#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MIB2	142678	hgsc.bcm.edu	37	1	1558785	1558785	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:1558785C>G	ENST00000357210.4	+	3	343	c.127C>G	c.(127-129)Ccc>Gcc	p.P43A	MIB2_ENST00000505820.2_Missense_Mutation_p.P100A|MIB2_ENST00000520777.1_Missense_Mutation_p.P100A|MIB2_ENST00000360522.4_Missense_Mutation_p.P43A|MIB2_ENST00000378710.3_Missense_Mutation_p.P43A|MIB2_ENST00000512004.1_3'UTR|MIB2_ENST00000378712.1_Intron|MIB2_ENST00000504599.1_5'UTR|MIB2_ENST00000355826.5_Intron|MIB2_ENST00000518681.1_Missense_Mutation_p.P100A|MIB2_ENST00000378708.1_Intron	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	43					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGCAGCCCGGCCCACCATGGA	0.716																																					p.P100A		Atlas-SNP	.											.	MIB2	62	.	0			c.C298G						.						11.0	14.0	13.0					1																	1558785		1885	4099	5984	SO:0001583	missense	142678	exon3			GCCCGGCCCACCA	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.127C>G	chr1.hg19:g.1558785C>G	ENSP00000349741:p.Pro43Ala	142.0	0.0		153.0	59.0	NM_001170686	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Missense_Mutation	SNP	ENST00000357210.4	hg19		.	.	.	.	.	.	.	.	.	.	C	7.970	0.748943	0.15710	.	.	ENSG00000197530	ENST00000520777;ENST00000357210;ENST00000360522;ENST00000378710;ENST00000518681;ENST00000505820	T;T;T;T;T;T	0.32515	1.45;1.49;1.48;1.48;1.46;1.45	1.19	1.19	0.21007	.	10.323000	0.00695	U	0.000758	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.04013	0.0;0.001;0.001	T	0.16719	-1.0393	10	0.36615	T	0.2	.	5.1539	0.15025	0.0:0.6231:0.3769:0.0	.	100;100;43	E9PHQ1;E9PGU1;Q96AX9	.;.;MIB2_HUMAN	A	100;43;43;43;100;100	ENSP00000428660:P100A;ENSP00000349741:P43A;ENSP00000353713:P43A;ENSP00000367982:P43A;ENSP00000428264:P100A;ENSP00000426103:P100A	ENSP00000349741:P43A	P	+	1	0	MIB2	1548648	0.000000	0.05858	0.003000	0.11579	0.350000	0.29205	-1.440000	0.02412	0.552000	0.29026	0.174000	0.16983	CCC	.	.		0.716	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_080875	
FOXD2	2306	hgsc.bcm.edu	37	1	47904970	47904970	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:47904970G>T	ENST00000334793.5	+	1	3282	c.1163G>T	c.(1162-1164)cGc>cTc	p.R388L		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	388	Ala-rich.|Gly-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		GCACTTCTGCGCCAGGGCCTC	0.721																																					p.R388L		Atlas-SNP	.											.	FOXD2	16	.	0			c.G1163T						.						2.0	4.0	3.0					1																	47904970		1699	3595	5294	SO:0001583	missense	2306	exon1			TTCTGCGCCAGGG	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.1163G>T	chr1.hg19:g.47904970G>T	ENSP00000335493:p.Arg388Leu	13.0	0.0		12.0	6.0	NM_004474	Q5SVZ3	Missense_Mutation	SNP	ENST00000334793.5	hg19	CCDS30708.1	.	.	.	.	.	.	.	.	.	.	G	3.634	-0.074840	0.07184	.	.	ENSG00000186564	ENST00000334793	D	0.91894	-2.93	4.3	3.29	0.37713	.	385.614000	0.00550	N	0.000246	T	0.79417	0.4442	N	0.02225	-0.63	0.26708	N	0.971038	B	0.09022	0.002	B	0.08055	0.003	T	0.74272	-0.3719	10	0.08179	T	0.78	.	5.8598	0.18740	0.0:0.2945:0.4553:0.2502	.	388	O60548	FOXD2_HUMAN	L	388	ENSP00000335493:R388L	ENSP00000335493:R388L	R	+	2	0	FOXD2	47677557	0.978000	0.34361	1.000000	0.80357	0.940000	0.58332	0.518000	0.22847	1.914000	0.55421	0.561000	0.74099	CGC	.	.		0.721	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021831.1	NM_004474	
SCP2	6342	hgsc.bcm.edu	37	1	53443889	53443889	+	Splice_Site	SNP	T	T	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:53443889T>G	ENST00000528311.1	+	8	728	c.432T>G	c.(430-432)tgT>tgG	p.C144W	SCP2_ENST00000473584.1_3'UTR|SCP2_ENST00000407246.2_Splice_Site_p.C201W|SCP2_ENST00000371509.4_Splice_Site_p.C181W|SCP2_ENST00000371513.5_Splice_Site_p.C181W|SCP2_ENST00000371514.3_Splice_Site_p.C225W	NM_001193617.1	NP_001180546.1	Q9BX26	SYCP2_HUMAN	sterol carrier protein 2	865					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	15						TTCCTCTTAGTCCCACTTCAG	0.433																																					p.C225W		Atlas-SNP	.											SCP2,NS,carcinoma,0,1	SCP2	44	.	0			c.T675G						.						73.0	69.0	70.0					1																	53443889		2203	4300	6503	SO:0001630	splice_region_variant	6342	exon9			TCTTAGTCCCACT	M75884	CCDS572.1, CCDS30719.1, CCDS41338.1, CCDS44149.1, CCDS44150.1, CCDS53317.1, CCDS53318.1, CCDS53319.1	1p32	2010-08-20			ENSG00000116171	ENSG00000116171			10606	protein-coding gene	gene with protein product		184755				1703300, 1718316	Standard	NM_001007098		Approved		uc001cur.2	P22307	OTTHUMG00000008936	ENST00000528311.1:c.432-1T>G	chr1.hg19:g.53443889T>G		79.0	0.0		88.0	42.0	NM_002979	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000528311.1	hg19	CCDS53319.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.87|17.87	3.495460|3.495460	0.64186|0.64186	.|.	.|.	ENSG00000116171|ENSG00000116171	ENST00000371514;ENST00000528311;ENST00000371509;ENST00000407246;ENST00000371513|ENST00000529363	D;T;D;D;D|.	0.94758|.	-3.51;-0.56;-3.51;-3.51;-3.51|.	5.29|5.29	-1.19|-1.19	0.09585|0.09585	Thiolase-like, subgroup (1);Thiolase-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85982|0.85982	0.5824|0.5824	H|H	0.98178|0.98178	4.165|4.165	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.87578|.	0.997;0.995;0.998;0.997|.	D|D	0.86946|0.86946	0.2082|0.2082	9|5	.|.	.|.	.|.	.|.	11.166|11.166	0.48543|0.48543	0.0:0.3803:0.0:0.6197|0.0:0.3803:0.0:0.6197	.|.	201;181;225;181|.	C9JC79;A6NM69;P22307;Q6NXF4|.	.;.;NLTP_HUMAN;.|.	W|R	225;144;181;201;181|171	ENSP00000360569:C225W;ENSP00000434132:C144W;ENSP00000360564:C181W;ENSP00000384569:C201W;ENSP00000360568:C181W|.	.|.	C|L	+|+	3|2	2|0	SCP2|SCP2	53216477|53216477	0.873000|0.873000	0.30073|0.30073	0.994000|0.994000	0.49952|0.49952	0.928000|0.928000	0.56348|0.56348	-0.079000|-0.079000	0.11357|0.11357	-0.106000|-0.106000	0.12110|0.12110	0.528000|0.528000	0.53228|0.53228	TGT|CTC	.	.		0.433	SCP2-010	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387558.1	NM_002979	Missense_Mutation
TM2D1	83941	hgsc.bcm.edu	37	1	62175038	62175038	+	Missense_Mutation	SNP	C	C	G	rs373304497		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:62175038C>G	ENST00000606498.1	-	3	330	c.310G>C	c.(310-312)Gaa>Caa	p.E104Q	TM2D1_ENST00000472989.1_5'UTR|TM2D1_ENST00000371177.2_Missense_Mutation_p.E104Q|TM2D1_ENST00000294613.5_Missense_Mutation_p.E104Q|TM2D1_ENST00000371180.2_Missense_Mutation_p.E166Q			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	104					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)	p.E166K(1)		large_intestine(2)|lung(3)|ovary(1)	6						AAACCAACTTCGTTCCCAGTA	0.358																																					p.E104Q		Atlas-SNP	.											TM2D1_ENST00000371177,NS,carcinoma,0,3	TM2D1	37	.	1	Substitution - Missense(1)	large_intestine(1)	c.G310C						.						92.0	88.0	89.0					1																	62175038		1839	4091	5930	SO:0001583	missense	83941	exon3			CAACTTCGTTCCC	AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.310G>C	chr1.hg19:g.62175038C>G	ENSP00000475700:p.Glu104Gln	316.0	2.0		365.0	113.0	NM_032027	A6NDA8	Missense_Mutation	SNP	ENST00000606498.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.72	3.879717	0.72294	.	.	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.75079	0.3801	L	0.59436	1.845	0.58432	D	0.999992	D	0.76494	0.999	D	0.79108	0.992	T	0.67401	-0.5680	9	0.18276	T	0.48	-3.277	18.396	0.90499	0.0:1.0:0.0:0.0	.	104	Q9BX74	TM2D1_HUMAN	Q	166;104;104;104	.	ENSP00000294613:E104Q	E	-	1	0	TM2D1	61947626	1.000000	0.71417	0.971000	0.41717	0.772000	0.43724	5.467000	0.66737	2.882000	0.98803	0.655000	0.94253	GAA	.	.		0.358	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470779.2	NM_032027	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156914158	156914158	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:156914158T>A	ENST00000361409.2	-	30	3681	c.2939A>T	c.(2938-2940)aAg>aTg	p.K980M	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.K1020M|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.K396M	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	980	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACCCAAGGTCTTATCCTTGCT	0.512																																					p.K1020M		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.A3059T						.						123.0	115.0	117.0					1																	156914158		2203	4300	6503	SO:0001583	missense	9826	exon31			AAGGTCTTATCCT	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2939A>T	chr1.hg19:g.156914158T>A	ENSP00000354644:p.Lys980Met	71.0	0.0		142.0	32.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	hg19	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.562143	0.86335	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.69435	-0.4;-0.4;-0.4	5.13	5.13	0.70059	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000020	T	0.81418	0.4818	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.999	D;D;D	0.85130	0.985;0.995;0.997	D	0.85571	0.1234	10	0.87932	D	0	-31.1983	14.7535	0.69546	0.0:0.0:0.0:1.0	.	396;980;1020	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	M	1020;980;396	ENSP00000357177:K1020M;ENSP00000354644:K980M;ENSP00000313470:K396M	ENSP00000313470:K396M	K	-	2	0	ARHGEF11	155180782	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	5.990000	0.70595	2.147000	0.66899	0.459000	0.35465	AAG	.	.		0.512	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
RASAL2	9462	hgsc.bcm.edu	37	1	178427542	178427542	+	Missense_Mutation	SNP	G	G	A	rs368617203		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:178427542G>A	ENST00000462775.1	+	12	2817	c.2692G>A	c.(2692-2694)Ggg>Agg	p.G898R	RASAL2_ENST00000367649.3_Missense_Mutation_p.G1039R|RASAL2_ENST00000448150.3_Missense_Mutation_p.G1028R	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	898					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.G1039R(1)|p.G1028R(1)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						ACGTAGCACCGGGAGCATGTC	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17455	0.0		0.0	False		,,,				2504	0.0				p.G1039R		Atlas-SNP	.											RASAL2_ENST00000462775,NS,lymphoid_neoplasm,0,5	RASAL2	334	.	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.G3115A						.	G	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	55.0	56.0	55.0		2692,3115	5.5	1.0	1		55	0,8600		0,0,4300	no	missense,missense	RASAL2	NM_004841.3,NM_170692.2	125,125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	898/1140,1039/1281	178427542	1,13005	2203	4300	6503	SO:0001583	missense	9462	exon14			AGCACCGGGAGCA	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.2692G>A	chr1.hg19:g.178427542G>A	ENSP00000420558:p.Gly898Arg	94.0	0.0		174.0	33.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	hg19	CCDS1322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.03|19.03	3.747873|3.747873	0.69533|0.69533	2.27E-4|2.27E-4	0.0|0.0	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	T;T;T|.	0.15487|.	2.42;2.42;2.42|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.257336|.	0.37530|.	N|.	0.002042|.	T|T	0.70710|0.70710	0.3255|0.3255	L|L	0.50333|0.50333	1.59|1.59	0.47621|0.47621	D|D	0.99947|0.99947	P;D;P|.	0.60160|.	0.952;0.987;0.862|.	B;P;B|.	0.53518|.	0.363;0.728;0.2|.	T|T	0.66897|0.66897	-0.5807|-0.5807	10|5	0.20046|.	T|.	0.44|.	.|.	19.321|19.321	0.94240|0.94240	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1028;898;1039|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	R|Q	1028;1039;898|448	ENSP00000407768:G1028R;ENSP00000356621:G1039R;ENSP00000420558:G898R|.	ENSP00000356621:G1039R|.	G|R	+|+	1|2	0|0	RASAL2|RASAL2	176694165|176694165	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.965000|0.965000	0.64279|0.64279	3.270000|3.270000	0.51600|0.51600	2.548000|2.548000	0.85928|0.85928	0.591000|0.591000	0.81541|0.81541	GGG|CGG	.	.		0.627	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
NPHS2	7827	hgsc.bcm.edu	37	1	179544879	179544879	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:179544879C>T	ENST00000367615.4	-	1	189	c.121G>A	c.(121-123)Gct>Act	p.A41T	NPHS2_ENST00000367616.4_Missense_Mutation_p.A41T|RNU5F-2P_ENST00000516066.1_RNA	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	41					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						TCGGGCCCAGCCTCCTGGCGC	0.771																																					p.A41T		Atlas-SNP	.											.	NPHS2	46	.	0			c.G121A						.						2.0	2.0	2.0					1																	179544879		1330	3093	4423	SO:0001583	missense	7827	exon1			GCCCAGCCTCCTG	AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.121G>A	chr1.hg19:g.179544879C>T	ENSP00000356587:p.Ala41Thr	51.0	0.0		52.0	18.0	NM_014625	B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	ENST00000367615.4	hg19	CCDS1331.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.409212	0.25378	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	D;D	0.99797	-6.79;-6.79	3.9	0.652	0.17823	.	1.401580	0.04659	U	0.408558	D	0.98479	0.9493	L	0.36672	1.1	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.0	D	0.99978	1.2355	10	0.21014	T	0.42	-1.8085	2.7606	0.05306	0.1858:0.52:0.1817:0.1126	.	41;41	Q9NP85-2;Q9NP85	.;PODO_HUMAN	T	41	ENSP00000356587:A41T;ENSP00000356588:A41T	ENSP00000356587:A41T	A	-	1	0	NPHS2	177811502	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.213000	0.17521	0.198000	0.20407	0.467000	0.42956	GCT	.	.		0.771	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1		
MRPL55	128308	hgsc.bcm.edu	37	1	228295710	228295710	+	Intron	SNP	G	G	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:228295710G>C	ENST00000411464.2	-	4	820				MRPL55_ENST00000366740.1_Intron|MRPL55_ENST00000366744.1_Intron|MRPL55_ENST00000366736.1_Intron|MRPL55_ENST00000430433.1_Silent_p.G34G|MRPL55_ENST00000295008.4_Intron|MRPL55_ENST00000366747.3_Intron|MRPL55_ENST00000366733.1_Intron|MRPL55_ENST00000391867.3_Intron|MRPL55_ENST00000366732.1_Intron|MRPL55_ENST00000336300.5_Intron|MRPL55_ENST00000348259.5_Intron|MRPL55_ENST00000366746.3_Intron|MRPL55_ENST00000366735.1_Intron|MRPL55_ENST00000336520.3_Intron|MRPL55_ENST00000366738.1_Silent_p.G34G|MRPL55_ENST00000366731.5_Silent_p.G34G|MRPL55_ENST00000366742.1_Intron|C1orf35_ENST00000472617.1_5'Flank|MRPL55_ENST00000366741.1_Intron|MRPL55_ENST00000465397.1_5'UTR|MRPL55_ENST00000366734.1_Intron|MRPL55_ENST00000366739.1_Intron			Q7Z7F7	RM55_HUMAN	mitochondrial ribosomal protein L55						translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|lung(4)	5		Prostate(94;0.0405)				GGCAGGATGAGCCTCGGGGCT	0.637																																					p.G34G		Atlas-SNP	.											.	MRPL55	27	.	0			c.C102G						.						26.0	35.0	32.0					1																	228295710		692	1591	2283	SO:0001627	intron_variant	128308	exon4			GGATGAGCCTCGG	AK056987	CCDS1567.1, CCDS44325.1	1q42.13	2012-09-13			ENSG00000162910	ENSG00000162910		"""Mitochondrial ribosomal proteins / large subunits"""	16686	protein-coding gene	gene with protein product		611859					Standard	NM_181463		Approved		uc001hrz.4	Q7Z7F7	OTTHUMG00000037965	ENST00000411464.2:c.27-140C>G	chr1.hg19:g.228295710G>C		129.0	0.0		237.0	105.0	NM_181462	Q5TBY3|Q5TBY6|Q6UWI8	Silent	SNP	ENST00000411464.2	hg19	CCDS1567.1																																																																																			.	.		0.637	MRPL55-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092808.1	XM_059233	
OBSCN	84033	hgsc.bcm.edu	37	1	228504446	228504446	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr1:228504446C>T	ENST00000422127.1	+	51	13366	c.13322C>T	c.(13321-13323)gCg>gTg	p.A4441V	OBSCN_ENST00000570156.2_Missense_Mutation_p.A5398V|OBSCN_ENST00000284548.11_Missense_Mutation_p.A4441V|OBSCN_ENST00000366709.4_Missense_Mutation_p.A1560V|OBSCN_ENST00000366707.4_Missense_Mutation_p.A2075V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4441	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTGAAAAACGCGGCGGTCCGG	0.677																																					p.A5398V		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C16193T						.																																			SO:0001583	missense	84033	exon62			AAAACGCGGCGGT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13322C>T	chr1.hg19:g.228504446C>T	ENSP00000409493:p.Ala4441Val	118.0	0.0		244.0	11.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	c	15.55	2.866931	0.51588	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.74209	-0.82;-0.82;0.23;0.74	5.14	-10.3	0.00346	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.577390	0.03472	N	0.213753	T	0.47581	0.1453	N	0.03294	-0.36	0.09310	N	1	B;B	0.25235	0.0;0.121	B;B	0.17722	0.0;0.019	T	0.57676	-0.7770	10	0.02654	T	1	.	19.934	0.97130	0.0:0.6833:0.0:0.3167	.	4441;4441	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	V	4441;4441;2075;1560	ENSP00000284548:A4441V;ENSP00000409493:A4441V;ENSP00000355668:A2075V;ENSP00000355670:A1560V	ENSP00000284548:A4441V	A	+	2	0	OBSCN	226571069	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.970000	0.03810	-2.566000	0.00470	-1.049000	0.02347	GCG	.	.		0.677	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
DYSF	8291	hgsc.bcm.edu	37	2	71743345	71743345	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr2:71743345G>C	ENST00000258104.3	+	8	1105	c.828G>C	c.(826-828)gaG>gaC	p.E276D	DYSF_ENST00000409744.1_Missense_Mutation_p.E277D|DYSF_ENST00000409651.1_Missense_Mutation_p.E308D|DYSF_ENST00000409582.3_Missense_Mutation_p.E307D|DYSF_ENST00000409762.1_Missense_Mutation_p.E307D|DYSF_ENST00000410020.3_Missense_Mutation_p.E308D|DYSF_ENST00000410041.1_Missense_Mutation_p.E308D|DYSF_ENST00000429174.2_Missense_Mutation_p.E276D|DYSF_ENST00000394120.2_Missense_Mutation_p.E277D|DYSF_ENST00000413539.2_Missense_Mutation_p.E307D|DYSF_ENST00000409366.1_Missense_Mutation_p.E277D	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	276	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CTCCTGGGGAGCTGTTTGATG	0.502																																					p.E308D		Atlas-SNP	.											.	DYSF	536	.	0			c.G924C						.						224.0	184.0	197.0					2																	71743345		2203	4300	6503	SO:0001583	missense	8291	exon9			TGGGGAGCTGTTT	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.828G>C	chr2.hg19:g.71743345G>C	ENSP00000258104:p.Glu276Asp	85.0	0.0		93.0	35.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	hg19	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	6.419	0.445454	0.12164	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	4.46	0.0465	0.14256	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.263965	0.37095	N	0.002249	T	0.47173	0.1431	L	0.39245	1.2	0.31905	N	0.61538	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.17098	0.002;0.007;0.007;0.007;0.017;0.017;0.017;0.017;0.002;0.017;0.011;0.007;0.002;0.003	T	0.25572	-1.0128	10	0.31617	T	0.26	-19.1238	1.5034	0.02481	0.2717:0.1436:0.4381:0.1466	.	308;308;277;277;308;277;307;276;307;307;276;276;277;276	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	D	307;307;307;276;276;308;277;277;277;308;308	ENSP00000407046:E307D;ENSP00000387137:E307D;ENSP00000386547:E307D;ENSP00000398305:E276D;ENSP00000258104:E276D;ENSP00000386683:E308D;ENSP00000377678:E277D;ENSP00000386285:E277D;ENSP00000386512:E277D;ENSP00000386881:E308D;ENSP00000386617:E308D	ENSP00000258104:E276D	E	+	3	2	DYSF	71596853	0.995000	0.38212	0.920000	0.36463	0.279000	0.26890	0.286000	0.18902	0.081000	0.16988	-0.275000	0.10095	GAG	.	.		0.502	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
IRS1	3667	hgsc.bcm.edu	37	2	227660609	227660609	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr2:227660609C>T	ENST00000305123.5	-	1	3866	c.2846G>A	c.(2845-2847)gGc>gAc	p.G949D	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	949					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TGCCCTCCGGCCCGGCCCCAG	0.652																																					p.G949D		Atlas-SNP	.											.	IRS1	141	.	0			c.G2846A						.						46.0	53.0	51.0					2																	227660609		2203	4300	6503	SO:0001583	missense	3667	exon1			CTCCGGCCCGGCC		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2846G>A	chr2.hg19:g.227660609C>T	ENSP00000304895:p.Gly949Asp	102.0	0.0		96.0	39.0	NM_005544		Missense_Mutation	SNP	ENST00000305123.5	hg19	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406880	0.25378	.	.	ENSG00000169047	ENST00000305123	T	0.56275	0.47	5.04	4.13	0.48395	.	0.458108	0.19622	N	0.109883	T	0.28599	0.0708	N	0.08118	0	0.33660	D	0.609567	B	0.17038	0.02	B	0.10450	0.005	T	0.28364	-1.0046	10	0.12103	T	0.63	-21.179	11.0555	0.47915	0.0:0.7412:0.2588:0.0	.	949	P35568	IRS1_HUMAN	D	949	ENSP00000304895:G949D	ENSP00000304895:G949D	G	-	2	0	IRS1	227368853	0.978000	0.34361	0.998000	0.56505	0.858000	0.48976	1.423000	0.34837	2.613000	0.88420	0.655000	0.94253	GGC	.	.		0.652	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	G	A	rs28931588|rs121913416|rs121913417		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr3:41266097G>A	ENST00000349496.5	+	3	374	c.94G>A	c.(94-96)Gac>Aac	p.D32N	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32N|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25N	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32Y(128)|p.D32N(82)|p.A5_A80del(53)|p.D32H(40)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.D32fs*9(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32N	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,2	CTNNB1	4904	.	397	Substitution - Missense(250)|Deletion - In frame(120)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Complex - frameshift(1)	liver(155)|central_nervous_system(55)|endometrium(40)|stomach(36)|pancreas(28)|large_intestine(22)|pituitary(22)|skin(11)|ovary(9)|soft_tissue(4)|prostate(4)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|adrenal_gland(1)|biliary_tract(1)|urinary_tract(1)|lung(1)|NS(1)	c.G94A						.						92.0	77.0	82.0					3																	41266097		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TACCTGGACTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.94G>A	chr3.hg19:g.41266097G>A	ENSP00000344456:p.Asp32Asn	160.0	0.0		172.0	76.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	30	5.054970	0.93793	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.71567	0.3355	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.73824	-0.3861	10	0.87932	D	0	0.3843	19.9596	0.97236	0.0:0.0:1.0:0.0	.	32	P35222	CTNB1_HUMAN	N	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25N;ENSP00000385604:D32N;ENSP00000412219:D32N;ENSP00000379486:D32N;ENSP00000344456:D32N;ENSP00000411226:D25N;ENSP00000379488:D32N;ENSP00000409302:D32N;ENSP00000401599:D32N	ENSP00000344456:D32N	D	+	1	0	CTNNB1	41241101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAC	.	.		0.478	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
RBM6	10180	hgsc.bcm.edu	37	3	50091780	50091780	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr3:50091780A>G	ENST00000266022.4	+	8	1904	c.1645A>G	c.(1645-1647)Att>Gtt	p.I549V	RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000422955.1_Missense_Mutation_p.I27V|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000442092.1_Missense_Mutation_p.I27V|RBM6_ENST00000443081.1_Missense_Mutation_p.I417V	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	549					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TAAGGCAAACATTGGTGGGCA	0.378																																					p.I549V		Atlas-SNP	.											.	RBM6	85	.	0			c.A1645G						.						198.0	204.0	202.0					3																	50091780		2203	4300	6503	SO:0001583	missense	10180	exon8			GCAAACATTGGTG	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1645A>G	chr3.hg19:g.50091780A>G	ENSP00000266022:p.Ile549Val	169.0	0.0		203.0	86.0	NM_005777	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	hg19	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	A	0.523	-0.861118	0.02610	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000422955;ENST00000446471	T;T;T;T;D	0.83673	1.01;1.61;1.62;1.01;-1.75	5.42	4.25	0.50352	.	0.590922	0.17228	N	0.182053	T	0.59432	0.2193	N	0.02539	-0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49418	-0.8942	9	.	.	.	0.5443	8.9942	0.36041	0.9113:0.0:0.0887:0.0	.	417;549	E9PGM9;P78332	.;RBM6_HUMAN	V	27;549;417;27;27	ENSP00000393530:I27V;ENSP00000266022:I549V;ENSP00000396466:I417V;ENSP00000392939:I27V;ENSP00000394336:I27V	.	I	+	1	0	RBM6	50066784	0.862000	0.29867	0.893000	0.35052	0.563000	0.35712	3.749000	0.55150	0.878000	0.35920	0.528000	0.53228	ATT	.	.		0.378	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
MUC4	4585	hgsc.bcm.edu	37	3	195477874	195477874	+	Silent	SNP	G	G	A	rs542498469		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr3:195477874G>A	ENST00000346145.4	-	22	3088	c.3049C>T	c.(3049-3051)Ctg>Ttg	p.L1017L	MUC4_ENST00000475231.1_Silent_p.L5201L|MUC4_ENST00000463781.3_Silent_p.L5253L|MUC4_ENST00000349607.4_Silent_p.L966L	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	2010	Repeat.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCGCGGCCAGCAGCTGGTTG	0.632													.|||	1	0.000199681	0.0	0.0014	5008	,	,		11533	0.0		0.0	False		,,,				2504	0.0				p.L5253L		Atlas-SNP	.											.	MUC4	1505	.	0			c.C15757T						.						54.0	51.0	52.0					3																	195477874		2203	4300	6503	SO:0001819	synonymous_variant	4585	exon23			CGGCCAGCAGCTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.3049C>T	chr3.hg19:g.195477874G>A		102.0	0.0		128.0	57.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000346145.4	hg19	CCDS3310.1																																																																																			.	.		0.632	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
TAPT1	202018	hgsc.bcm.edu	37	4	16204107	16204107	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr4:16204107T>C	ENST00000405303.2	-	3	510	c.427A>G	c.(427-429)Act>Gct	p.T143A	TAPT1_ENST00000399920.3_Missense_Mutation_p.T32A|TAPT1_ENST00000508888.1_5'UTR	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	143					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)			NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						CAAGGCAAAGTGAGGAGCCTG	0.378																																					p.T143A		Atlas-SNP	.											.	TAPT1	31	.	0			c.A427G						.						39.0	37.0	37.0					4																	16204107		1845	4047	5892	SO:0001583	missense	202018	exon3			GCAAAGTGAGGAG	AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.427A>G	chr4.hg19:g.16204107T>C	ENSP00000385347:p.Thr143Ala	358.0	1.0		440.0	168.0	NM_153365	Q8N2S3|Q9NZK9	Missense_Mutation	SNP	ENST00000405303.2	hg19	CCDS47030.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.067615	0.36470	.	.	ENSG00000169762	ENST00000405303;ENST00000542770;ENST00000399920	T;T	0.33216	1.42;1.45	5.07	3.88	0.44766	.	0.046390	0.85682	N	0.000000	T	0.25195	0.0612	L	0.53249	1.67	0.80722	D	1	B	0.15141	0.012	B	0.12156	0.007	T	0.05468	-1.0883	10	0.10636	T	0.68	-29.6464	9.7879	0.40688	0.0:0.0863:0.0:0.9137	.	143	Q6NXT6	TAPT1_HUMAN	A	143;143;32	ENSP00000385347:T143A;ENSP00000382803:T32A	ENSP00000382803:T32A	T	-	1	0	TAPT1	15813205	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	5.900000	0.69853	0.867000	0.35654	0.533000	0.62120	ACT	.	.		0.378	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359568.1	NM_153365	
GPR125	166647	hgsc.bcm.edu	37	4	22390453	22390453	+	Silent	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr4:22390453C>T	ENST00000334304.5	-	19	3110	c.2841G>A	c.(2839-2841)gaG>gaA	p.E947E	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	947					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CATATTTGCGCTCAGGGTGTC	0.443																																					p.E947E		Atlas-SNP	.											.	GPR125	118	.	0			c.G2841A						.						76.0	79.0	78.0					4																	22390453		2203	4300	6503	SO:0001819	synonymous_variant	166647	exon19			TTTGCGCTCAGGG	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2841G>A	chr4.hg19:g.22390453C>T		107.0	0.0		98.0	37.0	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	hg19	CCDS33964.1																																																																																			.	.		0.443	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
TAF11	6882	hgsc.bcm.edu	37	6	34846457	34846457	+	Silent	SNP	T	T	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr6:34846457T>C	ENST00000361288.4	-	5	677	c.546A>G	c.(544-546)ctA>ctG	p.L182L	TAF11_ENST00000420584.2_Missense_Mutation_p.Y150C|UHRF1BP1_ENST00000452449.2_Intron	NM_005643.3	NP_005634.1	Q15544	TAF11_HUMAN	TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa	182					gene expression (GO:0010467)|positive regulation by host of viral transcription (GO:0043923)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)	6						GTTTGGGTTGTAGTGGTGGCA	0.398																																					p.Y150C		Atlas-SNP	.											.	TAF11	15	.	0			c.A449G						.						198.0	175.0	183.0					6																	34846457		2203	4300	6503	SO:0001819	synonymous_variant	6882	exon4			GGGTTGTAGTGGT	X83928	CCDS4797.1, CCDS59014.1	6p21	2008-02-05	2002-08-29	2001-12-07	ENSG00000064995	ENSG00000064995			11544	protein-coding gene	gene with protein product		600772	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, I, 28kD"""	TAF2I		7729427, 8820923	Standard	NM_005643		Approved	TAFII28	uc003ojw.2	Q15544	OTTHUMG00000014556	ENST00000361288.4:c.546A>G	chr6.hg19:g.34846457T>C		73.0	0.0		74.0	27.0	NM_001270488	B2R8R3|B4DY18|Q9UHS0	Missense_Mutation	SNP	ENST00000361288.4	hg19	CCDS4797.1	.	.	.	.	.	.	.	.	.	.	T	12.67	2.008001	0.35415	.	.	ENSG00000064995	ENST00000420584	T	0.49720	0.77	5.46	-9.19	0.00685	.	.	.	.	.	T	0.12817	0.0311	.	.	.	0.24960	N	0.991735	B	0.02656	0.0	B	0.01281	0.0	T	0.31586	-0.9938	8	0.44086	T	0.13	.	10.9019	0.47056	0.0:0.4852:0.2847:0.2301	.	150	B4DY18	.	C	150	ENSP00000408121:Y150C	ENSP00000408121:Y150C	Y	-	2	0	TAF11	34954435	0.007000	0.16637	0.210000	0.23637	0.854000	0.48673	-1.240000	0.02914	-1.528000	0.01756	-1.209000	0.01634	TAC	.	.		0.398	TAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040259.1	NM_005643	
PCMT1	5110	hgsc.bcm.edu	37	6	150114716	150114716	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr6:150114716A>G	ENST00000367380.5	+	5	536	c.329A>G	c.(328-330)gAt>gGt	p.D110G	PCMT1_ENST00000367378.1_Missense_Mutation_p.D168G|PCMT1_ENST00000367384.2_Missense_Mutation_p.D168G|PCMT1_ENST00000544496.1_Missense_Mutation_p.D75G|RP11-350J20.5_ENST00000455607.2_RNA|PCMT1_ENST00000464889.1_Missense_Mutation_p.D168G	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase	110					protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		ATAGGAATTGATCACATTAAA	0.363																																					p.D168G		Atlas-SNP	.											.	PCMT1	27	.	0			c.A503G						.						71.0	74.0	73.0					6																	150114716		2203	4299	6502	SO:0001583	missense	5110	exon5			GAATTGATCACAT		CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.329A>G	chr6.hg19:g.150114716A>G	ENSP00000356350:p.Asp110Gly	199.0	0.0		227.0	77.0	NM_005389	A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	Missense_Mutation	SNP	ENST00000367380.5	hg19		.	.	.	.	.	.	.	.	.	.	A	28.5	4.927466	0.92389	.	.	ENSG00000120265	ENST00000367384;ENST00000367378;ENST00000464889;ENST00000367380;ENST00000544496;ENST00000495487	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;0.85;1.03	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.84047	0.5386	H	0.96604	3.85	0.80722	D	1	P;D;D	0.89917	0.92;1.0;0.992	P;D;P	0.76071	0.678;0.987;0.905	D	0.89692	0.3898	10	0.87932	D	0	-16.0912	16.0958	0.81123	1.0:0.0:0.0:0.0	.	75;110;110	B7Z972;P22061-2;P22061	.;.;PIMT_HUMAN	G	168;168;168;110;75;79	ENSP00000356354:D168G;ENSP00000356348:D168G;ENSP00000420813:D168G;ENSP00000356350:D110G;ENSP00000438247:D75G;ENSP00000418881:D79G	ENSP00000356348:D168G	D	+	2	0	PCMT1	150156409	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.175000	0.94831	2.203000	0.70933	0.482000	0.46254	GAT	.	.		0.363	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
MALSU1	115416	hgsc.bcm.edu	37	7	23338987	23338987	+	Missense_Mutation	SNP	C	C	T	rs375849242	byFrequency	TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr7:23338987C>T	ENST00000466681.1	+	1	169	c.16C>T	c.(16-18)Cgt>Tgt	p.R6C	MALSU1_ENST00000479974.1_Intron	NM_138446.1	NP_612455.1	Q96EH3	MASU1_HUMAN	mitochondrial assembly of ribosomal large subunit 1	6					negative regulation of mitochondrial translation (GO:0070130)|ribosomal large subunit biogenesis (GO:0042273)	mitochondrion (GO:0005739)											GCCGGGCGGCCGTGTGGCGCG	0.716													C|||	3	0.000599042	0.0023	0.0	5008	,	,		14891	0.0		0.0	False		,,,				2504	0.0				p.R6C		Atlas-SNP	.											.	.	.	.	0			c.C16T						.	C	CYS/ARG	2,3838		0,2,1918	6.0	8.0	7.0		16	-0.2	0.0	7		7	0,8006		0,0,4003	no	missense	C7orf30	NM_138446.1	180	0,2,5921	TT,TC,CC		0.0,0.0521,0.0169	benign	6/235	23338987	2,11844	1920	4003	5923	SO:0001583	missense	115416	exon1			GGCGGCCGTGTGG	BC012331	CCDS5381.1	7p15.3	2013-05-24	2012-02-20	2012-02-20	ENSG00000156928	ENSG00000156928			21721	protein-coding gene	gene with protein product		614624	"""chromosome 7 open reading frame 30"""	C7orf30		22238376, 22238375	Standard	NM_138446		Approved	mtRsfA	uc003swd.1	Q96EH3	OTTHUMG00000128443	ENST00000466681.1:c.16C>T	chr7.hg19:g.23338987C>T	ENSP00000419370:p.Arg6Cys	79.0	0.0		123.0	32.0	NM_138446	A4D154	Missense_Mutation	SNP	ENST00000466681.1	hg19	CCDS5381.1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.575492	0.28092	5.21E-4	0.0	ENSG00000156928	ENST00000466681	.	.	.	3.57	-0.161	0.13371	.	1.153800	0.06419	N	0.722092	T	0.13798	0.0334	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23976	-1.0173	9	0.25751	T	0.34	-0.0559	5.8948	0.18933	0.0:0.3614:0.0:0.6386	.	6	Q96EH3	CG030_HUMAN	C	6	.	ENSP00000419370:R6C	R	+	1	0	C7orf30	23305512	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.227000	0.02950	-0.025000	0.13918	-0.238000	0.12139	CGT	.	.		0.716	MALSU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250241.2	NM_138446	
ABCA13	154664	hgsc.bcm.edu	37	7	48431534	48431534	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr7:48431534C>T	ENST00000435803.1	+	38	11695	c.11671C>T	c.(11671-11673)Ctc>Ttc	p.L3891F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3891	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GTTGACGGGGCTCCACCCTCC	0.532																																					p.L3891F		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C11671T						.						74.0	74.0	74.0					7																	48431534		2014	4167	6181	SO:0001583	missense	154664	exon38			ACGGGGCTCCACC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11671C>T	chr7.hg19:g.48431534C>T	ENSP00000411096:p.Leu3891Phe	99.0	0.0		166.0	33.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106013	0.37145	.	.	ENSG00000179869	ENST00000435803	D	0.94862	-3.54	4.95	4.06	0.47325	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.31922	U	0.006851	D	0.95658	0.8588	L	0.53729	1.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95304	0.8406	10	0.72032	D	0.01	.	10.6604	0.45698	0.0:0.907:0.0:0.093	.	1593;3891	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	F	3891	ENSP00000411096:L3891F	ENSP00000411096:L3891F	L	+	1	0	ABCA13	48402080	0.988000	0.35896	0.058000	0.19502	0.140000	0.21249	2.848000	0.48278	2.296000	0.77279	0.467000	0.42956	CTC	.	.		0.532	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
GPC2	221914	hgsc.bcm.edu	37	7	99768966	99768966	+	Silent	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr7:99768966C>T	ENST00000292377.2	-	9	1571	c.1404G>A	c.(1402-1404)cgG>cgA	p.R468R	GAL3ST4_ENST00000423751.1_5'Flank|GAL3ST4_ENST00000360039.4_5'Flank|GPC2_ENST00000471050.1_5'UTR	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	468					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCGACGCCGCCGTGTCGGGA	0.711																																					p.R468R		Atlas-SNP	.											.	GPC2	49	.	0			c.G1404A						.						7.0	9.0	8.0					7																	99768966		2082	4132	6214	SO:0001819	synonymous_variant	221914	exon9			ACGCCGCCGTGTC	BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.1404G>A	chr7.hg19:g.99768966C>T		105.0	0.0		223.0	66.0	NM_152742	A4D2A7	Silent	SNP	ENST00000292377.2	hg19	CCDS5689.1																																																																																			.	.		0.711	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337556.1	NM_152742	
ZNF862	643641	hgsc.bcm.edu	37	7	149543298	149543298	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr7:149543298G>A	ENST00000223210.4	+	3	440	c.195G>A	c.(193-195)tgG>tgA	p.W65*		NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	65	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						CAGAGCCATGGCTTGGCAGCG	0.567																																					p.W65X		Atlas-SNP	.											.	ZNF862	97	.	0			c.G195A						.						30.0	33.0	32.0					7																	149543298		2015	4185	6200	SO:0001587	stop_gained	643641	exon3			GCCATGGCTTGGC	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.195G>A	chr7.hg19:g.149543298G>A	ENSP00000223210:p.Trp65*	229.0	0.0		359.0	199.0	NM_001099220	A0AUL8	Nonsense_Mutation	SNP	ENST00000223210.4	hg19	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	G	37	6.512028	0.97624	.	.	ENSG00000106479	ENST00000223210	.	.	.	4.78	4.78	0.61160	.	0.000000	0.45867	D	0.000322	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-33.042	13.3385	0.60530	0.0:0.0:1.0:0.0	.	.	.	.	X	65	.	ENSP00000223210:W65X	W	+	3	0	ZNF862	149174231	0.997000	0.39634	0.970000	0.41538	0.910000	0.53928	3.992000	0.56980	2.192000	0.70111	0.655000	0.94253	TGG	.	.		0.567	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
EN2	2020	hgsc.bcm.edu	37	7	155251300	155251300	+	Silent	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr7:155251300G>A	ENST00000297375.4	+	1	477	c.228G>A	c.(226-228)cgG>cgA	p.R76R	AC008060.8_ENST00000419225.1_lincRNA	NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	76					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACATCCTGCGGCCCGAGTTCG	0.746																																					p.R76R		Atlas-SNP	.											.	EN2	14	.	0			c.G228A						.						8.0	6.0	7.0					7																	155251300		2007	3913	5920	SO:0001819	synonymous_variant	2020	exon1			CCTGCGGCCCGAG		CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.228G>A	chr7.hg19:g.155251300G>A		82.0	0.0		70.0	38.0	NM_001427	A4D252|Q549U3|Q9UD58	Silent	SNP	ENST00000297375.4	hg19	CCDS5940.1																																																																																			.	.		0.746	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322337.1	NM_001427	
TRIB1	10221	hgsc.bcm.edu	37	8	126443458	126443458	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr8:126443458T>C	ENST00000311922.3	+	1	896	c.314T>C	c.(313-315)gTg>gCg	p.V105A	TRIB1_ENST00000519576.1_5'Flank|TRIB1_ENST00000520847.1_5'Flank	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CGCGAGCATGTGTCCCGGGCG	0.781																																					p.V105A		Atlas-SNP	.											.	TRIB1	73	.	0			c.T314C						.						2.0	2.0	2.0					8																	126443458		1534	3303	4837	SO:0001583	missense	10221	exon1			AGCATGTGTCCCG	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.314T>C	chr8.hg19:g.126443458T>C	ENSP00000312150:p.Val105Ala	22.0	0.0		52.0	10.0	NM_025195		Missense_Mutation	SNP	ENST00000311922.3	hg19	CCDS6357.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368782	0.42003	.	.	ENSG00000173334	ENST00000311922	D	0.84146	-1.81	3.22	3.22	0.36961	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.30492	U	0.009509	D	0.86268	0.5892	M	0.81341	2.54	0.80722	D	1	B	0.29232	0.238	B	0.37731	0.257	D	0.86597	0.1864	10	0.87932	D	0	-11.7931	9.7899	0.40699	0.0:0.0:0.0:1.0	.	105	Q96RU8	TRIB1_HUMAN	A	105	ENSP00000312150:V105A	ENSP00000312150:V105A	V	+	2	0	TRIB1	126512640	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.614000	0.61183	1.455000	0.47813	0.379000	0.24179	GTG	.	.		0.781	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195	
TG	7038	hgsc.bcm.edu	37	8	133899121	133899121	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr8:133899121C>T	ENST00000220616.4	+	9	1544	c.1504C>T	c.(1504-1506)Cag>Tag	p.Q502*	TG_ENST00000377869.1_Nonsense_Mutation_p.Q502*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	502					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TCAATTTTTCCAGCAACTTGG	0.443																																					p.Q502X		Atlas-SNP	.											.	TG	416	.	0			c.C1504T						.						61.0	63.0	62.0					8																	133899121		2203	4300	6503	SO:0001587	stop_gained	7038	exon9			TTTTTCCAGCAAC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1504C>T	chr8.hg19:g.133899121C>T	ENSP00000220616:p.Gln502*	126.0	0.0		296.0	68.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	C	38	6.916995	0.97932	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	.	.	.	5.81	5.81	0.92471	.	0.794825	0.11388	N	0.569117	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5096	0.75769	0.1386:0.8614:0.0:0.0	.	.	.	.	X	502	.	ENSP00000220616:Q502X	Q	+	1	0	TG	133968303	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.404000	0.34623	2.752000	0.94435	0.557000	0.71058	CAG	.	.		0.443	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
EPPK1	83481	hgsc.bcm.edu	37	8	144940731	144940732	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr8:144940731_144940732CC>AG	ENST00000525985.1	-	2	6761_6762	c.6690_6691GG>CT	c.(6688-6693)ctGGtg>ctCTtg	p.V2231L				P58107	EPIPL_HUMAN	epiplakin 1	2231						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.L2230L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTGGCGGGCACCAGGACGCCCG	0.683																																					p.V2231L|p.L2230L		Atlas-SNP	.											.|EPPK1,NS,carcinoma,0,1	EPPK1	199	.	1	Substitution - coding silent(1)	kidney(1)	c.G6691T|c.G6690C						.																																			SO:0001583	missense	83481	exon1			CGGGCACCAGGAC|GGGCACCAGGACG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6690_6691delinsAG	chr8.hg19:g.144940731_144940732delinsAG	ENSP00000436337:p.Val2231Leu	45.0|48.0	0.0		109.0|111.0	24.0|23.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation|Silent	SNP	ENST00000525985.1	hg19																																																																																				.	.		0.683	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PARP10	84875	hgsc.bcm.edu	37	8	145057702	145057702	+	Silent	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr8:145057702G>A	ENST00000313028.7	-	8	2149	c.2055C>T	c.(2053-2055)ctC>ctT	p.L685L	PARP10_ENST00000524918.1_Silent_p.L676L|PARP10_ENST00000525773.1_Silent_p.L697L|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	685	Glu-rich.				negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCAGCAGGGAGAGGGTTAGGG	0.672																																					p.L685L		Atlas-SNP	.											.	PARP10	57	.	0			c.C2055T						.						14.0	16.0	16.0					8																	145057702		2201	4296	6497	SO:0001819	synonymous_variant	84875	exon8			CAGGGAGAGGGTT	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.2055C>T	chr8.hg19:g.145057702G>A		59.0	0.0		171.0	21.0	NM_032789	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Silent	SNP	ENST00000313028.7	hg19	CCDS34960.1																																																																																			.	.		0.672	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
COL27A1	85301	hgsc.bcm.edu	37	9	117020825	117020825	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr9:117020825C>T	ENST00000356083.3	+	28	3537	c.3146C>T	c.(3145-3147)cCt>cTt	p.P1049L		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1049	Collagen-like 7.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						TCCCAGGGTCCTCCAGGATCT	0.622																																					p.P1049L		Atlas-SNP	.											.	COL27A1	200	.	0			c.C3146T						.						48.0	47.0	47.0					9																	117020825		2203	4300	6503	SO:0001583	missense	85301	exon28			AGGGTCCTCCAGG	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3146C>T	chr9.hg19:g.117020825C>T	ENSP00000348385:p.Pro1049Leu	67.0	0.0		95.0	40.0	NM_032888	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	hg19	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	7.822	0.717979	0.15372	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.96041	-3.89	5.09	5.09	0.68999	.	.	.	.	.	D	0.91405	0.7288	L	0.39898	1.24	0.58432	D	0.999999	P	0.50066	0.931	B	0.42112	0.376	D	0.89816	0.3985	9	0.07990	T	0.79	.	13.9936	0.64382	0.0:1.0:0.0:0.0	.	1049	Q8IZC6	CORA1_HUMAN	L	1049	ENSP00000348385:P1049L	ENSP00000348385:P1049L	P	+	2	0	COL27A1	116060646	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.797000	0.47877	2.365000	0.80145	0.462000	0.41574	CCT	.	.		0.622	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
BTAF1	9044	hgsc.bcm.edu	37	10	93716306	93716306	+	Silent	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr10:93716306G>A	ENST00000265990.6	+	7	1031	c.723G>A	c.(721-723)gaG>gaA	p.E241E		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	241					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				CTGATGGGGAGCCAGAAGAAA	0.318																																					p.E241E		Atlas-SNP	.											.	BTAF1	148	.	0			c.G723A						.						72.0	65.0	68.0					10																	93716306		2203	4300	6503	SO:0001819	synonymous_variant	9044	exon7			TGGGGAGCCAGAA	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.723G>A	chr10.hg19:g.93716306G>A		52.0	0.0		107.0	31.0	NM_003972	B4E0W6|O43578	Silent	SNP	ENST00000265990.6	hg19	CCDS7419.1																																																																																			.	.		0.318	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
SUFU	51684	hgsc.bcm.edu	37	10	104389858	104389858	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr10:104389858G>T	ENST00000369902.3	+	12	1567	c.1401G>T	c.(1399-1401)aaG>aaT	p.K467N		NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	467					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GGCCTGAAAAGAAGCTGAAGG	0.577			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.K467N		Atlas-SNP	.	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	SUFU	44	.	0			c.G1401T						.						230.0	197.0	208.0					10																	104389858		2203	4300	6503	SO:0001583	missense	51684	exon12	Familial Cancer Database		TGAAAAGAAGCTG	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.1401G>T	chr10.hg19:g.104389858G>T	ENSP00000358918:p.Lys467Asn	113.0	0.0		164.0	43.0	NM_016169	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	hg19	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382920	0.61845	.	.	ENSG00000107882	ENST00000369902	T	0.49432	0.78	5.59	5.59	0.84812	Suppressor of fused C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48589	0.1508	L	0.56769	1.78	0.80722	D	1	B	0.22080	0.064	B	0.24269	0.052	T	0.39583	-0.9607	10	0.40728	T	0.16	-14.1683	17.7787	0.88517	0.0:0.0:1.0:0.0	.	467	Q9UMX1	SUFU_HUMAN	N	467	ENSP00000358918:K467N	ENSP00000358918:K467N	K	+	3	2	SUFU	104379848	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.533000	0.60615	2.644000	0.89710	0.561000	0.74099	AAG	.	.		0.577	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
OR5W2	390148	hgsc.bcm.edu	37	11	55681633	55681633	+	Silent	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr11:55681633A>G	ENST00000344514.1	-	1	425	c.426T>C	c.(424-426)taT>taC	p.Y142Y		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TCAAGAGTAGATAGCACACTC	0.463																																					p.Y142Y	Melanoma(48;171 1190 15239 43886 49348)	Atlas-SNP	.											.	OR5W2	112	.	0			c.T426C						.						69.0	63.0	65.0					11																	55681633		2201	4296	6497	SO:0001819	synonymous_variant	390148	exon1			GAGTAGATAGCAC	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.426T>C	chr11.hg19:g.55681633A>G		66.0	0.0		90.0	30.0	NM_001001960		Silent	SNP	ENST00000344514.1	hg19	CCDS31513.1																																																																																			.	.		0.463	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
WDR74	54663	hgsc.bcm.edu	37	11	62601897	62601897	+	Splice_Site	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr11:62601897A>G	ENST00000525239.1	-	8	1257		c.e8+1		STX5_ENST00000394690.1_5'Flank|WDR74_ENST00000540620.1_5'Flank|STX5_ENST00000541317.1_5'Flank|WDR74_ENST00000525752.1_Splice_Site|WDR74_ENST00000278856.4_Splice_Site|RP11-727F15.9_ENST00000535817.1_RNA|STX5_ENST00000294179.3_5'Flank|RP11-727F15.9_ENST00000535867.1_RNA|WDR74_ENST00000529106.1_Splice_Site|WDR74_ENST00000311713.7_Splice_Site|STX5_ENST00000377897.4_5'Flank			Q6RFH5	WDR74_HUMAN	WD repeat domain 74						blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						CTAAACACTCACTTGCCTCCC	0.592																																					.		Atlas-SNP	.											.	WDR74	36	.	0			c.719+2T>C						.						29.0	29.0	29.0					11																	62601897		1848	4097	5945	SO:0001630	splice_region_variant	54663	exon9			ACACTCACTTGCC		CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.719+1T>C	chr11.hg19:g.62601897A>G		40.0	0.0		43.0	16.0	NM_018093	A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Splice_Site	SNP	ENST00000525239.1	hg19	CCDS44630.1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.074562	0.55646	.	.	ENSG00000133316	ENST00000311713;ENST00000529106;ENST00000525239;ENST00000278856;ENST00000525752	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0273	0.36239	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR74	62358473	0.764000	0.28473	0.997000	0.53966	0.968000	0.65278	0.922000	0.28734	1.614000	0.50241	0.379000	0.24179	.	.	.		0.592	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395678.1	NM_018093	Intron
C11orf95	65998	hgsc.bcm.edu	37	11	63533598	63533598	+	lincRNA	SNP	G	G	A	rs376973642		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr11:63533598G>A	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							GCCAGTGGTCGTGGTAGTAGC	0.637																																					p.H106H		Atlas-SNP	.											.	.	.	.	0			c.C318T						.	G		0,1384		0,0,692	30.0	39.0	36.0		318	-1.1	1.0	11		36	1,3181		0,1,1590	no	coding-synonymous	C11orf95	NM_001144936.1		0,1,2282	AA,AG,GG		0.0314,0.0,0.0219		106/679	63533598	1,4565	692	1591	2283			65998	exon2			GTGGTCGTGGTAG																													chr11.hg19:g.63533598G>A		50.0	0.0		67.0	39.0	NM_001144936		Silent	SNP	ENST00000546282.2	hg19																																																																																				.	.		0.637	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000396567.2		
EIF1AD	84285	hgsc.bcm.edu	37	11	65767088	65767088	+	Silent	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr11:65767088C>T	ENST00000312234.2	-	4	589	c.255G>A	c.(253-255)tcG>tcA	p.S85S	EIF1AD_ENST00000533544.1_Silent_p.S85S|EIF1AD_ENST00000529964.1_Silent_p.S85S|EIF1AD_ENST00000525767.1_Silent_p.S33S|BANF1_ENST00000445560.2_5'Flank|EIF1AD_ENST00000527249.1_Silent_p.S85S|BANF1_ENST00000533166.1_5'Flank|EIF1AD_ENST00000526451.1_Silent_p.S85S|BANF1_ENST00000312175.2_5'Flank	NM_001242481.1|NM_001242482.1|NM_001242483.1|NM_032325.3	NP_001229410.1|NP_001229411.1|NP_001229412.1|NP_115701.2	Q8N9N8	EIF1A_HUMAN	eukaryotic translation initiation factor 1A domain containing	85	S1-like. {ECO:0000255|PROSITE- ProRule:PRU00181}.					intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	translation initiation factor activity (GO:0003743)			lung(5)	5						AGAGCACAAACGAGATTTCAG	0.512																																					p.S85S		Atlas-SNP	.											.	EIF1AD	10	.	0			c.G255A						.						130.0	115.0	120.0					11																	65767088		2201	4296	6497	SO:0001819	synonymous_variant	84285	exon4			CACAAACGAGATT	AK094129	CCDS8124.1	11q13.1	2009-05-27				ENSG00000175376			28147	protein-coding gene	gene with protein product						12477932	Standard	NM_001242482		Approved	MGC11102, haponin	uc001ogn.2	Q8N9N8		ENST00000312234.2:c.255G>A	chr11.hg19:g.65767088C>T		115.0	0.0		126.0	56.0	NM_001242483	B2R4N5|Q9BSC1	Silent	SNP	ENST00000312234.2	hg19	CCDS8124.1																																																																																			.	.		0.512	EIF1AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391072.1	NM_032325	
ATP5B	506	hgsc.bcm.edu	37	12	57037707	57037707	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr12:57037707A>G	ENST00000262030.3	-	4	571	c.521T>C	c.(520-522)aTg>aCg	p.M174T	SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000552919.1_Missense_Mutation_p.M174T|ATP5B_ENST00000550162.1_5'Flank	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	174					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACTCATTTCCATGAACTCTGG	0.408																																					p.M174T		Atlas-SNP	.											.	ATP5B	48	.	0			c.T521C						.						111.0	95.0	101.0					12																	57037707		2203	4300	6503	SO:0001583	missense	506	exon4			ATTTCCATGAACT	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.521T>C	chr12.hg19:g.57037707A>G	ENSP00000262030:p.Met174Thr	74.0	0.0		81.0	27.0	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	hg19	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.608718	0.28623	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020	T;T;T	0.81078	-1.45;-1.45;-1.45	5.68	5.68	0.88126	.	0.516257	0.24534	N	0.037691	T	0.59959	0.2232	N	0.02266	-0.62	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48352	-0.9043	10	0.26408	T	0.33	1.8835	14.9317	0.70919	1.0:0.0:0.0:0.0	.	174	P06576	ATPB_HUMAN	T	174;174;113	ENSP00000262030:M174T;ENSP00000450297:M174T;ENSP00000446677:M113T	ENSP00000262030:M174T	M	-	2	0	ATP5B	55323974	0.669000	0.27502	0.402000	0.26371	0.853000	0.48598	4.649000	0.61433	2.174000	0.68829	0.379000	0.24179	ATG	.	.		0.408	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
ARHGAP9	64333	hgsc.bcm.edu	37	12	57868703	57868703	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr12:57868703C>A	ENST00000356411.2	-	13	1801	c.1663G>T	c.(1663-1665)Gtg>Ttg	p.V555L	ARHGAP9_ENST00000430041.2_Missense_Mutation_p.V352L|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.V615L|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.V536L|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.V536L|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.V626L|ARHGAP9_ENST00000550454.1_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	555	Lipid binding.|Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			AAGCTGGGCACCGTGTCTCCT	0.547																																					p.V536L		Atlas-SNP	.											.	ARHGAP9	79	.	0			c.G1606T						.						56.0	53.0	54.0					12																	57868703		2203	4300	6503	SO:0001583	missense	64333	exon12			TGGGCACCGTGTC	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1663G>T	chr12.hg19:g.57868703C>A	ENSP00000348782:p.Val555Leu	59.0	0.0		73.0	25.0	NM_001080157	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	hg19		.	.	.	.	.	.	.	.	.	.	C	34	5.351428	0.95830	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000423291;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041;ENST00000550130	T;T;T;T;T;T	0.45668	0.89;0.89;2.63;0.89;0.89;2.63	5.2	5.2	0.72013	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.60818	0.2298	L	0.53249	1.67	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;0.994;1.0;0.999;0.998	D;D;D;D;D	0.83275	0.987;0.97;0.994;0.996;0.963	T	0.61816	-0.6985	10	0.87932	D	0	.	16.5038	0.84263	0.0:1.0:0.0:0.0	.	615;555;536;536;352	Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9;B4DVI3	.;RHG09_HUMAN;.;.;.	L	536;555;206;536;626;585;352;43	ENSP00000377380:V536L;ENSP00000348782:V555L;ENSP00000394307:V536L;ENSP00000377386:V626L;ENSP00000397950:V352L;ENSP00000448423:V43L	ENSP00000344852:V585L	V	-	1	0	ARHGAP9	56154970	0.996000	0.38824	0.984000	0.44739	0.998000	0.95712	3.474000	0.53129	2.822000	0.97130	0.650000	0.86243	GTG	.	.		0.547	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496	
RASSF3	283349	hgsc.bcm.edu	37	12	65085254	65085254	+	Silent	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr12:65085254C>T	ENST00000542104.1	+	4	582	c.462C>T	c.(460-462)taC>taT	p.Y154Y	RASSF3_ENST00000336061.2_Silent_p.Y154Y	NM_178169.3	NP_835463.1	Q86WH2	RASF3_HUMAN	Ras association (RalGDS/AF-6) domain family member 3	154	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)		ACCCAGTCTACGCCTGCAAGC	0.488																																					p.Y154Y		Atlas-SNP	.											.	RASSF3	18	.	0			c.C462T						.						99.0	82.0	88.0					12																	65085254		2203	4300	6503	SO:0001819	synonymous_variant	283349	exon4			AGTCTACGCCTGC		CCDS8969.1	12q14.2	2008-02-22	2008-02-22		ENSG00000153179	ENSG00000153179			14271	protein-coding gene	gene with protein product		607019					Standard	NM_178169		Approved		uc001ssd.3	Q86WH2	OTTHUMG00000168812	ENST00000542104.1:c.462C>T	chr12.hg19:g.65085254C>T		100.0	0.0		77.0	32.0	NM_178169	Q86WH1	Silent	SNP	ENST00000542104.1	hg19	CCDS8969.1																																																																																			.	.		0.488	RASSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401161.1		
TRPV4	59341	hgsc.bcm.edu	37	12	110238504	110238504	+	Missense_Mutation	SNP	C	C	A	rs138419280		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr12:110238504C>A	ENST00000418703.2	-	4	866	c.772G>T	c.(772-774)Gtg>Ttg	p.V258L	TRPV4_ENST00000537083.1_Missense_Mutation_p.V258L|TRPV4_ENST00000541794.1_Intron|TRPV4_ENST00000392719.2_Intron|TRPV4_ENST00000261740.2_Missense_Mutation_p.V258L|TRPV4_ENST00000536838.1_Missense_Mutation_p.V224L|TRPV4_ENST00000346520.2_Missense_Mutation_p.V258L|TRPV4_ENST00000544971.1_Intron	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	258					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CCCTGGGCCACGAGAAGTTCC	0.642																																					p.V258L		Atlas-SNP	.											.	TRPV4	88	.	0			c.G772T						.						84.0	67.0	73.0					12																	110238504		2203	4300	6503	SO:0001583	missense	59341	exon4			GGGCCACGAGAAG	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.772G>T	chr12.hg19:g.110238504C>A	ENSP00000406191:p.Val258Leu	47.0	0.0		65.0	17.0	NM_147204	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	hg19	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698659	0.48307	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000346520;ENST00000537083;ENST00000536838	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	4.92	4.03	0.46877	Ankyrin repeat-containing domain (3);	0.184267	0.47852	D	0.000214	T	0.32285	0.0824	N	0.00778	-1.195	0.36571	D	0.872994	D;B;B	0.76494	0.999;0.262;0.312	D;B;B	0.79784	0.993;0.047;0.147	T	0.39014	-0.9634	10	0.08599	T	0.76	-12.1954	12.0442	0.53471	0.0:0.9156:0.0:0.0844	.	258;258;224	Q9HBA0-2;Q9HBA0;Q9HBA0-5	.;TRPV4_HUMAN;.	L	258;258;258;258;224	ENSP00000406191:V258L;ENSP00000261740:V258L;ENSP00000319003:V258L;ENSP00000442738:V258L;ENSP00000444336:V224L	ENSP00000261740:V258L	V	-	1	0	TRPV4	108722887	1.000000	0.71417	0.963000	0.40424	0.371000	0.29859	3.548000	0.53670	1.210000	0.43336	0.655000	0.94253	GTG	.	C|1.000;T|0.000		0.642	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
HECTD4	283450	hgsc.bcm.edu	37	12	112617070	112617070	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr12:112617070G>A	ENST00000430131.2	-	62	10998	c.9853C>T	c.(9853-9855)Cag>Tag	p.Q3285*	HECTD4_ENST00000550722.1_Nonsense_Mutation_p.Q3561*|HECTD4_ENST00000377560.5_Nonsense_Mutation_p.Q3535*			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3285					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GAGTTGATCTGCTCTTTGCTA	0.532																																					p.Q3573X		Atlas-SNP	.											.	.	.	.	0			c.C10717T						.						89.0	98.0	95.0					12																	112617070		2029	4187	6216	SO:0001587	stop_gained	283450	exon63			TGATCTGCTCTTT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9853C>T	chr12.hg19:g.112617070G>A	ENSP00000404379:p.Gln3285*	109.0	0.0		130.0	49.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Nonsense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	G	56	25.940885	0.99967	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6433	0.95764	0.0:0.0:1.0:0.0	.	.	.	.	X	3535;3285;3561	.	ENSP00000366783:Q3535X	Q	-	1	0	C12orf51	111101453	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.334000	0.96470	2.638000	0.89438	0.591000	0.81541	CAG	.	.		0.532	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
TBX3	6926	hgsc.bcm.edu	37	12	115118848	115118848	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr12:115118848A>T	ENST00000257566.3	-	2	882	c.493T>A	c.(493-495)Ttt>Att	p.F165I	TBX3_ENST00000349155.2_Missense_Mutation_p.F165I	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	165					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GAATTGTGAAATTTATAACGA	0.448																																					p.F165I		Atlas-SNP	.											.	TBX3	106	.	0			c.T493A						.						122.0	125.0	124.0					12																	115118848		2203	4300	6503	SO:0001583	missense	6926	exon2			TGTGAAATTTATA	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.493T>A	chr12.hg19:g.115118848A>T	ENSP00000257566:p.Phe165Ile	165.0	0.0		211.0	82.0	NM_005996	Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	hg19	CCDS9176.1	.	.	.	.	.	.	.	.	.	.	A	36	5.599905	0.96614	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.92495	-3.05;-3.05	5.81	5.81	0.92471	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97362	0.9137	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	0.986;1.0;0.997	D;D;D	0.81914	0.961;0.995;0.99	D	0.98543	1.0633	10	0.87932	D	0	.	15.352	0.74396	1.0:0.0:0.0:0.0	.	165;165;165	B4E3A6;O15119-2;O15119	.;.;TBX3_HUMAN	I	165	ENSP00000257567:F165I;ENSP00000257566:F165I	ENSP00000257566:F165I	F	-	1	0	TBX3	113603231	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.962000	0.93254	2.225000	0.72522	0.533000	0.62120	TTT	.	.		0.448	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996	
MPHOSPH8	54737	hgsc.bcm.edu	37	13	20237193	20237193	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr13:20237193C>T	ENST00000361479.5	+	9	2014	c.1946C>T	c.(1945-1947)aCa>aTa	p.T649I	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.T649I	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	649					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		TTTTTAACAACAGTGGCTATT	0.343																																					p.T649I		Atlas-SNP	.											.	MPHOSPH8	58	.	0			c.C1946T						.						101.0	108.0	106.0					13																	20237193		2203	4300	6503	SO:0001583	missense	54737	exon9			TAACAACAGTGGC	AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1946C>T	chr13.hg19:g.20237193C>T	ENSP00000355388:p.Thr649Ile	79.0	0.0		73.0	26.0	NM_017520	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	hg19	CCDS9287.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372171	0.61624	.	.	ENSG00000196199	ENST00000414242;ENST00000361479	T;T	0.61274	0.12;0.12	5.33	5.33	0.75918	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.59390	0.2190	N	0.04746	-0.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68146	-0.5486	10	0.46703	T	0.11	.	19.0094	0.92867	0.0:1.0:0.0:0.0	.	649;649	Q99549;Q99549-2	MPP8_HUMAN;.	I	649	ENSP00000414663:T649I;ENSP00000355388:T649I	ENSP00000355388:T649I	T	+	2	0	MPHOSPH8	19135193	1.000000	0.71417	0.720000	0.30636	0.541000	0.35023	7.210000	0.77924	2.479000	0.83701	0.555000	0.69702	ACA	.	.		0.343	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2	NM_017520	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111767970	111767970	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr13:111767970G>A	ENST00000375741.2	+	1	347	c.97G>A	c.(97-99)Gcg>Acg	p.A33T	ARHGEF7_ENST00000317133.5_Missense_Mutation_p.A33T|ARHGEF7-AS2_ENST00000425094.2_RNA|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.A33T|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.A33T	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	33	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CTTTCTGCAGGCGTCGCTGAA	0.657																																					p.A33T		Atlas-SNP	.											.	ARHGEF7	157	.	0			c.G97A						.						21.0	21.0	21.0					13																	111767970		2202	4299	6501	SO:0001583	missense	8874	exon1			CTGCAGGCGTCGC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.97G>A	chr13.hg19:g.111767970G>A	ENSP00000364893:p.Ala33Thr	28.0	0.0		22.0	7.0	NM_001113512	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	hg19	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	g	4.575	0.106728	0.08780	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635	D;D;T;D	0.94723	-3.5;-3.5;0.69;-3.5	3.1	-0.988	0.10245	Calponin homology domain (5);	0.537042	0.15754	U	0.246273	D	0.82504	0.5051	N	0.11845	0.185	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.0	T	0.66420	-0.5928	10	0.11182	T	0.66	.	3.3069	0.07003	0.1088:0.1185:0.4698:0.303	.	33;33;33	Q14155-2;Q14155;Q14155-3	.;ARHG7_HUMAN;.	T	33;33;33;33;31	ENSP00000325994:A33T;ENSP00000364893:A33T;ENSP00000364891:A33T;ENSP00000359657:A33T	ENSP00000325994:A33T	A	+	1	0	ARHGEF7	110565971	0.961000	0.32948	0.972000	0.41901	0.803000	0.45373	0.015000	0.13355	-0.097000	0.12307	0.306000	0.20318	GCG	.	.		0.657	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
UPF3A	65110	hgsc.bcm.edu	37	13	115067260	115067260	+	Silent	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr13:115067260A>G	ENST00000375299.3	+	9	1118	c.1062A>G	c.(1060-1062)caA>caG	p.Q354Q	UPF3A_ENST00000351487.5_Silent_p.Q321Q|UPF3A_ENST00000475218.2_3'UTR	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	354					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		CTCAAGAACAAGAATCTGAAG	0.498																																					p.Q354Q		Atlas-SNP	.											.	UPF3A	47	.	0			c.A1062G						.						68.0	57.0	61.0					13																	115067260		2203	4300	6503	SO:0001819	synonymous_variant	65110	exon9			AGAACAAGAATCT	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.1062A>G	chr13.hg19:g.115067260A>G		238.0	0.0		251.0	106.0	NM_023011	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	hg19	CCDS9543.1																																																																																			.	.		0.498	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
METTL17	64745	hgsc.bcm.edu	37	14	21460771	21460771	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr14:21460771C>T	ENST00000339374.6	+	5	751	c.518C>T	c.(517-519)gCa>gTa	p.A173V	METTL17_ENST00000556670.2_Missense_Mutation_p.A173V|METTL17_ENST00000382985.4_Missense_Mutation_p.A173V	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	173					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						GTCTCCAGAGCATTCCATGAG	0.448																																					p.A173V		Atlas-SNP	.											.	METTL17	46	.	0			c.C518T						.						109.0	110.0	110.0					14																	21460771		2203	4300	6503	SO:0001583	missense	64745	exon5			CCAGAGCATTCCA	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.518C>T	chr14.hg19:g.21460771C>T	ENSP00000343041:p.Ala173Val	80.0	0.0		107.0	41.0	NM_022734	Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	ENST00000339374.6	hg19	CCDS9562.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343522	0.61073	.	.	ENSG00000165792	ENST00000339374;ENST00000382985;ENST00000553564;ENST00000554751;ENST00000555670	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.86	5.86	0.93980	.	0.196755	0.43747	D	0.000525	T	0.28267	0.0698	N	0.10707	0.03	0.44168	D	0.996974	D;D;D	0.59357	0.978;0.985;0.981	P;P;P	0.62560	0.709;0.904;0.845	T	0.04307	-1.0961	10	0.02654	T	1	.	15.6803	0.77364	0.0:1.0:0.0:0.0	.	173;173;173	Q9H7H0-3;Q9H7H0;Q9H7H0-2	.;MET17_HUMAN;.	V	173;173;91;91;91	ENSP00000343041:A173V;ENSP00000372445:A173V;ENSP00000451478:A91V;ENSP00000451049:A91V	ENSP00000343041:A173V	A	+	2	0	METTL17	20530611	0.995000	0.38212	1.000000	0.80357	0.972000	0.66771	3.222000	0.51223	2.777000	0.95525	0.655000	0.94253	GCA	.	.		0.448	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734	
NOVA1	4857	hgsc.bcm.edu	37	14	27064670	27064670	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr14:27064670G>A	ENST00000344429.5	-	2	229	c.226C>T	c.(226-228)Caa>Taa	p.Q76*	NOVA1_ENST00000547619.1_Nonsense_Mutation_p.Q76*|NOVA1_ENST00000539517.2_Nonsense_Mutation_p.Q76*|NOVA1_ENST00000551754.1_5'Flank|RP11-483C6.1_ENST00000572358.1_RNA|NOVA1_ENST00000267422.7_5'UTR|NOVA1_ENST00000465357.2_Nonsense_Mutation_p.Q76*|NOVA1-AS1_ENST00000547786.1_RNA|NOVA1_ENST00000574031.1_Nonsense_Mutation_p.Q76*	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	76	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		GTTTCTTTTTGCAACTGAACA	0.428																																					p.Q76X		Atlas-SNP	.											.	NOVA1	146	.	0			c.C226T						.						156.0	147.0	150.0					14																	27064670		2203	4300	6503	SO:0001587	stop_gained	4857	exon2			CTTTTTGCAACTG	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.226C>T	chr14.hg19:g.27064670G>A	ENSP00000342387:p.Gln76*	135.0	0.0		131.0	38.0	NM_006489	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Nonsense_Mutation	SNP	ENST00000344429.5	hg19	CCDS9635.1	.	.	.	.	.	.	.	.	.	.	G	36	5.707513	0.96821	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000449198;ENST00000549571;ENST00000344429;ENST00000547619	.	.	.	5.1	5.1	0.69264	.	0.103804	0.42420	D	0.000718	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-3.4345	18.8679	0.92300	0.0:0.0:1.0:0.0	.	.	.	.	X	76;76;35;39;76;76	.	ENSP00000342387:Q76X	Q	-	1	0	NOVA1	26134510	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.751000	0.98889	2.523000	0.85059	0.561000	0.74099	CAA	.	.		0.428	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276557.1	NM_006491	
NRXN3	9369	hgsc.bcm.edu	37	14	80130128	80130128	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr14:80130128G>T	ENST00000557594.1	+	3	1390	c.437G>T	c.(436-438)gGg>gTg	p.G146V	RP11-242P2.1_ENST00000553322.1_RNA|NRXN3_ENST00000556003.1_3'UTR|NRXN3_ENST00000554719.1_Missense_Mutation_p.G778V|NRXN3_ENST00000428277.2_Missense_Mutation_p.G146V|NRXN3_ENST00000335750.5_Missense_Mutation_p.G778V|NRXN3_ENST00000281127.7_Missense_Mutation_p.G146V	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	146	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TAGGAACAGGGGAAAATTGGA	0.428																																					p.G778V		Atlas-SNP	.											.	NRXN3	342	.	0			c.G2333T						.						87.0	84.0	85.0					14																	80130128		2203	4300	6503	SO:0001583	missense	9369	exon14			AACAGGGGAAAAT	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.437G>T	chr14.hg19:g.80130128G>T	ENSP00000451672:p.Gly146Val	128.0	0.0		178.0	59.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	hg19		.	.	.	.	.	.	.	.	.	.	G	29.7	5.028051	0.93518	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	D;D;T;T;T	0.88509	-2.39;-2.39;0.04;0.04;0.04	5.74	5.74	0.90152	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.95667	0.8591	M	0.89214	3.015	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;1.0;0.949	D;D;D;P	0.91635	0.999;0.998;0.994;0.834	D	0.95303	0.8405	9	.	.	.	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	146;146;146;778	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	V	1151;1140;778;778;146;146;146	ENSP00000451648:G778V;ENSP00000338349:G778V;ENSP00000451672:G146V;ENSP00000281127:G146V;ENSP00000394426:G146V	.	G	+	2	0	NRXN3	79199881	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.796000	0.99103	2.873000	0.98535	0.563000	0.77884	GGG	.	.		0.428	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
MGA	23269	hgsc.bcm.edu	37	15	41988500	41988500	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr15:41988500A>G	ENST00000570161.1	+	2	1292	c.1292A>G	c.(1291-1293)aAt>aGt	p.N431S	MGA_ENST00000389936.4_Missense_Mutation_p.N431S|MGA_ENST00000545763.1_Missense_Mutation_p.N431S|MGA_ENST00000568630.1_3'UTR|MGA_ENST00000566586.1_Missense_Mutation_p.N431S|MGA_ENST00000219905.7_Missense_Mutation_p.N431S			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAGAGGCACAATAAAGTTGAC	0.418																																					p.N431S		Atlas-SNP	.											.	MGA	264	.	0			c.A1292G						.						79.0	74.0	76.0					15																	41988500		1903	4123	6026	SO:0001583	missense	23269	exon3			GGCACAATAAAGT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1292A>G	chr15.hg19:g.41988500A>G	ENSP00000457035:p.Asn431Ser	86.0	0.0		113.0	45.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	hg19	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.531003	0.27387	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.83163	-1.69;-1.68;-1.68	5.53	3.21	0.36854	.	1.321340	0.04131	N	0.317906	T	0.76097	0.3940	L	0.38531	1.155	0.24664	N	0.993459	B;B	0.26363	0.147;0.005	B;B	0.29176	0.099;0.005	T	0.60717	-0.7208	10	0.32370	T	0.25	.	4.0427	0.09758	0.5008:0.1799:0.3193:0.0	.	431;431	F5H7K2;E7ENI0	.;.	S	431	ENSP00000219905:N431S;ENSP00000374586:N431S;ENSP00000442467:N431S	ENSP00000219905:N431S	N	+	2	0	MGA	39775792	0.999000	0.42202	1.000000	0.80357	0.951000	0.60555	0.807000	0.27140	0.936000	0.37367	0.459000	0.35465	AAT	.	.		0.418	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
CDAN1	146059	hgsc.bcm.edu	37	15	43020923	43020923	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr15:43020923G>C	ENST00000356231.3	-	20	2754	c.2731C>G	c.(2731-2733)Cca>Gca	p.P911A		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	911					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		AGCTGGGCTGGGTCTCCCCCT	0.627																																					p.P911A		Atlas-SNP	.											.	CDAN1	70	.	0			c.C2731G						.						74.0	61.0	65.0					15																	43020923		2203	4299	6502	SO:0001583	missense	146059	exon20			GGGCTGGGTCTCC	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2731C>G	chr15.hg19:g.43020923G>C	ENSP00000348564:p.Pro911Ala	122.0	0.0		136.0	46.0	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	hg19	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498782	0.26861	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.86230	-2.09	5.92	2.95	0.34219	.	0.355893	0.32608	N	0.005872	T	0.74419	0.3714	L	0.27053	0.805	0.31173	N	0.70298	B;B	0.09022	0.002;0.001	B;B	0.06405	0.001;0.002	T	0.63265	-0.6676	10	0.16896	T	0.51	-4.7948	6.0952	0.20017	0.1902:0.3029:0.5069:0.0	.	911;909	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	A	911;909	ENSP00000348564:P911A	ENSP00000267892:P909A	P	-	1	0	CDAN1	40808215	1.000000	0.71417	0.993000	0.49108	0.877000	0.50540	2.485000	0.45250	0.791000	0.33826	0.561000	0.74099	CCA	.	.		0.627	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
ADAMTS17	170691	hgsc.bcm.edu	37	15	100821591	100821591	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr15:100821591G>A	ENST00000268070.4	-	4	737	c.632C>T	c.(631-633)aCg>aTg	p.T211M		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	211						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCTGCCCCACGTCGGCTTCTT	0.587																																					p.T211M		Atlas-SNP	.											.	ADAMTS17	127	.	0			c.C632T						.																																			SO:0001583	missense	170691	exon4			CCCCACGTCGGCT	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.632C>T	chr15.hg19:g.100821591G>A	ENSP00000268070:p.Thr211Met	30.0	0.0		48.0	20.0	NM_139057	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	hg19	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	G	7.849	0.723675	0.15439	.	.	ENSG00000140470	ENST00000268070	T	0.62232	0.04	4.62	-1.79	0.07932	.	0.612483	0.16044	N	0.232269	T	0.32852	0.0843	N	0.14661	0.345	0.09310	N	1	P	0.36660	0.564	B	0.27796	0.083	T	0.16453	-1.0402	10	0.45353	T	0.12	.	5.5803	0.17247	0.0:0.2988:0.1495:0.5517	.	211	Q8TE56	ATS17_HUMAN	M	211	ENSP00000268070:T211M	ENSP00000268070:T211M	T	-	2	0	ADAMTS17	98639114	0.000000	0.05858	0.004000	0.12327	0.122000	0.20287	0.043000	0.13971	-0.203000	0.10251	-0.375000	0.07067	ACG	.	.		0.587	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
PDIA2	64714	hgsc.bcm.edu	37	16	335324	335324	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr16:335324A>T	ENST00000219406.6	+	6	826	c.808A>T	c.(808-810)Atc>Ttc	p.I270F	PDIA2_ENST00000462950.1_3'UTR|PDIA2_ENST00000404312.1_Missense_Mutation_p.I267F	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	270					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GTCTGCCAAGATCTTCGCGGC	0.647																																					p.I270F		Atlas-SNP	.											.	PDIA2	51	.	0			c.A808T						.						43.0	49.0	47.0					16																	335324		2106	4222	6328	SO:0001583	missense	64714	exon6			GCCAAGATCTTCG	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.808A>T	chr16.hg19:g.335324A>T	ENSP00000219406:p.Ile270Phe	54.0	0.0		74.0	33.0	NM_006849	A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Missense_Mutation	SNP	ENST00000219406.6	hg19	CCDS42089.1	.	.	.	.	.	.	.	.	.	.	a	15.51	2.854347	0.51270	.	.	ENSG00000185615	ENST00000219406;ENST00000455994;ENST00000404312	T;T	0.30714	1.52;1.52	3.97	3.97	0.46021	Thioredoxin-like fold (1);	0.055535	0.64402	D	0.000001	T	0.56572	0.1994	M	0.83223	2.63	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.63528	-0.6617	10	0.87932	D	0	.	11.9446	0.52920	1.0:0.0:0.0:0.0	.	270	Q13087	PDIA2_HUMAN	F	270;239;267	ENSP00000219406:I270F;ENSP00000384410:I267F	ENSP00000219406:I270F	I	+	1	0	PDIA2	275325	1.000000	0.71417	0.998000	0.56505	0.334000	0.28698	3.334000	0.52097	1.675000	0.50919	0.454000	0.30748	ATC	.	.		0.647	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849	
BAIAP3	8938	hgsc.bcm.edu	37	16	1391408	1391408	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr16:1391408G>A	ENST00000324385.5	+	8	912	c.754G>A	c.(754-756)Gga>Aga	p.G252R	BAIAP3_ENST00000562208.1_Missense_Mutation_p.G194R|BAIAP3_ENST00000421665.2_Missense_Mutation_p.G217R|BAIAP3_ENST00000568887.1_Missense_Mutation_p.G189R|BAIAP3_ENST00000397488.2_Missense_Mutation_p.G234R|BAIAP3_ENST00000397489.1_Missense_Mutation_p.G234R|BAIAP3_ENST00000426824.3_Missense_Mutation_p.G217R	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	252	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CAAGCGCGGTGGACCCCTGCC	0.662																																					p.G252R		Atlas-SNP	.											.	BAIAP3	88	.	0			c.G754A						.						57.0	52.0	53.0					16																	1391408		2197	4295	6492	SO:0001583	missense	8938	exon8			CGCGGTGGACCCC	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.754G>A	chr16.hg19:g.1391408G>A	ENSP00000324510:p.Gly252Arg	167.0	0.0		172.0	70.0	NM_003933	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	hg19	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490603	0.26686	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.71341	-0.55;-0.56;-0.56;-0.56;-0.5	4.72	-4.98	0.03019	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.384288	0.25566	N	0.029796	T	0.57621	0.2066	N	0.25245	0.725	0.09310	N	1	P;P;B;P;P	0.51537	0.681;0.946;0.379;0.608;0.845	P;P;B;B;P	0.52386	0.507;0.697;0.29;0.29;0.507	T	0.59316	-0.7477	10	0.62326	D	0.03	-21.123	7.1411	0.25556	0.5911:0.0:0.2883:0.1206	.	217;269;194;252;234	E7EUB9;B4DGA2;B4DIK3;O94812;A2A2B2	.;.;.;BAIP3_HUMAN;.	R	217;234;252;234;217	ENSP00000407242:G217R;ENSP00000380625:G234R;ENSP00000324510:G252R;ENSP00000380626:G234R;ENSP00000409533:G217R	ENSP00000324510:G252R	G	+	1	0	BAIAP3	1331409	0.677000	0.27577	0.000000	0.03702	0.002000	0.02628	1.266000	0.33039	-0.834000	0.04239	-0.657000	0.03884	GGA	.	.		0.662	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		
SMG1	23049	hgsc.bcm.edu	37	16	18861619	18861619	+	Silent	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr16:18861619G>A	ENST00000446231.2	-	34	5635	c.5223C>T	c.(5221-5223)ttC>ttT	p.F1741F	SMG1_ENST00000389467.3_Silent_p.F1741F			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1741	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGTACAGGCTGAATATTCTAT	0.388																																					p.F1741F		Atlas-SNP	.											.	SMG1	401	.	0			c.C5223T						.						98.0	92.0	94.0					16																	18861619		1841	4095	5936	SO:0001819	synonymous_variant	23049	exon34			CAGGCTGAATATT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.5223C>T	chr16.hg19:g.18861619G>A		81.0	0.0		74.0	38.0	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	hg19	CCDS45430.1																																																																																			.	.		0.388	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
USP22	23326	hgsc.bcm.edu	37	17	20921295	20921295	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr17:20921295C>T	ENST00000261497.4	-	5	853	c.650G>A	c.(649-651)aGc>aAc	p.S217N	USP22_ENST00000537526.2_Missense_Mutation_p.S205N|USP22_ENST00000455117.2_Intron	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	217	USP.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						CAGACAGGAGCTGGGGCTCTG	0.527																																					p.S217N		Atlas-SNP	.											.	USP22	45	.	0			c.G650A						.						88.0	96.0	93.0					17																	20921295		2034	4187	6221	SO:0001583	missense	23326	exon5			CAGGAGCTGGGGC	AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.650G>A	chr17.hg19:g.20921295C>T	ENSP00000261497:p.Ser217Asn	51.0	0.0		46.0	19.0	NM_015276	A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Missense_Mutation	SNP	ENST00000261497.4	hg19	CCDS42285.1	.	.	.	.	.	.	.	.	.	.	c	13.61	2.289910	0.40494	.	.	ENSG00000124422	ENST00000455117;ENST00000537526;ENST00000261497	T;T	0.30981	1.51;1.51	4.22	4.22	0.49857	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000002	T	0.18759	0.0450	N	0.21617	0.685	0.39370	D	0.966078	B;B	0.06786	0.001;0.0	B;B	0.12837	0.005;0.008	T	0.08207	-1.0733	10	0.15499	T	0.54	.	10.6249	0.45502	0.0:0.9091:0.0:0.0909	.	205;217	Q9UPT9-2;Q9UPT9	.;UBP22_HUMAN	N	285;205;217	ENSP00000440950:S205N;ENSP00000261497:S217N	ENSP00000261497:S217N	S	-	2	0	USP22	20861887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.138000	0.64795	2.054000	0.61138	0.563000	0.77884	AGC	.	.		0.527	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1		
LASP1	3927	hgsc.bcm.edu	37	17	37074888	37074888	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr17:37074888G>A	ENST00000318008.6	+	7	974	c.643G>A	c.(643-645)Gcc>Acc	p.A215T	LASP1_ENST00000435347.3_Missense_Mutation_p.A215T|LASP1_ENST00000433206.2_Missense_Mutation_p.A159T|RP1-56K13.3_ENST00000580121.1_RNA	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	215	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						TGACTACAGCGCCGCCGACGA	0.627			T	MLL	AML																																p.A215T		Atlas-SNP	.		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	.	LASP1	24	.	0			c.G643A						.						103.0	92.0	96.0					17																	37074888		2203	4300	6503	SO:0001583	missense	3927	exon7			TACAGCGCCGCCG		CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.643G>A	chr17.hg19:g.37074888G>A	ENSP00000325240:p.Ala215Thr	106.0	0.0		137.0	34.0	NM_006148	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	ENST00000318008.6	hg19	CCDS11331.1	.	.	.	.	.	.	.	.	.	.	G	36	5.888562	0.97068	.	.	ENSG00000002834	ENST00000318008;ENST00000433206;ENST00000435347	T;T;T	0.52754	0.65;0.65;0.65	5.39	5.39	0.77823	Src homology-3 domain (5);	3.527180	0.02460	N	0.086506	T	0.81889	0.4918	M	0.93939	3.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68108	-0.5496	10	0.87932	D	0	.	17.7153	0.88335	0.0:0.0:1.0:0.0	.	159;215	B4DGQ0;Q14847	.;LASP1_HUMAN	T	215;159;215	ENSP00000325240:A215T;ENSP00000401048:A159T;ENSP00000392853:A215T	ENSP00000325240:A215T	A	+	1	0	LASP1	34328414	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.779000	0.99018	2.540000	0.85666	0.462000	0.41574	GCC	.	.		0.627	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256890.3	NM_006148	
KRT35	3886	hgsc.bcm.edu	37	17	39635730	39635730	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr17:39635730G>T	ENST00000393989.1	-	3	622	c.580C>A	c.(580-582)Cag>Aag	p.Q194K	KRT35_ENST00000246639.2_Missense_Mutation_p.Q164K	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	194	Coil 1B.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				TCCACCAGCTGCCGCAGGGAC	0.587																																					p.Q194K		Atlas-SNP	.											.	KRT35	58	.	0			c.C580A						.						86.0	81.0	83.0					17																	39635730		2203	4300	6503	SO:0001583	missense	3886	exon3			CCAGCTGCCGCAG	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.580C>A	chr17.hg19:g.39635730G>T	ENSP00000377558:p.Gln194Lys	72.0	0.0		112.0	63.0	NM_002280	O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	hg19	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619124	0.66787	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.88896	-2.44;-2.44	4.47	4.47	0.54385	Filament (1);	0.000000	0.48767	D	0.000178	D	0.91965	0.7455	M	0.78916	2.43	0.31625	N	0.649795	P	0.44260	0.83	P	0.53760	0.734	D	0.92381	0.5913	10	0.59425	D	0.04	.	11.8454	0.52381	0.0:0.0:0.8253:0.1747	.	194	Q92764	KRT35_HUMAN	K	164;194	ENSP00000246639:Q164K;ENSP00000377558:Q194K	ENSP00000246639:Q164K	Q	-	1	0	KRT35	36889256	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.799000	0.55529	2.456000	0.83038	0.655000	0.94253	CAG	.	.		0.587	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	
ALYREF	10189	hgsc.bcm.edu	37	17	79848595	79848595	+	Silent	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr17:79848595C>T	ENST00000331204.4	-	2	365	c.339G>A	c.(337-339)ctG>ctA	p.L113L	ANAPC11_ENST00000392376.3_5'Flank|ANAPC11_ENST00000579133.1_5'Flank|ANAPC11_ENST00000571570.1_5'Flank|ANAPC11_ENST00000357385.3_5'Flank|ANAPC11_ENST00000577747.1_5'Flank|ANAPC11_ENST00000583839.1_5'Flank|ANAPC11_ENST00000572851.2_5'Flank|ALYREF_ENST00000505490.2_Silent_p.L120L|ANAPC11_ENST00000571024.2_5'Flank|ANAPC11_ENST00000572639.1_5'Flank|ANAPC11_ENST00000574924.2_5'Flank|ANAPC11_ENST00000582222.1_5'Flank|ANAPC11_ENST00000571874.2_5'Flank|ANAPC11_ENST00000577425.1_5'Flank|ANAPC11_ENST00000584314.1_5'Flank|ANAPC11_ENST00000578550.1_5'Flank|ANAPC11_ENST00000579978.1_5'Flank|ALYREF_ENST00000512673.1_5'UTR|ANAPC11_ENST00000344877.5_5'Flank|ANAPC11_ENST00000578544.1_5'Flank	NM_005782.3	NP_005773.3	Q86V81	THOC4_HUMAN	Aly/REF export factor	113	Ala/Arg/Gly-rich.|Interaction with HHV-8 ORF57 protein and with ICP27 from HHV-1. {ECO:0000250}.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|replication fork processing (GO:0031297)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral mRNA export from host cell nucleus (GO:0046784)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|transcription export complex (GO:0000346)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)										CTCCAAAATCCAGATTGGACA	0.567																																					p.L120L		Atlas-SNP	.											.	.	.	.	0			c.G360A						.						87.0	80.0	82.0					17																	79848595		2203	4300	6503	SO:0001819	synonymous_variant	10189	exon2			AAAATCCAGATTG	AF047002	CCDS32768.1, CCDS32768.2	17q25.3	2013-02-12	2011-12-12	2011-12-12	ENSG00000183684	ENSG00000183684		"""THO complex subunits"", ""RNA binding motif (RRM) containing"""	19071	protein-coding gene	gene with protein product		604171	"""THO complex 4"""	THOC4		11032328	Standard	NM_005782		Approved	ALY, BEF, ALY/REF, REF	uc002kbu.2	Q86V81	OTTHUMG00000160470	ENST00000331204.4:c.339G>A	chr17.hg19:g.79848595C>T		62.0	0.0		124.0	61.0	NM_005782	O43672	Silent	SNP	ENST00000331204.4	hg19																																																																																				.	.		0.567	ALYREF-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005782	
TPGS1	91978	hgsc.bcm.edu	37	19	519341	519341	+	Missense_Mutation	SNP	G	G	T	rs550238099	byFrequency	TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr19:519341G>T	ENST00000359315.5	+	2	999	c.791G>T	c.(790-792)cGg>cTg	p.R264L		NM_033513.2	NP_277048.2	Q6ZTW0	TPGS1_HUMAN	tubulin polyglutamylase complex subunit 1	264					adult behavior (GO:0030534)|multicellular organismal development (GO:0007275)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|synaptic transmission (GO:0007268)|vesicle localization (GO:0051648)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)	tubulin-glutamic acid ligase activity (GO:0070740)										GGGGGGCGGCGGCCCAGCGCG	0.791													g|||	7	0.00139776	0.0008	0.0	5008	,	,		4409	0.0		0.005	False		,,,				2504	0.001				p.R264L		Atlas-SNP	.											.	.	.	.	0			c.G791T						.																																			SO:0001583	missense	91978	exon2			GGCGGCGGCCCAG	BC009520	CCDS42454.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000141933	ENSG00000141933			25058	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 20"""	C19orf20		11441184, 12972506	Standard	NM_033513		Approved	GTRGEO22, PGs1	uc002lou.3	Q6ZTW0		ENST00000359315.5:c.791G>T	chr19.hg19:g.519341G>T	ENSP00000352265:p.Arg264Leu	0.0	0.0		7.0	6.0	NM_033513	Q96GE2	Missense_Mutation	SNP	ENST00000359315.5	hg19	CCDS42454.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374462	0.42105	.	.	ENSG00000141933	ENST00000359315	.	.	.	3.61	2.49	0.30216	.	.	.	.	.	T	0.15522	0.0374	N	0.24115	0.695	0.09310	N	1	P	0.37176	0.586	B	0.31337	0.128	T	0.09487	-1.0672	8	0.42905	T	0.14	-16.7894	3.4176	0.07381	0.3759:0.0:0.6241:0.0	.	264	Q6ZTW0	TPGS1_HUMAN	L	264	.	ENSP00000352265:R264L	R	+	2	0	C19orf20	470341	1.000000	0.71417	0.114000	0.21550	0.854000	0.48673	3.687000	0.54692	1.910000	0.55303	0.444000	0.29173	CGG	.	.		0.791	TPGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451887.2	NM_033513	
CD97	976	hgsc.bcm.edu	37	19	14517933	14517933	+	Silent	SNP	C	C	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr19:14517933C>G	ENST00000242786.5	+	18	2348	c.2268C>G	c.(2266-2268)ggC>ggG	p.G756G	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Silent_p.G663G|CD97_ENST00000357355.3_Silent_p.G707G|DDX39A_ENST00000592927.1_5'Flank	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	756					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GGGTCTTTGGCCTGTTCATCT	0.627																																					p.G756G		Atlas-SNP	.											.	CD97	86	.	0			c.C2268G						.						155.0	115.0	129.0					19																	14517933		2203	4300	6503	SO:0001819	synonymous_variant	976	exon18			CTTTGGCCTGTTC		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.2268C>G	chr19.hg19:g.14517933C>G		65.0	0.0		70.0	22.0	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Silent	SNP	ENST00000242786.5	hg19	CCDS32929.1																																																																																			.	.		0.627	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
QPCTL	54814	hgsc.bcm.edu	37	19	46196071	46196071	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr19:46196071C>T	ENST00000012049.5	+	1	331	c.110C>T	c.(109-111)cCt>cTt	p.P37L	SNRPD2_ENST00000391932.3_5'Flank|SNRPD2_ENST00000588599.1_5'Flank|SNRPD2_ENST00000588301.1_5'Flank|SNRPD2_ENST00000587367.1_5'Flank|SNRPD2_ENST00000590212.1_5'Flank|SNRPD2_ENST00000587579.1_5'Flank|QPCTL_ENST00000366382.4_Missense_Mutation_p.P37L|SNRPD2_ENST00000585392.1_5'Flank|SNRPD2_ENST00000342669.3_5'Flank	NM_017659.3	NP_060129.2	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like	37					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(1)|lung(5)|skin(1)|stomach(1)	11		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		CGGCTCTTGCCTCTGTTGCTG	0.731																																					p.P37L		Atlas-SNP	.											.	QPCTL	24	.	0			c.C110T						.						12.0	13.0	12.0					19																	46196071		2172	4255	6427	SO:0001583	missense	54814	exon1			TCTTGCCTCTGTT	AK000091	CCDS12672.1, CCDS54282.1	19q13.32	2014-09-04			ENSG00000011478	ENSG00000011478			25952	protein-coding gene	gene with protein product	"""glutaminyl cyclase-like"""						Standard	NM_017659		Approved	FLJ20084	uc010xxr.2	Q9NXS2	OTTHUMG00000182131	ENST00000012049.5:c.110C>T	chr19.hg19:g.46196071C>T	ENSP00000012049:p.Pro37Leu	100.0	0.0		117.0	56.0	NM_017659	Q53HE4|Q96F74	Missense_Mutation	SNP	ENST00000012049.5	hg19	CCDS12672.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271883	0.59649	.	.	ENSG00000011478	ENST00000012049;ENST00000366382	T;T	0.15017	2.46;2.46	5.01	5.01	0.66863	.	0.382752	0.26939	N	0.021731	T	0.33876	0.0878	L	0.60455	1.87	0.42686	D	0.993568	D	0.89917	1.0	D	0.83275	0.996	T	0.02437	-1.1159	10	0.11485	T	0.65	.	13.9992	0.64421	0.0:1.0:0.0:0.0	.	37	Q9NXS2	QPCTL_HUMAN	L	37	ENSP00000012049:P37L;ENSP00000387944:P37L	ENSP00000012049:P37L	P	+	2	0	QPCTL	50887911	0.182000	0.23173	0.990000	0.47175	0.475000	0.33008	1.182000	0.32029	2.768000	0.95171	0.561000	0.74099	CCT	.	.		0.731	QPCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459656.1	NM_017659	
BAX	581	hgsc.bcm.edu	37	19	49459465	49459465	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr19:49459465G>T	ENST00000345358.7	+	4	296	c.244G>T	c.(244-246)Gcc>Tcc	p.A82S	BAX_ENST00000354470.3_Missense_Mutation_p.A33S|BAX_ENST00000391871.3_3'UTR|BAX_ENST00000539787.1_Missense_Mutation_p.A82S|BAX_ENST00000293288.8_Missense_Mutation_p.A82S|BAX_ENST00000415969.2_Missense_Mutation_p.A82S	NM_138761.3|NM_138764.4	NP_620116.1|NP_620119.2	Q07812	BAX_HUMAN	BCL2-associated X protein	82					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell homeostatic proliferation (GO:0002358)|B cell negative selection (GO:0002352)|B cell receptor apoptotic signaling pathway (GO:1990117)|blood vessel remodeling (GO:0001974)|cellular response to organic substance (GO:0071310)|cellular response to UV (GO:0034644)|cerebral cortex development (GO:0021987)|development of secondary sexual characteristics (GO:0045136)|ectopic germ cell programmed cell death (GO:0035234)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells within a tissue (GO:0048873)|hypothalamus development (GO:0021854)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein binding (GO:0032091)|neuron apoptotic process (GO:0051402)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic DNA fragmentation (GO:1902512)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of developmental pigmentation (GO:0048087)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-embryonic camera-type eye morphogenesis (GO:0048597)|protein homooligomerization (GO:0051260)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)|protein oligomerization (GO:0051259)|regulation of cell cycle (GO:0051726)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|release of matrix enzymes from mitochondria (GO:0032976)|response to axon injury (GO:0048678)|response to gamma radiation (GO:0010332)|response to salt stress (GO:0009651)|response to toxic substance (GO:0009636)|retina development in camera-type eye (GO:0060041)|retinal cell apoptotic process (GO:1990009)|retinal cell programmed cell death (GO:0046666)|Sertoli cell proliferation (GO:0060011)|spermatid differentiation (GO:0048515)|T cell homeostatic proliferation (GO:0001777)|thymocyte apoptotic process (GO:0070242)|transformed cell apoptotic process (GO:0006927)|vagina development (GO:0060068)|viral process (GO:0016032)	BAX complex (GO:0097144)|Bcl-2 family protein complex (GO:0097136)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrial permeability transition pore complex (GO:0005757)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(4)	17		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		GATGATTGCCGCCGTGGACAC	0.567																																					p.A82S		Atlas-SNP	.											.	BAX	69	.	0			c.G244T						.						71.0	77.0	75.0					19																	49459465		2203	4300	6503	SO:0001583	missense	581	exon4			ATTGCCGCCGTGG		CCDS12742.1, CCDS12743.1, CCDS12744.1, CCDS12745.1, CCDS12745.2	19q13.3-q13.4	2014-03-07			ENSG00000087088	ENSG00000087088			959	protein-coding gene	gene with protein product		600040				8358790	Standard	NM_138761		Approved	BCL2L4	uc002plf.1	Q07812	OTTHUMG00000160476	ENST00000345358.7:c.244G>T	chr19.hg19:g.49459465G>T	ENSP00000263262:p.Ala82Ser	96.0	0.0		69.0	19.0	NM_004324	A8K4W1|P55269|Q07814|Q07815|Q8WZ49|Q9NR76|Q9NYG7|Q9UCZ6|Q9UCZ7|Q9UQD6	Missense_Mutation	SNP	ENST00000345358.7	hg19	CCDS12742.1	.	.	.	.	.	.	.	.	.	.	G	0.038	-1.298992	0.01364	.	.	ENSG00000087088	ENST00000539787;ENST00000345358;ENST00000415969;ENST00000354470;ENST00000293288	T;T;T;T;T	0.10860	2.83;2.83;2.83;2.83;2.83	4.05	4.05	0.47172	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (2);	0.354374	0.29015	N	0.013411	T	0.05593	0.0147	N	0.12182	0.205	0.28733	N	0.902377	B;B;B;B	0.15930	0.002;0.003;0.001;0.015	B;B;B;B	0.14023	0.004;0.005;0.008;0.01	T	0.27938	-1.0059	10	0.08381	T	0.77	-2.9585	12.029	0.53388	0.0:0.0:1.0:0.0	.	33;82;82;82	Q07812-4;Q07812;Q07812-8;Q07812-2	.;BAX_HUMAN;.;.	S	82;82;82;33;82	ENSP00000441413:A82S;ENSP00000263262:A82S;ENSP00000389971:A82S;ENSP00000346461:A33S;ENSP00000293288:A82S	ENSP00000293288:A82S	A	+	1	0	BAX	54151277	0.002000	0.14202	0.008000	0.14137	0.051000	0.14879	0.943000	0.29030	2.549000	0.85964	0.563000	0.77884	GCC	.	.		0.567	BAX-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360767.1	NM_138763	
TSKS	60385	hgsc.bcm.edu	37	19	50250010	50250010	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr19:50250010G>A	ENST00000246801.3	-	6	791	c.709C>T	c.(709-711)Cga>Tga	p.R237*	TSKS_ENST00000358830.3_Nonsense_Mutation_p.R37*	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	237					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		tcctgccgtcgcggcgtctca	0.677																																					p.R237X		Atlas-SNP	.											.	TSKS	97	.	0			c.C709T						.						17.0	16.0	17.0					19																	50250010		2186	4263	6449	SO:0001587	stop_gained	60385	exon6			GCCGTCGCGGCGT	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.709C>T	chr19.hg19:g.50250010G>A	ENSP00000246801:p.Arg237*	48.0	0.0		43.0	16.0	NM_021733	Q8WXJ0	Nonsense_Mutation	SNP	ENST00000246801.3	hg19	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	-	32	5.142036	0.94560	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	.	.	.	4.78	1.13	0.20643	.	0.000000	0.42964	D	0.000627	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.0456	10.5632	0.45156	0.0:0.0:0.4723:0.5277	.	.	.	.	X	237;37	.	ENSP00000246801:R237X	R	-	1	2	TSKS	54941822	0.699000	0.27786	0.436000	0.26797	0.580000	0.36256	1.064000	0.30579	0.556000	0.29098	0.591000	0.81541	CGA	.	.		0.677	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733	
PTPRA	5786	hgsc.bcm.edu	37	20	3005219	3005219	+	Nonsense_Mutation	SNP	C	C	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr20:3005219C>G	ENST00000216877.6	+	16	1939	c.1539C>G	c.(1537-1539)taC>taG	p.Y513*	PTPRA_ENST00000399903.2_Nonsense_Mutation_p.Y522*|PTPRA_ENST00000318266.5_Nonsense_Mutation_p.Y513*|PTPRA_ENST00000356147.3_Nonsense_Mutation_p.Y513*|PTPRA_ENST00000380393.3_Nonsense_Mutation_p.Y522*|PTPRA_ENST00000358719.4_Nonsense_Mutation_p.Y378*|PTPRA_ENST00000425918.2_Nonsense_Mutation_p.Y533*	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	522					axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AGAAAATTTACAACAAAATCC	0.438																																					p.Y522X		Atlas-SNP	.											.	PTPRA	75	.	0			c.C1566G						.						121.0	124.0	123.0					20																	3005219		2203	4300	6503	SO:0001587	stop_gained	5786	exon21			AATTTACAACAAA		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1539C>G	chr20.hg19:g.3005219C>G	ENSP00000216877:p.Tyr513*	139.0	0.0		161.0	54.0	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Nonsense_Mutation	SNP	ENST00000216877.6	hg19	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	C	41	8.620370	0.98888	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	.	.	.	6.04	3.07	0.35406	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.891	0.41290	0.0:0.7259:0.0:0.2741	.	.	.	.	X	522;513;522;378;132;533;513;513	.	ENSP00000216877:Y513X	Y	+	3	2	PTPRA	2953219	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.582000	0.36568	0.439000	0.26476	0.561000	0.74099	TAC	.	.		0.438	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
ADNP	23394	hgsc.bcm.edu	37	20	49510049	49510049	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr20:49510049G>C	ENST00000396029.3	-	5	1769	c.1202C>G	c.(1201-1203)tCt>tGt	p.S401C	ADNP_ENST00000349014.3_Missense_Mutation_p.S401C|ADNP_ENST00000396032.3_Missense_Mutation_p.S401C|ADNP_ENST00000371602.4_Missense_Mutation_p.S401C	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	401					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						CGATGAGAGAGAAGAGGCATT	0.542																																					p.S401C		Atlas-SNP	.											.	ADNP	106	.	0			c.C1202G						.						113.0	115.0	114.0					20																	49510049		2203	4300	6503	SO:0001583	missense	23394	exon5			GAGAGAGAAGAGG	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1202C>G	chr20.hg19:g.49510049G>C	ENSP00000379346:p.Ser401Cys	45.0	0.0		35.0	15.0	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	hg19	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193589	0.38707	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.17	6.17	0.99709	.	0.451467	0.26052	N	0.026638	T	0.63931	0.2553	N	0.19112	0.55	0.38892	D	0.95713	D	0.64830	0.994	D	0.73708	0.981	T	0.67118	-0.5751	9	0.59425	D	0.04	-28.6145	16.2608	0.82541	0.0:0.1316:0.8683:0.0	.	401	Q9H2P0	ADNP_HUMAN	C	401	.	ENSP00000342905:S401C	S	-	2	0	ADNP	48943456	0.992000	0.36948	0.073000	0.20177	0.709000	0.40893	4.910000	0.63321	2.941000	0.99782	0.655000	0.94253	TCT	.	.		0.542	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
FAM209B	388799	hgsc.bcm.edu	37	20	55111382	55111382	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr20:55111382G>A	ENST00000371325.1	+	2	500	c.404G>A	c.(403-405)gGt>gAt	p.G135D		NM_001013646.2	NP_001013668.2	Q5JX69	F209B_HUMAN	family with sequence similarity 209, member B	135						integral component of membrane (GO:0016021)|nucleus (GO:0005634)											AATCTTAAAGGTGCCATGGCA	0.413																																					p.G135D		Atlas-SNP	.											.	.	.	.	0			c.G404A						.						101.0	100.0	100.0					20																	55111382		2203	4300	6503	SO:0001583	missense	388799	exon2			TTAAAGGTGCCAT	AL109806	CCDS33494.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000213714	ENSG00000213714			16101	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 107"""	C20orf107			Standard	NM_001013646		Approved	dJ1153D9.4	uc002xxz.4	Q5JX69	OTTHUMG00000032800	ENST00000371325.1:c.404G>A	chr20.hg19:g.55111382G>A	ENSP00000360376:p.Gly135Asp	179.0	0.0		213.0	10.0	NM_001013646	Q3KRB5	Missense_Mutation	SNP	ENST00000371325.1	hg19	CCDS33494.1	.	.	.	.	.	.	.	.	.	.	G	2.124	-0.400622	0.04865	.	.	ENSG00000213714	ENST00000371325	T	0.07688	3.17	3.55	-3.85	0.04243	.	0.740081	0.11437	N	0.564191	T	0.04724	0.0128	L	0.29908	0.895	0.09310	N	1	P	0.35982	0.531	B	0.32289	0.143	T	0.26292	-1.0107	10	0.48119	T	0.1	-3.4122	5.3394	0.15974	0.0:0.4265:0.1759:0.3976	.	135	Q5JX69	CT107_HUMAN	D	135	ENSP00000360376:G135D	ENSP00000360376:G135D	G	+	2	0	C20orf107	54544789	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.658000	0.05329	-0.919000	0.03803	-1.694000	0.00725	GGT	.	.		0.413	FAM209B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079816.1		
SLC5A1	6523	hgsc.bcm.edu	37	22	32495294	32495294	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr22:32495294G>A	ENST00000266088.4	+	12	1655	c.1405G>A	c.(1405-1407)Gct>Act	p.A469T	SLC5A1_ENST00000543737.1_Missense_Mutation_p.A342T	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	469					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	ACCCATTGCGGCTGTCTTCCT	0.493																																					p.A469T		Atlas-SNP	.											.	SLC5A1	80	.	0			c.G1405A						.						235.0	220.0	225.0					22																	32495294		2203	4300	6503	SO:0001583	missense	6523	exon12			ATTGCGGCTGTCT		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1405G>A	chr22.hg19:g.32495294G>A	ENSP00000266088:p.Ala469Thr	68.0	0.0		84.0	4.0	NM_000343	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	hg19	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861702	0.91433	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.89343	-2.5;-2.5	5.61	5.61	0.85477	.	0.048412	0.85682	D	0.000000	D	0.91536	0.7327	M	0.67700	2.07	0.80722	D	1	D	0.53462	0.96	P	0.54924	0.764	D	0.91825	0.5470	10	0.62326	D	0.03	.	13.578	0.61885	0.0:0.0:0.8447:0.1553	.	469	P13866	SC5A1_HUMAN	T	469;342	ENSP00000266088:A469T;ENSP00000444898:A342T	ENSP00000266088:A469T	A	+	1	0	SLC5A1	30825294	1.000000	0.71417	0.996000	0.52242	0.884000	0.51177	4.488000	0.60300	2.647000	0.89833	0.557000	0.71058	GCT	.	.		0.493	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343	
MT-CO3	4514	hgsc.bcm.edu	37	M	9379	9379	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chrM:9379G>A	ENST00000362079.2	+	1	173	c.173G>A	c.(172-174)tGg>tAg	p.W58*	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TH_ENST00000387441.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	58					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						ATACCAATGGTGGCGCGATGT	0.478																																					p.W58X		Atlas-SNP	.											.	.	.	.	0			c.G173A						.																																			SO:0001587	stop_gained	5742	exon1			AATGATGGCGCGA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.173G>A	chrM.hg19:g.9379G>A	ENSP00000354982:p.Trp58*	42.0	0.0		120.0	5.0	ENST00000362079	Q14Y83	Nonsense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.478	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
ZBED9	114821	hgsc.bcm.edu	37	6	28540012	28540013	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr6:28540012_28540013insG	ENST00000452236.2	-	4	4270_4271	c.3653_3654insC	c.(3652-3654)aatfs	p.N1218fs		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						ttacagttaaatttaagttatc	0.317																																					p.N1218fs		Atlas-INDEL	.											.	SCAND3	156	.	0			c.3654_3655insC						.																																			SO:0001589	frameshift_variant	114821	exon4			.																												ENST00000452236.2:c.3653_3654insC	chr6.hg19:g.28540012_28540013insG	ENSP00000395259:p.Asn1218fs	129.0	0.0		180.0	11.0	NM_052923		Frame_Shift_Ins	INS	ENST00000452236.2	hg19	CCDS34355.1																																																																																			.	.		0.317	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
ALB	213	hgsc.bcm.edu	37	4	74283386	74283387	+	Splice_Site	DEL	TG	TG	-	rs78527483		TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr4:74283386_74283387delTG	ENST00000503124.1	+	9	1185	c.978delTG	c.(976-978)tat>ta	p.Y326fs	ALB_ENST00000509063.1_Splice_Site_p.Y476fs|ALB_ENST00000505649.1_Intron|ALB_ENST00000415165.2_Splice_Site_p.Y284fs|ALB_ENST00000295897.4_Splice_Site_p.Y476fs|ALB_ENST00000401494.3_Splice_Site_p.Y361fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGAAGACTATGTGAGTCttta	0.332																																					p.476_476del		Atlas-INDEL	.											.	ALB	132	.	0			c.1427_1428del						.																																			SO:0001630	splice_region_variant	213	exon11			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.978+1TG>-	chr4.hg19:g.74283388_74283389delTG		137.0	0.0		157.0	62.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.332	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	Frame_Shift_Del
C16orf86	388284	hgsc.bcm.edu	37	16	67701908	67701919	+	In_Frame_Del	DEL	AAAAAAGCCAAG	AAAAAAGCCAAG	-			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	AAAAAAGCCAAG	AAAAAAGCCAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr16:67701908_67701919delAAAAAAGCCAAG	ENST00000403458.4	+	3	615_626	c.460_471delAAAAAAGCCAAG	c.(460-471)aaaaaagccaagdel	p.KKAK154del	ENKD1_ENST00000243878.4_5'Flank|C16orf86_ENST00000602974.1_3'UTR|ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000602644.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	154										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CAAACAGCACAAAAAAGCCAAGAAGCGCAAGA	0.608											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.153_157del		Atlas-INDEL	.											.	C16orf86	20	.	0			c.459_470del						.																																			SO:0001651	inframe_deletion	388284	exon3			.		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.460_471delAAAAAAGCCAAG	chr16.hg19:g.67701908_67701919delAAAAAAGCCAAG	ENSP00000384117:p.Lys154_Lys157del	134.0	0.0	1101	115.0	25.0	NM_001012984	B5MCW6	In_Frame_Del	DEL	ENST00000403458.4	hg19	CCDS32468.2																																																																																			.	.		0.608	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318767.2	NM_001012984	
RAB11FIP3	9727	hgsc.bcm.edu	37	16	570189	570197	+	In_Frame_Del	DEL	GGGGCCGCA	GGGGCCGCA	-	rs559245815|rs371078762|rs537339281	byFrequency	TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	GGGGCCGCA	GGGGCCGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr16:570189_570197delGGGGCCGCA	ENST00000262305.4	+	12	2316_2324	c.1928_1936delGGGGCCGCA	c.(1927-1938)cggggccgcagc>cgc	p.GRS644del	RAB11FIP3_ENST00000450428.1_In_Frame_Del_p.GRS348del|RAB11FIP3_ENST00000457159.1_In_Frame_Del_p.GRS689del	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	644					cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				GAGCAGCGGCGGGGCCGCAGCAGCAGCAT	0.713																																					p.643_645del	Melanoma(160;2366 2595 4474 8099)	Atlas-INDEL	.											.	RAB11FIP3	31	.	0			c.1927_1935del						.																																			SO:0001651	inframe_deletion	9727	exon12			.	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.1928_1936delGGGGCCGCA	chr16.hg19:g.570189_570197delGGGGCCGCA	ENSP00000262305:p.Gly644_Ser646del	63.0	0.0		60.0	18.0	NM_014700	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	In_Frame_Del	DEL	ENST00000262305.4	hg19	CCDS32351.1																																																																																			.	.		0.713	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4	NM_014700	
AFM	173	hgsc.bcm.edu	37	4	74361077	74361078	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr4:74361077_74361078insGA	ENST00000226355.3	+	9	1212_1213	c.1119_1120insGA	c.(1120-1122)gttfs	p.V374fs		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	374	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTTTAAGAATTGTTCAAATATA	0.361																																					p.I373fs		Atlas-INDEL	.											.	AFM	101	.	0			c.1119_1120insGA						.																																			SO:0001589	frameshift_variant	173	exon9			.	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	Exception_encountered	chr4.hg19:g.74361077_74361078insGA	ENSP00000226355:p.Val374fs	103.0	0.0		107.0	37.0	NM_001133	A8K3E1|Q32MR3|Q4W5C5	Frame_Shift_Ins	INS	ENST00000226355.3	hg19	CCDS3557.1																																																																																			.	.		0.361	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2		
ALB	213	hgsc.bcm.edu	37	4	74274517	74274518	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-AAV5-01A-11D-A36X-10	TCGA-G3-AAV5-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b43b12f-f84d-4283-9cd3-10dab5e6e45a	6f867add-e781-468a-96fe-bb81275f0c31	g.chr4:74274517_74274518insA	ENST00000295897.4	+	4	566_567	c.477_478insA	c.(478-480)aaafs	p.K160fs	ALB_ENST00000509063.1_Frame_Shift_Ins_p.K160fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000415165.2_Intron|ALB_ENST00000503124.1_Intron|ALB_ENST00000401494.3_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGACATTTTTGAAAAAGTAAGT	0.351																																					p.L159fs		Atlas-INDEL	.											.	ALB	132	.	0			c.477_478insA						.																																			SO:0001589	frameshift_variant	213	exon4			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.483dupA	chr4.hg19:g.74274522_74274522dupA	ENSP00000295897:p.Lys160fs	83.0	0.0		98.0	34.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Ins	INS	ENST00000295897.4	hg19	CCDS3555.1																																																																																			.	.		0.351	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	
