#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	hgsc.bcm.edu	37	1	1266805	1266805	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr1:1266805A>C	ENST00000339381.5	+	1	112	c.80A>C	c.(79-81)cAg>cCg	p.Q27P		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	27					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		TGCCTGTCACAGCAACTTAGG	0.687																																					p.Q27P		Atlas-SNP	.											.	TAS1R3	39	.	0			c.A80C						.						19.0	20.0	20.0					1																	1266805		2190	4280	6470	SO:0001583	missense	83756	exon1			TGTCACAGCAACT	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.80A>C	chr1.hg19:g.1266805A>C	ENSP00000344411:p.Gln27Pro	170.0	0.0		137.0	51.0	NM_152228	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	hg19	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	A	6.424	0.446438	0.12223	.	.	ENSG00000169962	ENST00000339381	D	0.89270	-2.49	4.18	-4.54	0.03452	.	1.163060	0.06289	N	0.698755	T	0.72407	0.3456	N	0.08118	0	0.09310	N	1	P	0.34934	0.476	B	0.28553	0.091	T	0.62723	-0.6794	10	0.33940	T	0.23	.	7.7272	0.28767	0.6168:0.1568:0.2264:0.0	.	27	Q7RTX0	TS1R3_HUMAN	P	27	ENSP00000344411:Q27P	ENSP00000344411:Q27P	Q	+	2	0	TAS1R3	1256668	0.000000	0.05858	0.006000	0.13384	0.247000	0.25773	-0.804000	0.04535	-1.207000	0.02637	-0.736000	0.03550	CAG	.	.		0.687	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
CTRC	11330	hgsc.bcm.edu	37	1	15772242	15772242	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr1:15772242G>T	ENST00000375949.4	+	7	816	c.790G>T	c.(790-792)Gag>Tag	p.E264*	CTRC_ENST00000375943.2_3'UTR|CTRC_ENST00000483406.1_3'UTR	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	264	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGATCAACGAGGTGGGTGC	0.597																																					p.E264X		Atlas-SNP	.											CTRC,NS,malignant_melanoma,0,1	CTRC	28	.	0			c.G790T						.						78.0	77.0	77.0					1																	15772242		2203	4300	6503	SO:0001587	stop_gained	11330	exon7			ATCAACGAGGTGG	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.790G>T	chr1.hg19:g.15772242G>T	ENSP00000365116:p.Glu264*	72.0	0.0		52.0	26.0	NM_007272	A8K082|O00765|Q9NUH5	Nonsense_Mutation	SNP	ENST00000375949.4	hg19	CCDS156.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271338	0.40194	.	.	ENSG00000162438	ENST00000375949	.	.	.	4.68	-9.36	0.00629	.	0.945603	0.08885	N	0.879394	.	.	.	.	.	.	0.34632	D	0.71971	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-12.9763	13.4365	0.61086	0.1769:0.6167:0.2064:0.0	.	.	.	.	X	264	.	ENSP00000365116:E264X	E	+	1	0	CTRC	15644829	0.000000	0.05858	0.001000	0.08648	0.610000	0.37248	-1.418000	0.02462	-2.565000	0.00471	-0.835000	0.03068	GAG	.	.		0.597	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	NM_007272	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144867973	144867973	+	Silent	SNP	A	A	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr1:144867973A>T	ENST00000369354.3	-	33	5655	c.5466T>A	c.(5464-5466)tcT>tcA	p.S1822S	PDE4DIP_ENST00000369359.4_Silent_p.S1958S|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Silent_p.S1907S|PDE4DIP_ENST00000313382.9_Silent_p.S1716S|PDE4DIP_ENST00000369356.4_Silent_p.S1822S|RP4-791M13.4_ENST00000532137.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1822					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATAGGTCCCCAGATACACTCC	0.522			T	PDGFRB	MPD																																p.S1822S		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.T5466A						.						290.0	295.0	293.0					1																	144867973		2203	4296	6499	SO:0001819	synonymous_variant	9659	exon33			GTCCCCAGATACA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5466T>A	chr1.hg19:g.144867973A>T		183.0	0.0		158.0	29.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	hg19	CCDS30824.1																																																																																			.	.		0.522	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
VSIG8	391123	hgsc.bcm.edu	37	1	159826324	159826324	+	Silent	SNP	C	C	G			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr1:159826324C>G	ENST00000368100.1	-	5	897	c.762G>C	c.(760-762)gtG>gtC	p.V254V	C1orf204_ENST00000491974.1_5'Flank|C1orf204_ENST00000368102.1_5'Flank	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	254	Ig-like V-type 2.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					CTGAGACCTTCACCTCCACCA	0.567																																					p.V254V		Atlas-SNP	.											.	VSIG8	24	.	0			c.G762C						.						318.0	246.0	270.0					1																	159826324		2203	4300	6503	SO:0001819	synonymous_variant	391123	exon5			GACCTTCACCTCC		CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.762G>C	chr1.hg19:g.159826324C>G		92.0	0.0		153.0	113.0	NM_001013661	Q5VU14	Silent	SNP	ENST00000368100.1	hg19	CCDS30913.1																																																																																			.	.		0.567	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085978.8	NM_001013661	
FLVCR1	28982	hgsc.bcm.edu	37	1	213031877	213031877	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr1:213031877G>A	ENST00000366971.4	+	1	281	c.83G>A	c.(82-84)gGc>gAc	p.G28D	FLVCR1-AS1_ENST00000356684.3_lincRNA	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	28					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TTGCCGAGGGGCGCGCCCGTT	0.736																																					p.G28D	Esophageal Squamous(199;2235 2952 19233 26256)	Atlas-SNP	.											.	FLVCR1	31	.	0			c.G83A						.						4.0	6.0	5.0					1																	213031877		1933	3871	5804	SO:0001583	missense	28982	exon1			CGAGGGGCGCGCC	AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.83G>A	chr1.hg19:g.213031877G>A	ENSP00000355938:p.Gly28Asp	75.0	0.0		117.0	58.0	NM_014053	Q1HE16|Q86XY9|Q9NVR9	Missense_Mutation	SNP	ENST00000366971.4	hg19	CCDS1510.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222810	0.39300	.	.	ENSG00000162769	ENST00000366971	D	0.81739	-1.53	4.74	-9.48	0.00591	.	1.441100	0.04630	N	0.403573	T	0.51991	0.1707	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44174	-0.9345	10	0.10636	T	0.68	-10.7686	4.3548	0.11172	0.1266:0.217:0.5344:0.122	.	28	Q9Y5Y0	FLVC1_HUMAN	D	28	ENSP00000355938:G28D	ENSP00000355938:G28D	G	+	2	0	FLVCR1	211098500	0.000000	0.05858	0.000000	0.03702	0.603000	0.37013	-0.361000	0.07612	-1.710000	0.01397	0.563000	0.77884	GGC	.	.		0.736	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	NM_014053	
CNST	163882	hgsc.bcm.edu	37	1	246811256	246811256	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr1:246811256T>A	ENST00000366513.4	+	9	2022	c.1753T>A	c.(1753-1755)Tcc>Acc	p.S585T	CNST_ENST00000366512.3_Missense_Mutation_p.S585T|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	585					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						TGAAGAAGCATCCTATAGTCT	0.413																																					p.S585T		Atlas-SNP	.											.	CNST	73	.	0			c.T1753A						.						103.0	108.0	106.0					1																	246811256		2203	4300	6503	SO:0001583	missense	163882	exon9			GAAGCATCCTATA	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1753T>A	chr1.hg19:g.246811256T>A	ENSP00000355470:p.Ser585Thr	186.0	0.0		277.0	56.0	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	hg19	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.851342	0.71719	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.30182	1.95;1.54	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000002	T	0.54631	0.1870	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.98;0.995	T	0.59500	-0.7443	10	0.87932	D	0	-10.1401	11.0358	0.47799	0.0:0.0727:0.0:0.9273	.	585;585	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	T	585	ENSP00000355470:S585T;ENSP00000355469:S585T	ENSP00000355469:S585T	S	+	1	0	CNST	244877879	0.998000	0.40836	0.944000	0.38274	0.578000	0.36192	3.528000	0.53524	2.220000	0.72140	0.383000	0.25322	TCC	.	.		0.413	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
TTN	7273	hgsc.bcm.edu	37	2	179413257	179413257	+	Silent	SNP	A	A	G			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr2:179413257A>G	ENST00000591111.1	-	289	88397	c.88173T>C	c.(88171-88173)tcT>tcC	p.S29391S	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Silent_p.S28464S|TTN_ENST00000342175.6_Silent_p.S22159S|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Silent_p.S22092S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Silent_p.S21967S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.S31032S|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29391	Fibronectin type-III 114. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAATGTAGCAGATCCCCGGG	0.502																																					p.S31032S		Atlas-SNP	.											.	TTN	18412	.	0			c.T93096C						.						175.0	172.0	173.0					2																	179413257		1945	4155	6100	SO:0001819	synonymous_variant	7273	exon339			TGTAGCAGATCCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.88173T>C	chr2.hg19:g.179413257A>G		113.0	0.0		135.0	50.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	146.0	1.0		189.0	109.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CISH	1154	hgsc.bcm.edu	37	3	50645253	50645253	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr3:50645253T>C	ENST00000348721.3	-	3	742	c.562A>G	c.(562-564)Aag>Gag	p.K188E	CISH_ENST00000443053.2_Missense_Mutation_p.K205E	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	188					intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCATCCTCCTTAGGCATAGGC	0.617																																					p.K205E		Atlas-SNP	.											.	CISH	27	.	0			c.A613G						.						64.0	63.0	63.0					3																	50645253		2203	4300	6503	SO:0001583	missense	1154	exon4			CCTCCTTAGGCAT	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.562A>G	chr3.hg19:g.50645253T>C	ENSP00000294173:p.Lys188Glu	86.0	0.0		113.0	41.0	NM_013324	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	ENST00000348721.3	hg19	CCDS2831.1	.	.	.	.	.	.	.	.	.	.	T	8.738	0.918390	0.17982	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.44482	0.92;0.95	5.38	5.38	0.77491	SH2 motif (1);	0.527887	0.22366	N	0.061006	T	0.40247	0.1109	L	0.59436	1.845	0.39548	D	0.968932	P;P	0.48230	0.907;0.85	P;B	0.45099	0.469;0.214	T	0.28106	-1.0054	10	0.10377	T	0.69	-12.4336	11.5189	0.50539	0.0:0.0:0.1902:0.8098	.	205;188	G5E9R1;Q9NSE2	.;CISH_HUMAN	E	205;188	ENSP00000409346:K205E;ENSP00000294173:K188E	ENSP00000294173:K188E	K	-	1	0	CISH	50620257	0.655000	0.27376	0.915000	0.36163	0.112000	0.19704	2.494000	0.45329	2.248000	0.74166	0.460000	0.39030	AAG	.	.		0.617	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
CACNA2D3	55799	hgsc.bcm.edu	37	3	54930804	54930804	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr3:54930804A>T	ENST00000474759.1	+	26	2323	c.2275A>T	c.(2275-2277)Aac>Tac	p.N759Y	CACNA2D3_ENST00000288197.5_Missense_Mutation_p.N759Y|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.N759Y|CACNA2D3-AS1_ENST00000471265.1_RNA|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.N665Y	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	759						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	CGACAAGGAGAACATTTTTAA	0.522																																					p.N759Y		Atlas-SNP	.											.	CACNA2D3	159	.	0			c.A2275T						.						136.0	138.0	137.0					3																	54930804		1991	4154	6145	SO:0001583	missense	55799	exon26			AAGGAGAACATTT	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2275A>T	chr3.hg19:g.54930804A>T	ENSP00000419101:p.Asn759Tyr	113.0	0.0		142.0	38.0	NM_018398	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	hg19	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243099	0.79912	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.69	5.69	0.88448	.	0.288637	0.41194	D	0.000921	T	0.31765	0.0807	L	0.27053	0.805	0.44523	D	0.997479	D	0.54397	0.966	P	0.49708	0.62	T	0.05903	-1.0857	10	0.59425	D	0.04	.	14.4892	0.67639	1.0:0.0:0.0:0.0	.	759	Q8IZS8	CA2D3_HUMAN	Y	759;759;759;665;665	ENSP00000389506:N759Y;ENSP00000419101:N759Y;ENSP00000288197:N759Y;ENSP00000417279:N665Y	ENSP00000288197:N759Y	N	+	1	0	CACNA2D3	54905844	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.847000	0.75404	2.291000	0.77112	0.533000	0.62120	AAC	.	.		0.522	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
OR5H1	26341	hgsc.bcm.edu	37	3	97851822	97851822	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr3:97851822T>A	ENST00000354565.2	+	1	281	c.281T>A	c.(280-282)cTc>cAc	p.L94H	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						ATGATATCTCTCTCTGAATGC	0.398																																					p.L94H		Atlas-SNP	.											.	OR5H1	71	.	0			c.T281A						.						160.0	158.0	159.0					3																	97851822		2203	4299	6502	SO:0001583	missense	26341	exon1			TATCTCTCTCTGA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.281T>A	chr3.hg19:g.97851822T>A	ENSP00000346575:p.Leu94His	372.0	0.0		277.0	106.0	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	hg19	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	T	8.713	0.912557	0.17907	.	.	ENSG00000231192	ENST00000354565	T	0.00488	7.04	3.57	2.36	0.29203	GPCR, rhodopsin-like superfamily (1);	1.009930	0.07969	N	0.983766	T	0.00754	0.0025	L	0.58969	1.84	0.09310	N	1	D	0.53745	0.962	P	0.52823	0.71	T	0.55042	-0.8202	10	0.59425	D	0.04	.	7.1495	0.25601	0.2006:0.0:0.0:0.7994	.	94	A6NKK0	OR5H1_HUMAN	H	94	ENSP00000346575:L94H	ENSP00000346575:L94H	L	+	2	0	OR5H1	99334512	0.000000	0.05858	0.059000	0.19551	0.036000	0.12997	0.779000	0.26746	0.415000	0.25817	0.164000	0.16699	CTC	.	.		0.398	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
ACAP2	23527	hgsc.bcm.edu	37	3	195017930	195017930	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr3:195017930T>A	ENST00000326793.6	-	16	1706	c.1476A>T	c.(1474-1476)caA>caT	p.Q492H		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	492	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TTTGTCCTGGTTGGGGTTTCT	0.313																																					p.Q492H		Atlas-SNP	.											.	ACAP2	72	.	0			c.A1476T						.						159.0	160.0	160.0					3																	195017930		2203	4296	6499	SO:0001583	missense	23527	exon16			TCCTGGTTGGGGT		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1476A>T	chr3.hg19:g.195017930T>A	ENSP00000324287:p.Gln492His	66.0	0.0		46.0	14.0	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	hg19	CCDS33924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.89|12.89	2.073147|2.073147	0.36566|0.36566	.|.	.|.	ENSG00000114331|ENSG00000114331	ENST00000326793|ENST00000450200	T|.	0.43688|.	0.94|.	5.29|5.29	-1.05|-1.05	0.10036|0.10036	.|.	0.155495|.	0.64402|.	N|.	0.000015|.	T|T	0.38665|0.38665	0.1049|0.1049	L|L	0.35542|0.35542	1.07|1.07	0.43782|0.43782	D|D	0.996315|0.996315	P|.	0.45715|.	0.865|.	P|.	0.53954|.	0.738|.	T|T	0.16305|0.16305	-1.0407|-1.0407	10|5	0.36615|.	T|.	0.2|.	.|.	3.5872|3.5872	0.07975|0.07975	0.2846:0.362:0.0:0.3534|0.2846:0.362:0.0:0.3534	.|.	492|.	Q15057|.	ACAP2_HUMAN|.	H|S	492|51	ENSP00000324287:Q492H|.	ENSP00000324287:Q492H|.	Q|T	-|-	3|1	2|0	ACAP2|ACAP2	196499219|196499219	0.918000|0.918000	0.31147|0.31147	0.998000|0.998000	0.56505|0.56505	0.992000|0.992000	0.81027|0.81027	-0.002000|-0.002000	0.12924|0.12924	-0.014000|-0.014000	0.14175|0.14175	-0.309000|-0.309000	0.09137|0.09137	CAA|ACC	.	.		0.313	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	
CYP2U1	113612	hgsc.bcm.edu	37	4	108866371	108866371	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr4:108866371A>G	ENST00000332884.6	+	2	1011	c.736A>G	c.(736-738)Agt>Ggt	p.S246G	RP11-286E11.1_ENST00000513071.1_RNA|CYP2U1_ENST00000508453.1_Missense_Mutation_p.S37G	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	246					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		TTACACTAATAGTGAGTTCAA	0.458																																					p.S246G		Atlas-SNP	.											.	CYP2U1	20	.	0			c.A736G						.						129.0	128.0	128.0					4																	108866371		2203	4300	6503	SO:0001583	missense	113612	exon2			ACTAATAGTGAGT	BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.736A>G	chr4.hg19:g.108866371A>G	ENSP00000333212:p.Ser246Gly	152.0	0.0		115.0	54.0	NM_183075	B2RMV7|Q96EQ6	Missense_Mutation	SNP	ENST00000332884.6	hg19	CCDS34047.1	.	.	.	.	.	.	.	.	.	.	A	11.44	1.640345	0.29157	.	.	ENSG00000155016	ENST00000332884;ENST00000424249;ENST00000508453	T;T	0.78924	-1.22;-1.22	5.63	3.26	0.37387	.	0.767472	0.13384	N	0.391874	T	0.61540	0.2355	N	0.17564	0.495	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.51663	-0.8677	10	0.41790	T	0.15	.	8.5967	0.33721	0.786:0.0:0.214:0.0	.	246	Q7Z449	CP2U1_HUMAN	G	246;203;37	ENSP00000333212:S246G;ENSP00000423667:S37G	ENSP00000333212:S246G	S	+	1	0	CYP2U1	109085820	0.000000	0.05858	0.606000	0.28943	0.943000	0.58893	0.395000	0.20850	0.975000	0.38392	0.533000	0.62120	AGT	.	.		0.458	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363691.2	NM_183075	
CYP2U1	113612	hgsc.bcm.edu	37	4	108866384	108866384	+	Missense_Mutation	SNP	A	A	C	rs200772412		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr4:108866384A>C	ENST00000332884.6	+	2	1024	c.749A>C	c.(748-750)aAa>aCa	p.K250T	RP11-286E11.1_ENST00000513071.1_RNA|CYP2U1_ENST00000508453.1_Missense_Mutation_p.K41T	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	250					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		GAGTTCAAGAAAATGCTTGGT	0.453																																					p.K250T		Atlas-SNP	.											.	CYP2U1	20	.	0			c.A749C						.						127.0	126.0	127.0					4																	108866384		2203	4300	6503	SO:0001583	missense	113612	exon2			TCAAGAAAATGCT	BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.749A>C	chr4.hg19:g.108866384A>C	ENSP00000333212:p.Lys250Thr	162.0	0.0		122.0	55.0	NM_183075	B2RMV7|Q96EQ6	Missense_Mutation	SNP	ENST00000332884.6	hg19	CCDS34047.1	.	.	.	.	.	.	.	.	.	.	A	8.895	0.955024	0.18507	.	.	ENSG00000155016	ENST00000332884;ENST00000424249;ENST00000508453	T;T	0.68765	-0.35;-0.35	5.63	3.15	0.36227	.	0.562750	0.21143	N	0.079450	T	0.42040	0.1185	N	0.16790	0.44	0.30712	N	0.749181	B	0.06786	0.001	B	0.16722	0.016	T	0.34129	-0.9841	10	0.07030	T	0.85	.	6.0234	0.19642	0.6052:0.2407:0.154:0.0	.	250	Q7Z449	CP2U1_HUMAN	T	250;207;41	ENSP00000333212:K250T;ENSP00000423667:K41T	ENSP00000333212:K250T	K	+	2	0	CYP2U1	109085833	0.011000	0.17503	0.941000	0.38009	0.654000	0.38779	0.206000	0.17375	0.404000	0.25506	0.533000	0.62120	AAA	.	.		0.453	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363691.2	NM_183075	
MCC	4163	hgsc.bcm.edu	37	5	112720863	112720863	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr5:112720863C>A	ENST00000408903.3	-	2	632	c.217G>T	c.(217-219)Gtg>Ttg	p.V73L	CTD-2201G3.1_ENST00000416046.2_RNA	NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ATCTCAGCCACAGACTCTTCC	0.428																																					p.V73L		Atlas-SNP	.											.	MCC	234	.	0			c.G217T						.						126.0	115.0	118.0					5																	112720863		1902	4119	6021	SO:0001583	missense	4163	exon2			CAGCCACAGACTC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.217G>T	chr5.hg19:g.112720863C>A	ENSP00000386227:p.Val73Leu	159.0	0.0		138.0	44.0	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000408903.3	hg19	CCDS43351.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974349	0.34848	.	.	ENSG00000171444	ENST00000408903	T	0.68765	-0.35	4.7	3.81	0.43845	.	0.128024	0.31809	N	0.007034	T	0.53769	0.1817	.	.	.	0.33285	D	0.562819	B	0.23128	0.08	B	0.18561	0.022	T	0.59716	-0.7402	9	0.27082	T	0.32	-3.3795	13.646	0.62281	0.1565:0.8435:0.0:0.0	.	73	P23508-2	.	L	73	ENSP00000386227:V73L	ENSP00000386227:V73L	V	-	1	0	MCC	112748762	1.000000	0.71417	0.993000	0.49108	0.818000	0.46254	5.417000	0.66423	1.267000	0.44247	-0.188000	0.12872	GTG	.	.		0.428	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
CDHR2	54825	hgsc.bcm.edu	37	5	176002561	176002561	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr5:176002561C>T	ENST00000510636.1	+	10	1097	c.823C>T	c.(823-825)Cct>Tct	p.P275S	CDHR2_ENST00000506348.1_Missense_Mutation_p.P275S|CDHR2_ENST00000261944.5_Missense_Mutation_p.P275S	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	275	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CATCAATGACCCTGTGATCTA	0.647																																					p.P275S		Atlas-SNP	.											.	CDHR2	152	.	0			c.C823T						.						98.0	102.0	100.0					5																	176002561		2203	4300	6503	SO:0001583	missense	54825	exon10			AATGACCCTGTGA	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.823C>T	chr5.hg19:g.176002561C>T	ENSP00000424565:p.Pro275Ser	103.0	0.0		75.0	35.0	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.795427	0.00617	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.47528	0.84;0.84;0.84	4.27	0.0758	0.14400	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.29158	0.0725	N	0.25426	0.745	0.09310	N	1	B	0.18968	0.032	B	0.24394	0.053	T	0.31081	-0.9956	9	0.09338	T	0.73	6.0787	7.7866	0.29095	0.3596:0.2647:0.3757:0.0	.	275	Q9BYE9	CDHR2_HUMAN	S	275	ENSP00000424565:P275S;ENSP00000261944:P275S;ENSP00000421078:P275S	ENSP00000261944:P275S	P	+	1	0	CDHR2	175935167	0.000000	0.05858	0.007000	0.13788	0.081000	0.17604	-0.690000	0.05138	-0.209000	0.10156	-1.396000	0.01147	CCT	.	.		0.647	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
OR2B3	442184	hgsc.bcm.edu	37	6	29054623	29054623	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr6:29054623T>C	ENST00000377173.2	-	1	467	c.403A>G	c.(403-405)Atc>Gtc	p.I135V		NM_001005226.2	NP_001005226.1	O76000	OR2B3_HUMAN	olfactory receptor, family 2, subfamily B, member 3	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|lung(17)|prostate(1)|skin(2)	24						TAATTCATGATGACTACATAG	0.488																																					p.I135V		Atlas-SNP	.											.	OR2B3	44	.	0			c.A403G						.						72.0	70.0	70.0					6																	29054623		2203	4300	6503	SO:0001583	missense	442184	exon1			TCATGATGACTAC		CCDS34358.1	6p22.2-p21.31	2012-08-09	2008-10-22	2008-10-22	ENSG00000204703	ENSG00000204703		"""GPCR / Class A : Olfactory receptors"""	8238	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 3 pseudogene"""	OR2B3P			Standard	NM_001005226		Approved	OR6-4	uc003nlx.3	O76000	OTTHUMG00000031226	ENST00000377173.2:c.403A>G	chr6.hg19:g.29054623T>C	ENSP00000366378:p.Ile135Val	109.0	0.0		106.0	41.0	NM_001005226	B0UYQ1|Q5ST41|Q96R13	Missense_Mutation	SNP	ENST00000377173.2	hg19	CCDS34358.1	.	.	.	.	.	.	.	.	.	.	T	11.27	1.589048	0.28357	.	.	ENSG00000204703	ENST00000377173	T	0.19669	2.13	3.9	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	U	0.000980	T	0.06872	0.0175	L	0.41824	1.3	0.22305	N	0.99921	B	0.12630	0.006	B	0.14578	0.011	T	0.19224	-1.0312	10	0.46703	T	0.11	.	8.9749	0.35930	0.0:0.0:0.3722:0.6278	.	135	O76000	OR2B3_HUMAN	V	135	ENSP00000366378:I135V	ENSP00000366378:I135V	I	-	1	0	OR2B3	29162602	0.000000	0.05858	1.000000	0.80357	0.955000	0.61496	-0.042000	0.12063	1.385000	0.46445	0.472000	0.43445	ATC	.	.		0.488	OR2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076469.2		
STK19	8859	hgsc.bcm.edu	37	6	31948260	31948260	+	Missense_Mutation	SNP	G	G	T	rs534517982		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr6:31948260G>T	ENST00000375333.2	+	6	901	c.848G>T	c.(847-849)cGa>cTa	p.R283L	C4A_ENST00000498271.1_5'Flank|C4A_ENST00000428956.2_5'Flank|STK19_ENST00000375331.2_Missense_Mutation_p.R279L|C4A_ENST00000537134.1_5'Flank	NM_032454.1	NP_115830.1	P49842	STK19_HUMAN	serine/threonine kinase 19	283					protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			skin(5)|upper_aerodigestive_tract(2)	7						CTCACCGTCCGAGATGCTGGG	0.567																																					p.R283L		Atlas-SNP	.											STK19_ENST00000375333,right_upper_lobe,carcinoma,0,1	STK19	33	.	0			c.G848T						.						71.0	62.0	65.0					6																	31948260		1511	2709	4220	SO:0001583	missense	8859	exon6			CCGTCCGAGATGC	X77474	CCDS4733.1, CCDS34417.1	6p21.33	2011-09-15			ENSG00000204344	ENSG00000204344			11398	protein-coding gene	gene with protein product		604977				8012361, 9812991	Standard	NM_032454		Approved	D6S60, G11, RP1	uc003nyv.3	P49842	OTTHUMG00000166424	ENST00000375333.2:c.848G>T	chr6.hg19:g.31948260G>T	ENSP00000364482:p.Arg283Leu	108.0	0.0		64.0	3.0	NM_032454	A6NF95|A6NFW8|B0QZR5|Q13159|Q31617|Q5JP77|Q5ST72|Q5ST75	Missense_Mutation	SNP	ENST00000375333.2	hg19	CCDS4733.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946040	0.92593	.	.	ENSG00000204344	ENST00000375331;ENST00000375333	T;T	0.30448	1.53;1.53	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.42653	0.1212	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.998	D;D;D;D	0.91635	0.999;0.965;0.999;0.97	T	0.12142	-1.0559	10	0.30078	T	0.28	-10.3514	17.2166	0.86946	0.0:0.0:1.0:0.0	.	236;279;283;236	C9IZ87;P49842-2;P49842;B7ZLI8	.;.;STK19_HUMAN;.	L	279;283	ENSP00000364480:R279L;ENSP00000364482:R283L	ENSP00000364480:R279L	R	+	2	0	STK19	32056239	1.000000	0.71417	0.990000	0.47175	0.926000	0.56050	8.148000	0.89630	2.364000	0.80123	0.555000	0.69702	CGA	.	.		0.567	STK19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076484.3		
HS3ST5	222537	hgsc.bcm.edu	37	6	114378489	114378489	+	Missense_Mutation	SNP	G	G	A	rs374141405		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr6:114378489G>A	ENST00000312719.5	-	5	2161	c.973C>T	c.(973-975)Cgc>Tgc	p.R325C	RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA|HS3ST5_ENST00000411826.1_Missense_Mutation_p.R325C			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	325					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		AAGAATTTGCGCAATTTAGTA	0.408																																					p.R325C		Atlas-SNP	.											HS3ST5,NS,carcinoma,0,2	HS3ST5	80	.	0			c.C973T						.	G	CYS/ARG	1,4405	4.2+/-10.8	0,1,2202	64.0	68.0	66.0		973	6.0	1.0	6		66	1,8597	1.2+/-3.3	0,1,4298	no	missense	HS3ST5	NM_153612.3	180	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	benign	325/347	114378489	2,13002	2203	4299	6502	SO:0001583	missense	222537	exon2			ATTTGCGCAATTT	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.973C>T	chr6.hg19:g.114378489G>A	ENSP00000427888:p.Arg325Cys	136.0	0.0		99.0	41.0	NM_153612	A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	ENST00000312719.5	hg19	CCDS34517.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722416	0.48728	2.27E-4	1.16E-4	ENSG00000249853	ENST00000312719;ENST00000411826	D;D	0.82803	-1.65;-1.65	6.02	6.02	0.97574	Sulfotransferase domain (1);	0.108901	0.64402	D	0.000004	D	0.83031	0.5166	M	0.63208	1.945	0.80722	D	1	D	0.69078	0.997	P	0.49252	0.604	T	0.81752	-0.0789	10	0.41790	T	0.15	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	325	Q8IZT8	HS3S5_HUMAN	C	325	ENSP00000427888:R325C;ENSP00000440332:R325C	ENSP00000427888:R325C	R	-	1	0	HS3ST5	114485182	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.618000	0.83043	2.865000	0.98341	0.655000	0.94253	CGC	.	.		0.408	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612	
LAMA2	3908	hgsc.bcm.edu	37	6	129663536	129663536	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr6:129663536G>C	ENST00000421865.2	+	30	4409	c.4360G>C	c.(4360-4362)Gga>Cga	p.G1454R		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1454	Laminin EGF-like 15. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATGTGCTCTTGGATACTATGG	0.378																																					p.G1454R		Atlas-SNP	.											.	LAMA2	481	.	0			c.G4360C						.						163.0	151.0	155.0					6																	129663536		2203	4300	6503	SO:0001583	missense	3908	exon30			GCTCTTGGATACT	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4360G>C	chr6.hg19:g.129663536G>C	ENSP00000400365:p.Gly1454Arg	103.0	0.0		90.0	36.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	hg19	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799841	0.90538	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.66638	-0.22	5.57	5.57	0.84162	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.87888	0.6291	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.993	D	0.91403	0.5145	10	0.87932	D	0	.	18.6919	0.91586	0.0:0.0:1.0:0.0	.	1454;1454	A6NF00;P24043	.;LAMA2_HUMAN	R	1454	ENSP00000400365:G1454R	ENSP00000346769:G1454R	G	+	1	0	LAMA2	129705229	1.000000	0.71417	0.976000	0.42696	0.999000	0.98932	8.479000	0.90431	2.785000	0.95823	0.655000	0.94253	GGA	.	.		0.378	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
FAM126A	84668	hgsc.bcm.edu	37	7	22985753	22985753	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr7:22985753G>C	ENST00000432176.2	-	11	1253	c.1021C>G	c.(1021-1023)Ctg>Gtg	p.L341V	FAM126A_ENST00000409923.1_3'UTR|FAM126A_ENST00000498833.1_5'UTR	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	341					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						ATCTCCATCAGTTCTTCTTGA	0.338																																					p.L341V		Atlas-SNP	.											.	FAM126A	53	.	0			c.C1021G						.						50.0	52.0	51.0					7																	22985753		2203	4295	6498	SO:0001583	missense	84668	exon11			CCATCAGTTCTTC	BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.1021C>G	chr7.hg19:g.22985753G>C	ENSP00000403396:p.Leu341Val	84.0	0.0		76.0	4.0	NM_032581	A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Missense_Mutation	SNP	ENST00000432176.2	hg19	CCDS5377.1	.	.	.	.	.	.	.	.	.	.	G	0.323	-0.960826	0.02249	.	.	ENSG00000122591	ENST00000432176	T	0.78364	-1.17	6.17	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.69477	0.3115	L	0.59436	1.845	0.80722	D	1	B	0.21606	0.058	B	0.20184	0.028	T	0.59867	-0.7373	10	0.12103	T	0.63	-1.4832	9.1636	0.37038	0.1303:0.1215:0.7482:0.0	.	341	Q9BYI3	HYCCI_HUMAN	V	341	ENSP00000403396:L341V	ENSP00000403396:L341V	L	-	1	2	FAM126A	22952278	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.730000	0.55006	0.955000	0.37878	0.655000	0.94253	CTG	.	.		0.338	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250230.1	NM_032581	
PLXNA4	91584	hgsc.bcm.edu	37	7	132192343	132192343	+	Silent	SNP	C	C	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr7:132192343C>A	ENST00000359827.3	-	2	2072	c.1110G>T	c.(1108-1110)cgG>cgT	p.R370R	PLXNA4_ENST00000423507.2_Silent_p.R370R|PLXNA4_ENST00000378539.5_Silent_p.R370R|PLXNA4_ENST00000321063.4_Silent_p.R370R			Q9HCM2	PLXA4_HUMAN	plexin A4	370	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AAGACTGCAGCCGCTCCTTAA	0.587																																					p.R370R		Atlas-SNP	.											.	PLXNA4	873	.	0			c.G1110T						.						65.0	57.0	60.0					7																	132192343		2203	4300	6503	SO:0001819	synonymous_variant	91584	exon2			CTGCAGCCGCTCC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1110G>T	chr7.hg19:g.132192343C>A		80.0	0.0		62.0	19.0	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	hg19	CCDS43646.1																																																																																			.	.		0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CSMD3	114788	hgsc.bcm.edu	37	8	113331084	113331084	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr8:113331084C>A	ENST00000297405.5	-	47	7586	c.7342G>T	c.(7342-7344)Gca>Tca	p.A2448S	CSMD3_ENST00000343508.3_Missense_Mutation_p.A2408S|CSMD3_ENST00000352409.3_Missense_Mutation_p.A2378S|CSMD3_ENST00000455883.2_Missense_Mutation_p.A2344S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2448	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACTGGAGGTGCTCCATCCATC	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.A2448S		Atlas-SNP	.											.	CSMD3	2325	.	0			c.G7342T						.						105.0	95.0	98.0					8																	113331084		2203	4300	6503	SO:0001583	missense	114788	exon47			GAGGTGCTCCATC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7342G>T	chr8.hg19:g.113331084C>A	ENSP00000297405:p.Ala2448Ser	44.0	0.0		61.0	12.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982361	0.34942	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	5.82	4.94	0.65067	Complement control module (2);Sushi/SCR/CCP (3);	0.165679	0.40818	N	0.001003	T	0.27967	0.0689	N	0.01003	-1.06	0.30476	N	0.772834	B;B;B	0.14012	0.009;0.005;0.005	B;B;B	0.16289	0.013;0.014;0.015	T	0.21655	-1.0239	10	0.05721	T	0.95	.	11.9201	0.52787	0.1373:0.7306:0.132:0.0	.	2344;2448;2408	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	2408;2448;1718;2344;2378	ENSP00000345799:A2408S;ENSP00000297405:A2448S;ENSP00000341558:A1718S;ENSP00000412263:A2344S;ENSP00000343124:A2378S	ENSP00000297405:A2448S	A	-	1	0	CSMD3	113400260	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.851000	0.48302	1.464000	0.47987	0.579000	0.79373	GCA	.	.		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu	37	8	113331118	113331118	+	Silent	SNP	C	C	A	rs371684642		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr8:113331118C>A	ENST00000297405.5	-	47	7552	c.7308G>T	c.(7306-7308)acG>acT	p.T2436T	CSMD3_ENST00000343508.3_Silent_p.T2396T|CSMD3_ENST00000352409.3_Silent_p.T2366T|CSMD3_ENST00000455883.2_Silent_p.T2332T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2436	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T2436T(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTAATCTGCACGTCAGAATTG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T2436T		Atlas-SNP	.											CSMD3,rectum,carcinoma,0,1	CSMD3	2325	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7308T						.						108.0	100.0	103.0					8																	113331118		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon47			TCTGCACGTCAGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7308G>T	chr8.hg19:g.113331118C>A		54.0	0.0		68.0	15.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ACTL7A	10881	hgsc.bcm.edu	37	9	111625852	111625852	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr9:111625852T>A	ENST00000333999.3	+	1	1250	c.1250T>A	c.(1249-1251)gTc>gAc	p.V417D		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	417						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCATTGTGGGTCCACCGCTTT	0.572																																					p.V417D	Esophageal Squamous(177;1480 3591 17554)	Atlas-SNP	.											.	ACTL7A	34	.	0			c.T1250A						.						85.0	74.0	78.0					9																	111625852		2203	4300	6503	SO:0001583	missense	10881	exon1			TGTGGGTCCACCG	BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.1250T>A	chr9.hg19:g.111625852T>A	ENSP00000334300:p.Val417Asp	127.0	0.0		101.0	40.0	NM_006687	B2RC83|Q5JSV0	Missense_Mutation	SNP	ENST00000333999.3	hg19	CCDS6772.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185182	0.78677	.	.	ENSG00000187003	ENST00000333999	D	0.96136	-3.92	5.44	5.44	0.79542	.	0.000000	0.41938	D	0.000782	D	0.98194	0.9403	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99264	1.0891	10	0.87932	D	0	.	13.7503	0.62904	0.0:0.0:0.0:1.0	.	417	Q9Y615	ACL7A_HUMAN	D	417	ENSP00000334300:V417D	ENSP00000334300:V417D	V	+	2	0	ACTL7A	110665673	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.018000	0.88722	2.193000	0.70182	0.533000	0.62120	GTC	.	.		0.572	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053570.1	NM_006687	
CHST3	9469	hgsc.bcm.edu	37	10	73767947	73767947	+	Silent	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr10:73767947C>T	ENST00000373115.4	+	3	1595	c.1158C>T	c.(1156-1158)taC>taT	p.Y386Y		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	386					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						GCGAGATGTACCGCTTCGCCG	0.692																																					p.Y386Y		Atlas-SNP	.											.	CHST3	36	.	0			c.C1158T						.						10.0	11.0	10.0					10																	73767947		2087	4085	6172	SO:0001819	synonymous_variant	9469	exon3			GATGTACCGCTTC	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1158C>T	chr10.hg19:g.73767947C>T		168.0	0.0		117.0	48.0	NM_004273	O75099|Q52M30	Silent	SNP	ENST00000373115.4	hg19	CCDS7312.1																																																																																			.	.		0.692	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
ABCC2	1244	hgsc.bcm.edu	37	10	101601846	101601846	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr10:101601846T>A	ENST00000370449.4	+	26	3850	c.3737T>A	c.(3736-3738)cTc>cAc	p.L1246H		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1246	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TCCAATGCACTCAATGTGAGT	0.418																																					p.L1246H		Atlas-SNP	.											.	ABCC2	160	.	0			c.T3737A						.						235.0	220.0	225.0					10																	101601846		2203	4300	6503	SO:0001583	missense	1244	exon26			ATGCACTCAATGT	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3737T>A	chr10.hg19:g.101601846T>A	ENSP00000359478:p.Leu1246His	76.0	0.0		63.0	28.0	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	hg19	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410000	0.83340	.	.	ENSG00000023839	ENST00000370449	D	0.90444	-2.67	6.16	5.03	0.67393	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.241597	0.41294	D	0.000910	D	0.97222	0.9092	H	0.98965	4.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97485	1.0050	10	0.87932	D	0	-16.1753	12.1862	0.54241	0.0:0.0661:0.0:0.9339	.	1246	Q92887	MRP2_HUMAN	H	1246	ENSP00000359478:L1246H	ENSP00000359478:L1246H	L	+	2	0	ABCC2	101591836	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.684000	0.84104	1.146000	0.42352	0.528000	0.53228	CTC	.	.		0.418	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
KCNA4	3739	hgsc.bcm.edu	37	11	30033717	30033717	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr11:30033717C>T	ENST00000328224.6	-	2	1742	c.509G>A	c.(508-510)cGc>cAc	p.R170H	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	170					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GTCACTGTAGCGGACTGAACT	0.502																																					p.R170H		Atlas-SNP	.											KCNA4,NS,carcinoma,0,1	KCNA4	158	.	0			c.G509A						.						65.0	65.0	65.0					11																	30033717		2153	4253	6406	SO:0001583	missense	3739	exon2			CTGTAGCGGACTG	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.509G>A	chr11.hg19:g.30033717C>T	ENSP00000328511:p.Arg170His	67.0	1.0		66.0	26.0	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	hg19	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557223	0.65425	.	.	ENSG00000182255	ENST00000328224	D	0.96940	-4.18	4.66	4.66	0.58398	.	0.133902	0.45126	U	0.000393	D	0.92724	0.7687	N	0.14661	0.345	0.45747	D	0.998647	D	0.60575	0.988	P	0.49799	0.622	D	0.91051	0.4878	10	0.13108	T	0.6	.	15.7518	0.77992	0.0:1.0:0.0:0.0	.	170	P22459	KCNA4_HUMAN	H	170	ENSP00000328511:R170H	ENSP00000328511:R170H	R	-	2	0	KCNA4	29990293	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.447000	0.60020	2.145000	0.66743	0.561000	0.74099	CGC	.	.		0.502	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
AHNAK	79026	hgsc.bcm.edu	37	11	62291321	62291321	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr11:62291321T>A	ENST00000378024.4	-	5	10842	c.10568A>T	c.(10567-10569)gAg>gTg	p.E3523V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3523					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CAAGCCTCCCTCCGGACCTTC	0.483																																					p.E3523V		Atlas-SNP	.											.	AHNAK	532	.	0			c.A10568T						.						107.0	114.0	111.0					11																	62291321		2202	4299	6501	SO:0001583	missense	79026	exon5			CCTCCCTCCGGAC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.10568A>T	chr11.hg19:g.62291321T>A	ENSP00000367263:p.Glu3523Val	79.0	0.0		75.0	27.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	19.65	3.866916	0.72065	.	.	ENSG00000124942	ENST00000378024	T	0.01133	5.29	4.65	4.65	0.58169	.	0.328463	0.31177	N	0.008104	T	0.04724	0.0128	M	0.81497	2.545	0.43632	D	0.996028	D	0.57571	0.98	P	0.53649	0.731	T	0.29243	-1.0018	10	0.54805	T	0.06	.	13.765	0.62990	0.0:0.0:0.0:1.0	.	3523	Q09666	AHNK_HUMAN	V	3523	ENSP00000367263:E3523V	ENSP00000367263:E3523V	E	-	2	0	AHNAK	62047897	0.750000	0.28316	0.828000	0.32881	0.843000	0.47879	1.933000	0.40153	1.744000	0.51775	0.372000	0.22366	GAG	.	.		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43821122	43821122	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr12:43821122T>A	ENST00000389420.3	-	27	4095	c.4096A>T	c.(4096-4098)Aat>Tat	p.N1366Y	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.N484Y|ADAMTS20_ENST00000553158.1_Missense_Mutation_p.N1366Y	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1366	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTCCCCAATTTCCGTAGTTC	0.403																																					p.N1366Y		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.A4096T						.						86.0	75.0	79.0					12																	43821122		2203	4300	6503	SO:0001583	missense	80070	exon27			CCCAATTTCCGTA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4096A>T	chr12.hg19:g.43821122T>A	ENSP00000374071:p.Asn1366Tyr	122.0	0.0		105.0	26.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	13.22	2.173541	0.38413	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	4.94	2.57	0.30868	.	0.521883	0.18557	N	0.137744	T	0.63474	0.2514	M	0.88704	2.975	0.19945	N	0.999944	P;P	0.48640	0.46;0.913	B;P	0.53266	0.436;0.722	T	0.57528	-0.7796	10	0.66056	D	0.02	.	9.3942	0.38392	0.0:0.1483:0.0:0.8517	.	1366;484	P59510;E9PBD5	ATS20_HUMAN;.	Y	1366;496;484;1366;1366	ENSP00000374071:N1366Y;ENSP00000447427:N496Y;ENSP00000378911:N484Y;ENSP00000448341:N1366Y	ENSP00000374068:N1366Y	N	-	1	0	ADAMTS20	42107389	0.696000	0.27757	0.091000	0.20842	0.523000	0.34469	3.801000	0.55545	0.438000	0.26450	0.528000	0.53228	AAT	.	.		0.403	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
MED13L	23389	hgsc.bcm.edu	37	12	116443800	116443800	+	Splice_Site	SNP	T	T	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr12:116443800T>C	ENST00000281928.3	-	13	2551		c.e13-2			NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like							mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GCCGGACATCTGTAGGAAAGG	0.493																																					.		Atlas-SNP	.											.	MED13L	193	.	0			c.2345-2A>G						.						69.0	70.0	70.0					12																	116443800		2203	4300	6503	SO:0001630	splice_region_variant	23389	exon14			GACATCTGTAGGA	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.2345-2A>G	chr12.hg19:g.116443800T>C		82.0	0.0		84.0	35.0	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Splice_Site	SNP	ENST00000281928.3	hg19	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.598135	0.66332	.	.	ENSG00000123066	ENST00000281928	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5446	0.84426	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MED13L	114928183	1.000000	0.71417	0.990000	0.47175	0.944000	0.59088	6.824000	0.75288	2.311000	0.77944	0.533000	0.62120	.	.	.		0.493	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		Intron
METTL21C	196541	hgsc.bcm.edu	37	13	103346826	103346826	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr13:103346826G>A	ENST00000267273.6	-	1	28	c.23C>T	c.(22-24)gCg>gTg	p.A8V		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	8					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						AGGCTGCTGCGCGGAGCTCAG	0.577																																					p.A8V		Atlas-SNP	.											.	METTL21C	23	.	0			c.C23T						.						15.0	17.0	16.0					13																	103346826		2201	4299	6500	SO:0001583	missense	196541	exon1			TGCTGCGCGGAGC		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.23C>T	chr13.hg19:g.103346826G>A	ENSP00000267273:p.Ala8Val	42.0	0.0		36.0	13.0	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	hg19	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351210	0.24512	.	.	ENSG00000139780	ENST00000267273	T	0.14893	2.47	3.79	-1.74	0.08056	.	1.133920	0.06768	N	0.783024	T	0.05960	0.0155	N	0.03608	-0.345	0.21740	N	0.999562	B	0.09022	0.002	B	0.04013	0.001	T	0.35822	-0.9773	10	0.30854	T	0.27	0.5169	1.38	0.02228	0.1602:0.1387:0.4585:0.2427	.	8	Q5VZV1	MT21C_HUMAN	V	8	ENSP00000267273:A8V	ENSP00000267273:A8V	A	-	2	0	METTL21C	102144827	0.000000	0.05858	0.722000	0.30670	0.875000	0.50365	-0.483000	0.06536	-0.257000	0.09459	-0.300000	0.09419	GCG	.	.		0.577	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
PSMB11	122706	hgsc.bcm.edu	37	14	23511534	23511534	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr14:23511534G>T	ENST00000408907.2	+	1	159	c.100G>T	c.(100-102)Gac>Tac	p.D34Y		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	34					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		CCGGGGTTGTGACCCTCAAAC	0.642																																					p.D34Y		Atlas-SNP	.											.	PSMB11	40	.	0			c.G100T						.						59.0	70.0	66.0					14																	23511534		2129	4223	6352	SO:0001583	missense	122706	exon1			GGTTGTGACCCTC		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.100G>T	chr14.hg19:g.23511534G>T	ENSP00000386212:p.Asp34Tyr	49.0	0.0		39.0	10.0	NM_001099780		Missense_Mutation	SNP	ENST00000408907.2	hg19	CCDS41923.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611342	0.66558	.	.	ENSG00000222028	ENST00000408907	T	0.32988	1.43	5.4	4.49	0.54785	.	0.300277	0.26103	N	0.026327	T	0.33118	0.0852	M	0.62723	1.935	0.35678	D	0.813873	B	0.17038	0.02	B	0.17433	0.018	T	0.41324	-0.9515	10	0.87932	D	0	0.4639	12.6451	0.56729	0.0:0.0:0.8343:0.1657	.	34	A5LHX3	PSB11_HUMAN	Y	34	ENSP00000386212:D34Y	ENSP00000386212:D34Y	D	+	1	0	PSMB11	22581374	0.965000	0.33210	0.840000	0.33206	0.983000	0.72400	3.744000	0.55112	1.240000	0.43803	0.563000	0.77884	GAC	.	.		0.642	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408294.1	NM_001099780	
NDN	4692	hgsc.bcm.edu	37	15	23931514	23931514	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr15:23931514T>C	ENST00000331837.4	-	1	936	c.851A>G	c.(850-852)aAg>aGg	p.K284R		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	284	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGGGTCTTTCTTAAAGACCCT	0.602									Prader-Willi syndrome																												p.K284R		Atlas-SNP	.											NDN,NS,carcinoma,0,2	NDN	79	.	0			c.A851G						.						27.0	31.0	30.0					15																	23931514		2201	4299	6500	SO:0001583	missense	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	TCTTTCTTAAAGA	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.851A>G	chr15.hg19:g.23931514T>C	ENSP00000332643:p.Lys284Arg	71.0	0.0		49.0	21.0	NM_002487	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	hg19	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.827791	0.50845	.	.	ENSG00000182636	ENST00000331837	T	0.02301	4.35	3.64	3.64	0.41730	.	0.401321	0.27143	N	0.020721	T	0.02767	0.0083	L	0.41027	1.25	0.27508	N	0.951775	B	0.33345	0.409	B	0.37550	0.253	T	0.36720	-0.9736	10	0.34782	T	0.22	.	8.9497	0.35781	0.0:0.0:0.0:1.0	.	284	Q99608	NECD_HUMAN	R	284	ENSP00000332643:K284R	ENSP00000332643:K284R	K	-	2	0	NDN	21482607	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.282000	0.51693	1.888000	0.54679	0.533000	0.62120	AAG	.	.		0.602	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
NTN3	4917	hgsc.bcm.edu	37	16	2522557	2522557	+	Silent	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr16:2522557C>T	ENST00000293973.1	+	1	1058	c.855C>T	c.(853-855)tgC>tgT	p.C285C	TBC1D24_ENST00000567020.1_5'Flank|TBC1D24_ENST00000293970.5_5'Flank	NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	285	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						GCCCTGACTGCGGCCGCTGCA	0.687																																					p.C285C		Atlas-SNP	.											.	NTN3	28	.	0			c.C855T						.						22.0	25.0	24.0					16																	2522557		2177	4249	6426	SO:0001819	synonymous_variant	4917	exon1			TGACTGCGGCCGC	U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.855C>T	chr16.hg19:g.2522557C>T		83.0	0.0		71.0	31.0	NM_006181		Silent	SNP	ENST00000293973.1	hg19	CCDS10469.1																																																																																			.	.		0.687	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250812.1	NM_006181	
ASPHD1	253982	hgsc.bcm.edu	37	16	29913162	29913162	+	Silent	SNP	C	C	T	rs374797206		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr16:29913162C>T	ENST00000308748.5	+	1	1122	c.870C>T	c.(868-870)gcC>gcT	p.A290A	SEZ6L2_ENST00000350527.3_5'Flank|SEZ6L2_ENST00000537485.1_5'Flank|SEZ6L2_ENST00000346932.5_5'Flank|ASPHD1_ENST00000483405.1_Silent_p.A9A|SEZ6L2_ENST00000308713.5_5'Flank	NM_181718.3	NP_859069.2	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	290					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)	dioxygenase activity (GO:0051213)			endometrium(4)|large_intestine(2)|lung(1)|prostate(1)	8						TCGGCAATGCCGGCTTTTCCG	0.667																																					p.A290A		Atlas-SNP	.											.	ASPHD1	28	.	0			c.C870T						.	C		1,4311		0,1,2155	22.0	22.0	22.0		870	2.2	1.0	16		22	0,8442		0,0,4221	no	coding-synonymous	ASPHD1	NM_181718.3		0,1,6376	TT,TC,CC		0.0,0.0232,0.0078		290/391	29913162	1,12753	2156	4221	6377	SO:0001819	synonymous_variant	253982	exon1			CAATGCCGGCTTT	AF070642	CCDS10660.1	16p11.2	2008-02-05			ENSG00000174939	ENSG00000174939			27380	protein-coding gene	gene with protein product							Standard	NM_181718		Approved		uc002dut.3	Q5U4P2	OTTHUMG00000132121	ENST00000308748.5:c.870C>T	chr16.hg19:g.29913162C>T		63.0	0.0		70.0	30.0	NM_181718	A0AVE3|B7ZLZ3|Q8IW63|Q8N316|Q96H00	Silent	SNP	ENST00000308748.5	hg19	CCDS10660.1																																																																																			.	.		0.667	ASPHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255163.2	NM_181718	
LONP2	83752	hgsc.bcm.edu	37	16	48385505	48385505	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr16:48385505A>C	ENST00000285737.4	+	15	2444	c.2351A>C	c.(2350-2352)aAa>aCa	p.K784T	LONP2_ENST00000535754.1_Missense_Mutation_p.K740T|LONP2_ENST00000564259.1_3'UTR	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GGTGGAATTAAAGACAAAGTG	0.448																																					p.K784T		Atlas-SNP	.											.	LONP2	63	.	0			c.A2351C						.						54.0	57.0	56.0					16																	48385505		2200	4300	6500	SO:0001583	missense	83752	exon15			GAATTAAAGACAA	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2351A>C	chr16.hg19:g.48385505A>C	ENSP00000285737:p.Lys784Thr	74.0	0.0		50.0	21.0	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	hg19	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.897938	0.91962	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754	T;T	0.41758	0.99;0.99	5.93	5.93	0.95920	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.173319	0.64402	D	0.000008	T	0.68540	0.3012	M	0.83692	2.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73531	-0.3953	10	0.87932	D	0	-24.883	16.422	0.83766	1.0:0.0:0.0:0.0	.	740;784	B7ZKL7;Q86WA8	.;LONP2_HUMAN	T	784;513;740	ENSP00000285737:K784T;ENSP00000445426:K740T	ENSP00000285737:K784T	K	+	2	0	LONP2	46943006	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.300000	0.96151	2.283000	0.76528	0.477000	0.44152	AAA	.	.		0.448	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
ROCK1	6093	hgsc.bcm.edu	37	18	18625364	18625364	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr18:18625364T>C	ENST00000399799.2	-	5	1419	c.479A>G	c.(478-480)gAt>gGt	p.D160G		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					GTTTACAAGATCTCCACCAGG	0.368																																					p.D160G		Atlas-SNP	.											.	ROCK1	162	.	0			c.A479G						.						126.0	114.0	118.0					18																	18625364		2203	4300	6503	SO:0001583	missense	6093	exon5			ACAAGATCTCCAC		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.479A>G	chr18.hg19:g.18625364T>C	ENSP00000382697:p.Asp160Gly	61.0	0.0		55.0	20.0	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	hg19	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	T	29.2	4.982065	0.93044	.	.	ENSG00000067900	ENST00000399799	T	0.28454	1.61	5.36	5.36	0.76844	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66147	0.2760	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76323	-0.3001	10	0.87932	D	0	.	15.5304	0.75956	0.0:0.0:0.0:1.0	.	160	Q13464	ROCK1_HUMAN	G	160	ENSP00000382697:D160G	ENSP00000382697:D160G	D	-	2	0	ROCK1	16879362	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.773000	0.85462	2.246000	0.74042	0.533000	0.62120	GAT	.	.		0.368	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
MKNK2	2872	hgsc.bcm.edu	37	19	2042023	2042024	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr19:2042023_2042024GC>AT	ENST00000591601.1	-	10	795_796	c.760_761GC>AT	c.(760-762)GCg>ATg	p.A254M	MKNK2_ENST00000591588.1_De_novo_Start_InFrame|MKNK2_ENST00000309340.7_Missense_Mutation_p.A254M|MKNK2_ENST00000541165.1_Missense_Mutation_p.A123M|MKNK2_ENST00000591142.1_De_novo_Start_InFrame|MKNK2_ENST00000588014.1_De_novo_Start_InFrame|MKNK2_ENST00000250896.3_Missense_Mutation_p.A254M			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGTACTCCGCCGAGCCGCAC	0.673																																					p.A254V|p.A254T		Atlas-SNP	.											.	MKNK2	56	.	0			c.C761T|c.G760A						.																																			SO:0001583	missense	2872	exon11			TACTCCGCCGAGC|ACTCCGCCGAGCC	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.760_761delinsAT	chr19.hg19:g.2042023_2042024delinsAT	ENSP00000467811:p.Ala254Met	61.0|59.0	0.0		70.0|69.0	18.0|16.0	NM_017572	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Missense_Mutation	SNP	ENST00000591601.1	hg19	CCDS12080.1																																																																																			.	.		0.673	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449312.1	NM_199054	
C3	718	hgsc.bcm.edu	37	19	6707900	6707900	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr19:6707900G>A	ENST00000245907.6	-	15	1978	c.1886C>T	c.(1885-1887)cCg>cTg	p.P629L		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	629					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CCCACTGCCCGGGGTGCAGCC	0.677																																					p.P629L		Atlas-SNP	.											.	C3	192	.	0			c.C1886T						.						57.0	51.0	53.0					19																	6707900		2203	4300	6503	SO:0001583	missense	718	exon15			CTGCCCGGGGTGC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1886C>T	chr19.hg19:g.6707900G>A	ENSP00000245907:p.Pro629Leu	90.0	0.0		83.0	33.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	hg19	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169803	0.38315	.	.	ENSG00000125730	ENST00000245907	T	0.34472	1.36	4.83	3.79	0.43588	.	0.222891	0.46758	D	0.000261	T	0.43743	0.1261	M	0.88241	2.94	0.36280	D	0.855692	P	0.48162	0.906	B	0.42282	0.382	T	0.58418	-0.7640	10	0.19147	T	0.46	.	11.9609	0.53007	0.0869:0.0:0.9131:0.0	.	629	P01024	CO3_HUMAN	L	629	ENSP00000245907:P629L	ENSP00000245907:P629L	P	-	2	0	C3	6658900	0.957000	0.32711	0.215000	0.23724	0.189000	0.23516	5.614000	0.67695	1.043000	0.40175	-0.192000	0.12808	CCG	.	.		0.677	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
RLN3	117579	hgsc.bcm.edu	37	19	14139180	14139180	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr19:14139180C>A	ENST00000431365.2	+	1	221	c.164C>A	c.(163-165)tCa>tAa	p.S55*	RLN3_ENST00000585987.1_Nonsense_Mutation_p.S55*|CTB-55O6.4_ENST00000590528.1_RNA	NM_080864.2	NP_543140.1	Q8WXF3	REL3_HUMAN	relaxin 3	55						extracellular region (GO:0005576)				endometrium(1)|lung(4)	5						TGGAGACGATCAGACATCCTG	0.627																																					p.S55X		Atlas-SNP	.											.	RLN3	10	.	0			c.C164A						.						45.0	48.0	47.0					19																	14139180		2203	4300	6503	SO:0001587	stop_gained	117579	exon1			GACGATCAGACAT	AF447451	CCDS12302.1	19p13.2	2013-02-26	2004-11-15					"""Endogenous ligands"""	17135	protein-coding gene	gene with protein product	"""prorelaxin H3"""	606855	"""relaxin 3 (H3)"""				Standard	NM_080864		Approved	ZINS4, RXN3, H3	uc002mxw.1	Q8WXF3		ENST00000431365.2:c.164C>A	chr19.hg19:g.14139180C>A	ENSP00000397415:p.Ser55*	152.0	0.0		137.0	60.0	NM_080864	Q6UXW5	Nonsense_Mutation	SNP	ENST00000431365.2	hg19	CCDS12302.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401240	0.83120	.	.	ENSG00000171136	ENST00000431365	.	.	.	4.13	1.88	0.25563	.	2.180380	0.01897	N	0.038922	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6451	6.6943	0.23191	0.0:0.7172:0.1805:0.1023	.	.	.	.	X	55	.	ENSP00000397415:S55X	S	+	2	0	RLN3	14000180	0.888000	0.30383	0.002000	0.10522	0.223000	0.24884	2.573000	0.46007	0.296000	0.22592	0.491000	0.48974	TCA	.	.		0.627	RLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458529.1		
PRR12	57479	hgsc.bcm.edu	37	19	50100111	50100111	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr19:50100111C>T	ENST00000418929.2	+	4	2531	c.2519C>T	c.(2518-2520)cCc>cTc	p.P840L		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCACCGCCACCCCCGCCTCCA	0.746																																					p.P840L		Atlas-SNP	.											.	PRR12	157	.	0			c.C2519T						.						4.0	5.0	4.0					19																	50100111		1580	3492	5072	SO:0001583	missense	57479	exon4			CGCCACCCCCGCC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2519C>T	chr19.hg19:g.50100111C>T	ENSP00000394510:p.Pro840Leu	30.0	0.0		43.0	21.0	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	hg19	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	C	9.793	1.178479	0.21787	.	.	ENSG00000126464	ENST00000418929	.	.	.	3.92	3.92	0.45320	.	.	.	.	.	T	0.48624	0.1510	.	.	.	0.38061	D	0.936074	P	0.36909	0.573	B	0.39217	0.294	T	0.50004	-0.8878	7	0.25751	T	0.34	-8.8078	13.8501	0.63492	0.0:1.0:0.0:0.0	.	840	Q9ULL5-3	.	L	840	.	ENSP00000394510:P840L	P	+	2	0	PRR12	54791923	0.001000	0.12720	0.806000	0.32338	0.633000	0.38033	0.248000	0.18198	2.470000	0.83445	0.313000	0.20887	CCC	.	.		0.746	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
USP29	57663	hgsc.bcm.edu	37	19	57641581	57641581	+	Missense_Mutation	SNP	G	G	T	rs148182755		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr19:57641581G>T	ENST00000254181.4	+	4	1992	c.1538G>T	c.(1537-1539)cGc>cTc	p.R513L	USP29_ENST00000598197.1_Missense_Mutation_p.R513L	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	513	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CATCTGAAACGCTATAGCTTC	0.378																																					p.R513L		Atlas-SNP	.											.	USP29	186	.	0			c.G1538T						.						114.0	117.0	116.0					19																	57641581		2203	4300	6503	SO:0001583	missense	57663	exon4			TGAAACGCTATAG		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1538G>T	chr19.hg19:g.57641581G>T	ENSP00000254181:p.Arg513Leu	95.0	0.0		75.0	38.0	NM_020903		Missense_Mutation	SNP	ENST00000254181.4	hg19	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.492932	0.44352	.	.	ENSG00000131864	ENST00000254181	D	0.91843	-2.92	2.69	1.58	0.23477	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.47093	U	0.000259	D	0.95191	0.8441	M	0.85041	2.73	0.30436	N	0.776635	D	0.89917	1.0	D	0.76575	0.988	D	0.91418	0.5156	10	0.87932	D	0	0.0014	8.6437	0.33991	0.0:0.0:0.7699:0.23	.	513	Q9HBJ7	UBP29_HUMAN	L	513	ENSP00000254181:R513L	ENSP00000254181:R513L	R	+	2	0	USP29	62333393	1.000000	0.71417	0.941000	0.38009	0.318000	0.28184	3.914000	0.56401	0.614000	0.30107	0.591000	0.81541	CGC	.	G|1.000;A|0.000		0.378	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
ARFGEF2	10564	hgsc.bcm.edu	37	20	47592685	47592685	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr20:47592685A>G	ENST00000371917.4	+	14	1907	c.1907A>G	c.(1906-1908)cAa>cGa	p.Q636R		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	636					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GACCCTGAGCAATTTGAGGTC	0.502																																					p.Q636R	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.A1907G						.						106.0	79.0	88.0					20																	47592685		2203	4300	6503	SO:0001583	missense	10564	exon14			CTGAGCAATTTGA	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1907A>G	chr20.hg19:g.47592685A>G	ENSP00000360985:p.Gln636Arg	261.0	0.0		206.0	89.0	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468387	0.84533	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.76578	-1.03	5.79	5.79	0.91817	Armadillo-type fold (1);SEC7-like (2);	0.113718	0.64402	D	0.000008	D	0.85630	0.5741	M	0.81341	2.54	0.80722	D	1	D	0.54772	0.968	P	0.54664	0.758	D	0.86798	0.1990	10	0.51188	T	0.08	.	16.1354	0.81481	1.0:0.0:0.0:0.0	.	636	Q9Y6D5	BIG2_HUMAN	R	636	ENSP00000360985:Q636R	ENSP00000360985:Q636R	Q	+	2	0	ARFGEF2	47026092	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	9.310000	0.96267	2.207000	0.71202	0.533000	0.62120	CAA	.	.		0.502	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
NDUFV3	4731	hgsc.bcm.edu	37	21	44324122	44324122	+	Intron	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr21:44324122C>T	ENST00000340344.4	+	3	235				NDUFV3_ENST00000354250.2_Silent_p.L334L|NDUFV3_ENST00000460259.1_3'UTR	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		AGAGGGGCATCTGGAAAAACC	0.667																																					p.L334L		Atlas-SNP	.											.	NDUFV3	23	.	0			c.C1000T						.						28.0	33.0	32.0					21																	44324122		2203	4300	6503	SO:0001627	intron_variant	4731	exon3			GGGCATCTGGAAA		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.170-4852C>T	chr21.hg19:g.44324122C>T		130.0	0.0		68.0	50.0	NM_021075	A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Silent	SNP	ENST00000340344.4	hg19	CCDS33573.1																																																																																			.	.		0.667	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2		
EP300	2033	hgsc.bcm.edu	37	22	41568575	41568575	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr22:41568575T>A	ENST00000263253.7	+	28	5744	c.4525T>A	c.(4525-4527)Tgg>Agg	p.W1509R	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1509	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GGGTGATTTCTGGCCCAATGT	0.398			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.W1509R		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.T4525A						.						109.0	105.0	107.0					22																	41568575		2203	4300	6503	SO:0001583	missense	2033	exon28	Familial Cancer Database	Broad Thumb-Hallux syndrome	GATTTCTGGCCCA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4525T>A	chr22.hg19:g.41568575T>A	ENSP00000263253:p.Trp1509Arg	181.0	0.0		141.0	71.0	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	hg19	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.134333	0.77662	.	.	ENSG00000100393	ENST00000263253	D	0.94000	-3.33	5.96	5.96	0.96718	.	0.000000	0.46145	D	0.000307	D	0.97882	0.9304	H	0.96269	3.795	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.99133	1.0853	10	0.87932	D	0	-5.3558	16.4484	0.83959	0.0:0.0:0.0:1.0	.	1509	Q09472	EP300_HUMAN	R	1509	ENSP00000263253:W1509R	ENSP00000263253:W1509R	W	+	1	0	EP300	39898521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.953000	0.87836	2.285000	0.76669	0.533000	0.62120	TGG	.	.		0.398	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
EFCAB6	64800	hgsc.bcm.edu	37	22	43976358	43976358	+	Silent	SNP	G	G	A			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr22:43976358G>A	ENST00000262726.7	-	25	3467	c.3214C>T	c.(3214-3216)Ctg>Ttg	p.L1072L	EFCAB6_ENST00000396231.2_Silent_p.L920L	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1072	EF-hand 12. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GACAAAGCCAGCTGGGAGGAC	0.493																																					p.L1072L		Atlas-SNP	.											.	EFCAB6	177	.	0			c.C3214T						.						204.0	177.0	186.0					22																	43976358		2203	4300	6503	SO:0001819	synonymous_variant	64800	exon25			AAGCCAGCTGGGA	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3214C>T	chr22.hg19:g.43976358G>A		96.0	0.0		96.0	34.0	NM_022785	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Silent	SNP	ENST00000262726.7	hg19	CCDS14049.1																																																																																			.	.		0.493	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
CELSR1	9620	hgsc.bcm.edu	37	22	46792558	46792558	+	Silent	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr22:46792558C>T	ENST00000262738.3	-	13	5786	c.5787G>A	c.(5785-5787)ccG>ccA	p.P1929P		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1929	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGTAGCCCTGCGGGGAGCCGG	0.622																																					p.P1929P		Atlas-SNP	.											.	CELSR1	242	.	0			c.G5787A						.						38.0	34.0	36.0					22																	46792558		2203	4300	6503	SO:0001819	synonymous_variant	9620	exon13			GCCCTGCGGGGAG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5787G>A	chr22.hg19:g.46792558C>T		92.0	0.0		80.0	5.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	hg19	CCDS14076.1																																																																																			.	.		0.622	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
ZMAT1	84460	hgsc.bcm.edu	37	X	101139682	101139682	+	Silent	SNP	C	C	T			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chrX:101139682C>T	ENST00000372782.3	-	7	764	c.717G>A	c.(715-717)aaG>aaA	p.K239K	ZMAT1_ENST00000540921.1_Silent_p.K239K|ZMAT1_ENST00000458570.1_Silent_p.K68K|ZMAT1_ENST00000494068.1_5'UTR	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	239						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TGAAACAAGTCTTGGCCTCTA	0.413																																					p.K239K		Atlas-SNP	.											.	ZMAT1	143	.	0			c.G717A						.						204.0	179.0	187.0					X																	101139682		2203	4300	6503	SO:0001819	synonymous_variant	84460	exon7			ACAAGTCTTGGCC	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.717G>A	chrX.hg19:g.101139682C>T		66.0	0.0		111.0	52.0	NM_001011657	Q8NDS3|Q96JN6	Silent	SNP	ENST00000372782.3	hg19	CCDS35348.1																																																																																			.	.		0.413	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
PPP1R10	5514	hgsc.bcm.edu	37	6	30573978	30573980	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr6:30573978_30573980delTTC	ENST00000376511.2	-	9	1227_1229	c.675_677delGAA	c.(673-678)aagaat>aat	p.K225del		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	225	Interaction with TOX4. {ECO:0000250}.			K -> E (in Ref. 1; CAA73697). {ECO:0000305}.	protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						TGTGCTGGCATTCTTCTTCACAG	0.522																																					p.226_226del		Atlas-INDEL	.											.	PPP1R10	60	.	0			c.676_678del						.																																			SO:0001651	inframe_deletion	5514	exon9			.	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.675_677delGAA	chr6.hg19:g.30573984_30573986delTTC	ENSP00000365694:p.Lys225del	39.0	0.0		46.0	13.0	NM_002714	O00405	In_Frame_Del	DEL	ENST00000376511.2	hg19	CCDS4681.1																																																																																			.	.		0.522	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714	
TTN	7273	hgsc.bcm.edu	37	2	179523961	179523962	+	Intron	INS	-	-	CTT			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr2:179523961_179523962insCTT	ENST00000591111.1	-	154	34489				TTN_ENST00000342992.6_In_Frame_Ins_p.10531_10532insE|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_In_Frame_Ins_p.12435_12436insE|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGGAACAACTTCTTTGGGA	0.406																																					p.V12436delinsEV		Atlas-INDEL	.											.	TTN	18412	.	0			c.37307_37308insAAG						.																																			SO:0001627	intron_variant	7273	exon181			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34265-440->AAG	chr2.hg19:g.179523965_179523967dupCTT		278.0	0.0		230.0	32.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Ins	INS	ENST00000591111.1	hg19																																																																																				.	.		0.406	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179519701	179519702	+	In_Frame_Ins	INS	-	-	CTT	rs576495357		TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr2:179519701_179519702insCTT	ENST00000591111.1	-	155	34599_34600	c.34375_34376insAAG	c.(34375-34377)gtt>gAAGtt	p.11458_11459insE	TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_In_Frame_Ins_p.12686_12687insE|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11402	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGGAACAACTTCTTTGGGA	0.406																																					p.V12687delinsEV		Atlas-INDEL	.											.	TTN	18412	.	0			c.38060_38061insAAG						.																																			SO:0001652	inframe_insertion	7273	exon190			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34373_34375dupAAG	chr2.hg19:g.179519705_179519707dupCTT	ENSP00000465570:p.Glu11458_Glu11458dup	260.0	0.0		232.0	24.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Ins	INS	ENST00000591111.1	hg19																																																																																				.	.		0.406	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DAK	26007	hgsc.bcm.edu	37	11	61110239	61110241	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-G3-AAV2-01A-11D-A36X-10	TCGA-G3-AAV2-10A-01D-A370-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cef171de-1b26-42a6-b2c3-6b4123a54ee4	9800974a-91e2-4674-9dfb-f809efce470b	g.chr11:61110239_61110241delTGA	ENST00000394900.3	+	10	1017_1019	c.788_790delTGA	c.(787-792)gtgatg>gtg	p.M265del		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	265	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						TCCTCAGTTGTGATGATGGTCAA	0.621																																					p.263_263del		Atlas-INDEL	.											.	DAK	52	.	0			c.787_789del						.																																			SO:0001651	inframe_deletion	26007	exon10			.		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.788_790delTGA	chr11.hg19:g.61110242_61110244delTGA	ENSP00000378360:p.Met265del	109.0	0.0		86.0	30.0	NM_015533	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	In_Frame_Del	DEL	ENST00000394900.3	hg19	CCDS8003.1																																																																																			.	.		0.621	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533	
