ENST00000324682.5	hg19	CCDS34902.1																																																																																			.	.		0.313	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380034.2	NM_001013626	
CPQ	10404	hgsc.bcm.edu	37	8	97847252	97847252	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:97847252G>C	ENST00000220763.5	+	3	695	c.485G>C	c.(484-486)aGg>aCg	p.R162T		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	162					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										CTGCAGAGAAGGGCCTCAGAA	0.473																																					p.R162T		Atlas-SNP	.											.	.	.	.	0			c.G485C						.						121.0	112.0	115.0					8																	97847252		2203	4300	6503	SO:0001583	missense	10404	exon3			AGAGAAGGGCCTC	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.485G>C	chr8.hg19:g.97847252G>C	ENSP00000220763:p.Arg162Thr	215.0	0.0		235.0	88.0	NM_016134	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	hg19	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848311	0.32699	.	.	ENSG00000104324	ENST00000220763;ENST00000517742	T;T	0.45668	0.94;0.89	5.74	4.87	0.63330	.	0.047455	0.85682	D	0.000000	T	0.49457	0.1558	L	0.55103	1.725	0.39093	D	0.961145	P;D	0.55172	0.893;0.97	P;P	0.54759	0.76;0.67	T	0.47699	-0.9097	10	0.22706	T	0.39	-25.4327	12.6301	0.56653	0.0758:0.0:0.9242:0.0	.	162;162	B5MDX4;Q9Y646	.;PGCP_HUMAN	T	162	ENSP00000220763:R162T;ENSP00000429146:R162T	ENSP00000220763:R162T	R	+	2	0	AC010859.1	97916428	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.876000	0.63079	1.418000	0.47098	0.655000	0.94253	AGG	.	.		0.473	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110447476	110447476	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:110447476T>G	ENST00000378402.5	+	29	3502	c.3398T>G	c.(3397-3399)gTg>gGg	p.V1133G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1133	IPT/TIG 4.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCCGTTGCTGTGTCCATGGCT	0.423										HNSCC(38;0.096)																											p.V1133G		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.T3398G						.						175.0	175.0	175.0					8																	110447476		1865	4121	5986	SO:0001583	missense	93035	exon29			TTGCTGTGTCCAT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3398T>G	chr8.hg19:g.110447476T>G	ENSP00000367655:p.Val1133Gly	115.0	0.0		120.0	6.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.467625	0.43839	.	.	ENSG00000205038	ENST00000378402	D	0.81908	-1.55	6.07	6.07	0.98685	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.074683	0.52532	D	0.000065	D	0.90823	0.7118	M	0.84082	2.675	0.46901	D	0.999245	D	0.67145	0.996	D	0.68765	0.96	D	0.91925	0.5550	10	0.87932	D	0	.	13.0325	0.58851	0.0:0.0:0.0:1.0	.	1133	Q86WI1	PKHL1_HUMAN	G	1133	ENSP00000367655:V1133G	ENSP00000367655:V1133G	V	+	2	0	PKHD1L1	110516652	1.000000	0.71417	0.994000	0.49952	0.026000	0.11368	3.959000	0.56744	2.326000	0.78906	0.533000	0.62120	GTG	.	.		0.423	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PUF60	22827	hgsc.bcm.edu	37	8	144899577	144899577	+	Silent	SNP	T	T	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:144899577T>A	ENST00000526683.1	-	10	1623	c.1068A>T	c.(1066-1068)ccA>ccT	p.P356P	PUF60_ENST00000456095.2_Silent_p.P327P|SCRIB_ENST00000320476.3_5'Flank|SCRIB_ENST00000356994.2_5'Flank|PUF60_ENST00000313352.7_Silent_p.P296P|PUF60_ENST00000453551.2_Silent_p.P313P|PUF60_ENST00000527197.1_Silent_p.P310P|PUF60_ENST00000524570.1_5'UTR|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000349157.6_Silent_p.P339P	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	356	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGGTCAGTGCTGGGGACACCA	0.637																																					p.P356P		Atlas-SNP	.											.	PUF60	26	.	0			c.A1068T						.						20.0	24.0	23.0					8																	144899577		2167	4281	6448	SO:0001819	synonymous_variant	22827	exon10			CAGTGCTGGGGAC	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1068A>T	chr8.hg19:g.144899577T>A		151.0	0.0		187.0	84.0	NM_078480	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	hg19	CCDS47934.1	.	.	.	.	.	.	.	.	.	.	T	9.483	1.098705	0.20552	.	.	ENSG00000179950	ENST00000532884	.	.	.	3.96	-1.84	0.07809	.	.	.	.	.	T	0.39655	0.1086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29366	-1.0014	4	.	.	.	.	1.7799	0.03029	0.4723:0.1027:0.1016:0.3233	.	.	.	.	L	226	.	.	Q	-	2	0	PUF60	144971565	0.735000	0.28153	0.987000	0.45799	0.990000	0.78478	-0.368000	0.07543	-0.113000	0.11958	0.459000	0.35465	CAG	.	.		0.637	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1	NM_014281	
PARP10	84875	hgsc.bcm.edu	37	8	145059302	145059302	+	Missense_Mutation	SNP	C	C	A	rs199611396		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:145059302C>A	ENST00000313028.7	-	5	962	c.868G>T	c.(868-870)Gca>Tca	p.A290S	PARP10_ENST00000525773.1_Missense_Mutation_p.A302S|PARP10_ENST00000533665.1_5'UTR|PARP10_ENST00000524918.1_Missense_Mutation_p.A290S	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	290					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACAGTCCCTGCACCCTGCAGA	0.627																																					p.A290S		Atlas-SNP	.											.	PARP10	57	.	0			c.G868T						.						84.0	82.0	83.0					8																	145059302		2203	4300	6503	SO:0001583	missense	84875	exon5			TCCCTGCACCCTG	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.868G>T	chr8.hg19:g.145059302C>A	ENSP00000325618:p.Ala290Ser	75.0	0.0		81.0	13.0	NM_032789	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	hg19	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	C	8.863	0.947293	0.18356	.	.	ENSG00000178685	ENST00000524918;ENST00000313028;ENST00000525773;ENST00000313059	T;T;T;T	0.57107	2.61;2.55;2.53;0.42	3.01	-6.03	0.02185	.	1.668030	0.04232	U	0.335399	T	0.27278	0.0669	N	0.19112	0.55	0.09310	N	1	B;B;B	0.22800	0.035;0.028;0.075	B;B;B	0.17433	0.018;0.007;0.018	T	0.10042	-1.0647	10	0.15499	T	0.54	.	0.9804	0.01435	0.1384:0.2593:0.2557:0.3466	.	302;290;290	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	S	290;290;302;205	ENSP00000431620:A290S;ENSP00000325618:A290S;ENSP00000434776:A302S;ENSP00000314320:A205S	ENSP00000325618:A290S	A	-	1	0	PARP10	145131290	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.212000	0.09319	-1.108000	0.03000	-0.488000	0.04728	GCA	.	.		0.627	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
DNAI1	27019	hgsc.bcm.edu	37	9	34514529	34514529	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr9:34514529C>T	ENST00000242317.4	+	17	1878	c.1707C>T	c.(1705-1707)gaC>gaT	p.D569D		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	569					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		AGATCTGGGACCACACCATCA	0.597									Kartagener syndrome																												p.D569D		Atlas-SNP	.											.	DNAI1	72	.	0			c.C1707T						.						117.0	111.0	113.0					9																	34514529		2203	4300	6503	SO:0001819	synonymous_variant	27019	exon17	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CTGGGACCACACC	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1707C>T	chr9.hg19:g.34514529C>T		91.0	0.0		90.0	14.0	NM_012144	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Silent	SNP	ENST00000242317.4	hg19	CCDS6557.1	.	.	.	.	.	.	.	.	.	.	C	7.842	0.722142	0.15372	.	.	ENSG00000122735	ENST00000442556	.	.	.	5.57	4.67	0.58626	.	.	.	.	.	T	0.58047	0.2095	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56165	-0.8024	4	.	.	.	.	7.5718	0.27911	0.1617:0.7545:0.0:0.0838	.	.	.	.	I	73	.	.	T	+	2	0	DNAI1	34504529	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.112000	0.31172	1.352000	0.45808	0.561000	0.74099	ACC	.	.		0.597	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052192.1		
TLE4	7091	hgsc.bcm.edu	37	9	82320836	82320837	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr9:82320836_82320837GG>TT	ENST00000376552.2	+	10	1780_1781	c.762_763GG>TT	c.(760-765)ttGGtg>ttTTtg	p.254_255LV>FL	TLE4_ENST00000376544.3_Intron|TLE4_ENST00000265284.6_Missense_Mutation_p.229_230LV>FL|TLE4_ENST00000376537.4_Missense_Mutation_p.254_255LV>FL|TLE4_ENST00000376520.4_Missense_Mutation_p.254_255LV>FL|TLE4_ENST00000376534.4_5'UTR	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	254	CCN domain.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						ATGACAACTTGGTGGTTGACGT	0.401																																					p.L254F|p.V255L		Atlas-SNP	.											.	TLE4	187	.	0			c.G762T|c.G763T						.																																			SO:0001583	missense	7091	exon10			CAACTTGGTGGTT|AACTTGGTGGTTG	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	Exception_encountered	chr9.hg19:g.82320836_82320837delinsTT	ENSP00000365735:p.L254_V255delinsFL	326.0|322.0	0.0		166.0|161.0	52.0|49.0	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	hg19	CCDS43837.1																																																																																			.	.		0.401	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
ABCA1	19	hgsc.bcm.edu	37	9	107607783	107607783	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr9:107607783T>C	ENST00000374736.3	-	8	1182	c.788A>G	c.(787-789)cAt>cGt	p.H263R		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	263					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CCCAAGACTATGCAGCAATGT	0.448																																					p.H263R		Atlas-SNP	.											.	ABCA1	244	.	0			c.A788G						.						117.0	105.0	109.0					9																	107607783		2203	4300	6503	SO:0001583	missense	19	exon8			AGACTATGCAGCA	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.788A>G	chr9.hg19:g.107607783T>C	ENSP00000363868:p.His263Arg	87.0	0.0		79.0	21.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	hg19	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	T	7.197	0.592676	0.13875	.	.	ENSG00000165029	ENST00000374736	D	0.87571	-2.27	5.62	3.26	0.37387	.	0.583335	0.19928	N	0.102936	T	0.75221	0.3820	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.66280	-0.5963	10	0.56958	D	0.05	.	8.4518	0.32875	0.0:0.1534:0.0:0.8466	.	263	O95477	ABCA1_HUMAN	R	263	ENSP00000363868:H263R	ENSP00000363868:H263R	H	-	2	0	ABCA1	106647604	0.260000	0.24053	0.452000	0.26994	0.123000	0.20343	3.305000	0.51873	0.413000	0.25759	-0.361000	0.07541	CAT	.	.		0.448	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
TPRN	286262	hgsc.bcm.edu	37	9	140093940	140093940	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr9:140093940G>T	ENST00000409012.4	-	1	1310	c.1224C>A	c.(1222-1224)gaC>gaA	p.D408E	TPRN_ENST00000321773.2_Missense_Mutation_p.D347E|TPRN_ENST00000541945.1_Intron	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	408					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						TAATAGCCCGGTCAGCGAGGG	0.697																																					p.D408E		Atlas-SNP	.											.	TPRN	28	.	0			c.C1224A						.						9.0	12.0	11.0					9																	140093940		2181	4279	6460	SO:0001583	missense	286262	exon1			AGCCCGGTCAGCG	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1224C>A	chr9.hg19:g.140093940G>T	ENSP00000387100:p.Asp408Glu	102.0	0.0		75.0	33.0	NM_001128228	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	hg19	CCDS56594.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.152969	0.00325	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	3.47	1.43	0.22495	.	2.020920	0.02495	N	0.089907	T	0.34221	0.0890	L	0.43923	1.385	0.09310	N	1	B	0.24618	0.107	B	0.20577	0.03	T	0.12682	-1.0538	9	0.28530	T	0.3	.	4.0337	0.09721	0.1489:0.2767:0.5745:0.0	.	408	Q4KMQ1	TPRN_HUMAN	E	206;408;347	.	ENSP00000313704:D347E	D	-	3	2	TPRN	139213761	0.472000	0.25870	0.162000	0.22713	0.120000	0.20174	0.966000	0.29331	0.653000	0.30826	0.456000	0.33151	GAC	.	.		0.697	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691	
VIM	7431	hgsc.bcm.edu	37	10	17271663	17271663	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:17271663A>T	ENST00000224237.5	+	1	387	c.242A>T	c.(241-243)cAg>cTg	p.Q81L	VIM_ENST00000485947.1_3'UTR|VIM_ENST00000544301.1_Missense_Mutation_p.Q81L|VIM-AS1_ENST00000605833.1_RNA|VIM-AS1_ENST00000437232.1_RNA			P08670	VIME_HUMAN	vimentin	81	Head.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGGCTCCTGCAGGACTCGGTG	0.677																																					p.Q81L		Atlas-SNP	.											.	VIM	71	.	0			c.A242T						.						15.0	15.0	15.0					10																	17271663		2168	4246	6414	SO:0001583	missense	7431	exon2			TCCTGCAGGACTC	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.242A>T	chr10.hg19:g.17271663A>T	ENSP00000224237:p.Gln81Leu	108.0	0.0		98.0	34.0	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	hg19	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	A	10.51	1.369899	0.24771	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533	D;D	0.82255	-1.59;-1.59	5.29	4.12	0.48240	Intermediate filament head, DNA-binding domain (1);	0.153499	0.30383	N	0.009749	T	0.68778	0.3038	N	0.19112	0.55	0.35531	D	0.802231	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.001;0.0	B;B;B;B;B	0.11329	0.004;0.002;0.004;0.006;0.004	T	0.64918	-0.6294	10	0.33141	T	0.24	.	7.5003	0.27513	0.7098:0.1484:0.0:0.1418	.	81;68;68;81;81	Q53HU8;F5H288;B3KRK8;B0YJC4;P08670	.;.;.;.;VIME_HUMAN	L	81;81;68	ENSP00000446007:Q81L;ENSP00000224237:Q81L	ENSP00000224237:Q81L	Q	+	2	0	VIM	17311669	1.000000	0.71417	0.998000	0.56505	0.928000	0.56348	4.392000	0.59659	0.809000	0.34255	0.450000	0.29827	CAG	.	.		0.677	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
MYO3A	53904	hgsc.bcm.edu	37	10	26409644	26409644	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:26409644A>T	ENST00000265944.5	+	18	1982	c.1816A>T	c.(1816-1818)Aat>Tat	p.N606Y	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	606	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TGCAATCTTGAATGTTGGCAA	0.403																																					p.N606Y		Atlas-SNP	.											.	MYO3A	371	.	0			c.A1816T						.						186.0	155.0	165.0					10																	26409644		2203	4300	6503	SO:0001583	missense	53904	exon18			ATCTTGAATGTTG	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1816A>T	chr10.hg19:g.26409644A>T	ENSP00000265944:p.Asn606Tyr	113.0	0.0		82.0	27.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.779314	0.90195	.	.	ENSG00000095777	ENST00000265944	T	0.71222	-0.55	5.96	5.96	0.96718	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	L	0.39467	1.215	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.81219	-0.1032	10	0.87932	D	0	.	16.4447	0.83919	1.0:0.0:0.0:0.0	.	606	Q8NEV4	MYO3A_HUMAN	Y	606	ENSP00000265944:N606Y	ENSP00000265944:N606Y	N	+	1	0	MYO3A	26449650	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.339000	0.96797	2.284000	0.76573	0.528000	0.53228	AAT	.	.		0.403	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
A1CF	29974	hgsc.bcm.edu	37	10	52575807	52575807	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:52575807T>C	ENST00000373993.1	-	7	1144	c.1100A>G	c.(1099-1101)cAt>cGt	p.H367R	A1CF_ENST00000374001.2_Missense_Mutation_p.H367R|A1CF_ENST00000395489.2_Missense_Mutation_p.H360R|ASAH2B_ENST00000483649.1_3'UTR|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000373997.3_Missense_Mutation_p.H367R|A1CF_ENST00000282641.2_Missense_Mutation_p.H367R|A1CF_ENST00000395495.1_Missense_Mutation_p.H312R|A1CF_ENST00000373995.3_Missense_Mutation_p.H375R			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	367	Required for nuclear localization. {ECO:0000269|PubMed:12896982}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						GTTGCTGAGATGTCCTTTGGT	0.473																																					p.H375R		Atlas-SNP	.											.	A1CF	190	.	0			c.A1124G						.						155.0	150.0	152.0					10																	52575807		2203	4300	6503	SO:0001583	missense	29974	exon10			CTGAGATGTCCTT	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1100A>G	chr10.hg19:g.52575807T>C	ENSP00000363105:p.His367Arg	205.0	0.0		177.0	50.0	NM_001198820	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	hg19	CCDS7242.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.973237	0.53614	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489	T;T;T;T;T;T;T	0.10960	2.88;2.94;2.88;2.88;2.94;2.82;2.94	5.78	3.26	0.37387	.	0.428194	0.29348	N	0.012402	T	0.07954	0.0199	L	0.29908	0.895	0.38326	D	0.943653	B;B;B;B	0.22003	0.063;0.012;0.008;0.0	B;B;B;B	0.21360	0.034;0.006;0.009;0.004	T	0.24190	-1.0167	10	0.21014	T	0.42	.	11.3109	0.49364	0.0:0.0:0.2317:0.7683	.	360;367;367;375	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	R	367;367;367;375;367;312;350;360	ENSP00000363113:H367R;ENSP00000363105:H367R;ENSP00000363109:H367R;ENSP00000363107:H375R;ENSP00000282641:H367R;ENSP00000378873:H312R;ENSP00000378868:H360R	ENSP00000282641:H367R	H	-	2	0	A1CF	52245813	0.995000	0.38212	0.998000	0.56505	0.989000	0.77384	2.389000	0.44407	2.214000	0.71695	0.528000	0.53228	CAT	.	.		0.473	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576	
TMEM26	219623	hgsc.bcm.edu	37	10	63212687	63212687	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:63212687C>T	ENST00000399298.3	-	1	521	c.153G>A	c.(151-153)gcG>gcA	p.A51A	TMEM26_ENST00000399293.1_Silent_p.A51A|RP11-809M12.1_ENST00000389640.4_RNA	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	51						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					TGAGGGTGAGCGCAGTCTCCA	0.637																																					p.A51A		Atlas-SNP	.											.	TMEM26	47	.	0			c.G153A						.						74.0	86.0	82.0					10																	63212687		2032	4182	6214	SO:0001819	synonymous_variant	219623	exon1			GGTGAGCGCAGTC	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.153G>A	chr10.hg19:g.63212687C>T		207.0	0.0		212.0	27.0	NM_178505	Q6ZVM0|Q8IVN9	Silent	SNP	ENST00000399298.3	hg19	CCDS41530.1																																																																																			.	.		0.637	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
STOX1	219736	hgsc.bcm.edu	37	10	70644911	70644911	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:70644911C>T	ENST00000298596.6	+	3	1442	c.1359C>T	c.(1357-1359)ccC>ccT	p.P453P	STOX1_ENST00000399169.4_Silent_p.P453P|STOX1_ENST00000421961.2_Silent_p.P343P|STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399165.4_Intron	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	453						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						AGAAACACCCCAAGCTCCCTG	0.488																																					p.P453P		Atlas-SNP	.											.	STOX1	75	.	0			c.C1359T						.						106.0	109.0	108.0					10																	70644911		1908	4114	6022	SO:0001819	synonymous_variant	219736	exon3			ACACCCCAAGCTC	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1359C>T	chr10.hg19:g.70644911C>T		101.0	0.0		112.0	16.0	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Silent	SNP	ENST00000298596.6	hg19	CCDS41535.1																																																																																			.	.		0.488	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
HKDC1	80201	hgsc.bcm.edu	37	10	71007177	71007177	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:71007177G>A	ENST00000354624.5	+	9	1226	c.1093G>A	c.(1093-1095)Gag>Aag	p.E365K	HKDC1_ENST00000395086.2_Missense_Mutation_p.E365K	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	365	Hexokinase type-2 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GGAACCGTCTGAGGCTGACTG	0.572																																					p.E365K		Atlas-SNP	.											.	HKDC1	98	.	0			c.G1093A						.						126.0	122.0	123.0					10																	71007177		2203	4300	6503	SO:0001583	missense	80201	exon9			CCGTCTGAGGCTG		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1093G>A	chr10.hg19:g.71007177G>A	ENSP00000346643:p.Glu365Lys	177.0	0.0		190.0	51.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	hg19	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.324364	0.41197	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.96265	-3.96;-3.96	4.84	4.84	0.62591	Hexokinase, C-terminal (1);	0.390122	0.28209	N	0.016190	D	0.93360	0.7883	L	0.33792	1.035	0.40601	D	0.981589	B	0.23591	0.088	B	0.30943	0.122	D	0.90623	0.4561	10	0.12766	T	0.61	-26.9802	18.1044	0.89516	0.0:0.0:1.0:0.0	.	365	Q2TB90	HKDC1_HUMAN	K	365	ENSP00000346643:E365K;ENSP00000378521:E365K	ENSP00000346643:E365K	E	+	1	0	HKDC1	70677183	1.000000	0.71417	0.919000	0.36401	0.746000	0.42486	4.420000	0.59841	2.498000	0.84270	0.561000	0.74099	GAG	.	.		0.572	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
SORCS1	114815	hgsc.bcm.edu	37	10	108367021	108367021	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr10:108367021G>A	ENST00000263054.6	-	23	3075	c.3068C>T	c.(3067-3069)gCg>gTg	p.A1023V	SORCS1_ENST00000369698.1_Missense_Mutation_p.A558V|SORCS1_ENST00000344440.6_Missense_Mutation_p.A1023V|SORCS1_ENST00000478809.2_5'UTR	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	1023					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGGGAGCACCGCCACCAGGAT	0.552																																					p.A1023V		Atlas-SNP	.											.	SORCS1	534	.	0			c.C3068T						.						66.0	63.0	64.0					10																	108367021		2203	4300	6503	SO:0001583	missense	114815	exon23			AGCACCGCCACCA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3068C>T	chr10.hg19:g.108367021G>A	ENSP00000263054:p.Ala1023Val	90.0	0.0		78.0	24.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.37|13.37	2.217666|2.217666	0.39201|0.39201	.|.	.|.	ENSG00000108018|ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440|ENST00000452214	T;T;T|.	0.20881|.	2.04;2.57;2.59|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.059080|.	0.64402|.	D|.	0.000002|.	T|T	0.65450|0.65450	0.2692|0.2692	L|L	0.35249|0.35249	1.045|1.045	0.58432|0.58432	D|D	0.999998|0.999998	B;P;P;B;P|.	0.37038|.	0.443;0.579;0.579;0.443;0.579|.	B;B;B;B;B|.	0.31290|.	0.06;0.127;0.127;0.06;0.127|.	T|T	0.58487|0.58487	-0.7628|-0.7628	9|5	.|.	.|.	.|.	-22.0366|-22.0366	19.9164|19.9164	0.97064|0.97064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1023;1023;1023;1023;1023|.	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2|.	.;.;.;SORC1_HUMAN;.|.	V|W	558;1023;1023|38	ENSP00000358712:A558V;ENSP00000263054:A1023V;ENSP00000345964:A1023V|.	.|.	A|R	-|-	2|1	0|2	SORCS1|SORCS1	108357011|108357011	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.742000|0.742000	0.42306|0.42306	8.452000|8.452000	0.90346|0.90346	2.804000|2.804000	0.96469|0.96469	0.655000|0.655000	0.94253|0.94253	GCG|CGG	.	.		0.552	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR4A15	81328	hgsc.bcm.edu	37	11	55135547	55135547	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:55135547A>T	ENST00000314706.3	+	1	188	c.188A>T	c.(187-189)tAc>tTc	p.Y63F		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						TTACTAATCTACATGGTGACG	0.423																																					p.Y63F		Atlas-SNP	.											.	OR4A15	161	.	0			c.A188T						.						93.0	85.0	88.0					11																	55135547		2201	4296	6497	SO:0001583	missense	81328	exon1			TAATCTACATGGT	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.188A>T	chr11.hg19:g.55135547A>T	ENSP00000325065:p.Tyr63Phe	108.0	0.0		123.0	17.0	NM_001005275	Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	hg19	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	a	15.58	2.874859	0.51695	.	.	ENSG00000181958	ENST00000314706	T	0.04406	3.63	3.48	3.48	0.39840	.	0.000000	0.45606	D	0.000359	T	0.11623	0.0283	M	0.84156	2.68	0.34689	D	0.725566	B	0.33528	0.416	B	0.40285	0.325	T	0.04976	-1.0914	10	0.72032	D	0.01	.	10.0107	0.41984	1.0:0.0:0.0:0.0	.	63	Q8NGL6	O4A15_HUMAN	F	63	ENSP00000325065:Y63F	ENSP00000325065:Y63F	Y	+	2	0	OR4A15	54892123	0.997000	0.39634	0.544000	0.28141	0.021000	0.10359	5.616000	0.67709	1.456000	0.47831	0.403000	0.27427	TAC	.	.		0.423	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
OR4C11	219429	hgsc.bcm.edu	37	11	55371775	55371775	+	Silent	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:55371775C>A	ENST00000302231.4	-	1	99	c.75G>T	c.(73-75)gtG>gtT	p.V25V		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						AGATTACAAACACTATTTTCT	0.408																																					p.V25V		Atlas-SNP	.											.	OR4C11	73	.	0			c.G75T						.						70.0	66.0	68.0					11																	55371775		2177	3998	6175	SO:0001819	synonymous_variant	219429	exon1			TACAAACACTATT	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.75G>T	chr11.hg19:g.55371775C>A		95.0	0.0		84.0	15.0	NM_001004700	B9EIL4|Q8NGL8	Silent	SNP	ENST00000302231.4	hg19	CCDS31503.1																																																																																			.	.		0.408	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
OR8K1	390157	hgsc.bcm.edu	37	11	56114194	56114194	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:56114194T>G	ENST00000279783.2	+	1	774	c.680T>G	c.(679-681)aTt>aGt	p.I227S		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					TACATGTTTATTCTAGTGGCC	0.398										HNSCC(65;0.19)																											p.I227S		Atlas-SNP	.											.	OR8K1	93	.	0			c.T680G						.						98.0	89.0	92.0					11																	56114194		2201	4296	6497	SO:0001583	missense	390157	exon1			TGTTTATTCTAGT	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.680T>G	chr11.hg19:g.56114194T>G	ENSP00000279783:p.Ile227Ser	96.0	0.0		105.0	51.0	NM_001002907	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	hg19	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.494499	0.64186	.	.	ENSG00000150261	ENST00000279783	T	0.00384	7.6	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000137	T	0.02012	0.0063	H	0.98446	4.235	0.50632	D	0.99988	D	0.76494	0.999	D	0.70487	0.969	T	0.05500	-1.0881	10	0.87932	D	0	-20.7066	14.7062	0.69191	0.0:0.0:0.0:1.0	.	227	Q8NGG5	OR8K1_HUMAN	S	227	ENSP00000279783:I227S	ENSP00000279783:I227S	I	+	2	0	OR8K1	55870770	1.000000	0.71417	0.021000	0.16686	0.613000	0.37349	7.351000	0.79395	1.862000	0.54008	0.448000	0.29417	ATT	.	.		0.398	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907	
TSKU	25987	hgsc.bcm.edu	37	11	76507685	76507685	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:76507685C>A	ENST00000527881.1	+	2	2051	c.1025C>A	c.(1024-1026)aCc>aAc	p.T342N	TSKU_ENST00000333090.4_Missense_Mutation_p.T342N			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	342					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					TGCGTAGACACCCGGGATTCT	0.677																																					p.T342N		Atlas-SNP	.											.	TSKU	26	.	0			c.C1025A						.						8.0	14.0	12.0					11																	76507685		2016	4002	6018	SO:0001583	missense	25987	exon2			TAGACACCCGGGA	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.1025C>A	chr11.hg19:g.76507685C>A	ENSP00000434847:p.Thr342Asn	55.0	0.0		38.0	11.0	NM_015516	B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	ENST00000527881.1	hg19	CCDS8246.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024939	0.35701	.	.	ENSG00000182704	ENST00000333090;ENST00000439807;ENST00000527881	T;T	0.33216	1.42;1.42	4.63	1.26	0.21427	.	0.934295	0.09039	N	0.857533	T	0.15565	0.0375	N	0.19112	0.55	0.09310	N	1	B	0.23650	0.089	B	0.18263	0.021	T	0.33033	-0.9884	10	0.11485	T	0.65	-7.6346	4.7821	0.13208	0.0:0.5036:0.2745:0.2219	.	342	Q8WUA8	TSK_HUMAN	N	342;310;342	ENSP00000332668:T342N;ENSP00000434847:T342N	ENSP00000332668:T342N	T	+	2	0	TSKU	76185333	0.003000	0.15002	0.003000	0.11579	0.613000	0.37349	0.981000	0.29526	0.492000	0.27815	0.556000	0.70494	ACC	.	.		0.677	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382871.1	NM_015516	
CAPN5	726	hgsc.bcm.edu	37	11	76834775	76834775	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:76834775G>A	ENST00000278559.3	+	13	1971	c.1782G>A	c.(1780-1782)caG>caA	p.Q594Q	CAPN5_ENST00000456580.2_Silent_p.Q634Q|CAPN5_ENST00000531028.1_Splice_Site|CAPN5_ENST00000529629.1_Silent_p.Q594Q	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	594	C2.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						TTCTGGGCCAGGTGCACCTAA	0.607																																					p.Q594Q		Atlas-SNP	.											.	CAPN5	67	.	0			c.G1782A						.						117.0	116.0	116.0					11																	76834775		2200	4292	6492	SO:0001819	synonymous_variant	726	exon13			GGGCCAGGTGCAC		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.1782G>A	chr11.hg19:g.76834775G>A		136.0	0.0		144.0	29.0	NM_004055	O00263	Silent	SNP	ENST00000278559.3	hg19	CCDS8248.1																																																																																			.	.		0.607	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
DSCAML1	57453	hgsc.bcm.edu	37	11	117342745	117342745	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:117342745C>T	ENST00000321322.6	-	15	2973	c.2972G>A	c.(2971-2973)tGg>tAg	p.W991*	DSCAML1_ENST00000527706.1_Nonsense_Mutation_p.W721*	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	931	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTTGAAGTCCCAGGAATCTGG	0.522																																					p.W991X		Atlas-SNP	.											.	DSCAML1	286	.	0			c.G2972A						.						143.0	122.0	129.0					11																	117342745		2201	4296	6497	SO:0001587	stop_gained	57453	exon15			AAGTCCCAGGAAT		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2972G>A	chr11.hg19:g.117342745C>T	ENSP00000315465:p.Trp991*	163.0	0.0		178.0	12.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Nonsense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	39	7.714800	0.98450	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.9945	0.86363	0.0:1.0:0.0:0.0	.	.	.	.	X	721;991;698	.	ENSP00000315465:W991X	W	-	2	0	DSCAML1	116847955	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.645000	0.83430	2.226000	0.72624	0.455000	0.32223	TGG	.	.		0.522	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
HYOU1	10525	hgsc.bcm.edu	37	11	118924950	118924950	+	Splice_Site	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr11:118924950T>C	ENST00000404233.3	-	8	803		c.e8-2		HYOU1_ENST00000529972.1_Splice_Site|HYOU1_ENST00000525859.1_Splice_Site|HYOU1_ENST00000543287.1_Splice_Site	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CATGATATTCTGTAGAGATAT	0.522																																					.		Atlas-SNP	.											.	HYOU1	88	.	0			c.679-2A>G						.						65.0	55.0	59.0					11																	118924950		2200	4295	6495	SO:0001630	splice_region_variant	10525	exon9			ATATTCTGTAGAG	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.679-2A>G	chr11.hg19:g.118924950T>C		86.0	0.0		79.0	15.0	NM_001130991	A8C1Z0|B7Z909|Q2I204|Q53H25	Splice_Site	SNP	ENST00000404233.3	hg19	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261262	0.59431	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9041	0.63823	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HYOU1	118430160	1.000000	0.71417	0.872000	0.34217	0.730000	0.41778	7.466000	0.80914	1.879000	0.54435	0.460000	0.39030	.	.	.		0.522	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	Intron
CACNA1C	775	hgsc.bcm.edu	37	12	2774038	2774038	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:2774038C>T	ENST00000347598.4	+	37	4424	c.4424C>T	c.(4423-4425)cCa>cTa	p.P1475L	CACNA1C_ENST00000399655.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399595.1_Missense_Mutation_p.P1416L|CACNA1C_ENST00000399603.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000406454.3_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.P1447L|CACNA1C_ENST00000399597.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000327702.7_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399634.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399644.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399591.1_Missense_Mutation_p.P1416L|CACNA1C_ENST00000399601.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.P1414L|CACNA1C_ENST00000402845.3_Missense_Mutation_p.P1427L|CACNA1C_ENST00000399629.1_Missense_Mutation_p.P1444L|CACNA1C_ENST00000335762.5_Missense_Mutation_p.P1452L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.P1455L|CACNA1C_ENST00000399617.1_Missense_Mutation_p.P1427L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.P1449L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1475					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCTGCATGCCAGGCAAGAAG	0.597																																					p.P1475L		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.C4424T						.						37.0	40.0	39.0					12																	2774038		2185	4299	6484	SO:0001583	missense	775	exon37			GCATGCCAGGCAA	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4424C>T	chr12.hg19:g.2774038C>T	ENSP00000266376:p.Pro1475Leu	69.0	0.0		77.0	30.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	hg19	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.758790	0.49468	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97016	-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21	4.07	4.07	0.47477	Ion transport (1);	0.121117	0.56097	D	0.000024	D	0.97324	0.9125	L	0.54323	1.7	0.80722	D	1	B;D;B;B;D;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.89917	0.113;0.999;0.012;0.383;1.0;0.018;0.012;0.018;0.189;0.077;0.002;0.005;0.018;0.009;0.005;0.011;0.004;0.094;0.033;0.016;0.027;0.007;0.007;0.016;0.005	B;D;B;B;D;B;B;B;P;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.87578	0.132;0.991;0.02;0.344;0.998;0.027;0.02;0.036;0.447;0.099;0.013;0.009;0.029;0.026;0.011;0.044;0.006;0.087;0.027;0.028;0.013;0.02;0.02;0.013;0.009	D	0.98100	1.0414	10	0.72032	D	0.01	.	16.8336	0.85951	0.0:1.0:0.0:0.0	.	118;1449;1424;1475;1427;1427;1427;1444;1455;1427;1447;1427;1387;1475;1427;1427;1427;1416;1414;1416;1416;1427;1427;1427;1427	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	1452;1427;1427;1455;1427;1427;1427;1416;1427;1475;1447;1427;1449;1444;1427;1414;1427;1427;1427;1427;1427;1416;1257	ENSP00000336982:P1452L;ENSP00000382563:P1427L;ENSP00000382552:P1427L;ENSP00000382547:P1455L;ENSP00000382506:P1427L;ENSP00000382530:P1427L;ENSP00000382546:P1427L;ENSP00000382500:P1416L;ENSP00000382549:P1427L;ENSP00000266376:P1475L;ENSP00000382515:P1447L;ENSP00000382510:P1427L;ENSP00000341092:P1449L;ENSP00000382537:P1444L;ENSP00000329877:P1427L;ENSP00000382557:P1414L;ENSP00000385724:P1427L;ENSP00000382512:P1427L;ENSP00000382542:P1427L;ENSP00000382526:P1427L;ENSP00000385896:P1427L;ENSP00000382504:P1416L	ENSP00000323129:P1257L	P	+	2	0	CACNA1C	2644299	0.997000	0.39634	0.999000	0.59377	0.993000	0.82548	3.681000	0.54648	2.264000	0.75181	0.561000	0.74099	CCA	.	.		0.597	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
SOX5	6660	hgsc.bcm.edu	37	12	24048842	24048842	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:24048842A>C	ENST00000451604.2	-	2	256	c.155T>G	c.(154-156)cTt>cGt	p.L52R	SOX5_ENST00000545921.1_Missense_Mutation_p.L42R|SOX5_ENST00000309359.1_Missense_Mutation_p.L39R|SOX5_ENST00000541536.1_Missense_Mutation_p.L39R|SOX5_ENST00000381381.2_Missense_Mutation_p.L39R|SOX5_ENST00000537393.1_Missense_Mutation_p.L52R|SOX5_ENST00000546136.1_Missense_Mutation_p.L39R|SOX5_ENST00000441133.2_Missense_Mutation_p.L52R|SOX5_ENST00000541847.1_Missense_Mutation_p.L42R			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	52					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						ATGCAAGGGAAGGTGAAAGGC	0.532																																					p.L52R		Atlas-SNP	.											.	SOX5	134	.	0			c.T155G						.						251.0	238.0	242.0					12																	24048842		2203	4300	6503	SO:0001583	missense	6660	exon2			AAGGGAAGGTGAA	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.155T>G	chr12.hg19:g.24048842A>C	ENSP00000398273:p.Leu52Arg	133.0	0.0		120.0	37.0	NM_006940	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	hg19	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.005010	0.74932	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000441133;ENST00000538083	D;D;D;D;D;D;D	0.99105	-5.36;-5.36;-5.43;-5.38;-4.5;-5.43;-5.36	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.99199	0.9722	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.997;1.0	D;D;D;D	0.97110	0.996;1.0;0.991;0.999	D	0.99768	1.1023	10	0.87932	D	0	.	16.5285	0.84344	1.0:0.0:0.0:0.0	.	52;52;39;52	G3V0H1;F5H0I3;P35711-4;P35711	.;.;.;SOX5_HUMAN	R	39;39;39;52;39;52;39;42;42;52;39	ENSP00000437487:L39R;ENSP00000308927:L39R;ENSP00000370788:L39R;ENSP00000398273:L52R;ENSP00000439832:L52R;ENSP00000441973:L39R;ENSP00000443520:L42R	ENSP00000308927:L39R	L	-	2	0	SOX5	23940109	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.343000	0.90052	2.307000	0.77673	0.528000	0.53228	CTT	.	.		0.532	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
SOX5	6660	hgsc.bcm.edu	37	12	24048849	24048849	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:24048849A>C	ENST00000451604.2	-	2	249	c.148T>G	c.(148-150)Ttt>Gtt	p.F50V	SOX5_ENST00000545921.1_Missense_Mutation_p.F40V|SOX5_ENST00000309359.1_Missense_Mutation_p.F37V|SOX5_ENST00000541536.1_Missense_Mutation_p.F37V|SOX5_ENST00000381381.2_Missense_Mutation_p.F37V|SOX5_ENST00000537393.1_Missense_Mutation_p.F50V|SOX5_ENST00000546136.1_Missense_Mutation_p.F37V|SOX5_ENST00000441133.2_Missense_Mutation_p.F50V|SOX5_ENST00000541847.1_Missense_Mutation_p.F40V			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	50					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						GGAAGGTGAAAGGCTGGGAGC	0.537																																					p.F50V		Atlas-SNP	.											.	SOX5	134	.	0			c.T148G						.						251.0	238.0	242.0					12																	24048849		2203	4300	6503	SO:0001583	missense	6660	exon2			GGTGAAAGGCTGG	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.148T>G	chr12.hg19:g.24048849A>C	ENSP00000398273:p.Phe50Val	132.0	0.0		118.0	33.0	NM_006940	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	hg19	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	A	17.11	3.305198	0.60305	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000441133;ENST00000538083	D;D;D;D;D;D;D	0.96685	-4.07;-4.07;-4.08;-4.08;-4.09;-4.08;-4.07	6.01	6.01	0.97437	.	0.055402	0.64402	D	0.000001	D	0.93268	0.7855	L	0.34521	1.04	0.44123	D	0.996903	B;B;B;B	0.24368	0.048;0.05;0.102;0.066	B;B;B;B	0.21151	0.015;0.022;0.033;0.017	D	0.90370	0.4380	10	0.37606	T	0.19	.	16.5285	0.84344	1.0:0.0:0.0:0.0	.	50;50;37;50	G3V0H1;F5H0I3;P35711-4;P35711	.;.;.;SOX5_HUMAN	V	37;37;37;50;37;50;37;40;40;50;37	ENSP00000437487:F37V;ENSP00000308927:F37V;ENSP00000370788:F37V;ENSP00000398273:F50V;ENSP00000439832:F50V;ENSP00000441973:F37V;ENSP00000443520:F40V	ENSP00000308927:F37V	F	-	1	0	SOX5	23940116	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.162000	0.71874	2.307000	0.77673	0.528000	0.53228	TTT	.	.		0.537	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
KRT2	3849	hgsc.bcm.edu	37	12	53041619	53041619	+	Silent	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:53041619A>G	ENST00000309680.3	-	6	1164	c.1143T>C	c.(1141-1143)acT>acC	p.T381T		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	381	Coil 2.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GTCTCCCGACAGTCACCTGGA	0.537																																					p.T381T		Atlas-SNP	.											.	KRT2	94	.	0			c.T1143C						.						74.0	59.0	64.0					12																	53041619		2203	4300	6503	SO:0001819	synonymous_variant	3849	exon6			CCCGACAGTCACC		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.1143T>C	chr12.hg19:g.53041619A>G		91.0	0.0		82.0	21.0	NM_000423	Q4VAQ2	Silent	SNP	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.		0.537	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
TENC1	23371	hgsc.bcm.edu	37	12	53448150	53448150	+	Silent	SNP	C	C	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:53448150C>G	ENST00000314250.6	+	7	737	c.447C>G	c.(445-447)ccC>ccG	p.P149P	RP11-983P16.4_ENST00000551890.1_RNA|TENC1_ENST00000451358.1_Silent_p.P149P|TENC1_ENST00000314276.3_Silent_p.P159P|TENC1_ENST00000549700.1_Silent_p.P149P|RP11-983P16.4_ENST00000550601.1_RNA|TENC1_ENST00000379902.3_Silent_p.P25P|RP11-983P16.4_ENST00000546793.1_RNA|TENC1_ENST00000552570.1_Silent_p.P149P|TENC1_ENST00000546602.1_Silent_p.P149P	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	149	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						CCGCGCGGCCCGATGAACAGC	0.687																																					p.P159P		Atlas-SNP	.											.	TENC1	148	.	0			c.C477G						.						22.0	24.0	23.0					12																	53448150		2202	4292	6494	SO:0001819	synonymous_variant	23371	exon7			GCGGCCCGATGAA	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.447C>G	chr12.hg19:g.53448150C>G		144.0	0.0		48.0	4.0	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Silent	SNP	ENST00000314250.6	hg19	CCDS8843.1																																																																																			.	.		0.687	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
ITGA7	3679	hgsc.bcm.edu	37	12	56092544	56092544	+	Silent	SNP	C	C	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:56092544C>G	ENST00000555728.1	-	7	1108	c.1080G>C	c.(1078-1080)ctG>ctC	p.L360L	ITGA7_ENST00000347027.6_Silent_p.L316L|ITGA7_ENST00000394229.2_Silent_p.L316L|ITGA7_ENST00000257879.6_Silent_p.L316L|ITGA7_ENST00000553804.1_Silent_p.L320L|ITGA7_ENST00000257880.7_Silent_p.L360L|ITGA7_ENST00000394230.2_Silent_p.L320L|ITGA7_ENST00000452168.2_Silent_p.L223L			Q13683	ITA7_HUMAN	integrin, alpha 7	360					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AGCCGGAGGTCAGGCGCTCCC	0.652																																					p.L320L		Atlas-SNP	.											.	ITGA7	194	.	0			c.G960C						.						68.0	55.0	60.0					12																	56092544		2203	4300	6503	SO:0001819	synonymous_variant	3679	exon6			GGAGGTCAGGCGC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.1080G>C	chr12.hg19:g.56092544C>G		175.0	0.0		152.0	26.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Silent	SNP	ENST00000555728.1	hg19																																																																																				.	.		0.652	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
ANKRD52	283373	hgsc.bcm.edu	37	12	56638565	56638565	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:56638565C>T	ENST00000267116.7	-	24	2714	c.2593G>A	c.(2593-2595)Gct>Act	p.A865T	ANKRD52_ENST00000548241.1_5'Flank	NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	865										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						GCGAAGGCAGCGGCGTGAAGG	0.582																																					p.A865T		Atlas-SNP	.											ANKRD52,NS,carcinoma,0,1	ANKRD52	81	.	0			c.G2593A						.						60.0	61.0	61.0					12																	56638565		2103	4232	6335	SO:0001583	missense	283373	exon24			AGGCAGCGGCGTG	AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.2593G>A	chr12.hg19:g.56638565C>T	ENSP00000267116:p.Ala865Thr	73.0	0.0		59.0	8.0	NM_173595	A6NE79|B1Q2K2	Missense_Mutation	SNP	ENST00000267116.7	hg19	CCDS44920.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226030	0.95173	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	T	0.81163	-1.46	4.53	4.53	0.55603	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.91264	0.7246	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92745	0.6211	9	.	.	.	.	16.5704	0.84611	0.0:1.0:0.0:0.0	.	865	Q8NB46	ANR52_HUMAN	T	865	ENSP00000267116:A865T	.	A	-	1	0	ANKRD52	54924832	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.629000	0.83207	2.527000	0.85204	0.655000	0.94253	GCT	.	.		0.582	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595	
B4GALNT1	2583	hgsc.bcm.edu	37	12	58020643	58020643	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:58020643C>T	ENST00000341156.4	-	11	2070	c.1486G>A	c.(1486-1488)Gcc>Acc	p.A496T	B4GALNT1_ENST00000418555.2_Missense_Mutation_p.A441T	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	496					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TCTGCTCCGGCATCCCTTGAT	0.572																																					p.D496N		Atlas-SNP	.											B4GALNT1,NS,carcinoma,0,1	B4GALNT1	53	.	0			c.G1486A						.						134.0	103.0	114.0					12																	58020643		2203	4300	6503	SO:0001583	missense	2583	exon11			CTCCGGCATCCCT	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.1486G>A	chr12.hg19:g.58020643C>T	ENSP00000341562:p.Ala496Thr	157.0	0.0		121.0	28.0	NM_001478	B4DE26|Q8N636	Missense_Mutation	SNP	ENST00000341156.4	hg19	CCDS8950.1	.	.	.	.	.	.	.	.	.	.	.	3.499	-0.102300	0.06967	.	.	ENSG00000135454	ENST00000341156;ENST00000418555	T;T	0.24908	1.83;1.83	4.6	-2.01	0.07410	.	0.986029	0.08259	N	0.973367	T	0.12561	0.0305	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.35968	-0.9767	10	0.12766	T	0.61	-8.2877	2.3241	0.04218	0.2739:0.1614:0.4339:0.1308	.	441;496	B4DE26;Q00973	.;B4GN1_HUMAN	T	496;441	ENSP00000341562:A496T;ENSP00000401601:A441T	ENSP00000341562:A496T	A	-	1	0	B4GALNT1	56306910	0.000000	0.05858	0.005000	0.12908	0.227000	0.25037	-0.340000	0.07821	-0.240000	0.09696	0.467000	0.42956	GCC	.	.		0.572	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478	
XPOT	11260	hgsc.bcm.edu	37	12	64813854	64813854	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:64813854C>T	ENST00000332707.5	+	7	1023	c.494C>T	c.(493-495)gCt>gTt	p.A165V		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	165	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TTTTAGGAGGCTCGTAGGAAT	0.333																																					p.A165V		Atlas-SNP	.											.	XPOT	105	.	0			c.C494T						.						62.0	61.0	61.0					12																	64813854		2203	4300	6503	SO:0001583	missense	11260	exon7			AGGAGGCTCGTAG	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.494C>T	chr12.hg19:g.64813854C>T	ENSP00000327821:p.Ala165Val	53.0	0.0		42.0	5.0	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	hg19	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.498967	0.44455	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	T;T	0.44083	0.93;0.93	4.79	4.79	0.61399	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.153219	0.64402	D	0.000017	T	0.37348	0.1000	L	0.41415	1.275	0.46044	D	0.998839	B	0.16802	0.019	B	0.19666	0.026	T	0.12837	-1.0532	9	.	.	.	.	18.7197	0.91688	0.0:1.0:0.0:0.0	.	165	O43592	XPOT_HUMAN	V	165	ENSP00000327821:A165V;ENSP00000383722:A165V	.	A	+	2	0	XPOT	63100121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.921000	0.70028	2.593000	0.87608	0.655000	0.94253	GCT	.	.		0.333	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
FAM71C	196472	hgsc.bcm.edu	37	12	100042218	100042218	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:100042218C>T	ENST00000324341.1	+	1	688	c.266C>T	c.(265-267)gCc>gTc	p.A89V	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000547776.2_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	89										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		ATGCTGCTGGCCCGACCAGCT	0.562																																					p.A89V		Atlas-SNP	.											.	FAM71C	48	.	0			c.C266T						.						93.0	85.0	88.0					12																	100042218		2203	4300	6503	SO:0001583	missense	196472	exon1			TGCTGGCCCGACC		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.266C>T	chr12.hg19:g.100042218C>T	ENSP00000315247:p.Ala89Val	119.0	0.0		122.0	18.0	NM_153364	B2R6Y6	Missense_Mutation	SNP	ENST00000324341.1	hg19	CCDS9072.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913571	0.52439	.	.	ENSG00000180219	ENST00000324341	T	0.32988	1.43	3.94	1.94	0.25998	.	0.000000	0.64402	D	0.000012	T	0.47673	0.1458	M	0.72479	2.2	0.20074	N	0.999934	D	0.89917	1.0	D	0.91635	0.999	T	0.21211	-1.0252	9	.	.	.	-18.162	6.4957	0.22140	0.2078:0.5908:0.2014:0.0	.	89	Q8NEG0	FA71C_HUMAN	V	89	ENSP00000315247:A89V	.	A	+	2	0	FAM71C	98566349	0.657000	0.27393	0.465000	0.27155	0.589000	0.36550	0.870000	0.28010	0.530000	0.28619	0.555000	0.69702	GCC	.	.		0.562	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
FAM71C	196472	hgsc.bcm.edu	37	12	100042223	100042223	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:100042223C>T	ENST00000324341.1	+	1	693	c.271C>T	c.(271-273)Cca>Tca	p.P91S	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000547776.2_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	91										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		GCTGGCCCGACCAGCTGCTGT	0.552																																					p.P91S		Atlas-SNP	.											.	FAM71C	48	.	0			c.C271T						.						90.0	83.0	85.0					12																	100042223		2203	4300	6503	SO:0001583	missense	196472	exon1			GCCCGACCAGCTG		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.271C>T	chr12.hg19:g.100042223C>T	ENSP00000315247:p.Pro91Ser	111.0	0.0		120.0	19.0	NM_153364	B2R6Y6	Missense_Mutation	SNP	ENST00000324341.1	hg19	CCDS9072.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.455266	0.26161	.	.	ENSG00000180219	ENST00000324341	T	0.11385	2.78	3.94	2.02	0.26589	.	0.218998	0.31082	N	0.008300	T	0.24044	0.0582	M	0.70595	2.14	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.03193	-1.1062	9	.	.	.	-13.4292	4.5197	0.11954	0.2189:0.6653:0.0:0.1158	.	91	Q8NEG0	FA71C_HUMAN	S	91	ENSP00000315247:P91S	.	P	+	1	0	FAM71C	98566354	0.000000	0.05858	0.004000	0.12327	0.119000	0.20118	-0.632000	0.05489	0.567000	0.29293	0.555000	0.69702	CCA	.	.		0.552	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
DIS3	22894	hgsc.bcm.edu	37	13	73336102	73336102	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr13:73336102T>G	ENST00000377767.4	-	17	2401	c.2301A>C	c.(2299-2301)ttA>ttC	p.L767F	DIS3_ENST00000545453.1_Missense_Mutation_p.L605F|DIS3_ENST00000377780.4_Missense_Mutation_p.L737F	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	767					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TTGGAGACGCTAAGCCATAGT	0.328										Multiple Myeloma(4;0.011)																											p.L767F		Atlas-SNP	.											.	DIS3	103	.	0			c.A2301C						.						94.0	90.0	91.0					13																	73336102		2203	4300	6503	SO:0001583	missense	22894	exon17			AGACGCTAAGCCA	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2301A>C	chr13.hg19:g.73336102T>G	ENSP00000366997:p.Leu767Phe	93.0	0.0		61.0	18.0	NM_014953	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	hg19	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237751	0.58886	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.71341	-0.56;-0.56;-0.56	5.68	3.24	0.37175	Ribonuclease II/R, conserved site (1);Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	D	0.90246	0.6950	H	0.99770	4.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90372	0.4381	10	0.87932	D	0	.	10.126	0.42649	0.0:0.1357:0.0:0.8643	.	737;767	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	F	767;737;605	ENSP00000366997:L767F;ENSP00000367011:L737F;ENSP00000440058:L605F	ENSP00000366997:L767F	L	-	3	2	DIS3	72234103	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.646000	0.37249	0.428000	0.26173	-0.451000	0.05528	TTA	.	.		0.328	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
RNASE2	6036	hgsc.bcm.edu	37	14	21423958	21423958	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr14:21423958A>G	ENST00000304625.2	+	2	118	c.28A>G	c.(28-30)Att>Gtt	p.I10V		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	10					chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)			breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		CACTTCCCAAATTTGTCTGCT	0.463																																					p.I10V		Atlas-SNP	.											.	RNASE2	26	.	0			c.A28G						.						99.0	107.0	104.0					14																	21423958		2203	4297	6500	SO:0001583	missense	6036	exon2			TCCCAAATTTGTC	X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.28A>G	chr14.hg19:g.21423958A>G	ENSP00000303276:p.Ile10Val	138.0	0.0		142.0	33.0	NM_002934	Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	ENST00000304625.2	hg19	CCDS9561.1	.	.	.	.	.	.	.	.	.	.	a	4.437	0.080951	0.08533	.	.	ENSG00000169385	ENST00000304625	T	0.05996	3.36	2.23	1.29	0.21616	.	1.581710	0.04558	U	0.391135	T	0.05868	0.0153	L	0.38531	1.155	0.09310	N	1	B	0.34241	0.444	B	0.27380	0.079	T	0.38972	-0.9636	10	0.41790	T	0.15	.	5.9076	0.19010	0.3353:0.6647:0.0:0.0	.	10	P10153	RNAS2_HUMAN	V	10	ENSP00000303276:I10V	ENSP00000303276:I10V	I	+	1	0	RNASE2	20493798	0.001000	0.12720	0.002000	0.10522	0.009000	0.06853	0.097000	0.15168	0.473000	0.27368	-0.666000	0.03841	ATT	.	.		0.463	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073799.2		
LTB4R	1241	hgsc.bcm.edu	37	14	24785243	24785243	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr14:24785243G>T	ENST00000396789.4	+	2	2111	c.386G>T	c.(385-387)cGc>cTc	p.R129L	LTB4R_ENST00000396782.2_Missense_Mutation_p.R129L|LTB4R_ENST00000345363.3_Missense_Mutation_p.R129L	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	129					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CAGAAGCTACGCACCAAGGCG	0.637																																					p.R129L		Atlas-SNP	.											.	LTB4R	18	.	0			c.G386T						.						42.0	44.0	43.0					14																	24785243		2203	4300	6503	SO:0001583	missense	1241	exon2			AGCTACGCACCAA	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.386G>T	chr14.hg19:g.24785243G>T	ENSP00000380008:p.Arg129Leu	68.0	0.0		74.0	12.0	NM_181657	Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	hg19	CCDS9626.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353581	0.82243	.	.	ENSG00000213903	ENST00000345363;ENST00000396789;ENST00000556141;ENST00000396782	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.89	5.89	0.94794	GPCR, rhodopsin-like superfamily (1);	0.063953	0.64402	U	0.000011	T	0.66177	0.2763	M	0.86268	2.805	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.70099	-0.4965	10	0.87932	D	0	.	17.7301	0.88375	0.0:0.0:1.0:0.0	.	129	Q15722	LT4R1_HUMAN	L	129;129;29;129	ENSP00000307445:R129L;ENSP00000380008:R129L;ENSP00000451929:R29L;ENSP00000380002:R129L	ENSP00000307445:R129L	R	+	2	0	LTB4R	23855083	0.060000	0.20803	0.992000	0.48379	0.090000	0.18270	1.812000	0.38952	2.789000	0.95967	0.655000	0.94253	CGC	.	.		0.637	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4		
MLH3	27030	hgsc.bcm.edu	37	14	75505047	75505047	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr14:75505047C>A	ENST00000556740.1	-	5	3674	c.3639G>T	c.(3637-3639)gaG>gaT	p.E1213D	MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000556257.1_Intron|MLH3_ENST00000355774.2_Missense_Mutation_p.E1213D|MLH3_ENST00000238662.7_Missense_Mutation_p.E1213D|MLH3_ENST00000380968.2_Missense_Mutation_p.E159D|MLH3_ENST00000544985.1_Missense_Mutation_p.E173D			Q9UHC1	MLH3_HUMAN	mutL homolog 3	1213					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TCTTACCTGCCTCGCCATTCT	0.353								Mismatch excision repair (MMR)																													p.E1213D		Atlas-SNP	.											.	MLH3	200	.	0			c.G3639T						.						127.0	116.0	120.0					14																	75505047		2203	4300	6503	SO:0001583	missense	27030	exon6			ACCTGCCTCGCCA	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.3639G>T	chr14.hg19:g.75505047C>A	ENSP00000452316:p.Glu1213Asp	64.0	0.0		65.0	4.0	NM_014381	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	hg19	CCDS32123.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.72|13.72	2.322843|2.322843	0.41096|0.41096	.|.	.|.	ENSG00000119684|ENSG00000119684	ENST00000355774;ENST00000380968;ENST00000238662;ENST00000556740;ENST00000544985|ENST00000553713	T;T;T;T;T|.	0.81330|.	-1.47;0.58;-1.48;-1.47;0.44|.	5.58|5.58	0.0763|0.0763	0.14402|0.14402	MutL, C-terminal, dimerisation (1);|.	0.834230|.	0.11104|.	N|.	0.599366|.	T|T	0.19046|0.19046	0.0457|0.0457	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B|.	0.16603|.	0.018;0.005|.	B;B|.	0.21151|.	0.019;0.033|.	T|T	0.28427|0.28427	-1.0044|-1.0044	10|5	0.49607|.	T|.	0.09|.	0.0621|0.0621	5.9608|5.9608	0.19299|0.19299	0.1247:0.3891:0.0:0.4862|0.1247:0.3891:0.0:0.4862	.|.	1213;1213|.	Q9UHC1-2;Q9UHC1|.	.;MLH3_HUMAN|.	D|M	1213;159;1213;1213;173|237	ENSP00000348020:E1213D;ENSP00000370355:E159D;ENSP00000238662:E1213D;ENSP00000452316:E1213D;ENSP00000441371:E173D|.	ENSP00000238662:E1213D|.	E|R	-|-	3|2	2|0	MLH3|MLH3	74574800|74574800	0.000000|0.000000	0.05858|0.05858	0.380000|0.380000	0.26093|0.26093	0.935000|0.935000	0.57460|0.57460	-1.227000|-1.227000	0.02950|0.02950	0.194000|0.194000	0.20326|0.20326	0.561000|0.561000	0.74099|0.74099	GAG|AGG	.	.		0.353	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
ITPK1	3705	hgsc.bcm.edu	37	14	93542960	93542960	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr14:93542960G>A	ENST00000267615.6	-	3	273	c.100C>T	c.(100-102)Cga>Tga	p.R34*	ITPK1_ENST00000354313.3_Nonsense_Mutation_p.R34*|ITPK1_ENST00000555495.1_Intron|ITPK1_ENST00000556603.2_Nonsense_Mutation_p.R34*			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	34					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TCCATCCCTCGCTTCCTGTGG	0.582																																					p.R34X		Atlas-SNP	.											.	ITPK1	53	.	0			c.C100T						.						158.0	123.0	135.0					14																	93542960		2203	4300	6503	SO:0001587	stop_gained	3705	exon3			TCCCTCGCTTCCT	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.100C>T	chr14.hg19:g.93542960G>A	ENSP00000267615:p.Arg34*	167.0	0.0		164.0	55.0	NM_001142593	Q9BTL6|Q9H2E7	Nonsense_Mutation	SNP	ENST00000267615.6	hg19	CCDS9907.1	.	.	.	.	.	.	.	.	.	.	G	36	5.790703	0.96945	.	.	ENSG00000100605	ENST00000354313;ENST00000556603;ENST00000267615;ENST00000311458;ENST00000554999;ENST00000555553;ENST00000553452;ENST00000557309	.	.	.	3.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3871	11.2719	0.49144	0.0:0.0:1.0:0.0	.	.	.	.	X	34	.	ENSP00000267615:R34X	R	-	1	2	ITPK1	92612713	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.694000	0.54742	2.372000	0.80975	0.561000	0.74099	CGA	.	.		0.582	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
KIF26A	26153	hgsc.bcm.edu	37	14	104641634	104641634	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr14:104641634C>T	ENST00000423312.2	+	12	2509	c.2509C>T	c.(2509-2511)Cgc>Tgc	p.R837C	KIF26A_ENST00000315264.7_Missense_Mutation_p.R698C	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	837					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		AGACCACTTCCGCTGCAGCAC	0.677																																					p.R837C		Atlas-SNP	.											.	KIF26A	84	.	0			c.C2509T						.						15.0	18.0	17.0					14																	104641634		2025	4166	6191	SO:0001583	missense	26153	exon12			CACTTCCGCTGCA	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2509C>T	chr14.hg19:g.104641634C>T	ENSP00000388241:p.Arg837Cys	77.0	0.0		18.0	8.0	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	hg19	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406843	0.83230	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.80033	-1.33;-1.33	3.81	2.7	0.31948	.	.	.	.	.	T	0.80486	0.4632	L	0.47716	1.5	0.43673	D	0.996106	D	0.76494	0.999	P	0.54924	0.764	T	0.81245	-0.1020	9	0.87932	D	0	.	8.962	0.35854	0.53:0.47:0.0:0.0	.	837	Q9ULI4	KI26A_HUMAN	C	837;698	ENSP00000388241:R837C;ENSP00000325452:R698C	ENSP00000325452:R698C	R	+	1	0	KIF26A	103711387	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.441000	0.66569	1.835000	0.53391	0.462000	0.41574	CGC	.	.		0.677	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105420945	105420945	+	Silent	SNP	C	C	T	rs376708808	byFrequency	TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr14:105420945C>T	ENST00000333244.5	-	7	962	c.843G>A	c.(841-843)tcG>tcA	p.S281S	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	281						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGCCTCTGACGAGCTGTGTG	0.612																																					p.S281S		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G843A						.						35.0	38.0	37.0					14																	105420945		2077	4190	6267	SO:0001819	synonymous_variant	113146	exon7			CTCTGACGAGCTG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.843G>A	chr14.hg19:g.105420945C>T		74.0	0.0		48.0	28.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	hg19	CCDS45177.1																																																																																			.	.		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
HCN4	10021	hgsc.bcm.edu	37	15	73617654	73617654	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr15:73617654G>A	ENST00000261917.3	-	5	2715	c.1722C>T	c.(1720-1722)agC>agT	p.S574S		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	574					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GCAGGGGCTCGCTTAGCTCGC	0.677																																					p.S574S		Atlas-SNP	.											.	HCN4	150	.	0			c.C1722T						.						41.0	46.0	44.0					15																	73617654		2198	4297	6495	SO:0001819	synonymous_variant	10021	exon5			GGGCTCGCTTAGC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1722C>T	chr15.hg19:g.73617654G>A		160.0	0.0		113.0	80.0	NM_005477	Q9UMQ7	Silent	SNP	ENST00000261917.3	hg19	CCDS10248.1																																																																																			.	.		0.677	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
ITFG3	83986	hgsc.bcm.edu	37	16	314814	314814	+	Silent	SNP	C	C	A	rs140101617		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr16:314814C>A	ENST00000399932.3	+	13	1903	c.1452C>A	c.(1450-1452)gtC>gtA	p.V484V	ITFG3_ENST00000450082.2_Silent_p.V484V|ITFG3_ENST00000301678.3_Silent_p.V484V|ITFG3_ENST00000600536.1_Intron|ITFG3_ENST00000442458.2_Intron|ITFG3_ENST00000301679.2_Silent_p.V484V	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	484						cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				CTGCAGCCGTCCTGTTTGAGC	0.687																																					p.V484V		Atlas-SNP	.											.	ITFG3	42	.	0			c.C1452A						.						17.0	21.0	20.0					16																	314814		2093	4211	6304	SO:0001819	synonymous_variant	83986	exon13			AGCCGTCCTGTTT	AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.1452C>A	chr16.hg19:g.314814C>A		58.0	0.0		48.0	12.0	NM_032039	D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Silent	SNP	ENST00000399932.3	hg19	CCDS10402.1	.	.	.	.	.	.	.	.	.	.	C	0.718	-0.784727	0.02907	.	.	ENSG00000167930	ENST00000424016	.	.	.	5.0	2.97	0.34412	.	.	.	.	.	T	0.54886	0.1886	.	.	.	0.51482	D	0.999924	.	.	.	.	.	.	T	0.49916	-0.8888	4	.	.	.	-18.7667	6.4344	0.21815	0.0:0.58:0.3073:0.1126	.	.	.	.	Y	124	.	.	S	+	2	0	ITFG3	254815	0.235000	0.23794	0.270000	0.24601	0.826000	0.46750	0.395000	0.20850	1.102000	0.41551	0.555000	0.69702	TCC	.	C|1.000;T|0.000		0.687	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134227.2	NM_032039	
PTX4	390667	hgsc.bcm.edu	37	16	1535964	1535964	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr16:1535964G>A	ENST00000447419.2	-	3	1438	c.1413C>T	c.(1411-1413)tgC>tgT	p.C471C	PTX4_ENST00000293922.1_Silent_p.C466C|PTX4_ENST00000440447.2_3'UTR			Q96A99	PTX4_HUMAN	pentraxin 4, long	471						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CCAGGCAGGTGCAGTTGGCCC	0.652																																					p.C466C		Atlas-SNP	.											.	PTX4	46	.	0			c.C1398T						.						28.0	29.0	29.0					16																	1535964		2198	4300	6498	SO:0001819	synonymous_variant	390667	exon3			GCAGGTGCAGTTG		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.1413C>T	chr16.hg19:g.1535964G>A		58.0	0.0		66.0	11.0	NM_001013658		Silent	SNP	ENST00000447419.2	hg19																																																																																				.	.		0.652	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658	
PKD1	5310	hgsc.bcm.edu	37	16	2157970	2157970	+	Silent	SNP	G	G	T	rs184394342	byFrequency	TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr16:2157970G>T	ENST00000262304.4	-	16	7187	c.6979C>A	c.(6979-6981)Cgg>Agg	p.R2327R	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.R2327R	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2327	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGCCGCTCCCGTGGAATGGTG	0.701																																					p.R2327R		Atlas-SNP	.											.	PKD1	184	.	0			c.C6979A						.						5.0	5.0	5.0					16																	2157970		1955	3980	5935	SO:0001819	synonymous_variant	5310	exon16			GCTCCCGTGGAAT	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.6979C>A	chr16.hg19:g.2157970G>T		112.0	0.0		53.0	4.0	NM_000296	Q15140|Q15141	Silent	SNP	ENST00000262304.4	hg19	CCDS32369.1																																																																																			.	G|0.999;A|0.001		0.701	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
MLST8	64223	hgsc.bcm.edu	37	16	2257268	2257268	+	Silent	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr16:2257268G>T	ENST00000569417.1	+	6	849	c.495G>T	c.(493-495)ctG>ctT	p.L165L	MLST8_ENST00000564088.1_Silent_p.L165L|MLST8_ENST00000397124.1_Silent_p.L165L|MLST8_ENST00000301724.10_Silent_p.L165L|MLST8_ENST00000561651.1_3'UTR|AC009065.3_ENST00000517149.1_RNA|MLST8_ENST00000565250.1_Silent_p.L165L|MLST8_ENST00000382450.4_Silent_p.L164L|MLST8_ENST00000301725.7_Silent_p.L184L	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	165					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						ACGAGCAGCTGATCCCTGAGC	0.617																																					p.L165L		Atlas-SNP	.											.	MLST8	60	.	0			c.G495T						.						158.0	174.0	169.0					16																	2257268		2159	4256	6415	SO:0001819	synonymous_variant	64223	exon6			GCAGCTGATCCCT		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.495G>T	chr16.hg19:g.2257268G>T		180.0	0.0		220.0	87.0	NM_001199174	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Silent	SNP	ENST00000569417.1	hg19	CCDS10462.2																																																																																			.	.		0.617	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372	
NMRAL1	57407	hgsc.bcm.edu	37	16	4519432	4519432	+	Silent	SNP	C	C	T	rs11557237		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr16:4519432C>T	ENST00000574733.1	-	3	804	c.75G>A	c.(73-75)ctG>ctA	p.L25L	NMRAL1_ENST00000572391.1_Intron|NMRAL1_ENST00000283429.6_Silent_p.L25L|NMRAL1_ENST00000574425.1_Silent_p.L25L|NMRAL1_ENST00000404295.3_Silent_p.L25L			Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	25						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|prostate(2)|stomach(1)	15						TCCCATCTTCCAGGAGTGTGC	0.562																																					p.L25L		Atlas-SNP	.											.	NMRAL1	31	.	0			c.G75A						.						218.0	197.0	204.0					16																	4519432		2197	4300	6497	SO:0001819	synonymous_variant	57407	exon3			ATCTTCCAGGAGT	AF225419	CCDS10516.1	16p13.3	2013-10-11			ENSG00000153406	ENSG00000153406		"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	24987	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 48A, member 1"""					19027726	Standard	NM_020677		Approved	FLJ25918, HSCARG, SDR48A1	uc002cwo.3	Q9HBL8	OTTHUMG00000129468	ENST00000574733.1:c.75G>A	chr16.hg19:g.4519432C>T		73.0	0.0		81.0	36.0	NM_020677		Silent	SNP	ENST00000574733.1	hg19	CCDS10516.1																																																																																			.	.		0.562	NMRAL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438579.1	NM_020677	
CCP110	9738	hgsc.bcm.edu	37	16	19551992	19551992	+	Silent	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr16:19551992A>G	ENST00000381396.5	+	5	2179	c.1932A>G	c.(1930-1932)ttA>ttG	p.L644L	CCP110_ENST00000396208.2_Silent_p.L644L|CCP110_ENST00000396212.2_Silent_p.L644L	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	644					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GCGAGGAGTTACTAAAAAGCA	0.358																																					p.L644L		Atlas-SNP	.											.	CCP110	57	.	0			c.A1932G						.						64.0	63.0	63.0					16																	19551992		2197	4300	6497	SO:0001819	synonymous_variant	9738	exon5			GGAGTTACTAAAA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1932A>G	chr16.hg19:g.19551992A>G		298.0	0.0		337.0	133.0	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Silent	SNP	ENST00000381396.5	hg19	CCDS55992.1																																																																																			.	.		0.358	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
WDR81	124997	hgsc.bcm.edu	37	17	1630783	1630783	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:1630783C>T	ENST00000409644.1	+	1	2530	c.2530C>T	c.(2530-2532)Caa>Taa	p.Q844*	WDR81_ENST00000545662.1_5'Flank|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000419248.1_Intron|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000309182.5_Intron|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	844					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CAAGCTGGACCAACTGTTTGA	0.632																																					p.Q844X		Atlas-SNP	.											.	WDR81	180	.	0			c.C2530T						.						34.0	39.0	37.0					17																	1630783		692	1589	2281	SO:0001587	stop_gained	124997	exon1			CTGGACCAACTGT	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.2530C>T	chr17.hg19:g.1630783C>T	ENSP00000386609:p.Gln844*	109.0	0.0		66.0	26.0	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Nonsense_Mutation	SNP	ENST00000409644.1	hg19	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683694	0.88639	.	.	ENSG00000167716	ENST00000409644	.	.	.	5.38	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	15.359	0.74453	0.0:0.8599:0.1401:0.0	.	.	.	.	X	844	.	ENSP00000386609:Q844X	Q	+	1	0	WDR81	1577533	0.004000	0.15560	0.044000	0.18714	0.098000	0.18820	1.483000	0.35497	1.358000	0.45922	0.555000	0.69702	CAA	.	.		0.632	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
SMG6	23293	hgsc.bcm.edu	37	17	2076069	2076069	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:2076069C>G	ENST00000263073.6	-	13	3290	c.3240G>C	c.(3238-3240)aaG>aaC	p.K1080N	SMG6_ENST00000544865.1_Missense_Mutation_p.K1049N|SMG6_ENST00000536871.2_Missense_Mutation_p.K172N|SMG6_ENST00000354901.4_Missense_Mutation_p.K172N	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	1080					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CATCCGGGTCCTTGTACAGTG	0.537																																					p.K1080N	Melanoma(59;28 1088 11621 25887 46638 50814)	Atlas-SNP	.											.	SMG6	97	.	0			c.G3240C						.						128.0	104.0	112.0					17																	2076069		2203	4300	6503	SO:0001583	missense	23293	exon13			CGGGTCCTTGTAC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.3240G>C	chr17.hg19:g.2076069C>G	ENSP00000263073:p.Lys1080Asn	134.0	0.0		127.0	57.0	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	hg19	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.661901	0.29515	.	.	ENSG00000070366	ENST00000263073;ENST00000544865;ENST00000536871	T;T;T	0.29917	1.55;1.55;1.55	6.02	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.28333	0.0700	L	0.40543	1.245	0.40679	D	0.982284	D	0.52996	0.957	B	0.43658	0.426	T	0.04242	-1.0966	10	0.33141	T	0.24	-12.8458	13.5637	0.61804	0.0:0.9286:0.0:0.0714	.	1080	Q86US8	EST1A_HUMAN	N	1080;1049;172	ENSP00000263073:K1080N;ENSP00000443920:K1049N;ENSP00000440283:K172N	ENSP00000263073:K1080N	K	-	3	2	SMG6	2022819	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.970000	0.40520	1.568000	0.49683	0.549000	0.68633	AAG	.	.		0.537	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
SPNS3	201305	hgsc.bcm.edu	37	17	4348361	4348361	+	Silent	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:4348361G>T	ENST00000355530.2	+	3	580	c.300G>T	c.(298-300)gtG>gtT	p.V100V	SPNS3_ENST00000576069.1_Intron|SPNS3_ENST00000333476.2_Intron	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	100					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						CTGCACCTGTGTTTGGCTACC	0.617																																					p.V100V		Atlas-SNP	.											.	SPNS3	52	.	0			c.G300T						.						231.0	181.0	198.0					17																	4348361		2203	4300	6503	SO:0001819	synonymous_variant	201305	exon3			ACCTGTGTTTGGC		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.300G>T	chr17.hg19:g.4348361G>T		156.0	0.0		113.0	5.0	NM_182538	Q8IZ31	Silent	SNP	ENST00000355530.2	hg19	CCDS11045.1																																																																																			.	.		0.617	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538	
PITPNM3	83394	hgsc.bcm.edu	37	17	6381970	6381970	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:6381970G>C	ENST00000262483.8	-	7	761	c.674C>G	c.(673-675)tCc>tGc	p.S225C	PITPNM3_ENST00000421306.3_Missense_Mutation_p.S189C	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	225					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CTGCGGGGAGGAGATGGCCAA	0.632																																					p.S225C		Atlas-SNP	.											.	PITPNM3	91	.	0			c.C674G						.						64.0	53.0	57.0					17																	6381970		2203	4300	6503	SO:0001583	missense	83394	exon7			GGGGAGGAGATGG	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.674C>G	chr17.hg19:g.6381970G>C	ENSP00000262483:p.Ser225Cys	114.0	0.0		81.0	36.0	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	hg19	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753172	0.69648	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.20598	2.06;2.06	3.89	3.89	0.44902	.	0.273259	0.42420	D	0.000716	T	0.37571	0.1008	L	0.46157	1.445	0.43902	D	0.996533	D;D	0.89917	1.0;0.993	D;P	0.72982	0.979;0.635	T	0.08889	-1.0700	10	0.52906	T	0.07	.	14.1702	0.65506	0.0:0.0:1.0:0.0	.	189;225	F8WEW5;Q9BZ71	.;PITM3_HUMAN	C	225;189	ENSP00000262483:S225C;ENSP00000407882:S189C	ENSP00000262483:S225C	S	-	2	0	PITPNM3	6322694	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.312000	0.78968	2.477000	0.83638	0.455000	0.32223	TCC	.	.		0.632	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
TP53	7157	hgsc.bcm.edu	37	17	7574035	7574035	+	Splice_Site	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:7574035T>C	ENST00000269305.4	-	10	1183		c.e10-2		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(10)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCACGGATCTGCAGCAACAG	0.507		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000269305,NS,carcinoma,0,13	TP53	33396	.	19	Unknown(10)|Whole gene deletion(8)|Insertion - Frameshift(1)	lung(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|central_nervous_system(2)|liver(2)|stomach(1)|breast(1)	c.994-2A>G						.						44.0	36.0	38.0					17																	7574035		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon11	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGGATCTGCAGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.994-2A>G	chr17.hg19:g.7574035T>C		110.0	0.0		82.0	35.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	12.31	1.898270	0.33535	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1784	0.59641	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7514760	1.000000	0.71417	0.937000	0.37676	0.131000	0.20780	6.590000	0.74085	2.061000	0.61500	0.459000	0.35465	.	.	.		0.507	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
KRTAP1-3	81850	hgsc.bcm.edu	37	17	39190602	39190602	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:39190602A>G	ENST00000344363.5	-	1	505	c.472T>C	c.(472-474)Tgc>Cgc	p.C158R		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	168						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TAGCAGCAGCAGACTGGGCGG	0.542																																					p.C158R		Atlas-SNP	.											.	KRTAP1-3	18	.	0			c.T472C						.						36.0	43.0	40.0					17																	39190602		2029	4178	6207	SO:0001583	missense	81850	exon1			AGCAGCAGACTGG	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.472T>C	chr17.hg19:g.39190602A>G	ENSP00000344420:p.Cys158Arg	294.0	0.0		263.0	46.0	NM_030966	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	hg19	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.122611	0.56613	.	.	ENSG00000221880	ENST00000344363	T	0.50001	0.76	4.52	4.52	0.55395	.	.	.	.	.	T	0.66742	0.2820	.	.	.	0.58432	D	0.999998	D	0.62365	0.991	D	0.77557	0.99	T	0.70905	-0.4745	8	0.87932	D	0	.	10.7883	0.46417	1.0:0.0:0.0:0.0	.	168	Q8IUG1	KRA13_HUMAN	R	158	ENSP00000344420:C158R	ENSP00000344420:C158R	C	-	1	0	KRTAP1-3	36444128	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	3.489000	0.53237	1.971000	0.57363	0.523000	0.50628	TGC	.	.		0.542	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
ITGA3	3675	hgsc.bcm.edu	37	17	48148866	48148866	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:48148866G>A	ENST00000320031.8	+	6	1273	c.943G>A	c.(943-945)Gac>Aac	p.D315N	ITGA3_ENST00000007722.7_Missense_Mutation_p.D315N|ITGA3_ENST00000544892.1_Missense_Mutation_p.D90N	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	315					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TGCCCTGGCAGACCTGAACAA	0.637																																					p.D315N		Atlas-SNP	.											.	ITGA3	128	.	0			c.G943A						.						26.0	26.0	26.0					17																	48148866		2203	4298	6501	SO:0001583	missense	3675	exon6			CTGGCAGACCTGA	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.943G>A	chr17.hg19:g.48148866G>A	ENSP00000315190:p.Asp315Asn	21.0	0.0		26.0	7.0	NM_005501	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	hg19	CCDS11558.1	.	.	.	.	.	.	.	.	.	.	G	33	5.198081	0.94997	.	.	ENSG00000005884	ENST00000544892;ENST00000007722;ENST00000538917;ENST00000320031	D;D;D	0.94897	-3.55;-3.55;-3.55	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.98460	0.9487	H	0.98068	4.14	0.51767	D	0.999937	D;D	0.89917	0.999;1.0	D;D	0.79784	0.936;0.993	D	0.99716	1.1008	10	0.87932	D	0	.	18.0766	0.89428	0.0:0.0:1.0:0.0	.	315;315	P26006-1;P26006	.;ITA3_HUMAN	N	90;315;301;315	ENSP00000446133:D90N;ENSP00000007722:D315N;ENSP00000315190:D315N	ENSP00000007722:D315N	D	+	1	0	ITGA3	45503865	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.093000	0.94163	2.566000	0.86566	0.563000	0.77884	GAC	.	.		0.637	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
KIF2B	84643	hgsc.bcm.edu	37	17	51901739	51901739	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:51901739G>T	ENST00000268919.4	+	1	1501	c.1345G>T	c.(1345-1347)Gct>Tct	p.A449S		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	449	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CGTTGATTTAGCTGGGAATGA	0.488																																					p.A449S		Atlas-SNP	.											.	KIF2B	254	.	0			c.G1345T						.						55.0	50.0	52.0					17																	51901739		2203	4300	6503	SO:0001583	missense	84643	exon1			GATTTAGCTGGGA	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1345G>T	chr17.hg19:g.51901739G>T	ENSP00000268919:p.Ala449Ser	101.0	0.0		94.0	16.0	NM_032559	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	hg19	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700253	0.88924	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	D	0.86956	-2.19	5.73	5.73	0.89815	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.000000	0.44688	D	0.000437	D	0.96926	0.8996	H	0.99535	4.615	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.98245	1.0490	10	0.87932	D	0	.	19.2577	0.93952	0.0:0.0:1.0:0.0	.	449	Q8N4N8	KIF2B_HUMAN	S	449;337	ENSP00000268919:A449S	ENSP00000268919:A449S	A	+	1	0	KIF2B	49256738	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	9.813000	0.99286	2.854000	0.98071	0.655000	0.94253	GCT	.	.		0.488	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
TEX14	56155	hgsc.bcm.edu	37	17	56700253	56700253	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:56700253G>T	ENST00000240361.8	-	4	457	c.372C>A	c.(370-372)aaC>aaA	p.N124K	TEX14_ENST00000349033.5_Missense_Mutation_p.N124K|TEX14_ENST00000389934.3_Missense_Mutation_p.N124K			Q8IWB6	TEX14_HUMAN	testis expressed 14	124					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAGTCTTCGGGTTTTGACCCC	0.562																																					p.N124K		Atlas-SNP	.											.	TEX14	343	.	0			c.C372A						.						117.0	86.0	96.0					17																	56700253		2203	4300	6503	SO:0001583	missense	56155	exon4			CTTCGGGTTTTGA	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.372C>A	chr17.hg19:g.56700253G>T	ENSP00000240361:p.Asn124Lys	135.0	0.0		129.0	56.0	NM_198393	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	hg19	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	G	9.071	0.996974	0.19043	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.33865	1.39;1.39;1.39	5.12	-5.34	0.02705	Ankyrin repeat-containing domain (3);	0.245125	0.35291	N	0.003309	T	0.23649	0.0572	L	0.34521	1.04	0.21499	N	0.999668	B;B;B	0.25809	0.083;0.135;0.135	B;B;B	0.21917	0.017;0.037;0.037	T	0.11060	-1.0603	10	0.66056	D	0.02	-6.3684	14.5577	0.68113	0.7121:0.0:0.2879:0.0	.	124;124;124	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	K	124	ENSP00000240361:N124K;ENSP00000374584:N124K;ENSP00000268910:N124K	ENSP00000240361:N124K	N	-	3	2	TEX14	54055252	0.000000	0.05858	0.007000	0.13788	0.478000	0.33099	-0.907000	0.04067	-0.915000	0.03823	-0.768000	0.03414	AAC	.	.		0.562	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
CD300E	342510	hgsc.bcm.edu	37	17	72613454	72613454	+	Missense_Mutation	SNP	G	G	C	rs201462551		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr17:72613454G>C	ENST00000328630.3	-	2	231	c.191C>G	c.(190-192)aCc>aGc	p.T64S	CD300E_ENST00000426295.2_Missense_Mutation_p.T105S|CD300E_ENST00000392619.1_Missense_Mutation_p.T91S			Q496F6	CLM2_HUMAN	CD300e molecule	64	Ig-like V-type.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	19						TTCTCCCTTGGTCTCCACAAT	0.522																																					p.T64S		Atlas-SNP	.											.	CD300E	70	.	0			c.C191G						.						245.0	156.0	186.0					17																	72613454		2203	4300	6503	SO:0001583	missense	342510	exon2			CCCTTGGTCTCCA	BX648376	CCDS11702.1	17q25.1	2013-01-11	2006-03-28	2006-02-22	ENSG00000186407	ENSG00000186407		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	28874	protein-coding gene	gene with protein product		609801	"""CD300 antigen like family member E"", ""CD300e antigen"""	CD300LE		15549731, 15557162	Standard	NM_181449		Approved	IREM2, CLM2	uc002jlb.2	Q496F6	OTTHUMG00000067605	ENST00000328630.3:c.191C>G	chr17.hg19:g.72613454G>C	ENSP00000329942:p.Thr64Ser	150.0	0.0		164.0	18.0	NM_181449	B4DNS1|Q7Z7I3	Missense_Mutation	SNP	ENST00000328630.3	hg19	CCDS11702.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133156	0.56828	.	.	ENSG00000186407	ENST00000392619;ENST00000426295;ENST00000328630;ENST00000412268	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	4.74	3.77	0.43336	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47455	D	0.000235	T	0.73442	0.3587	M	0.63428	1.95	0.27250	N	0.958922	D	0.89917	1.0	D	0.91635	0.999	T	0.65294	-0.6203	10	0.87932	D	0	-16.4136	9.5171	0.39113	0.1012:0.0:0.8988:0.0	.	64	Q496F6	CLM2_HUMAN	S	91;105;64;66	ENSP00000376395:T91S;ENSP00000416642:T105S;ENSP00000329942:T64S;ENSP00000415488:T66S	ENSP00000329942:T64S	T	-	2	0	CD300E	70125049	0.224000	0.23674	0.447000	0.26932	0.004000	0.04260	2.338000	0.43957	1.312000	0.45043	-0.229000	0.12294	ACC	.	G|1.000;A|0.000		0.522	CD300E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181449	
GALNT1	2589	hgsc.bcm.edu	37	18	33267144	33267144	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr18:33267144C>T	ENST00000269195.5	+	5	957	c.854C>T	c.(853-855)cCt>cTt	p.P285L	GALNT1_ENST00000537549.1_Missense_Mutation_p.P225L	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	285	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						CGGACTCTTCCTGTCAGGTAA	0.408																																					p.P285L		Atlas-SNP	.											.	GALNT1	53	.	0			c.C854T						.						128.0	126.0	126.0					18																	33267144		2203	4300	6503	SO:0001583	missense	2589	exon5			CTCTTCCTGTCAG		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.854C>T	chr18.hg19:g.33267144C>T	ENSP00000269195:p.Pro285Leu	129.0	0.0		133.0	17.0	NM_020474	Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	hg19	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019438	0.93462	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.61392	0.11;0.11	5.5	5.5	0.81552	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.81912	0.4923	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86191	0.1612	10	0.87932	D	0	.	16.8858	0.86075	0.0:1.0:0.0:0.0	.	285	Q10472	GALT1_HUMAN	L	285;285;225	ENSP00000269195:P285L;ENSP00000440910:P225L	ENSP00000269195:P285L	P	+	2	0	GALNT1	31521142	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.595000	0.87683	0.585000	0.79938	CCT	.	.		0.408	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474	
FHOD3	80206	hgsc.bcm.edu	37	18	34156482	34156482	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr18:34156482T>C	ENST00000359247.4	+	6	580	c.580T>C	c.(580-582)Tgg>Cgg	p.W194R	FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000445677.1_Missense_Mutation_p.W194R|FHOD3_ENST00000590592.1_Missense_Mutation_p.W194R|FHOD3_ENST00000257209.4_Missense_Mutation_p.W194R	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	194	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AACCATTCAGTGGCTGTACAC	0.388																																					p.W194R		Atlas-SNP	.											.	FHOD3	210	.	0			c.T580C						.						137.0	121.0	127.0					18																	34156482		2203	4300	6503	SO:0001583	missense	80206	exon6			ATTCAGTGGCTGT	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.580T>C	chr18.hg19:g.34156482T>C	ENSP00000352186:p.Trp194Arg	188.0	0.0		180.0	24.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	hg19		.	.	.	.	.	.	.	.	.	.	T	22.9	4.351935	0.82132	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.25749	1.78;1.78;1.78	5.73	5.73	0.89815	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51483	0.1677	M	0.74467	2.265	0.52501	D	0.99995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.997	T	0.55360	-0.8153	10	0.87932	D	0	.	13.9605	0.64175	0.0:0.0:0.0:1.0	.	194;194;194	Q2V2M9;Q2V2M9-3;E5F5Q0	FHOD3_HUMAN;.;.	R	194	ENSP00000257209:W194R;ENSP00000352186:W194R;ENSP00000411430:W194R	ENSP00000257209:W194R	W	+	1	0	FHOD3	32410480	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.645000	0.83430	2.176000	0.68965	0.533000	0.62120	TGG	.	.		0.388	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
DOK6	220164	hgsc.bcm.edu	37	18	67425047	67425047	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr18:67425047G>A	ENST00000382713.5	+	7	984	c.794G>A	c.(793-795)cGc>cAc	p.R265H		NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	265										central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				TCTCTTCCTCGCAGCGCGTAC	0.398																																					p.R265H		Atlas-SNP	.											DOK6,NS,carcinoma,0,1	DOK6	56	.	0			c.G794A						.						129.0	110.0	117.0					18																	67425047		2203	4300	6503	SO:0001583	missense	220164	exon7			TTCCTCGCAGCGC	AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.794G>A	chr18.hg19:g.67425047G>A	ENSP00000372160:p.Arg265His	85.0	1.0		97.0	42.0	NM_152721	A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Missense_Mutation	SNP	ENST00000382713.5	hg19	CCDS32841.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.877349	0.91664	.	.	ENSG00000206052	ENST00000382713	D	0.82803	-1.65	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.87661	0.6233	L	0.38175	1.15	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.87903	0.2692	10	0.54805	T	0.06	-17.7497	18.4033	0.90525	0.0:0.0:1.0:0.0	.	265	Q6PKX4	DOK6_HUMAN	H	265	ENSP00000372160:R265H	ENSP00000372160:R265H	R	+	2	0	DOK6	65576027	1.000000	0.71417	0.958000	0.39756	0.974000	0.67602	7.786000	0.85741	2.681000	0.91329	0.561000	0.74099	CGC	.	.		0.398	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721	
SALL3	27164	hgsc.bcm.edu	37	18	76754132	76754132	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr18:76754132G>T	ENST00000537592.2	+	2	2141	c.2141G>T	c.(2140-2142)cGc>cTc	p.R714L	SALL3_ENST00000575389.2_Missense_Mutation_p.R714L|SALL3_ENST00000536229.3_Missense_Mutation_p.R581L	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	714					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		ATCTGCGGCCGCGCCTTCACC	0.657																																					p.R714L		Atlas-SNP	.											.	SALL3	162	.	0			c.G2141T						.						39.0	36.0	37.0					18																	76754132		2203	4299	6502	SO:0001583	missense	27164	exon2			GCGGCCGCGCCTT	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2141G>T	chr18.hg19:g.76754132G>T	ENSP00000441823:p.Arg714Leu	133.0	0.0		75.0	17.0	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	hg19	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561897	0.45590	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.19105	2.17	5.33	5.33	0.75918	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000022	T	0.42921	0.1224	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.29336	-1.0015	10	0.87932	D	0	-49.9595	19.053	0.93053	0.0:0.0:1.0:0.0	.	446;714	F5GXY4;Q9BXA9	.;SALL3_HUMAN	L	714;714;446	ENSP00000441823:R714L	ENSP00000299466:R714L	R	+	2	0	SALL3	74855120	1.000000	0.71417	0.997000	0.53966	0.692000	0.40212	9.787000	0.99055	2.499000	0.84300	0.655000	0.94253	CGC	.	.		0.657	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
PSG11	5680	hgsc.bcm.edu	37	19	43528932	43528932	+	Missense_Mutation	SNP	C	C	A	rs111739483	byFrequency	TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr19:43528932C>A	ENST00000401740.1	-	2	444	c.341G>T	c.(340-342)cGg>cTg	p.R114L	PSG11_ENST00000403486.1_Intron|PSG11_ENST00000320078.7_Missense_Mutation_p.R114L|PSG11_ENST00000306322.7_Intron			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	114	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				TGCGTCCTCCCGGGTGACATT	0.443																																					p.R114L		Atlas-SNP	.											.	PSG11	57	.	0			c.G341T						.						157.0	153.0	154.0					19																	43528932		2198	4295	6493	SO:0001583	missense	5680	exon2			TCCTCCCGGGTGA	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.341G>T	chr19.hg19:g.43528932C>A	ENSP00000384995:p.Arg114Leu	292.0	0.0		364.0	44.0	NM_002785	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	hg19	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	t	0.187	-1.056764	0.01965	.	.	ENSG00000243130	ENST00000320078;ENST00000401740	T;T	0.63096	-0.02;-0.02	0.929	-1.86	0.07760	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33818	0.0876	N	0.11131	0.1	0.09310	N	1	B	0.10296	0.003	B	0.22152	0.038	T	0.13656	-1.0501	9	0.22109	T	0.4	.	1.4589	0.02391	0.3155:0.2605:0.0:0.424	.	114	Q9UQ72	PSG11_HUMAN	L	114	ENSP00000319140:R114L;ENSP00000384995:R114L	ENSP00000319140:R114L	R	-	2	0	PSG11	48220772	0.000000	0.05858	0.024000	0.17045	0.008000	0.06430	-2.383000	0.01063	-1.324000	0.02272	-1.109000	0.02080	CGG	.	C|0.977;T|0.023		0.443	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
KLK1	3816	hgsc.bcm.edu	37	19	51322605	51322605	+	Splice_Site	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr19:51322605C>T	ENST00000301420.2	-	5	669	c.634G>A	c.(634-636)Ggt>Agt	p.G212S	CTD-2568A17.5_ENST00000326989.5_lincRNA|KLK1_ENST00000448701.2_Splice_Site_p.G110S	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	212	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	CCTGAATCACCCTGGGAGCAC	0.627																																					p.G212S		Atlas-SNP	.											.	KLK1	27	.	0			c.G634A						.						50.0	49.0	49.0					19																	51322605		2203	4300	6503	SO:0001630	splice_region_variant	3816	exon5			AATCACCCTGGGA	L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.634-1G>A	chr19.hg19:g.51322605C>T		63.0	0.0		79.0	5.0	NM_002257	Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Missense_Mutation	SNP	ENST00000301420.2	hg19	CCDS12804.1	.	.	.	.	.	.	.	.	.	.	c	22.8	4.336266	0.81801	.	.	ENSG00000167748	ENST00000301420;ENST00000448701	D;D	0.97924	-4.61;-4.61	3.66	3.66	0.41972	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.98623	0.9539	M	0.88512	2.96	0.43959	D	0.996635	D	0.89917	1.0	D	0.91635	0.999	D	0.98667	1.0686	9	0.87932	D	0	.	11.1408	0.48402	0.0:1.0:0.0:0.0	.	212	P06870	KLK1_HUMAN	S	212;110	ENSP00000301420:G212S;ENSP00000400994:G110S	ENSP00000301420:G212S	G	-	1	0	KLK1	56014417	1.000000	0.71417	0.999000	0.59377	0.567000	0.35839	4.291000	0.59025	2.334000	0.79466	0.561000	0.74099	GGT	.	.		0.627	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464135.2	NM_002257	Missense_Mutation
ZNF528	84436	hgsc.bcm.edu	37	19	52919064	52919064	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr19:52919064C>A	ENST00000360465.3	+	7	1385	c.959C>A	c.(958-960)aCt>aAt	p.T320N	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AAAATTCATACTGGAGAGAAA	0.378																																					p.T320N		Atlas-SNP	.											.	ZNF528	95	.	0			c.C959A						.						49.0	52.0	51.0					19																	52919064		2203	4299	6502	SO:0001583	missense	84436	exon7			TTCATACTGGAGA	AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.959C>A	chr19.hg19:g.52919064C>A	ENSP00000353652:p.Thr320Asn	89.0	0.0		90.0	7.0	NM_032423	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	hg19	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822683	0.71028	.	.	ENSG00000167555	ENST00000360465	T	0.26067	1.76	1.85	-1.06	0.10002	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21631	0.0521	L	0.45137	1.4	0.23076	N	0.998334	P	0.43857	0.819	B	0.44133	0.442	T	0.14755	-1.0461	9	0.72032	D	0.01	.	4.6207	0.12449	0.211:0.6502:0.0:0.1388	.	320	Q3MIS6	ZN528_HUMAN	N	320	ENSP00000353652:T320N	ENSP00000353652:T320N	T	+	2	0	ZNF528	57610876	0.016000	0.18221	0.007000	0.13788	0.787000	0.44495	0.494000	0.22467	-0.357000	0.08175	0.491000	0.48974	ACT	.	.		0.378	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
ZNF835	90485	hgsc.bcm.edu	37	19	57175244	57175244	+	Silent	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr19:57175244C>T	ENST00000537055.2	-	2	1554	c.1323G>A	c.(1321-1323)acG>acA	p.T441T		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GCCGCTCGCCCGTGTGCGTGC	0.667																																					p.T441T		Atlas-SNP	.											.	ZNF835	106	.	0			c.G1323A						.						44.0	49.0	47.0					19																	57175244		2201	4297	6498	SO:0001819	synonymous_variant	90485	exon2			CTCGCCCGTGTGC	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1323G>A	chr19.hg19:g.57175244C>T		60.0	0.0		35.0	10.0	NM_001005850	B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	hg19	CCDS56105.1																																																																																			.	.		0.667	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
PREX1	57580	hgsc.bcm.edu	37	20	47269978	47269978	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr20:47269978C>T	ENST00000371941.3	-	20	2289	c.2267G>A	c.(2266-2268)gGc>gAc	p.G756D	PREX1_ENST00000396220.1_Missense_Mutation_p.G756D	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	756					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CACGTTGCTGCCATTGACCTT	0.587																																					p.G756D		Atlas-SNP	.											.	PREX1	441	.	0			c.G2267A						.						126.0	114.0	118.0					20																	47269978		2203	4300	6503	SO:0001583	missense	57580	exon20			TTGCTGCCATTGA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2267G>A	chr20.hg19:g.47269978C>T	ENSP00000361009:p.Gly756Asp	67.0	0.0		63.0	18.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023153	0.75275	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.28895	1.59;1.59	5.08	5.08	0.68730	PDZ/DHR/GLGF (2);	0.000000	0.56097	U	0.000034	T	0.60818	0.2298	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.992;0.994	T	0.68093	-0.5500	10	0.87932	D	0	.	16.7473	0.85476	0.0:1.0:0.0:0.0	.	756;53	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	D	756	ENSP00000361009:G756D;ENSP00000379522:G756D	ENSP00000361009:G756D	G	-	2	0	PREX1	46703385	1.000000	0.71417	0.997000	0.53966	0.338000	0.28826	7.015000	0.76387	2.382000	0.81193	0.456000	0.33151	GGC	.	.		0.587	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
KRTAP8-1	337879	hgsc.bcm.edu	37	21	32185533	32185533	+	Silent	SNP	G	G	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr21:32185533G>C	ENST00000329621.4	-	1	37	c.6C>G	c.(4-6)ctC>ctG	p.L2L		NM_175857.3	NP_787053.1	Q8IUC2	KRA81_HUMAN	keratin associated protein 8-1	2						intermediate filament (GO:0005882)				central_nervous_system(1)|large_intestine(1)|lung(4)	6						AGTTGTCGCAGAGCATGGTGT	0.552																																					p.L2L		Atlas-SNP	.											.	KRTAP8-1	20	.	0			c.C6G						.						75.0	65.0	68.0					21																	32185533		2203	4300	6503	SO:0001819	synonymous_variant	337879	exon1			GTCGCAGAGCATG	AJ457064	CCDS13607.1	21q22.1	2006-03-13			ENSG00000183640	ENSG00000183640		"""Keratin associated proteins"""	18935	protein-coding gene	gene with protein product						12359730	Standard	NM_175857		Approved	KAP8.1	uc002you.3	Q8IUC2	OTTHUMG00000057771	ENST00000329621.4:c.6C>G	chr21.hg19:g.32185533G>C		190.0	0.0		173.0	52.0	NM_175857	Q3LI57	Silent	SNP	ENST00000329621.4	hg19	CCDS13607.1																																																																																			.	.		0.552	KRTAP8-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128223.1		
BACE2	25825	hgsc.bcm.edu	37	21	42598204	42598204	+	Silent	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr21:42598204C>A	ENST00000330333.6	+	2	787	c.324C>A	c.(322-324)ctC>ctA	p.L108L	BACE2_ENST00000347667.5_Silent_p.L108L|BACE2_ENST00000328735.6_Silent_p.L108L	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	108					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				TACAGATTCTCGTTGACACTG	0.398																																					p.L108L		Atlas-SNP	.											.	BACE2	45	.	0			c.C324A						.						86.0	87.0	87.0					21																	42598204		2203	4300	6503	SO:0001819	synonymous_variant	25825	exon2			GATTCTCGTTGAC	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.324C>A	chr21.hg19:g.42598204C>A		160.0	0.0		200.0	14.0	NM_138992	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	hg19	CCDS13668.1																																																																																			.	.		0.398	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
RRP1B	23076	hgsc.bcm.edu	37	21	45107710	45107710	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr21:45107710A>T	ENST00000340648.4	+	13	1572	c.1455A>T	c.(1453-1455)gaA>gaT	p.E485D		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	485					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		CCCACAGGGAAATGTTGGAAT	0.617																																					p.E485D		Atlas-SNP	.											.	RRP1B	51	.	0			c.A1455T						.						50.0	56.0	54.0					21																	45107710		2203	4297	6500	SO:0001583	missense	23076	exon13			CAGGGAAATGTTG	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.1455A>T	chr21.hg19:g.45107710A>T	ENSP00000339145:p.Glu485Asp	120.0	0.0		131.0	25.0	NM_015056	Q8TBZ4	Missense_Mutation	SNP	ENST00000340648.4	hg19	CCDS33577.1	.	.	.	.	.	.	.	.	.	.	A	10.84	1.465065	0.26335	.	.	ENSG00000160208	ENST00000340648	T	0.01192	5.2	4.41	2.52	0.30459	.	0.412177	0.22580	N	0.058227	T	0.01092	0.0036	L	0.32530	0.975	0.09310	N	1	P	0.37466	0.596	B	0.32864	0.154	T	0.51252	-0.8729	10	0.87932	D	0	-0.0083	8.8103	0.34963	0.198:0.0:0.802:0.0	.	485	Q14684	RRP1B_HUMAN	D	485	ENSP00000339145:E485D	ENSP00000339145:E485D	E	+	3	2	RRP1B	43932138	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.587000	0.23909	0.945000	0.37605	-0.366000	0.07423	GAA	.	.		0.617	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
MAGED1	9500	hgsc.bcm.edu	37	X	51638377	51638377	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:51638377T>C	ENST00000375722.1	+	3	526	c.274T>C	c.(274-276)Tat>Cat	p.Y92H	MAGED1_ENST00000375695.2_Missense_Mutation_p.Y148H|MAGED1_ENST00000326587.7_Missense_Mutation_p.Y92H|MAGED1_ENST00000375772.3_Missense_Mutation_p.Y92H|MAGED1_ENST00000494718.1_3'UTR			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	92					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					AAATGGTGTCTATGATTTCTC	0.507										Multiple Myeloma(10;0.10)																											p.Y148H		Atlas-SNP	.											.	MAGED1	84	.	0			c.T442C						.						47.0	38.0	42.0					X																	51638377		2203	4300	6503	SO:0001583	missense	9500	exon4			GGTGTCTATGATT	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.274T>C	chrX.hg19:g.51638377T>C	ENSP00000364874:p.Tyr92His	127.0	0.0		120.0	19.0	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	hg19	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.759515	0.49468	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695;ENST00000430189	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	3.43	3.43	0.39272	.	0.000000	0.33959	N	0.004388	T	0.52709	0.1751	L	0.29908	0.895	0.25094	N	0.990835	D;P;D	0.76494	0.999;0.77;0.998	D;P;D	0.78314	0.974;0.611;0.991	T	0.38866	-0.9641	10	0.15952	T	0.53	.	7.6184	0.28171	0.0:0.0:0.0:1.0	.	92;148;92	B4DQ04;Q9Y5V3-2;Q9Y5V3	.;.;MAGD1_HUMAN	H	92;92;92;148;92	ENSP00000364927:Y92H;ENSP00000364874:Y92H;ENSP00000325333:Y92H;ENSP00000364847:Y148H	ENSP00000325333:Y92H	Y	+	1	0	MAGED1	51655117	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.396000	0.34531	1.611000	0.50210	0.372000	0.22366	TAT	.	.		0.507	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
KDM5C	8242	hgsc.bcm.edu	37	X	53246991	53246991	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:53246991C>A	ENST00000375401.3	-	4	1041	c.509G>T	c.(508-510)gGa>gTa	p.G170V	KDM5C_ENST00000404049.3_Missense_Mutation_p.G170V|KDM5C_ENST00000375379.3_Missense_Mutation_p.G170V|KDM5C_ENST00000452825.3_Missense_Mutation_p.G103V|KDM5C_ENST00000375383.3_Missense_Mutation_p.G129V	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	170					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AAGGTTGGCTCCAGACTGGTA	0.498			"""N, F, S"""		clear cell renal carcinoma																																p.G170V		Atlas-SNP	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C	385	.	0			c.G509T						.						98.0	72.0	81.0					X																	53246991		2203	4300	6503	SO:0001583	missense	8242	exon4			TTGGCTCCAGACT	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.509G>T	chrX.hg19:g.53246991C>A	ENSP00000364550:p.Gly170Val	241.0	0.0		227.0	43.0	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	hg19	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203222	0.79127	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	5.21	5.21	0.72293	ARID/BRIGHT DNA-binding domain (3);	0.000000	0.85682	D	0.000000	T	0.80649	0.4663	M	0.84846	2.72	0.80722	D	1	D;D;D	0.67145	0.982;0.996;0.996	D;D;D	0.70016	0.927;0.923;0.967	D	0.84188	0.0443	10	0.87932	D	0	-15.3935	15.4283	0.75072	0.0:1.0:0.0:0.0	.	103;170;170	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	V	103;170;170;170;129	ENSP00000445176:G103V;ENSP00000364550:G170V;ENSP00000385394:G170V;ENSP00000364528:G170V;ENSP00000364532:G129V	ENSP00000364528:G170V	G	-	2	0	KDM5C	53263716	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.657000	0.83745	2.323000	0.78572	0.529000	0.55759	GGA	.	.		0.498	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
IQSEC2	23096	hgsc.bcm.edu	37	X	53277365	53277365	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:53277365C>T	ENST00000375368.5	-	6	2683	c.2483G>A	c.(2482-2484)cGg>cAg	p.R828Q	IQSEC2_ENST00000396435.3_Missense_Mutation_p.R838Q|IQSEC2_ENST00000375365.2_Missense_Mutation_p.R633Q			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	828	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTGGAACTTCCGGAGCGCATC	0.562																																					p.R838Q		Atlas-SNP	.											.	IQSEC2	195	.	0			c.G2513A						.						92.0	55.0	67.0					X																	53277365		2203	4300	6503	SO:0001583	missense	23096	exon7			AACTTCCGGAGCG	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2483G>A	chrX.hg19:g.53277365C>T	ENSP00000364517:p.Arg828Gln	150.0	0.0		158.0	11.0	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	hg19		.	.	.	.	.	.	.	.	.	.	C	31	5.080058	0.94050	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.71461	-0.57;-0.57;-0.57	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.90188	0.6933	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.99	D	0.93523	0.6863	10	0.87932	D	0	.	17.5783	0.87957	0.0:1.0:0.0:0.0	.	838;633	Q5JU85-2;Q5JU85-3	.;.	Q	838;828;633	ENSP00000379712:R838Q;ENSP00000364517:R828Q;ENSP00000364514:R633Q	ENSP00000364514:R633Q	R	-	2	0	IQSEC2	53294090	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.422000	0.82143	0.600000	0.82982	CGG	.	.		0.562	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
GLRA4	441509	hgsc.bcm.edu	37	X	102973919	102973919	+	Intron	SNP	G	G	T			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:102973919G>T	ENST00000372617.4	-	7	1354				GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4							cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAGCAGGAGGGCACATTGGGA	0.502																																					p.C333X		Atlas-SNP	.											.	GLRA4	86	.	0			c.C999A						.																																			SO:0001627	intron_variant	441509	exon7			AGGAGGGCACATT	Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.933+65C>A	chrX.hg19:g.102973919G>T		189.0	0.0		180.0	67.0	NM_001172285		Nonsense_Mutation	SNP	ENST00000372617.4	hg19	CCDS43980.2																																																																																			.	.		0.502	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057742.2	NM_001024452	
IRS4	8471	hgsc.bcm.edu	37	X	107977917	107977917	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:107977917G>A	ENST00000372129.2	-	1	1734	c.1658C>T	c.(1657-1659)gCa>gTa	p.A553V	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	553					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GTGCCCACCTGCGGTGCCCTG	0.642																																					p.A553V		Atlas-SNP	.											.	IRS4	253	.	0			c.C1658T						.						115.0	117.0	117.0					X																	107977917		2203	4300	6503	SO:0001583	missense	8471	exon1			CCACCTGCGGTGC	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1658C>T	chrX.hg19:g.107977917G>A	ENSP00000361202:p.Ala553Val	56.0	0.0		41.0	8.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	hg19	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	G	8.057	0.767257	0.15983	.	.	ENSG00000133124	ENST00000372129	T	0.35421	1.31	4.76	4.76	0.60689	.	0.526496	0.20003	N	0.101297	T	0.31796	0.0808	L	0.51422	1.61	0.23831	N	0.996729	B	0.06786	0.001	B	0.09377	0.004	T	0.10405	-1.0631	10	0.25106	T	0.35	0.3699	12.071	0.53616	0.0:0.0:1.0:0.0	.	553	O14654	IRS4_HUMAN	V	553	ENSP00000361202:A553V	ENSP00000361202:A553V	A	-	2	0	IRS4	107864573	0.003000	0.15002	0.948000	0.38648	0.130000	0.20726	1.176000	0.31957	2.335000	0.79485	0.600000	0.82982	GCA	.	.		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
RBMXL3	139804	hgsc.bcm.edu	37	X	114424158	114424158	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:114424158G>A	ENST00000424776.3	+	1	196	c.154G>A	c.(154-156)Gcg>Acg	p.A52T	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	52	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GAGGGGCTTCGCGTTCGTCAC	0.542																																					p.A52T		Atlas-SNP	.											.	RBMXL3	83	.	0			c.G154A						.						81.0	75.0	77.0					X																	114424158		692	1591	2283	SO:0001583	missense	139804	exon1			GGCTTCGCGTTCG	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.154G>A	chrX.hg19:g.114424158G>A	ENSP00000417451:p.Ala52Thr	357.0	0.0		398.0	69.0	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	hg19	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.267744	0.59540	.	.	ENSG00000175718	ENST00000424776	D	0.85773	-2.03	0.69	0.69	0.18039	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	D	0.92625	0.7657	H	0.94771	3.58	0.40970	D	0.984695	D	0.89917	1.0	D	0.76071	0.987	D	0.91014	0.4852	9	0.87932	D	0	.	6.9589	0.24585	1.0E-4:0.0:0.9999:0.0	.	52	Q8N7X1	RMXL3_HUMAN	T	52	ENSP00000417451:A52T	ENSP00000417451:A52T	A	+	1	0	RBMXL3	114330414	1.000000	0.71417	0.011000	0.14972	0.004000	0.04260	6.330000	0.72925	0.587000	0.29643	0.422000	0.28245	GCG	.	.		0.542	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
STAG2	10735	hgsc.bcm.edu	37	X	123195634	123195634	+	Silent	SNP	G	G	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:123195634G>A	ENST00000371160.1	+	17	1838	c.1548G>A	c.(1546-1548)agG>agA	p.R516R	STAG2_ENST00000218089.9_Silent_p.R516R|STAG2_ENST00000371157.3_Silent_p.R516R|STAG2_ENST00000371144.3_Silent_p.R516R|STAG2_ENST00000371145.3_Silent_p.R516R|STAG2_ENST00000354548.5_Silent_p.R447R|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	516					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TAACAGATAGGCAAGAGAGTG	0.363																																					p.R516R		Atlas-SNP	.											.	STAG2	309	.	0			c.G1548A						.						57.0	53.0	54.0					X																	123195634		2203	4300	6503	SO:0001819	synonymous_variant	10735	exon17			AGATAGGCAAGAG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1548G>A	chrX.hg19:g.123195634G>A		152.0	0.0		138.0	22.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	ENST00000371160.1	hg19	CCDS14607.1																																																																																			.	.		0.363	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
PLXNB3	5365	hgsc.bcm.edu	37	X	153035892	153035892	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:153035892C>A	ENST00000361971.5	+	9	2000	c.1886C>A	c.(1885-1887)gCg>gAg	p.A629E	PLXNB3_ENST00000538966.1_Missense_Mutation_p.A652E|PLXNB3_ENST00000538776.1_Missense_Mutation_p.A282E|PLXNB3_ENST00000538543.1_Missense_Mutation_p.A179E|PLXNB3_ENST00000538282.1_Missense_Mutation_p.A239E	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	629	PSI 2.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCTTGGAGGCGGCTGCCCCG	0.657																																					p.A652E		Atlas-SNP	.											.	PLXNB3	208	.	0			c.C1955A						.						56.0	41.0	46.0					X																	153035892		2192	4296	6488	SO:0001583	missense	5365	exon10			TGGAGGCGGCTGC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.1886C>A	chrX.hg19:g.153035892C>A	ENSP00000355378:p.Ala629Glu	181.0	0.0		165.0	67.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	hg19	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.406058	0.00193	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538543;ENST00000538282	T;T;T;T;T	0.65732	5.38;5.34;4.75;2.03;-0.17	5.1	-5.79	0.02354	.	1.048160	0.07454	N	0.899545	T	0.39911	0.1096	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.30914	0.045;0.3;0.144;0.077;0.007	B;B;B;B;B	0.36534	0.024;0.039;0.227;0.109;0.031	T	0.36720	-0.9736	10	0.02654	T	1	.	8.4457	0.32841	0.0:0.4929:0.1237:0.3834	.	282;311;179;652;629	B7Z3H9;B7Z9A5;F5GZZ4;F5H773;Q9ULL4	.;.;.;.;PLXB3_HUMAN	E	652;629;282;179;239	ENSP00000442736:A652E;ENSP00000355378:A629E;ENSP00000445569:A282E;ENSP00000444086:A179E;ENSP00000441919:A239E	ENSP00000355378:A629E	A	+	2	0	PLXNB3	152689086	0.000000	0.05858	0.005000	0.12908	0.015000	0.08874	-3.653000	0.00402	-1.807000	0.01236	-1.326000	0.01283	GCG	.	.		0.657	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
PLXNB3	5365	hgsc.bcm.edu	37	X	153042728	153042728	+	Missense_Mutation	SNP	G	G	A	rs372327696		TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chrX:153042728G>A	ENST00000361971.5	+	30	5107	c.4993G>A	c.(4993-4995)Gag>Aag	p.E1665K	PLXNB3_ENST00000538966.1_Missense_Mutation_p.E1688K|PLXNB3_ENST00000538776.1_Missense_Mutation_p.E1318K|SRPK3_ENST00000489426.1_5'UTR|PLXNB3_ENST00000485980.1_3'UTR	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1665					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GAAAGCCACCGAGGAGCCAGA	0.657													G|||	1	0.000264901	0.0008	0.0	3775	,	,		12328	0.0		0.0	False		,,,				2504	0.0				p.E1688K		Atlas-SNP	.											.	PLXNB3	208	.	0			c.G5062A						.	G	LYS/GLU,LYS/GLU	0,3816		0,0,1628,560	29.0	21.0	24.0		5062,4993	5.0	0.5	X		24	1,6714		0,1,2426,1861	no	missense,missense	PLXNB3	NM_001163257.1,NM_005393.2	56,56	0,1,4054,2421	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging,probably-damaging	1688/1933,1665/1910	153042728	1,10530	2188	4288	6476	SO:0001583	missense	5365	exon31			GCCACCGAGGAGC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.4993G>A	chrX.hg19:g.153042728G>A	ENSP00000355378:p.Glu1665Lys	138.0	0.0		121.0	45.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	hg19	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014283	0.93404	0.0	1.49E-4	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776	T;T;T	0.12361	2.69;2.69;2.69	4.99	4.99	0.66335	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.43100	0.1232	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.995;0.998	T	0.50092	-0.8868	10	0.72032	D	0.01	.	16.3453	0.83126	0.0:0.0:1.0:0.0	.	1318;1688;1665	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	K	1688;1665;1318	ENSP00000442736:E1688K;ENSP00000355378:E1665K;ENSP00000445569:E1318K	ENSP00000355378:E1665K	E	+	1	0	PLXNB3	152695922	1.000000	0.71417	0.539000	0.28077	0.567000	0.35839	9.785000	0.99042	2.200000	0.70718	0.529000	0.55759	GAG	.	.		0.657	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
COG5	10466	hgsc.bcm.edu	37	7	106921825	106921827	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr7:106921825_106921827delCAG	ENST00000347053.3	-	14	1636_1638	c.1586_1588delCTG	c.(1585-1590)gctgtt>gtt	p.A529del	COG5_ENST00000297135.3_In_Frame_Del_p.A529del|COG5_ENST00000393603.2_In_Frame_Del_p.A529del	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	529					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						TTTGTATCAACAGCAGCAACATT	0.34																																					p.529_530del		Atlas-Indel,Pindel	.											.	COG5	78	.	0			c.1587_1589del						.																																			SO:0001651	inframe_deletion	10466	exon14			.	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1586_1588delCTG	chr7.hg19:g.106921828_106921830delCAG	ENSP00000334703:p.Ala529del	98.0	0.0		114.0	19.0	NM_001161520	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	In_Frame_Del	DEL	ENST00000347053.3	hg19	CCDS5743.1																																																																																			.	.		0.340	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4		
FAM71C	196472	hgsc.bcm.edu	37	12	100042220	100042221	+	Frame_Shift_Del	DEL	CG	CG	-	rs141451941|rs181913768	byFrequency	TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:100042220_100042221delCG	ENST00000324341.1	+	1	690_691	c.268_269delCG	c.(268-270)cgafs	p.R90fs	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000547776.2_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	90										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		GCTGCTGGCCCGACCAGCTGCT	0.559																																					p.89_90del		Atlas-INDEL	.											.	FAM71C	48	.	0			c.267_268del						.																																			SO:0001589	frameshift_variant	196472	exon1			.		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.268_269delCG	chr12.hg19:g.100042220_100042221delCG	ENSP00000315247:p.Arg90fs	114.0	0.0		117.0	18.0	NM_153364	B2R6Y6	Frame_Shift_Del	DEL	ENST00000324341.1	hg19	CCDS9072.1																																																																																			.	.		0.559	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
MICU3	286097	hgsc.bcm.edu	37	8	16921654	16921654	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr8:16921654delG	ENST00000318063.5	+	2	485	c.443delG	c.(442-444)cgafs	p.R148fs		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	148						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)										CGGGAGAGGCGATTTCGTTTA	0.388																																					p.R148fs		Atlas-Indel,Pindel	.											EFHA2,NS,carcinoma,0,2	EFHA2	60	.	0			c.442delC						.						188.0	166.0	174.0					8																	16921654		2203	4300	6503	SO:0001589	frameshift_variant	286097	exon2			.	BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.443delG	chr8.hg19:g.16921654delG	ENSP00000321455:p.Arg148fs	94.0	0.0		74.0	14.0	NM_181723	Q8IYZ3	Frame_Shift_Del	DEL	ENST00000318063.5	hg19	CCDS5999.1																																																																																			.	.		0.388	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723	
VPS39	23339	hgsc.bcm.edu	37	15	42454640	42454641	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr15:42454640_42454641insG	ENST00000348544.4	-	23	2246_2247	c.2247_2248insC	c.(2245-2250)cccagcfs	p.S750fs	VPS39_ENST00000318006.5_Frame_Shift_Ins_p.S739fs			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	750					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		CAGTGAATGCTGGGGGGCGACA	0.589																																					p.S739fs		Atlas-Indel,Pindel	.											.	VPS39	53	.	0			c.2215_2216insC						.																																			SO:0001589	frameshift_variant	23339	exon22			.	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.2248dupC	chr15.hg19:g.42454646_42454646dupG	ENSP00000335193:p.Ser750fs	135.0	0.0		103.0	35.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Frame_Shift_Ins	INS	ENST00000348544.4	hg19	CCDS10083.1																																																																																			.	.		0.589	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
FAM71C	196472	hgsc.bcm.edu	37	12	100042218	100042223	+	In_Frame_Del	DEL	CCCGAC	CCCGAC	-	rs141451941|rs181913768	byFrequency	TCGA-G3-A5SM-01A-12D-A28X-10	TCGA-G3-A5SM-10A-01D-A28X-10	CCCGAC	CCCGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e2dae934-c940-4712-976d-68a9cce2b2c2	e6086fb4-e933-4934-8437-5c592d7bf553	g.chr12:100042218_100042223delCCCGAC	ENST00000324341.1	+	1	688_693	c.266_271delCCCGAC	c.(265-273)gcccgacca>gca	p.RP90del	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000547776.2_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	90										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		ATGCTGCTGGCCCGACCAGCTGCTGT	0.553																																					p.89_90del		Pindel	.											.	FAM71C	48	.	0			c.265_270del						.																																			SO:0001651	inframe_deletion	196472	exon1			.		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.266_271delCCCGAC	chr12.hg19:g.100042218_100042223delCCCGAC	ENSP00000315247:p.Arg90_Pro91del	115.0	0.0		124.0	16.0	NM_153364	B2R6Y6	In_Frame_Del	DEL	ENST00000324341.1	hg19	CCDS9072.1																																																																																			.	.		0.553	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
