#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
IPP	3652	hgsc.bcm.edu	37	1	46211836	46211836	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:46211836A>G	ENST00000396478.3	-	2	350	c.248T>C	c.(247-249)aTt>aCt	p.I83T		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	83	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TCCTGCTTCAATTCCTAGAAT	0.413																																					p.I83T		Atlas-SNP	.											.	IPP	66	.	0			c.T248C						.						87.0	85.0	85.0					1																	46211836		2203	4300	6503	SO:0001583	missense	3652	exon2			GCTTCAATTCCTA	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.248T>C	chr1.hg19:g.46211836A>G	ENSP00000379739:p.Ile83Thr	126.0	0.0		144.0	54.0	NM_001145349	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	hg19	CCDS30702.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.533477	0.64972	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.70749	-0.51;-0.51	5.57	5.57	0.84162	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.193310	0.47852	D	0.000218	T	0.74854	0.3771	M	0.71206	2.165	0.44402	D	0.997314	B;B	0.32653	0.085;0.379	B;B	0.39590	0.259;0.304	T	0.77172	-0.2685	10	0.87932	D	0	.	15.7343	0.77831	1.0:0.0:0.0:0.0	.	83;83	Q9Y573;A2A6V3	IPP_HUMAN;.	T	83	ENSP00000353024:I83T;ENSP00000379739:I83T	ENSP00000353024:I83T	I	-	2	0	IPP	45984423	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.692000	0.91284	2.115000	0.64714	0.533000	0.62120	ATT	.	.		0.413	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
GLIS1	148979	hgsc.bcm.edu	37	1	54060500	54060500	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:54060500G>T	ENST00000312233.2	-	3	642	c.76C>A	c.(76-78)Ctc>Atc	p.L26I		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						CGGCCCGGGAGGTCCAGGTCT	0.706																																					p.L26I		Atlas-SNP	.											.	GLIS1	52	.	0			c.C76A						.						13.0	18.0	16.0					1																	54060500		2161	4208	6369	SO:0001583	missense	148979	exon3			CCGGGAGGTCCAG	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.76C>A	chr1.hg19:g.54060500G>T	ENSP00000309653:p.Leu26Ile	98.0	0.0		119.0	32.0	NM_147193		Missense_Mutation	SNP	ENST00000312233.2	hg19	CCDS582.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.316674	0.23908	.	.	ENSG00000174332	ENST00000312233	T	0.13778	2.56	4.53	2.59	0.31030	.	0.134805	0.33534	N	0.004818	T	0.09818	0.0241	L	0.27053	0.805	0.24806	N	0.992671	B	0.24186	0.099	B	0.27608	0.081	T	0.22626	-1.0211	10	0.56958	D	0.05	.	8.0879	0.30784	0.0886:0.1598:0.7516:0.0	.	26	Q8NBF1	GLIS1_HUMAN	I	26	ENSP00000309653:L26I	ENSP00000309653:L26I	L	-	1	0	GLIS1	53833088	1.000000	0.71417	0.899000	0.35326	0.342000	0.28953	2.413000	0.44618	0.570000	0.29347	-0.302000	0.09304	CTC	.	.		0.706	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
AKNAD1	254268	hgsc.bcm.edu	37	1	109394989	109394989	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:109394989T>G	ENST00000370001.3	-	2	566	c.298A>C	c.(298-300)Aat>Cat	p.N100H	AKNAD1_ENST00000369995.3_Missense_Mutation_p.N100H|AKNAD1_ENST00000369994.1_Missense_Mutation_p.N100H|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	100						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TCTCCTTCATTTGCTGGAATA	0.398																																					p.N100H		Atlas-SNP	.											.	AKNAD1	83	.	0			c.A298C						.						108.0	107.0	107.0					1																	109394989		2203	4300	6503	SO:0001583	missense	254268	exon2			CTTCATTTGCTGG	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.298A>C	chr1.hg19:g.109394989T>G	ENSP00000359018:p.Asn100His	80.0	0.0		97.0	33.0	NM_152763	B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	ENST00000370001.3	hg19	CCDS791.2	.	.	.	.	.	.	.	.	.	.	T	12.85	2.062286	0.36373	.	.	ENSG00000162641	ENST00000370001;ENST00000369994;ENST00000369995	T;T;T	0.09163	3.03;3.07;3.01	5.77	-2.28	0.06826	.	0.737789	0.13302	N	0.398178	T	0.05731	0.0150	L	0.56769	1.78	0.09310	N	1	P	0.43169	0.8	P	0.47206	0.541	T	0.18999	-1.0319	10	0.72032	D	0.01	-3.2114	6.2491	0.20835	0.1099:0.3173:0.0:0.5728	.	100	Q5T1N1	AKND1_HUMAN	H	100	ENSP00000359018:N100H;ENSP00000359011:N100H;ENSP00000359012:N100H	ENSP00000359011:N100H	N	-	1	0	AKNAD1	109196512	0.005000	0.15991	0.000000	0.03702	0.002000	0.02628	0.901000	0.28445	-0.415000	0.07484	-0.290000	0.09829	AAT	.	.		0.398	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763	
ZNF687	57592	hgsc.bcm.edu	37	1	151259083	151259083	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:151259083G>T	ENST00000368879.2	+	2	414	c.316G>T	c.(316-318)Ggg>Tgg	p.G106W		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGCAGGAGACGGGGCCCAGGC	0.592																																					p.G106W		Atlas-SNP	.											ZNF687,colon,carcinoma,0,1	ZNF687	94	.	0			c.G316T						.						53.0	59.0	57.0					1																	151259083		2203	4300	6503	SO:0001583	missense	57592	exon2			GGAGACGGGGCCC		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.316G>T	chr1.hg19:g.151259083G>T	ENSP00000357874:p.Gly106Trp	68.0	0.0		151.0	19.0	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	ENST00000368879.2	hg19		.	.	.	.	.	.	.	.	.	.	G	6.458	0.452661	0.12283	.	.	ENSG00000143373	ENST00000443959;ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.01015	5.44;5.44;5.78	4.32	4.32	0.51571	.	0.220870	0.22859	N	0.054762	T	0.01454	0.0047	L	0.51422	1.61	0.20926	N	0.999826	D;D;D	0.71674	0.997;0.979;0.998	D;P;D	0.69824	0.95;0.571;0.966	T	0.46005	-0.9222	10	0.87932	D	0	.	10.082	0.42395	0.0987:0.0:0.9013:0.0	.	106;106;106	Q8N1G0-2;Q8N1G0;F8WCX2	.;ZN687_HUMAN;.	W	115;106;106;106	ENSP00000336620:G106W;ENSP00000319829:G106W;ENSP00000357874:G106W	ENSP00000319829:G106W	G	+	1	0	ZNF687	149525707	0.521000	0.26258	0.053000	0.19242	0.053000	0.15095	3.544000	0.53640	2.247000	0.74100	0.313000	0.20887	GGG	.	.		0.592	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
FLG2	388698	hgsc.bcm.edu	37	1	152324696	152324696	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:152324696C>A	ENST00000388718.5	-	3	5638	c.5566G>T	c.(5566-5568)Gga>Tga	p.G1856*	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1856					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGAATGTCCACTGGTATCT	0.502																																					p.G1856X		Atlas-SNP	.											.	FLG2	431	.	0			c.G5566T						.						336.0	292.0	307.0					1																	152324696		2203	4300	6503	SO:0001587	stop_gained	388698	exon3			AATGTCCACTGGT	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5566G>T	chr1.hg19:g.152324696C>A	ENSP00000373370:p.Gly1856*	108.0	0.0		239.0	40.0	NM_001014342	Q9H4U1	Nonsense_Mutation	SNP	ENST00000388718.5	hg19	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	42	9.419145	0.99166	.	.	ENSG00000143520	ENST00000388718	.	.	.	3.93	-1.66	0.08265	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-0.1059	7.9128	0.29800	0.0:0.5261:0.0:0.4739	.	.	.	.	X	1856	.	ENSP00000373370:G1856X	G	-	1	0	FLG2	150591320	0.000000	0.05858	0.004000	0.12327	0.044000	0.14063	-0.751000	0.04803	-0.129000	0.11620	0.449000	0.29647	GGA	.	.		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
CREB3L4	148327	hgsc.bcm.edu	37	1	153941033	153941033	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:153941033C>G	ENST00000368607.3	+	2	298	c.32C>G	c.(31-33)gCg>gGg	p.A11G	CREB3L4_ENST00000368601.1_Missense_Mutation_p.A11G|CREB3L4_ENST00000368603.1_Missense_Mutation_p.A11G|SLC39A1_ENST00000310483.6_5'Flank|CREB3L4_ENST00000368600.3_Missense_Mutation_p.A11G|RP11-422P24.10_ENST00000608147.1_RNA|CREB3L4_ENST00000405694.3_5'UTR|CREB3L4_ENST00000271889.4_Missense_Mutation_p.A11G	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	11					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGCTGGACGCGTGGCTGGAG	0.597																																					p.A11G		Atlas-SNP	.											.	CREB3L4	36	.	0			c.C32G						.						51.0	52.0	52.0					1																	153941033		2203	4300	6503	SO:0001583	missense	148327	exon2			TGGACGCGTGGCT	AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.32C>G	chr1.hg19:g.153941033C>G	ENSP00000357596:p.Ala11Gly	96.0	0.0		187.0	78.0	NM_001255980	D3DV62|Q5T4L0|Q86YW6	Missense_Mutation	SNP	ENST00000368607.3	hg19	CCDS1056.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.943594	0.34283	.	.	ENSG00000143578	ENST00000449724;ENST00000368607;ENST00000271889;ENST00000368601;ENST00000368603;ENST00000368600;ENST00000431292	T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45	4.24	0.289	0.15723	.	2.382990	0.01788	N	0.032160	T	0.04363	0.0120	N	0.08118	0	0.23003	N	0.99845	B;B;B	0.22146	0.065;0.049;0.039	B;B;B	0.23275	0.045;0.008;0.013	T	0.20438	-1.0275	10	0.22706	T	0.39	.	2.4672	0.04555	0.2098:0.2943:0.0:0.4959	.	11;11;11	B4E2G3;Q5T4L0;Q8TEY5	.;.;CR3L4_HUMAN	G	11	ENSP00000391847:A11G;ENSP00000357596:A11G;ENSP00000271889:A11G;ENSP00000357590:A11G;ENSP00000357592:A11G;ENSP00000357589:A11G;ENSP00000402308:A11G	ENSP00000271889:A11G	A	+	2	0	CREB3L4	152207657	0.002000	0.14202	0.219000	0.23793	0.585000	0.36419	-0.105000	0.10907	-0.058000	0.13177	0.561000	0.74099	GCG	.	.		0.597	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898	
NES	10763	hgsc.bcm.edu	37	1	156639400	156639400	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:156639400C>T	ENST00000368223.3	-	4	4712	c.4580G>A	c.(4579-4581)gGc>gAc	p.G1527D		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1527	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCCCCTGGGCCTGCATCCTC	0.577																																					p.G1527D		Atlas-SNP	.											.	NES	196	.	0			c.G4580A						.						80.0	69.0	73.0					1																	156639400		2203	4300	6503	SO:0001583	missense	10763	exon4			CCTGGGCCTGCAT	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4580G>A	chr1.hg19:g.156639400C>T	ENSP00000357206:p.Gly1527Asp	93.0	0.0		179.0	41.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	hg19	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	3.129	-0.178864	0.06380	.	.	ENSG00000132688	ENST00000368223	D	0.86769	-2.17	3.63	-0.976	0.10286	.	.	.	.	.	T	0.65144	0.2663	L	0.50333	1.59	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.55173	-0.8182	9	0.52906	T	0.07	.	1.9409	0.03346	0.4776:0.2559:0.1515:0.1151	.	1527	P48681	NEST_HUMAN	D	1527	ENSP00000357206:G1527D	ENSP00000357206:G1527D	G	-	2	0	NES	154906024	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	-0.333000	0.07894	0.172000	0.19760	0.313000	0.20887	GGC	.	.		0.577	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
PEAR1	375033	hgsc.bcm.edu	37	1	156875181	156875181	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:156875181G>C	ENST00000338302.3	+	5	497	c.272G>C	c.(271-273)tGc>tCc	p.C91S	PEAR1_ENST00000292357.7_Missense_Mutation_p.C91S			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	91	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGCAGTGCTGCCATGGCTTC	0.642																																					p.C91S		Atlas-SNP	.											.	PEAR1	118	.	0			c.G272C						.						65.0	57.0	60.0					1																	156875181		2203	4300	6503	SO:0001583	missense	375033	exon4			AGTGCTGCCATGG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.272G>C	chr1.hg19:g.156875181G>C	ENSP00000344465:p.Cys91Ser	27.0	0.0		81.0	20.0	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	hg19	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154826	0.78114	.	.	ENSG00000187800	ENST00000338302;ENST00000455314;ENST00000292357	D;D;D	0.90955	-2.76;-2.53;-2.76	4.02	4.02	0.46733	EMI domain (1);	0.000000	0.44902	D	0.000417	D	0.92159	0.7514	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	D	0.91353	0.5106	10	0.39692	T	0.17	.	13.7114	0.62670	0.0:0.0:1.0:0.0	.	91	Q5VY43	PEAR1_HUMAN	S	91	ENSP00000344465:C91S;ENSP00000389742:C91S;ENSP00000292357:C91S	ENSP00000292357:C91S	C	+	2	0	PEAR1	155141805	1.000000	0.71417	0.934000	0.37439	0.637000	0.38172	8.778000	0.91785	2.073000	0.62155	0.655000	0.94253	TGC	.	.		0.642	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
OR6P1	128366	hgsc.bcm.edu	37	1	158532696	158532696	+	Silent	SNP	T	T	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:158532696T>A	ENST00000334632.1	-	1	698	c.699A>T	c.(697-699)ggA>ggT	p.G233G		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						CTTTGTGGCGTCCCCTGGACG	0.537																																					p.G233G		Atlas-SNP	.											.	OR6P1	47	.	0			c.A699T						.						125.0	102.0	109.0					1																	158532696		692	1591	2283	SO:0001819	synonymous_variant	128366	exon1			GTGGCGTCCCCTG	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.699A>T	chr1.hg19:g.158532696T>A		115.0	0.0		222.0	49.0	NM_001160325	Q6IFR9	Silent	SNP	ENST00000334632.1	hg19	CCDS53391.1																																																																																			.	.		0.537	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
TSTD1	100131187	hgsc.bcm.edu	37	1	161008344	161008344	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:161008344G>A	ENST00000423014.2	-	2	230	c.130C>T	c.(130-132)Ccg>Tcg	p.P44S	TSTD1_ENST00000368023.3_Missense_Mutation_p.P51S|F11R_ENST00000289779.3_Intron|TSTD1_ENST00000368024.1_Intron|TSTD1_ENST00000466967.1_5'UTR|TSTD1_ENST00000318289.10_Missense_Mutation_p.P44S	NM_001113205.1|NM_001113207.1	NP_001106676.1|NP_001106678.1	Q8NFU3	TSTD1_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 1	44	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.					cytoplasm (GO:0005737)											CCTATACCCGGGATGTTGAGC	0.622																																					p.P44S		Atlas-SNP	.											.	TSTD1	12	.	0			c.C130T						.						11.0	13.0	12.0					1																	161008344		692	1591	2283	SO:0001583	missense	100131187	exon2			TACCCGGGATGTT		CCDS44257.1, CCDS44258.1, CCDS53400.1	1q23.3	2009-09-02			ENSG00000215845	ENSG00000215845			35410	protein-coding gene	gene with protein product						12817473	Standard	NM_001113205		Approved	KAT		Q8NFU3	OTTHUMG00000031476	ENST00000423014.2:c.130C>T	chr1.hg19:g.161008344G>A	ENSP00000388293:p.Pro44Ser	86.0	0.0		178.0	74.0	NM_001113207	Q5SY48|Q5SY49|Q5SY50|Q5SY51|Q8NFU2|Q9BV22	Missense_Mutation	SNP	ENST00000423014.2	hg19	CCDS53400.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470182	0.84533	.	.	ENSG00000215845	ENST00000318289;ENST00000368023;ENST00000423014	T;T;T	0.46451	0.87;0.87;0.87	4.44	4.44	0.53790	Rhodanese-like (5);	0.000000	0.64402	U	0.000004	T	0.60353	0.2262	M	0.84773	2.715	0.52501	D	0.999957	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66760	-0.5842	10	0.87932	D	0	.	12.7524	0.57316	0.0:0.0:1.0:0.0	.	44;44	Q8NFU3;Q8NFU3-3	TSTD1_HUMAN;.	S	44;51;44	ENSP00000325518:P44S;ENSP00000357002:P51S;ENSP00000388293:P44S	ENSP00000325518:P44S	P	-	1	0	TSTD1	159274968	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	4.570000	0.60872	2.442000	0.82660	0.305000	0.20034	CCG	.	.		0.622	TSTD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077078.2	NM_001113207	
MPC2	25874	hgsc.bcm.edu	37	1	167905052	167905052	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:167905052G>A	ENST00000367846.4	-	1	226	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	MPC2_ENST00000271373.4_Missense_Mutation_p.R10W|DCAF6_ENST00000367840.3_5'Flank|DCAF6_ENST00000367843.3_5'Flank|DCAF6_ENST00000312263.6_5'Flank|DCAF6_ENST00000432587.2_5'Flank	NM_015415.3	NP_056230.1	O95563	MPC2_HUMAN	mitochondrial pyruvate carrier 2	10					cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate transmembrane transporter activity (GO:0050833)										TAGGTGGCCCGCAGGCCTCGG	0.642																																					p.R10W		Atlas-SNP	.											.	.	.	.	0			c.C28T						.						18.0	16.0	17.0					1																	167905052		2159	4214	6373	SO:0001583	missense	25874	exon2			TGGCCCGCAGGCC		CCDS1266.1	1q24	2012-07-30	2012-07-30	2012-07-30	ENSG00000143158	ENSG00000143158			24515	protein-coding gene	gene with protein product		614737	"""brain protein 44"""	BRP44		3022128, 22628558	Standard	NM_015415		Approved	DKFZP564B167	uc001get.3	O95563	OTTHUMG00000034570	ENST00000367846.4:c.28C>T	chr1.hg19:g.167905052G>A	ENSP00000356820:p.Arg10Trp	141.0	0.0		253.0	47.0	NM_001143674	A8K261|Q3SXR6|Q6FIF3	Missense_Mutation	SNP	ENST00000367846.4	hg19	CCDS1266.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661706	0.88154	.	.	ENSG00000143158	ENST00000367846;ENST00000271373;ENST00000458574	T;T;T	0.65732	-0.17;-0.17;-0.16	5.22	3.34	0.38264	.	0.056233	0.64402	D	0.000002	T	0.67059	0.2853	M	0.79805	2.47	0.42037	D	0.991055	B;D	0.89917	0.016;1.0	B;D	0.66979	0.005;0.948	T	0.71354	-0.4618	9	0.72032	D	0.01	-4.3393	7.8078	0.29213	0.0829:0.0:0.7566:0.1604	.	10;10	B2R4Q7;O95563	.;BR44_HUMAN	W	10	ENSP00000356820:R10W;ENSP00000271373:R10W;ENSP00000392874:R10W	ENSP00000271373:R10W	R	-	1	2	BRP44	166171676	0.994000	0.37717	0.999000	0.59377	0.956000	0.61745	1.530000	0.36007	0.756000	0.33013	0.650000	0.86243	CGG	.	.		0.642	MPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083652.1	NM_015415	
SLC19A2	10560	hgsc.bcm.edu	37	1	169454948	169454948	+	Silent	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:169454948G>T	ENST00000236137.5	-	1	293	c.57C>A	c.(55-57)ctC>ctA	p.L19L	SLC19A2_ENST00000367804.4_Silent_p.L19L	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	19					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	CGGTCCGCAGGAGCACAGTgg	0.751																																					p.L19L		Atlas-SNP	.											.	SLC19A2	35	.	0			c.C57A						.						4.0	6.0	5.0					1																	169454948		1792	3489	5281	SO:0001819	synonymous_variant	10560	exon1			CCGCAGGAGCACA	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.57C>A	chr1.hg19:g.169454948G>T		121.0	0.0		183.0	62.0	NM_006996	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Silent	SNP	ENST00000236137.5	hg19	CCDS1280.1																																																																																			.	.		0.751	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
SCYL3	57147	hgsc.bcm.edu	37	1	169833605	169833605	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:169833605G>A	ENST00000367770.1	-	8	907	c.860C>T	c.(859-861)gCt>gTt	p.A287V	SCYL3_ENST00000470238.1_5'UTR|SCYL3_ENST00000367771.6_Missense_Mutation_p.A287V|SCYL3_ENST00000367772.4_Missense_Mutation_p.A287V			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	287					cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CAACCTTGAAGCTATCAATTC	0.458																																					p.A287V		Atlas-SNP	.											.	SCYL3	116	.	0			c.C860T						.						87.0	81.0	83.0					1																	169833605		2203	4300	6503	SO:0001583	missense	57147	exon9			CTTGAAGCTATCA	BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.860C>T	chr1.hg19:g.169833605G>A	ENSP00000356744:p.Ala287Val	293.0	1.0		513.0	203.0	NM_020423	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Missense_Mutation	SNP	ENST00000367770.1	hg19	CCDS1287.1	.	.	.	.	.	.	.	.	.	.	G	33	5.283003	0.95489	.	.	ENSG00000000457	ENST00000367772;ENST00000367771;ENST00000367770;ENST00000423670	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	5.54	5.54	0.83059	Armadillo-like helical (1);Armadillo-type fold (1);	0.050565	0.85682	D	0.000000	T	0.50017	0.1591	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.983	T	0.54866	-0.8229	10	0.62326	D	0.03	-16.4968	19.0844	0.93198	0.0:0.0:1.0:0.0	.	287;287	Q8IZE3-2;Q8IZE3	.;PACE1_HUMAN	V	287	ENSP00000356746:A287V;ENSP00000356745:A287V;ENSP00000356744:A287V;ENSP00000407993:A287V	ENSP00000356744:A287V	A	-	2	0	SCYL3	168100229	1.000000	0.71417	0.984000	0.44739	0.976000	0.68499	7.484000	0.81180	2.584000	0.87258	0.655000	0.94253	GCT	.	.		0.458	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4	NM_181093	
TDRD5	163589	hgsc.bcm.edu	37	1	179631239	179631239	+	Splice_Site	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:179631239G>A	ENST00000367614.1	+	14	2520	c.2161G>A	c.(2161-2163)Gat>Aat	p.D721N	TDRD5_ENST00000444136.1_Splice_Site_p.D775N|TDRD5_ENST00000294848.8_Splice_Site_p.D721N	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	721					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TACATTTTAGGATGAGATCCC	0.383																																					p.D775N		Atlas-SNP	.											.	TDRD5	149	.	0			c.G2323A						.						133.0	117.0	123.0					1																	179631239		2203	4300	6503	SO:0001630	splice_region_variant	163589	exon15			TTTTAGGATGAGA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2161-1G>A	chr1.hg19:g.179631239G>A		81.0	0.0		139.0	21.0	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136361	0.56936	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.37411	2.43;2.43;2.69;1.2	5.41	3.43	0.39272	.	0.258333	0.27846	N	0.017610	T	0.42653	0.1212	M	0.63843	1.955	0.25750	N	0.98506	D;D	0.57899	0.981;0.958	P;P	0.54174	0.744;0.477	T	0.26849	-1.0091	9	.	.	.	-13.5812	6.3659	0.21455	0.0972:0.1865:0.7164:0.0	.	775;721	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	N	721;721;775;231	ENSP00000356586:D721N;ENSP00000294848:D721N;ENSP00000406052:D775N;ENSP00000410744:D231N	.	D	+	1	0	TDRD5	177897862	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	2.006000	0.40874	2.699000	0.92147	0.650000	0.86243	GAT	.	.		0.383	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	Missense_Mutation
HMCN1	83872	hgsc.bcm.edu	37	1	186088414	186088414	+	Silent	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:186088414G>A	ENST00000271588.4	+	78	12169	c.11940G>A	c.(11938-11940)gtG>gtA	p.V3980V	HMCN1_ENST00000367492.2_Silent_p.V3980V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3980	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATCGACACGTGACCCTTCATG	0.433																																					p.V3980V		Atlas-SNP	.											.	HMCN1	797	.	0			c.G11940A						.						114.0	106.0	109.0					1																	186088414		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon78			ACACGTGACCCTT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11940G>A	chr1.hg19:g.186088414G>A		222.0	0.0		386.0	64.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
TTC13	79573	hgsc.bcm.edu	37	1	231047225	231047225	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:231047225C>G	ENST00000366661.4	-	20	2307	c.2300G>C	c.(2299-2301)cGa>cCa	p.R767P	TTC13_ENST00000414259.1_Missense_Mutation_p.R714P|TTC13_ENST00000366662.4_Missense_Mutation_p.R713P	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	767										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		CCTGGATCCTCGAGAGAGTGG	0.308																																					p.R767P		Atlas-SNP	.											.	TTC13	74	.	0			c.G2300C						.						33.0	37.0	35.0					1																	231047225		2200	4281	6481	SO:0001583	missense	79573	exon20			GATCCTCGAGAGA		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.2300G>C	chr1.hg19:g.231047225C>G	ENSP00000355621:p.Arg767Pro	525.0	0.0		1011.0	101.0	NM_024525	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	hg19	CCDS1588.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725840	0.89298	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	T;T;T	0.64260	-0.09;0.02;0.03	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.80297	0.4597	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.995;0.999;0.999	T	0.82032	-0.0658	10	0.87932	D	0	-14.7544	19.4157	0.94697	0.0:1.0:0.0:0.0	.	692;714;713;767	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	P	767;713;714	ENSP00000355621:R767P;ENSP00000355622:R713P;ENSP00000416631:R714P	ENSP00000355621:R767P	R	-	2	0	TTC13	229113848	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.178000	0.77657	2.655000	0.90218	0.591000	0.81541	CGA	.	.		0.308	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	
SNTG2	54221	hgsc.bcm.edu	37	2	1241734	1241734	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr2:1241734G>T	ENST00000308624.5	+	10	923	c.794G>T	c.(793-795)gGc>gTc	p.G265V	SNTG2_ENST00000407292.1_Missense_Mutation_p.G138V	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	265					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GCCCAGGATGGCACCGACTGG	0.602																																					p.G265V		Atlas-SNP	.											.	SNTG2	125	.	0			c.G794T						.						35.0	40.0	39.0					2																	1241734		2194	4294	6488	SO:0001583	missense	54221	exon10			AGGATGGCACCGA	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.794G>T	chr2.hg19:g.1241734G>T	ENSP00000311837:p.Gly265Val	51.0	0.0		36.0	18.0	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	hg19	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	6.878	0.531504	0.13127	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.54675	0.56;0.56	4.68	3.8	0.43715	.	0.282778	0.44097	D	0.000496	T	0.31358	0.0794	N	0.14661	0.345	0.40631	D	0.981858	B;B	0.34015	0.435;0.112	B;B	0.28139	0.086;0.039	T	0.13019	-1.0525	10	0.30854	T	0.27	.	11.1991	0.48730	0.0923:0.0:0.9077:0.0	.	138;265	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	V	265;138	ENSP00000311837:G265V;ENSP00000385020:G138V	ENSP00000311837:G265V	G	+	2	0	SNTG2	1224285	0.997000	0.39634	0.005000	0.12908	0.076000	0.17211	2.665000	0.46791	1.083000	0.41159	0.655000	0.94253	GGC	.	.		0.602	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
BIRC6	57448	hgsc.bcm.edu	37	2	32703821	32703821	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr2:32703821A>G	ENST00000421745.2	+	36	7321	c.7187A>G	c.(7186-7188)gAt>gGt	p.D2396G		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2396					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AATAGAGGAGATATATCTTGG	0.418																																					p.D2396G	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.A7187G						.						185.0	170.0	175.0					2																	32703821		2203	4300	6503	SO:0001583	missense	57448	exon36			GAGGAGATATATC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.7187A>G	chr2.hg19:g.32703821A>G	ENSP00000393596:p.Asp2396Gly	115.0	0.0		100.0	11.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273759	0.80580	.	.	ENSG00000115760	ENST00000421745	T	0.78126	-1.15	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.71187	0.3310	N	0.24115	0.695	0.54753	D	0.999981	P	0.51791	0.948	P	0.46237	0.508	T	0.76143	-0.3067	10	0.66056	D	0.02	.	15.3129	0.74048	1.0:0.0:0.0:0.0	.	2396	Q9NR09	BIRC6_HUMAN	G	2396	ENSP00000393596:D2396G	ENSP00000393596:D2396G	D	+	2	0	BIRC6	32557325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.179000	0.77665	2.012000	0.59069	0.533000	0.62120	GAT	.	.		0.418	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
TTN	7273	hgsc.bcm.edu	37	2	179528600	179528600	+	Intron	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr2:179528600C>T	ENST00000591111.1	-	154	34489				TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E12132K|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTTCTCTTCGCGGATAACC	0.423																																					p.E12132K		Atlas-SNP	.											.	TTN	18412	.	0			c.G36394A						.						305.0	282.0	289.0					2																	179528600		876	1991	2867	SO:0001627	intron_variant	7273	exon170			TCTCTTCGCGGAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34265-5079G>A	chr2.hg19:g.179528600C>T		144.0	0.0		101.0	50.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.18	3.778576	0.70107	.	.	ENSG00000155657	ENST00000541862;ENST00000392423	.	.	.	4.73	3.83	0.44106	.	.	.	.	.	T	0.42517	0.1206	.	.	.	0.80722	D	1	P	0.51537	0.946	B	0.41088	0.347	T	0.36383	-0.9750	7	0.40728	T	0.16	.	10.3022	0.43659	0.1357:0.7878:0.0:0.0765	.	406	Q71S18	.	K	406;258	.	ENSP00000376219:E258K	E	-	1	0	TTN	179236845	0.042000	0.20092	0.990000	0.47175	0.007000	0.05969	2.169000	0.42434	2.334000	0.79466	0.558000	0.71614	GAA	.	.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FSIP2	401024	hgsc.bcm.edu	37	2	186670171	186670171	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr2:186670171A>G	ENST00000424728.1	+	17	16138	c.16138A>G	c.(16138-16140)Atg>Gtg	p.M5380V	FSIP2_ENST00000343098.5_Missense_Mutation_p.M5469V			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5380										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TGCTATAGGGATGATTGCTGC	0.353																																					p.M5469V		Atlas-SNP	.											.	FSIP2	251	.	0			c.A16405G						.						112.0	103.0	106.0					2																	186670171		1870	4092	5962	SO:0001583	missense	401024	exon17			ATAGGGATGATTG	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.16138A>G	chr2.hg19:g.186670171A>G	ENSP00000401306:p.Met5380Val	338.0	0.0		247.0	109.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	A	5.854	0.341798	0.11069	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.46063	0.88;0.88	5.28	2.9	0.33743	.	.	.	.	.	T	0.30854	0.0778	L	0.29908	0.895	0.21105	N	0.999787	.	.	.	.	.	.	T	0.20273	-1.0280	7	0.27785	T	0.31	.	6.5993	0.22691	0.8126:0.0:0.1874:0.0	.	.	.	.	V	5469;5380	ENSP00000344403:M5469V;ENSP00000401306:M5380V	ENSP00000344403:M5469V	M	+	1	0	FSIP2	186378416	0.991000	0.36638	0.851000	0.33527	0.076000	0.17211	1.404000	0.34623	0.462000	0.27095	0.377000	0.23210	ATG	.	.		0.353	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
PLCL1	5334	hgsc.bcm.edu	37	2	198950089	198950089	+	Silent	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr2:198950089T>C	ENST00000428675.1	+	2	2246	c.1848T>C	c.(1846-1848)agT>agC	p.S616S	PLCL1_ENST00000437704.2_Silent_p.S518S	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	616	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GTTCATTTAGTGAAACAGAGG	0.373																																					p.S616S		Atlas-SNP	.											.	PLCL1	358	.	0			c.T1848C						.						50.0	53.0	52.0					2																	198950089		2201	4300	6501	SO:0001819	synonymous_variant	5334	exon2			ATTTAGTGAAACA	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1848T>C	chr2.hg19:g.198950089T>C		122.0	0.0		71.0	5.0	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Silent	SNP	ENST00000428675.1	hg19	CCDS2326.2																																																																																			.	.		0.373	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
NBEAL1	65065	hgsc.bcm.edu	37	2	204009854	204009854	+	Missense_Mutation	SNP	G	G	A	rs369975893		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr2:204009854G>A	ENST00000449802.1	+	32	5521	c.5188G>A	c.(5188-5190)Gaa>Aaa	p.E1730K		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1730										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ACGAGACCGGGAAGGAGGGGA	0.323																																					p.E1730K		Atlas-SNP	.											.	NBEAL1	266	.	0			c.G5188A						.	G	LYS/GLU	1,3659		0,1,1829	103.0	98.0	100.0		5188	4.6	1.0	2		100	0,8160		0,0,4080	no	missense	NBEAL1	NM_001114132.1	56	0,1,5909	AA,AG,GG		0.0,0.0273,0.0085	possibly-damaging	1730/2695	204009854	1,11819	1830	4080	5910	SO:0001583	missense	65065	exon32			GACCGGGAAGGAG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5188G>A	chr2.hg19:g.204009854G>A	ENSP00000399903:p.Glu1730Lys	135.0	0.0		115.0	7.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805363	0.70682	2.73E-4	0.0	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.58506	0.33	5.49	4.6	0.57074	.	0.254943	0.45606	D	0.000359	T	0.58438	0.2122	M	0.72894	2.215	0.58432	D	0.999997	B;B	0.21606	0.058;0.058	B;B	0.23275	0.045;0.045	T	0.57608	-0.7782	10	0.39692	T	0.17	.	15.5608	0.76244	0.0:0.0:0.8606:0.1394	.	1730;1719	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	K	1730	ENSP00000399903:E1730K	ENSP00000344985:E1730K	E	+	1	0	NBEAL1	203718099	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.452000	0.97615	1.432000	0.47375	0.650000	0.86243	GAA	.	.		0.323	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
C3orf20	84077	hgsc.bcm.edu	37	3	14724699	14724699	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr3:14724699T>C	ENST00000253697.3	+	3	931	c.479T>C	c.(478-480)aTg>aCg	p.M160T	C3orf20_ENST00000435614.1_Missense_Mutation_p.M38T|C3orf20_ENST00000412910.1_Missense_Mutation_p.M38T	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	160						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GTGGAGTCTATGTCGGGTAAG	0.582																																					p.M160T		Atlas-SNP	.											.	C3orf20	109	.	0			c.T479C						.						103.0	93.0	96.0					3																	14724699		2201	4298	6499	SO:0001583	missense	84077	exon3			AGTCTATGTCGGG	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.479T>C	chr3.hg19:g.14724699T>C	ENSP00000253697:p.Met160Thr	75.0	0.0		101.0	36.0	NM_032137	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	hg19	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.286714	0.23478	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.07567	3.47;3.18;3.18	4.93	0.128	0.14733	.	1.294780	0.05712	N	0.596087	T	0.05364	0.0142	N	0.19112	0.55	0.09310	N	1	B	0.21452	0.056	B	0.18561	0.022	T	0.43750	-0.9372	10	0.27082	T	0.32	-1.873	3.9665	0.09434	0.178:0.2562:0.0:0.5658	.	160	Q8ND61	CC020_HUMAN	T	160;38;38	ENSP00000253697:M160T;ENSP00000402933:M38T;ENSP00000396081:M38T	ENSP00000253697:M160T	M	+	2	0	C3orf20	14699703	0.000000	0.05858	0.004000	0.12327	0.546000	0.35178	0.087000	0.14958	-0.003000	0.14444	0.482000	0.46254	ATG	.	.		0.582	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
SGOL1	151648	hgsc.bcm.edu	37	3	20225381	20225381	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr3:20225381T>C	ENST00000263753.4	-	2	278	c.139A>G	c.(139-141)Atc>Gtc	p.I47V	SGOL1_ENST00000452020.1_Missense_Mutation_p.I47V|SGOL1-AS1_ENST00000448208.1_RNA|SGOL1_ENST00000419233.2_Missense_Mutation_p.I47V|SGOL1_ENST00000412868.1_Missense_Mutation_p.I47V|SGOL1_ENST00000437051.1_Missense_Mutation_p.I47V|SGOL1_ENST00000412997.1_Missense_Mutation_p.I47V|SGOL1_ENST00000421451.1_Missense_Mutation_p.I47V|SGOL1_ENST00000417364.1_Missense_Mutation_p.I47V|SGOL1-AS1_ENST00000441442.1_RNA|SGOL1_ENST00000443724.1_Missense_Mutation_p.I47V|SGOL1_ENST00000442720.1_Missense_Mutation_p.I47V|SGOL1_ENST00000429446.3_Missense_Mutation_p.I47V|SGOL1_ENST00000425061.1_Missense_Mutation_p.I47V|SGOL1_ENST00000306698.2_Missense_Mutation_p.I47V|SGOL1_ENST00000383774.1_Missense_Mutation_p.I47V	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)	47	Necessary for interaction with PPP2CA and PPP2R1A.				attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)			kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						CTCTTACTGATTATTTGGCAT	0.313																																					p.I47V		Atlas-SNP	.											.	SGOL1	55	.	0			c.A139G						.						95.0	95.0	95.0					3																	20225381		2203	4300	6503	SO:0001583	missense	151648	exon2			TACTGATTATTTG	BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.139A>G	chr3.hg19:g.20225381T>C	ENSP00000263753:p.Ile47Val	105.0	0.0		99.0	34.0	NM_001199253	Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	Missense_Mutation	SNP	ENST00000263753.4	hg19	CCDS33716.1	.	.	.	.	.	.	.	.	.	.	T	1.982	-0.433940	0.04669	.	.	ENSG00000129810	ENST00000306698;ENST00000419233;ENST00000263753;ENST00000383774;ENST00000425061;ENST00000443724;ENST00000421451;ENST00000452020;ENST00000442720;ENST00000412997;ENST00000437051;ENST00000412868;ENST00000429446;ENST00000417364	T;T;T;T;T;T;T;T;T;T	0.46063	0.88;2.98;0.93;0.88;0.93;2.98;1.49;0.89;1.49;0.89	5.53	-1.58	0.08479	Shugoshin, N-terminal (1);	1.230160	0.05183	N	0.501710	T	0.32645	0.0836	L	0.34521	1.04	0.09310	N	1	B;P;B;P;B;B;B	0.43412	0.114;0.454;0.114;0.806;0.114;0.27;0.114	B;B;B;P;B;B;B	0.44647	0.053;0.192;0.053;0.456;0.053;0.192;0.053	T	0.18493	-1.0335	10	0.30078	T	0.28	.	3.7402	0.08527	0.1082:0.1351:0.4447:0.312	.	47;47;47;47;47;47;47	Q5FBB7-7;B5BUA4;Q5FBB7-5;Q5FBB7-4;Q5FBB7-2;Q5FBB7;Q5FBB7-3	.;.;.;.;.;SGOL1_HUMAN;.	V	47	ENSP00000394625:I47V;ENSP00000263753:I47V;ENSP00000373284:I47V;ENSP00000414960:I47V;ENSP00000413070:I47V;ENSP00000414129:I47V;ENSP00000410458:I47V;ENSP00000389034:I47V;ENSP00000406880:I47V;ENSP00000394613:I47V	ENSP00000263753:I47V	I	-	1	0	SGOL1	20200385	0.024000	0.19004	0.000000	0.03702	0.012000	0.07955	0.342000	0.19926	-0.403000	0.07622	0.533000	0.62120	ATC	.	.		0.313	SGOL1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340498.1	NM_138484	
MYRIP	25924	hgsc.bcm.edu	37	3	40251524	40251524	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr3:40251524C>A	ENST00000302541.6	+	11	2187	c.1845C>A	c.(1843-1845)aaC>aaA	p.N615K	RN7SL411P_ENST00000585204.1_RNA|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000425621.1_Missense_Mutation_p.N615K|MYRIP_ENST00000396217.3_Missense_Mutation_p.N526K|MYRIP_ENST00000539167.1_Missense_Mutation_p.N428K|MYRIP_ENST00000444716.1_Missense_Mutation_p.N615K	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	615	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		AATCTGAGAACCAGAAGGAAA	0.493																																					p.N615K		Atlas-SNP	.											.	MYRIP	98	.	0			c.C1845A						.						58.0	57.0	57.0					3																	40251524		2203	4300	6503	SO:0001583	missense	25924	exon11			TGAGAACCAGAAG	AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.1845C>A	chr3.hg19:g.40251524C>A	ENSP00000301972:p.Asn615Lys	284.0	0.0		345.0	114.0	NM_015460	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	hg19	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.370859	0.42003	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.52	0.972	0.19704	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.735153	0.12786	N	0.439242	T	0.30355	0.0762	L	0.55481	1.735	0.36855	D	0.888095	P;P;B	0.48834	0.916;0.634;0.04	P;B;B	0.51701	0.677;0.124;0.025	T	0.29397	-1.0013	9	.	.	.	.	5.6033	0.17365	0.0:0.5718:0.1492:0.279	.	526;615;615	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	K	615;615;615;526;428	ENSP00000398665:N615K;ENSP00000301972:N615K;ENSP00000389323:N615K;ENSP00000379519:N526K;ENSP00000438297:N428K	.	N	+	3	2	MYRIP	40226528	0.190000	0.23276	0.997000	0.53966	0.999000	0.98932	-0.038000	0.12144	0.248000	0.21435	0.655000	0.94253	AAC	.	.		0.493	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
TRAK1	22906	hgsc.bcm.edu	37	3	42236385	42236385	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr3:42236385G>C	ENST00000327628.5	+	10	1465	c.1065G>C	c.(1063-1065)atG>atC	p.M355I	TRAK1_ENST00000396175.1_Missense_Mutation_p.M297I|TRAK1_ENST00000341421.3_Missense_Mutation_p.M297I|TRAK1_ENST00000449246.1_Missense_Mutation_p.M281I|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	355					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						ACAAAACCATGCCCAATACCA	0.592																																					p.M355I	GBM(44;195 884 22595 31865 41850)	Atlas-SNP	.											.	TRAK1	188	.	0			c.G1065C						.						139.0	101.0	114.0					3																	42236385		2203	4300	6503	SO:0001583	missense	22906	exon10			AACCATGCCCAAT		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1065G>C	chr3.hg19:g.42236385G>C	ENSP00000328998:p.Met355Ile	91.0	0.0		113.0	31.0	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	ENST00000327628.5	hg19	CCDS43072.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.391120	0.42410	.	.	ENSG00000182606	ENST00000327628;ENST00000543338;ENST00000449246;ENST00000396175;ENST00000341421;ENST00000427771	T;T;T;T;T	0.14516	3.09;3.05;3.08;3.07;2.5	6.06	6.06	0.98353	.	0.180581	0.64402	D	0.000017	T	0.14874	0.0359	L	0.44542	1.39	0.43555	D	0.995862	B;B;B;B;B;B	0.25850	0.051;0.002;0.003;0.032;0.136;0.002	B;B;B;B;B;B	0.20577	0.01;0.002;0.006;0.013;0.03;0.003	T	0.07790	-1.0754	10	0.20046	T	0.44	.	19.609	0.95594	0.0:0.0:1.0:0.0	.	281;297;355;297;281;355	B7Z218;C9JC32;B7Z347;Q9UPV9-2;E9PDS2;Q9UPV9	.;.;.;.;.;TRAK1_HUMAN	I	355;355;281;297;297;73	ENSP00000328998:M355I;ENSP00000410717:M281I;ENSP00000379478:M297I;ENSP00000340702:M297I;ENSP00000413729:M73I	ENSP00000328998:M355I	M	+	3	0	TRAK1	42211389	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.053000	0.64269	2.882000	0.98803	0.655000	0.94253	ATG	.	.		0.592	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
HYAL1	3373	hgsc.bcm.edu	37	3	50339584	50339584	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr3:50339584C>G	ENST00000266031.4	-	1	1419	c.804G>C	c.(802-804)gaG>gaC	p.E268D	HYAL3_ENST00000336307.1_5'Flank|NAT6_ENST00000354862.4_5'Flank|HYAL1_ENST00000395144.2_Missense_Mutation_p.E268D|NAT6_ENST00000443842.1_5'Flank|HYAL3_ENST00000513170.1_5'Flank|HYAL1_ENST00000320295.8_Missense_Mutation_p.E268D|HYAL3_ENST00000415204.1_5'Flank|HYAL1_ENST00000447605.2_Missense_Mutation_p.E9D|HYAL3_ENST00000450982.1_5'Flank|HYAL1_ENST00000395143.2_Missense_Mutation_p.E268D|HYAL1_ENST00000457214.2_Missense_Mutation_p.E86D|NAT6_ENST00000443094.2_5'Flank			Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1	268			E -> K (in MPS9). {ECO:0000269|PubMed:10339581}.		carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to pH (GO:0071467)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal joint morphogenesis (GO:0060272)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|negative regulation of cell growth (GO:0030308)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of growth (GO:0045927)|positive regulation of hyaluranon cable assembly (GO:1900106)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|hyaluranon cable (GO:0036117)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	hyaluronan synthase activity (GO:0050501)|hyalurononglucosaminidase activity (GO:0004415)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CACGGAATGCCTCGGCCACAC	0.592																																					p.E268D		Atlas-SNP	.											.	HYAL1	28	.	0			c.G804C						.						83.0	79.0	80.0					3																	50339584		2203	4300	6503	SO:0001583	missense	3373	exon2			GAATGCCTCGGCC	U90094	CCDS2816.1, CCDS2817.1, CCDS46832.1, CCDS46833.1	3p21.31	2014-07-17			ENSG00000114378	ENSG00000114378	3.2.1.35		5320	protein-coding gene	gene with protein product		607071				9223416, 9409739	Standard	NM_153281		Approved	LUCA1, HYAL-1, FUS2, NAT6	uc003czp.4	Q12794	OTTHUMG00000156941	ENST00000266031.4:c.804G>C	chr3.hg19:g.50339584C>G	ENSP00000266031:p.Glu268Asp	293.0	0.0		367.0	116.0	NM_033159	Q6FH23|Q6PIZ6|Q7KYU2|Q7LE34|Q8NFK5|Q8NFK6|Q8NFK7|Q8NFK8|Q8NFK9|Q93013|Q9UKD5|Q9UNI8	Missense_Mutation	SNP	ENST00000266031.4	hg19	CCDS2816.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516568	0.85495	.	.	ENSG00000114378	ENST00000395144;ENST00000266031;ENST00000320295;ENST00000395143;ENST00000457214;ENST00000447605	T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.47	5.46	4.59	0.56863	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.78767	0.4335	H	0.94698	3.57	0.44780	D	0.997789	D;D;D	0.89917	0.962;1.0;0.998	P;D;D	0.72625	0.64;0.978;0.938	D	0.84551	0.0644	10	0.87932	D	0	-26.9725	13.1397	0.59428	0.0:0.9219:0.0:0.0781	.	268;268;268	Q12794-7;Q12794-2;Q12794	.;.;HYAL1_HUMAN	D	268;268;268;268;86;9	ENSP00000378576:E268D;ENSP00000266031:E268D;ENSP00000346068:E268D;ENSP00000378575:E268D;ENSP00000393358:E86D;ENSP00000390149:E9D	ENSP00000266031:E268D	E	-	3	2	HYAL1	50314588	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	3.629000	0.54266	1.322000	0.45245	0.655000	0.94253	GAG	.	.		0.592	HYAL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346703.1		
TRPC1	7220	hgsc.bcm.edu	37	3	142467157	142467157	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr3:142467157G>A	ENST00000476941.1	+	4	973	c.487G>A	c.(487-489)Gtc>Atc	p.V163I	TRPC1_ENST00000273482.6_Missense_Mutation_p.V129I	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	163					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TGTTGCACCTGTCATTTTAGC	0.358																																					p.V163I		Atlas-SNP	.											.	TRPC1	82	.	0			c.G487A						.						124.0	125.0	125.0					3																	142467157		2203	4300	6503	SO:0001583	missense	7220	exon4			GCACCTGTCATTT	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.487G>A	chr3.hg19:g.142467157G>A	ENSP00000419313:p.Val163Ile	212.0	0.0		243.0	78.0	NM_001251845	Q14CE4	Missense_Mutation	SNP	ENST00000476941.1	hg19	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247341	0.39697	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;T	0.63255	0.7;-0.03	5.59	5.59	0.84812	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.61110	0.2321	N	0.11651	0.15	0.80722	D	1	D;P	0.63046	0.992;0.51	D;B	0.77004	0.989;0.147	T	0.54450	-0.8292	10	0.05833	T	0.94	-29.8276	19.5934	0.95525	0.0:0.0:1.0:0.0	.	163;129	P48995;P48995-2	TRPC1_HUMAN;.	I	163;129	ENSP00000419313:V163I;ENSP00000273482:V129I	ENSP00000273482:V129I	V	+	1	0	TRPC1	143949847	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.441000	0.97557	2.641000	0.89580	0.460000	0.39030	GTC	.	.		0.358	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
MSX1	4487	hgsc.bcm.edu	37	4	4861842	4861842	+	Silent	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr4:4861842G>A	ENST00000382723.4	+	1	450	c.216G>A	c.(214-216)aaG>aaA	p.K72K		NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	72					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		ACCACAGGAAGCCGGGGGCCA	0.761																																					p.K72K		Atlas-SNP	.											.	MSX1	19	.	0			c.G216A						.						7.0	8.0	7.0					4																	4861842		1578	2871	4449	SO:0001819	synonymous_variant	4487	exon1			CAGGAAGCCGGGG	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.216G>A	chr4.hg19:g.4861842G>A		805.0	0.0		1014.0	281.0	NM_002448	A0SZU5|A8K3M1|Q96NY4	Silent	SNP	ENST00000382723.4	hg19	CCDS3378.2																																																																																			.	.		0.761	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3		
BRD9	65980	hgsc.bcm.edu	37	5	891776	891776	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr5:891776A>C	ENST00000467963.1	-	2	412	c.246T>G	c.(244-246)gaT>gaG	p.D82E	BRD9_ENST00000388890.4_5'Flank|BRD9_ENST00000323510.4_5'Flank|BRD9_ENST00000483173.1_Missense_Mutation_p.M31R|TRIP13_ENST00000166345.3_5'Flank|BRD9_ENST00000435709.2_5'UTR	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	82	Lys-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			TTCTTTCCTCATCGTCCAGAT	0.557																																					p.D82E		Atlas-SNP	.											.	BRD9	113	.	0			c.T246G						.						101.0	90.0	93.0					5																	891776		692	1591	2283	SO:0001583	missense	65980	exon2			TTCCTCATCGTCC	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.246T>G	chr5.hg19:g.891776A>C	ENSP00000419765:p.Asp82Glu	43.0	0.0		94.0	34.0	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	hg19	CCDS34127.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.592|6.592	0.477509|0.477509	0.12521|0.12521	.|.	.|.	ENSG00000028310|ENSG00000028310	ENST00000467963|ENST00000483173	T|T	0.08896|0.39056	3.04|1.1	5.02|5.02	-8.26|-8.26	0.01021|0.01021	.|.	.|.	.|.	.|.	.|.	T|T	0.28234|0.28234	0.0697|0.0697	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|B	0.02656|0.02656	0.0|0.0	B|B	0.08055|0.01281	0.003|0.0	T|T	0.05194|0.05194	-1.0900|-1.0900	8|8	0.18710|0.87932	T|D	0.47|0	.|.	10.3454|10.3454	0.43903|0.43903	0.1561:0.4074:0.4364:0.0|0.1561:0.4074:0.4364:0.0	.|.	82|31	Q9H8M2|B4DMQ2	BRD9_HUMAN|.	E|R	82|31	ENSP00000419765:D82E|ENSP00000419845:M31R	ENSP00000419765:D82E|ENSP00000420397:M31R	D|M	-|-	3|2	2|0	BRD9|BRD9	944776|944776	0.002000|0.002000	0.14202|0.14202	0.316000|0.316000	0.25252|0.25252	0.691000|0.691000	0.40173|0.40173	-1.212000|-1.212000	0.02994|0.02994	-1.619000|-1.619000	0.01566|0.01566	0.533000|0.533000	0.62120|0.62120	GAT|ATG	.	.		0.557	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
HIST1H3C	8352	hgsc.bcm.edu	37	6	26045843	26045843	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:26045843C>T	ENST00000540144.1	+	1	205	c.205C>T	c.(205-207)Cag>Tag	p.Q69*	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	69					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GCTGCCGTTCCAGCGCCTGGT	0.622																																					p.Q69X		Atlas-SNP	.											.	HIST1H3C	34	.	0			c.C205T						.						50.0	52.0	51.0					6																	26045843		2203	4300	6503	SO:0001587	stop_gained	8352	exon1			CCGTTCCAGCGCC	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.205C>T	chr6.hg19:g.26045843C>T	ENSP00000439493:p.Gln69*	117.0	0.0		200.0	52.0	NM_003531	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Nonsense_Mutation	SNP	ENST00000540144.1	hg19	CCDS4576.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350369	0.41599	.	.	ENSG00000196532	ENST00000540144	.	.	.	4.38	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.8064	0.85706	0.0:1.0:0.0:0.0	.	.	.	.	X	69	.	ENSP00000439493:Q69X	Q	+	1	0	HIST1H3C	26153822	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	4.821000	0.62679	2.378000	0.81104	0.491000	0.48974	CAG	.	.		0.622	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040078.1	NM_003531	
SYNGAP1	8831	hgsc.bcm.edu	37	6	33405540	33405540	+	Silent	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:33405540G>T	ENST00000418600.2	+	8	959	c.858G>T	c.(856-858)ctG>ctT	p.L286L	SYNGAP1_ENST00000496374.1_3'UTR|MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000293748.5_Silent_p.L286L|SYNGAP1_ENST00000428982.2_Silent_p.L227L	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	286	C2.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						AGCTCTGCCTGGATGACATGC	0.607																																					p.L286L		Atlas-SNP	.											.	SYNGAP1	202	.	0			c.G858T						.						87.0	92.0	90.0					6																	33405540		2203	4300	6503	SO:0001819	synonymous_variant	8831	exon8			CTGCCTGGATGAC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.858G>T	chr6.hg19:g.33405540G>T		105.0	0.0		130.0	35.0	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	hg19	CCDS34434.2																																																																																			.	.		0.607	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
RIMS1	22999	hgsc.bcm.edu	37	6	73001644	73001644	+	Silent	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:73001644C>A	ENST00000521978.1	+	26	3745	c.3745C>A	c.(3745-3747)Cga>Aga	p.R1249R	RIMS1_ENST00000538414.1_Silent_p.R45R|RIMS1_ENST00000425662.2_Silent_p.R489R|RIMS1_ENST00000348717.5_Silent_p.R1041R|RIMS1_ENST00000517960.1_Silent_p.R1041R|RIMS1_ENST00000401910.3_Silent_p.R569R|RIMS1_ENST00000518273.1_Silent_p.R1100R|RIMS1_ENST00000264839.7_Silent_p.R1098R|RIMS1_ENST00000523963.1_Silent_p.R546R|RIMS1_ENST00000520567.1_Silent_p.R1071R|RIMS1_ENST00000522291.1_Silent_p.R1020R|RIMS1_ENST00000517827.1_Silent_p.R555R|RIMS1_ENST00000491071.2_Silent_p.R1072R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1249					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAGAATGCACCGACAGAGAAG	0.468																																					p.R1249R		Atlas-SNP	.											.	RIMS1	278	.	0			c.C3745A						.						21.0	21.0	21.0					6																	73001644		1964	4130	6094	SO:0001819	synonymous_variant	22999	exon26			ATGCACCGACAGA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3745C>A	chr6.hg19:g.73001644C>A		184.0	0.0		192.0	47.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	hg19	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	C	8.210	0.800214	0.16397	.	.	ENSG00000079841	ENST00000517433	.	.	.	5.57	1.62	0.23740	.	.	.	.	.	T	0.43700	0.1259	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32561	-0.9902	4	.	.	.	-13.4053	9.5	0.39011	0.3654:0.5705:0.0:0.0641	.	.	.	.	Q	594	.	.	P	+	2	0	RIMS1	73058365	1.000000	0.71417	0.942000	0.38095	0.807000	0.45602	3.391000	0.52530	0.061000	0.16311	0.650000	0.86243	CCG	.	.		0.468	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
FHL5	9457	hgsc.bcm.edu	37	6	97053798	97053798	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:97053798A>G	ENST00000326771.2	+	5	735	c.355A>G	c.(355-357)Aag>Gag	p.K119E	FHL5_ENST00000541107.1_Missense_Mutation_p.K119E	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	119	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AATGGAATTTAAGGGAAACTA	0.363																																					p.K119E		Atlas-SNP	.											.	FHL5	73	.	0			c.A355G						.						77.0	74.0	75.0					6																	97053798		2203	4300	6503	SO:0001583	missense	9457	exon5			GAATTTAAGGGAA	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.355A>G	chr6.hg19:g.97053798A>G	ENSP00000326022:p.Lys119Glu	149.0	0.0		147.0	29.0	NM_020482	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	ENST00000326771.2	hg19	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.177873	0.57692	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	D;D;D	0.87334	-2.24;-2.24;-2.24	6.06	3.58	0.41010	Zinc finger, LIM-type (5);	0.000000	0.47455	D	0.000232	T	0.67316	0.2880	N	0.17674	0.51	0.44899	D	0.997912	B	0.27951	0.195	B	0.28011	0.085	T	0.71196	-0.4664	10	0.51188	T	0.08	.	9.5385	0.39237	0.8127:0.1222:0.0651:0.0	.	119	Q5TD97	FHL5_HUMAN	E	119	ENSP00000442357:K119E;ENSP00000326022:K119E;ENSP00000396390:K119E	ENSP00000326022:K119E	K	+	1	0	FHL5	97160519	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.015000	0.64035	2.323000	0.78572	0.528000	0.53228	AAG	.	.		0.363	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
ARMC2	84071	hgsc.bcm.edu	37	6	109232114	109232114	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:109232114A>G	ENST00000392644.4	+	9	1204	c.1036A>G	c.(1036-1038)Aga>Gga	p.R346G	ARMC2_ENST00000368972.3_Missense_Mutation_p.R181G	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	346										endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		TAAAGTGAGTAGAAAGAATCT	0.308																																					p.R346G		Atlas-SNP	.											.	ARMC2	56	.	0			c.A1036G						.						36.0	36.0	36.0					6																	109232114		2200	4293	6493	SO:0001583	missense	84071	exon9			GTGAGTAGAAAGA	BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.1036A>G	chr6.hg19:g.109232114A>G	ENSP00000376417:p.Arg346Gly	67.0	0.0		63.0	18.0	NM_032131	A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Missense_Mutation	SNP	ENST00000392644.4	hg19	CCDS5069.2	.	.	.	.	.	.	.	.	.	.	A	2.282	-0.364408	0.05103	.	.	ENSG00000118690	ENST00000368972;ENST00000392644	T;T	0.18810	2.22;2.19	5.19	1.57	0.23409	.	0.096535	0.64402	N	0.000001	T	0.01029	0.0034	N	0.00563	-1.375	0.27212	N	0.959877	B	0.02656	0.0	B	0.01281	0.0	T	0.47341	-0.9125	10	0.02654	T	1	.	7.7902	0.29116	0.2971:0.0:0.7029:0.0	.	346	Q8NEN0	ARMC2_HUMAN	G	181;346	ENSP00000357968:R181G;ENSP00000376417:R346G	ENSP00000357968:R181G	R	+	1	2	ARMC2	109338807	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.528000	0.45624	0.317000	0.23160	0.482000	0.46254	AGA	.	.		0.308	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041732.2	NM_032131	
SERAC1	84947	hgsc.bcm.edu	37	6	158535993	158535993	+	Silent	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:158535993G>A	ENST00000367104.3	-	15	1643	c.1512C>T	c.(1510-1512)gtC>gtT	p.V504V	SERAC1_ENST00000367101.1_Missense_Mutation_p.S519L|SERAC1_ENST00000367102.2_Missense_Mutation_p.S519L	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	504					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		GCATCTTTTTGACAAGAAGAC	0.363																																					p.V504V		Atlas-SNP	.											.	SERAC1	31	.	0			c.C1512T						.						121.0	127.0	125.0					6																	158535993		2203	4300	6503	SO:0001819	synonymous_variant	84947	exon15			CTTTTTGACAAGA	BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.1512C>T	chr6.hg19:g.158535993G>A		95.0	0.0		116.0	5.0	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Silent	SNP	ENST00000367104.3	hg19	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	.	15.00	2.703391	0.48412	.	.	ENSG00000122335	ENST00000367102;ENST00000367101	D;D	0.85629	-2.01;-2.01	5.93	0.961	0.19638	.	.	.	.	.	T	0.79149	0.4397	.	.	.	0.36661	D	0.877974	.	.	.	.	.	.	T	0.79918	-0.1600	6	0.87932	D	0	-25.448	3.4109	0.07357	0.1806:0.3091:0.4045:0.1058	.	.	.	.	L	519	ENSP00000356069:S519L;ENSP00000356068:S519L	ENSP00000356068:S519L	S	-	2	0	SERAC1	158455981	0.692000	0.27719	1.000000	0.80357	0.977000	0.68977	-0.205000	0.09411	2.271000	0.75665	0.533000	0.62120	TCA	.	.		0.363	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
SUN1	23353	hgsc.bcm.edu	37	7	878543	878543	+	Silent	SNP	A	A	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr7:878543A>C	ENST00000405266.1	+	2	210	c.186A>C	c.(184-186)gcA>gcC	p.A62A	SUN1_ENST00000469755.1_3'UTR|SUN1_ENST00000456758.2_Silent_p.A120A|SUN1_ENST00000457378.2_Silent_p.A83A|SUN1_ENST00000425407.2_Silent_p.A12A|SUN1_ENST00000401592.1_Silent_p.A62A|SUN1_ENST00000452783.2_Silent_p.A62A|SUN1_ENST00000403868.1_Silent_p.A62A|SUN1_ENST00000389574.3_Silent_p.A12A			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	62	LMNA-binding.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCACGACAGCATGCACCCTGG	0.597																																					p.A83A		Atlas-SNP	.											.	SUN1	157	.	0			c.A249C						.						39.0	39.0	39.0					7																	878543		2035	4190	6225	SO:0001819	synonymous_variant	23353	exon4			GACAGCATGCACC	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.186A>C	chr7.hg19:g.878543A>C		61.0	0.0		61.0	12.0	NM_001171945	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Silent	SNP	ENST00000405266.1	hg19																																																																																				.	.		0.597	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154	
SRPK2	6733	hgsc.bcm.edu	37	7	104767483	104767483	+	Silent	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr7:104767483A>G	ENST00000393651.3	-	14	1866	c.1779T>C	c.(1777-1779)taT>taC	p.Y593Y	SRPK2_ENST00000489828.1_Silent_p.Y582Y|SRPK2_ENST00000357311.3_Silent_p.Y582Y	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						GTTCAAACAAATAATCTCCCG	0.478																																					p.Y593Y		Atlas-SNP	.											.	SRPK2	76	.	0			c.T1779C						.						137.0	117.0	124.0					7																	104767483		2203	4300	6503	SO:0001819	synonymous_variant	6733	exon14			AAACAAATAATCT	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.1779T>C	chr7.hg19:g.104767483A>G		125.0	0.0		136.0	48.0	NM_182692		Silent	SNP	ENST00000393651.3	hg19	CCDS34724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.47|10.47	1.359425|1.359425	0.24598|0.24598	.|.	.|.	ENSG00000135250|ENSG00000135250	ENST00000477925|ENST00000474770	.|.	.|.	.|.	5.68|5.68	0.786|0.786	0.18590|0.18590	.|.	.|.	.|.	.|.	.|.	T|T	0.58264|0.58264	0.2110|0.2110	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.52533|0.52533	-0.8563|-0.8563	4|4	.|.	.|.	.|.	-17.0746|-17.0746	10.1801|10.1801	0.42963|0.42963	0.6661:0.0:0.3339:0.0|0.6661:0.0:0.3339:0.0	.|.	.|.	.|.	.|.	L|T	189|67	.|.	.|.	F|I	-|-	1|2	0|0	SRPK2|SRPK2	104554719|104554719	0.997000|0.997000	0.39634|0.39634	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	0.687000|0.687000	0.25407|0.25407	0.178000|0.178000	0.19917|0.19917	0.460000|0.460000	0.39030|0.39030	TTT|ATT	.	.		0.478	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348723.1	NM_182691	
DGKI	9162	hgsc.bcm.edu	37	7	137170153	137170153	+	Silent	SNP	T	T	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr7:137170153T>A	ENST00000288490.5	-	24	2394	c.2394A>T	c.(2392-2394)tcA>tcT	p.S798S	DGKI_ENST00000446122.1_Silent_p.S780S|DGKI_ENST00000424189.2_Silent_p.S801S|DGKI_ENST00000453654.2_Silent_p.S498S	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	798					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CAGAAGAAACTGACTGTAGGT	0.368																																					p.S798S		Atlas-SNP	.											.	DGKI	335	.	0			c.A2394T						.						81.0	80.0	80.0					7																	137170153		2203	4300	6503	SO:0001819	synonymous_variant	9162	exon24			AGAAACTGACTGT	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2394A>T	chr7.hg19:g.137170153T>A		258.0	0.0		339.0	110.0	NM_004717	A4D1Q9|Q9NZ49	Silent	SNP	ENST00000288490.5	hg19	CCDS5845.1																																																																																			.	.		0.368	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
WEE2	494551	hgsc.bcm.edu	37	7	141416059	141416059	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr7:141416059C>T	ENST00000397541.2	+	3	983	c.577C>T	c.(577-579)Cct>Tct	p.P193S	WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000478332.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	193					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					GGGAGGGCTGCCTGCCAAGGT	0.438																																					p.P193S		Atlas-SNP	.											.	WEE2	59	.	0			c.C577T						.						126.0	127.0	127.0					7																	141416059		1959	4137	6096	SO:0001583	missense	494551	exon3			GGGCTGCCTGCCA	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.577C>T	chr7.hg19:g.141416059C>T	ENSP00000380675:p.Pro193Ser	34.0	0.0		37.0	13.0	NM_001105558		Missense_Mutation	SNP	ENST00000397541.2	hg19	CCDS43660.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.224820	0.39300	.	.	ENSG00000214102	ENST00000397541	T	0.24908	1.83	4.34	4.34	0.51931	.	0.158837	0.42294	U	0.000723	T	0.35682	0.0940	M	0.77103	2.36	0.42515	D	0.99298	P	0.42785	0.79	B	0.44108	0.441	T	0.37174	-0.9717	10	0.66056	D	0.02	.	12.5171	0.56038	0.0:1.0:0.0:0.0	.	193	P0C1S8	WEE2_HUMAN	S	193	ENSP00000380675:P193S	ENSP00000380675:P193S	P	+	1	0	WEE2	141062528	1.000000	0.71417	0.982000	0.44146	0.121000	0.20230	1.177000	0.31969	2.414000	0.81942	0.561000	0.74099	CCT	.	.		0.438	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	
PTPRN2	5799	hgsc.bcm.edu	37	7	157959681	157959681	+	Silent	SNP	G	G	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr7:157959681G>C	ENST00000389418.4	-	6	861	c.852C>G	c.(850-852)gcC>gcG	p.A284A	PTPRN2_ENST00000389413.3_Silent_p.A284A|PTPRN2_ENST00000404321.2_Silent_p.A307A|PTPRN2_ENST00000409483.1_Silent_p.A246A|PTPRN2_ENST00000389416.4_Silent_p.A267A	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	284					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACTTCTGGGGGGCGGCTGGTG	0.652																																					p.A284A		Atlas-SNP	.											.	PTPRN2	243	.	0			c.C852G						.						12.0	12.0	12.0					7																	157959681		2117	4144	6261	SO:0001819	synonymous_variant	5799	exon6			CTGGGGGGCGGCT	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.852C>G	chr7.hg19:g.157959681G>C		104.0	0.0		126.0	37.0	NM_130843	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	ENST00000389418.4	hg19	CCDS5947.1																																																																																			.	.		0.652	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
ESYT2	57488	hgsc.bcm.edu	37	7	158540904	158540904	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr7:158540904C>T	ENST00000251527.5	-	15	1771	c.1706G>A	c.(1705-1707)cGc>cAc	p.R569H		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	597	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						AAGGTCCTGGCGCTTGGGATT	0.338																																					p.R569H		Atlas-SNP	.											.	ESYT2	70	.	0			c.G1706A						.						120.0	124.0	123.0					7																	158540904		2203	4300	6503	SO:0001583	missense	57488	exon15			TCCTGGCGCTTGG	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1706G>A	chr7.hg19:g.158540904C>T	ENSP00000251527:p.Arg569His	121.0	0.0		152.0	10.0	NM_020728	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	hg19	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949205	0.73787	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000429474	T;T	0.69040	-0.37;-0.37	4.98	4.98	0.66077	.	0.117564	0.52532	D	0.000062	T	0.75975	0.3923	L	0.44542	1.39	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70016	0.967;0.939	T	0.76647	-0.2882	10	0.48119	T	0.1	-21.6892	17.2579	0.87062	0.0:1.0:0.0:0.0	.	618;569	A0FGR8-6;A0FGR8-2	.;.	H	569;618;560;393	ENSP00000251527:R569H;ENSP00000275418:R560H	ENSP00000251527:R569H	R	-	2	0	ESYT2	158233665	0.859000	0.29813	1.000000	0.80357	0.998000	0.95712	1.507000	0.35758	2.308000	0.77769	0.563000	0.77884	CGC	.	.		0.338	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
TLN1	7094	hgsc.bcm.edu	37	9	35703773	35703773	+	Splice_Site	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr9:35703773T>C	ENST00000314888.9	-	47	6709	c.6356A>G	c.(6355-6357)aAg>aGg	p.K2119R	TLN1_ENST00000464379.1_5'UTR|TLN1_ENST00000540444.1_Splice_Site_p.K2013R	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2119					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTCTCCAACCTTGGCAGAGTT	0.507																																					p.K2119R		Atlas-SNP	.											.	TLN1	185	.	0			c.A6356G						.						90.0	84.0	86.0					9																	35703773		2203	4300	6503	SO:0001630	splice_region_variant	7094	exon47			CCAACCTTGGCAG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6357+1A>G	chr9.hg19:g.35703773T>C		62.0	0.0		51.0	15.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	17.21	3.332809	0.60853	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.09073	3.02;3.02	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.12646	0.0307	M	0.74389	2.26	0.80722	D	1	P	0.36616	0.561	B	0.33454	0.164	T	0.03315	-1.1049	10	0.37606	T	0.19	-19.6436	14.6742	0.68967	0.0:0.0:0.0:1.0	.	2119	Q9Y490	TLN1_HUMAN	R	2119;2013	ENSP00000316029:K2119R;ENSP00000442981:K2013R	ENSP00000316029:K2119R	K	-	2	0	TLN1	35693773	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.148000	0.64857	1.879000	0.54435	0.459000	0.35465	AAG	.	.		0.507	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	Missense_Mutation
CCDC180	100499483	hgsc.bcm.edu	37	9	100117288	100117288	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr9:100117288C>G	ENST00000357054.1	+	35	4242	c.3307C>G	c.(3307-3309)Cag>Gag	p.Q1103E	CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000375202.2_Missense_Mutation_p.Q1132E|CCDC180_ENST00000529487.1_Missense_Mutation_p.Q1132E|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1103						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AATCAAGTGCCAGGTAGGATA	0.463																																					p.Q1132E		Atlas-SNP	.											.	.	.	.	0			c.C3394G						.						54.0	52.0	53.0					9																	100117288		2203	4300	6503	SO:0001583	missense	0	exon24			AAGTGCCAGGTAG	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3307C>G	chr9.hg19:g.100117288C>G	ENSP00000349562:p.Gln1103Glu	48.0	0.0		74.0	31.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.24	1.879224	0.33162	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.05199	3.48;3.8;3.8	5.16	3.3	0.37823	.	0.101074	0.43579	N	0.000552	T	0.01730	0.0055	N	0.01003	-1.06	0.80722	D	1	B;B	0.20261	0.001;0.043	B;B	0.15052	0.003;0.012	T	0.42531	-0.9446	10	0.02654	T	1	-13.779	8.8157	0.34993	0.0:0.2507:0.6308:0.1185	.	1271;1103	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	E	1103;1132;1132	ENSP00000349562:Q1103E;ENSP00000364348:Q1132E;ENSP00000434727:Q1132E	ENSP00000349562:Q1103E	Q	+	1	0	C9orf174	99157109	1.000000	0.71417	0.981000	0.43875	0.937000	0.57800	4.043000	0.57354	0.671000	0.31185	-0.175000	0.13238	CAG	.	.		0.463	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
FOXE1	2304	hgsc.bcm.edu	37	9	100616728	100616728	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr9:100616728G>A	ENST00000375123.3	+	1	1193	c.532G>A	c.(532-534)Gcc>Acc	p.A178T		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	178	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				cgccgccgccgccgccATCTT	0.791																																					p.A178T		Atlas-SNP	.											.	FOXE1	19	.	0			c.G532A						.						2.0	2.0	2.0					9																	100616728		529	1359	1888	SO:0001583	missense	2304	exon1			GCCGCCGCCGCCA	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.532G>A	chr9.hg19:g.100616728G>A	ENSP00000364265:p.Ala178Thr	194.0	0.0		194.0	10.0	NM_004473	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	hg19	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930555	0.52866	.	.	ENSG00000178919	ENST00000375123	D	0.93953	-3.32	3.94	3.02	0.34903	.	0.612880	0.14474	U	0.317365	D	0.83087	0.5178	L	0.34521	1.04	0.22571	N	0.998979	P	0.47253	0.892	B	0.30251	0.113	T	0.72969	-0.4130	10	0.13108	T	0.6	.	6.9037	0.24297	0.0993:0.1791:0.7216:0.0	.	178	O00358	FOXE1_HUMAN	T	178	ENSP00000364265:A178T	ENSP00000364265:A178T	A	+	1	0	FOXE1	99656549	0.087000	0.21565	0.898000	0.35279	0.822000	0.46500	0.422000	0.21296	0.758000	0.33059	0.557000	0.71058	GCC	.	.		0.791	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1		
PAEP	5047	hgsc.bcm.edu	37	9	138457313	138457313	+	Missense_Mutation	SNP	C	C	A	rs373981009		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr9:138457313C>A	ENST00000479141.1	+	5	523	c.479C>A	c.(478-480)cCc>cAc	p.P160H	PAEP_ENST00000277508.5_Missense_Mutation_p.P160H|PAEP_ENST00000371766.2_Missense_Mutation_p.P160H	NM_002571.2	NP_002562.2	P09466	PAEP_HUMAN	progestagen-associated endometrial protein	160					multicellular organismal development (GO:0007275)|transport (GO:0006810)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)			cervix(1)|endometrium(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		GCTTTCAGGCCCCTGCCCAGG	0.597																																					p.P160H		Atlas-SNP	.											.	PAEP	16	.	0			c.C479A						.	C	HIS/PRO,HIS/PRO	0,4406		0,0,2203	76.0	73.0	74.0		479,479	0.1	0.0	9		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PAEP	NM_001018049.1,NM_002571.2	77,77	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	160/181,160/181	138457313	1,13005	2203	4300	6503	SO:0001583	missense	5047	exon5			TCAGGCCCCTGCC		CCDS35173.1	9q34	2011-11-15	2008-07-31		ENSG00000122133	ENSG00000122133		"""Lipocalins"""	8573	protein-coding gene	gene with protein product	"""glycodelin-A"", ""glycodelin-S"", ""glycodelin-F"", ""progesterone-associated endometrial protein"", ""glycodelin"", ""PP14 protein (placental protein 14)"", ""pregnancy-associated endometrial alpha-2-globulin"", ""alpha uterine protein"""	173310				3320533, 2016092	Standard	XM_005263405		Approved	PEP, PP14, GdA, GdS, GdF, PAEG, GD, MGC138509, MGC142288	uc004cgd.1	P09466	OTTHUMG00000020914	ENST00000479141.1:c.479C>A	chr9.hg19:g.138457313C>A	ENSP00000417898:p.Pro160His	79.0	0.0		91.0	29.0	NM_002571	Q5T6T1|Q9UG92	Missense_Mutation	SNP	ENST00000479141.1	hg19	CCDS35173.1	.	.	.	.	.	.	.	.	.	.	c	9.835	1.189520	0.21954	0.0	1.16E-4	ENSG00000122133	ENST00000479141;ENST00000371767;ENST00000344007;ENST00000371766;ENST00000277508;ENST00000418284	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	1.06	0.109	0.14578	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	.	.	.	.	T	0.15046	0.0363	L	0.42245	1.32	0.09310	N	1	D;D;P;D	0.76494	0.995;0.998;0.939;0.999	P;D;P;D	0.69142	0.612;0.935;0.669;0.962	T	0.16129	-1.0413	9	0.72032	D	0.01	.	3.3802	0.07252	0.0:0.7085:0.0:0.2915	.	138;142;123;160	P09466-2;B2R4F9;A6XNE0;P09466	.;.;.;PAEP_HUMAN	H	160;125;66;160;160;112	ENSP00000417898:P160H;ENSP00000360831:P160H;ENSP00000277508:P160H;ENSP00000401933:P112H	ENSP00000277508:P160H	P	+	2	0	PAEP	137597134	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.162000	0.16501	0.029000	0.15352	-0.382000	0.06688	CCC	.	.		0.597	PAEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055010.1	NM_001018049	
CUBN	8029	hgsc.bcm.edu	37	10	16955931	16955931	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr10:16955931G>C	ENST00000377833.4	-	48	7477	c.7412C>G	c.(7411-7413)cCa>cGa	p.P2471R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2471	CUB 18. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATGAGGATTTGGGTTCGGGTA	0.522																																					p.P2471R		Atlas-SNP	.											.	CUBN	515	.	0			c.C7412G						.						102.0	99.0	100.0					10																	16955931		2203	4300	6503	SO:0001583	missense	8029	exon48			GGATTTGGGTTCG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7412C>G	chr10.hg19:g.16955931G>C	ENSP00000367064:p.Pro2471Arg	54.0	0.0		50.0	10.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	3.525	-0.097014	0.07010	.	.	ENSG00000107611	ENST00000377833	T	0.30714	1.52	4.89	4.89	0.63831	CUB (5);	0.157695	0.30151	N	0.010294	T	0.20941	0.0504	L	0.41356	1.27	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.09400	-1.0676	10	0.17369	T	0.5	.	6.5831	0.22607	0.1533:0.1566:0.6901:0.0	.	2471	O60494	CUBN_HUMAN	R	2471	ENSP00000367064:P2471R	ENSP00000367064:P2471R	P	-	2	0	CUBN	16995937	0.998000	0.40836	0.874000	0.34290	0.889000	0.51656	3.177000	0.50871	2.553000	0.86117	0.591000	0.81541	CCA	.	.		0.522	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CUBN	8029	hgsc.bcm.edu	37	10	17142085	17142085	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr10:17142085T>C	ENST00000377833.4	-	14	1749	c.1684A>G	c.(1684-1686)Aat>Gat	p.N562D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	562	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAGAGAGCATTGTCACTGCTG	0.428																																					p.N562D		Atlas-SNP	.											.	CUBN	515	.	0			c.A1684G						.						118.0	118.0	118.0					10																	17142085		2203	4300	6503	SO:0001583	missense	8029	exon14			GAGCATTGTCACT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1684A>G	chr10.hg19:g.17142085T>C	ENSP00000367064:p.Asn562Asp	235.0	0.0		243.0	80.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273220	0.80580	.	.	ENSG00000107611	ENST00000377833	T	0.65732	-0.17	5.51	5.51	0.81932	CUB (5);	0.145914	0.31450	N	0.007623	T	0.67906	0.2943	M	0.67517	2.055	0.80722	D	1	P	0.38300	0.626	P	0.44623	0.455	T	0.68899	-0.5287	10	0.44086	T	0.13	.	15.6269	0.76867	0.0:0.0:0.0:1.0	.	562	O60494	CUBN_HUMAN	D	562	ENSP00000367064:N562D	ENSP00000367064:N562D	N	-	1	0	CUBN	17182091	1.000000	0.71417	0.975000	0.42487	0.774000	0.43823	4.491000	0.60326	2.091000	0.63221	0.528000	0.53228	AAT	.	.		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
SLC16A9	220963	hgsc.bcm.edu	37	10	61412663	61412663	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr10:61412663A>T	ENST00000395348.3	-	6	2033	c.1397T>A	c.(1396-1398)tTt>tAt	p.F466Y	SLC16A9_ENST00000395347.1_Missense_Mutation_p.F466Y	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	466					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.F466C(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						GAAGCCACTAAAATAAAATGC	0.438																																					p.F466Y		Atlas-SNP	.											SLC16A9,larynx,carcinoma,0,1	SLC16A9	58	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.T1397A						.						70.0	77.0	74.0					10																	61412663		2203	4300	6503	SO:0001583	missense	220963	exon6			CCACTAAAATAAA	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1397T>A	chr10.hg19:g.61412663A>T	ENSP00000378757:p.Phe466Tyr	265.0	0.0		356.0	115.0	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	hg19	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.412625	0.83340	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.81330	-1.48;-1.48	5.57	5.57	0.84162	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.256104	0.48286	D	0.000189	D	0.84920	0.5579	L	0.61387	1.9	0.46061	D	0.998841	D	0.58268	0.982	P	0.58577	0.841	T	0.81901	-0.0720	10	0.14252	T	0.57	.	15.7166	0.77672	1.0:0.0:0.0:0.0	.	466	Q7RTY1	MOT9_HUMAN	Y	466	ENSP00000378757:F466Y;ENSP00000378756:F466Y	ENSP00000378756:F466Y	F	-	2	0	SLC16A9	61082669	1.000000	0.71417	0.997000	0.53966	0.853000	0.48598	8.523000	0.90576	2.103000	0.63969	0.528000	0.53228	TTT	.	.		0.438	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
LRIT1	26103	hgsc.bcm.edu	37	10	85997354	85997354	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr10:85997354T>C	ENST00000372105.3	-	2	232	c.211A>G	c.(211-213)Ata>Gta	p.I71V		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	71						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						ACCCTGCGTATGGCCGTCCGC	0.682																																					p.I71V		Atlas-SNP	.											.	LRIT1	73	.	0			c.A211G						.						24.0	29.0	27.0					10																	85997354		2172	4251	6423	SO:0001583	missense	26103	exon2			TGCGTATGGCCGT	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.211A>G	chr10.hg19:g.85997354T>C	ENSP00000361177:p.Ile71Val	58.0	0.0		84.0	15.0	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	hg19	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413596	0.42817	.	.	ENSG00000148602	ENST00000372105	T	0.56941	0.43	5.46	-1.35	0.09114	.	0.355643	0.28694	N	0.014445	T	0.49558	0.1564	M	0.85630	2.765	0.52501	D	0.99995	B	0.13594	0.008	B	0.14578	0.011	T	0.31336	-0.9947	10	0.48119	T	0.1	.	6.382	0.21540	0.0:0.1536:0.4385:0.408	.	71	Q9P2V4	LRIT1_HUMAN	V	71	ENSP00000361177:I71V	ENSP00000361177:I71V	I	-	1	0	LRIT1	85987334	1.000000	0.71417	0.109000	0.21407	0.922000	0.55478	1.610000	0.36869	-0.513000	0.06496	0.533000	0.62120	ATA	.	.		0.682	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
GRID1	2894	hgsc.bcm.edu	37	10	87373360	87373360	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr10:87373360T>C	ENST00000327946.7	-	15	2490	c.2405A>G	c.(2404-2406)cAg>cGg	p.Q802R	GRID1_ENST00000552278.2_5'Flank|GRID1_ENST00000536331.1_Missense_Mutation_p.Q373R	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	802					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CCACCACTTCTGCTTCAGCAC	0.607										Multiple Myeloma(13;0.14)																											p.Q802R		Atlas-SNP	.											.	GRID1	204	.	0			c.A2405G						.						77.0	82.0	80.0					10																	87373360		2203	4300	6503	SO:0001583	missense	2894	exon15			CACTTCTGCTTCA	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2405A>G	chr10.hg19:g.87373360T>C	ENSP00000330148:p.Gln802Arg	122.0	0.0		193.0	61.0	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	hg19	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	T	17.16	3.318270	0.60524	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.27104	1.69;1.69	5.46	5.46	0.80206	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.052929	0.85682	D	0.000000	T	0.21921	0.0528	N	0.21142	0.635	0.80722	D	1	B	0.27286	0.174	B	0.32211	0.142	T	0.05616	-1.0874	10	0.59425	D	0.04	.	14.7069	0.69198	0.0:0.0:0.0:1.0	.	802	Q9ULK0	GRID1_HUMAN	R	802;373	ENSP00000330148:Q802R;ENSP00000444455:Q373R	ENSP00000330148:Q802R	Q	-	2	0	GRID1	87363340	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.075000	0.62263	0.454000	0.30748	CAG	.	.		0.607	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
CHUK	1147	hgsc.bcm.edu	37	10	101950685	101950685	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr10:101950685G>T	ENST00000370397.7	-	20	2235	c.2149C>A	c.(2149-2151)Ctt>Att	p.L717I	CHUK_ENST00000590930.1_5'UTR|ERLIN1_ENST00000421367.2_5'Flank|RP11-316M21.7_ENST00000443919.1_RNA	NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	717					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	AAATGGCCAAGGCAGTTCAAA	0.398																																					p.L717I	Ovarian(159;52 1904 10536 35305 37148)	Atlas-SNP	.											.	CHUK	71	.	0			c.C2149A						.						234.0	214.0	221.0					10																	101950685		2203	4300	6503	SO:0001583	missense	1147	exon20			GGCCAAGGCAGTT	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.2149C>A	chr10.hg19:g.101950685G>T	ENSP00000359424:p.Leu717Ile	118.0	0.0		127.0	23.0	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	hg19	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247910	0.59103	.	.	ENSG00000213341	ENST00000370397	T	0.33216	1.42	5.89	5.89	0.94794	I-kappa-kinase-beta NEMO binding domain (1);	0.063063	0.64402	D	0.000005	T	0.47322	0.1439	L	0.59436	1.845	0.49582	D	0.999806	D	0.61080	0.989	P	0.59643	0.861	T	0.14504	-1.0470	10	0.30854	T	0.27	-15.3343	15.7448	0.77929	0.0:0.0:1.0:0.0	.	717	O15111	IKKA_HUMAN	I	717	ENSP00000359424:L717I	ENSP00000359424:L717I	L	-	1	0	CHUK	101940675	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.393000	0.66279	2.790000	0.95986	0.609000	0.83330	CTT	.	.		0.398	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1642908	1642908	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr11:1642908C>G	ENST00000399682.1	-	1	460	c.416G>C	c.(415-417)tGc>tCc	p.C139S		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACAGCAGCTGCACTGGGAGCA	0.642																																					p.C139S		Atlas-SNP	.											.	KRTAP5-4	78	.	0			c.G416C						.						16.0	31.0	26.0					11																	1642908		692	1589	2281	SO:0001583	missense	387267	exon1			CAGCTGCACTGGG	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.416G>C	chr11.hg19:g.1642908C>G	ENSP00000382590:p.Cys139Ser	164.0	0.0		144.0	6.0	NM_001012709		Missense_Mutation	SNP	ENST00000399682.1	hg19		.	.	.	.	.	.	.	.	.	.	C	0.001	-3.519974	0.00010	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.00695	5.83	2.21	1.25	0.21368	.	.	.	.	.	T	0.00300	0.0009	N	0.00621	-1.32	0.20638	N	0.999873	B	0.02656	0.0	B	0.01281	0.0	T	0.42899	-0.9424	9	0.02654	T	1	.	4.6118	0.12406	0.0:0.2511:0.5007:0.2483	.	199	Q6L8H1	KRA54_HUMAN	S	139	ENSP00000382590:C139S	ENSP00000331603:C139S	C	-	2	0	KRTAP5-4	1599484	0.001000	0.12720	0.020000	0.16555	0.001000	0.01503	0.013000	0.13310	0.265000	0.21872	-0.989000	0.02550	TGC	.	.		0.642	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
PCNXL3	399909	hgsc.bcm.edu	37	11	65404386	65404386	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr11:65404386G>T	ENST00000355703.3	+	35	6581	c.6042G>T	c.(6040-6042)tgG>tgT	p.W2014C	SIPA1_ENST00000527525.1_5'Flank|SIPA1_ENST00000534313.1_5'Flank|MIR4690_ENST00000578459.1_RNA	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	2014						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						TGGGCGACTGGCCTGCCCCTA	0.637																																					p.W2014C		Atlas-SNP	.											.	PCNXL3	140	.	0			c.G6042T						.						15.0	18.0	17.0					11																	65404386		1935	4129	6064	SO:0001583	missense	399909	exon35			CGACTGGCCTGCC	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.6042G>T	chr11.hg19:g.65404386G>T	ENSP00000347931:p.Trp2014Cys	61.0	0.0		53.0	21.0	NM_032223	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	hg19	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.721775	0.30503	.	.	ENSG00000197136	ENST00000355703	T	0.08807	3.05	5.17	4.23	0.50019	.	0.000000	0.35013	N	0.003508	T	0.06826	0.0174	N	0.24115	0.695	0.46609	D	0.999129	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.19549	-1.0302	10	0.56958	D	0.05	.	11.5486	0.50708	0.0:0.1809:0.8191:0.0	.	901;2014	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	C	2014	ENSP00000347931:W2014C	ENSP00000347931:W2014C	W	+	3	0	PCNXL3	65160962	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	3.522000	0.53480	1.141000	0.42275	0.462000	0.41574	TGG	.	.		0.637	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19501413	19501413	+	Silent	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr12:19501413A>G	ENST00000299275.6	+	19	2487	c.2481A>G	c.(2479-2481)aaA>aaG	p.K827K	PLEKHA5_ENST00000543806.1_Silent_p.K809K|PLEKHA5_ENST00000538714.1_Silent_p.K885K|PLEKHA5_ENST00000429027.2_Silent_p.K993K|PLEKHA5_ENST00000355397.3_Silent_p.K885K|PLEKHA5_ENST00000317589.4_Silent_p.K890K|PLEKHA5_ENST00000539256.1_Silent_p.K585K|PLEKHA5_ENST00000424268.1_Silent_p.K816K|PLEKHA5_ENST00000359180.3_Intron	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	827					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GAGAAGAAAAATCAGAACCTG	0.353																																					p.K993K	Pancreas(196;329 2193 11246 14234 19524)	Atlas-SNP	.											.	PLEKHA5	198	.	0			c.A2979G						.						92.0	92.0	92.0					12																	19501413		2203	4300	6503	SO:0001819	synonymous_variant	54477	exon25			AGAAAAATCAGAA	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2481A>G	chr12.hg19:g.19501413A>G		158.0	0.0		123.0	52.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	ENST00000299275.6	hg19	CCDS8682.1																																																																																			.	.		0.353	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
CALCOCO1	57658	hgsc.bcm.edu	37	12	54118961	54118961	+	Silent	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr12:54118961C>A	ENST00000550804.1	-	2	126	c.66G>T	c.(64-66)cgG>cgT	p.R22R	CALCOCO1_ENST00000430117.2_Silent_p.R22R|CALCOCO1_ENST00000548263.1_Silent_p.R22R|CALCOCO1_ENST00000262059.4_Silent_p.R22R|CALCOCO1_ENST00000547885.1_5'UTR			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	22	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.|p300 KIX-binding. {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						GGATGTAGGTCCGGGCTACAT	0.532																																					p.R22R		Atlas-SNP	.											.	CALCOCO1	50	.	0			c.G66T						.						201.0	155.0	171.0					12																	54118961		2203	4300	6503	SO:0001819	synonymous_variant	57658	exon2			GTAGGTCCGGGCT	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.66G>T	chr12.hg19:g.54118961C>A		170.0	0.0		226.0	40.0	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Silent	SNP	ENST00000550804.1	hg19	CCDS8864.1																																																																																			.	.		0.532	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
AGAP2	116986	hgsc.bcm.edu	37	12	58131025	58131025	+	Silent	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr12:58131025G>T	ENST00000547588.1	-	1	1004	c.1005C>A	c.(1003-1005)ggC>ggA	p.G335G	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	335	Interaction with PLCG1. {ECO:0000250}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TGGATGCTCGGCCCCCCTCCC	0.682																																					p.G335G		Atlas-SNP	.											.	AGAP2	167	.	0			c.C1005A						.						13.0	19.0	17.0					12																	58131025		1563	3580	5143	SO:0001819	synonymous_variant	116986	exon1			TGCTCGGCCCCCC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1005C>A	chr12.hg19:g.58131025G>T		107.0	0.0		155.0	50.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Silent	SNP	ENST00000547588.1	hg19	CCDS44932.1	.	.	.	.	.	.	.	.	.	.	G	6.884	0.532513	0.13127	.	.	ENSG00000135439	ENST00000328568	.	.	.	4.3	2.41	0.29592	.	.	.	.	.	T	0.55449	0.1921	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50608	-0.8808	4	.	.	.	.	7.2698	0.26250	0.0992:0.1769:0.7238:0.0	.	.	.	.	T	199	.	.	P	-	1	0	AGAP2	56417292	0.981000	0.34729	1.000000	0.80357	0.992000	0.81027	0.326000	0.19646	1.128000	0.42052	0.555000	0.69702	CCG	.	.		0.682	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
AGAP2	116986	hgsc.bcm.edu	37	12	58131661	58131661	+	Silent	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr12:58131661G>T	ENST00000547588.1	-	1	368	c.369C>A	c.(367-369)ctC>ctA	p.L123L	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	123					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GTCCCCCGGAGAGCGGGGGTC	0.811																																					p.L123L		Atlas-SNP	.											.	AGAP2	167	.	0			c.C369A						.						1.0	1.0	1.0					12																	58131661		432	1106	1538	SO:0001819	synonymous_variant	116986	exon1			CCCGGAGAGCGGG	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.369C>A	chr12.hg19:g.58131661G>T		23.0	0.0		33.0	5.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Silent	SNP	ENST00000547588.1	hg19	CCDS44932.1																																																																																			.	.		0.811	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
ANKS1B	56899	hgsc.bcm.edu	37	12	99145188	99145188	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr12:99145188T>C	ENST00000547776.2	-	25	3616	c.3617A>G	c.(3616-3618)gAa>gGa	p.E1206G	ANKS1B_ENST00000549493.2_Missense_Mutation_p.E456G|ANKS1B_ENST00000549025.2_Missense_Mutation_p.E304G|ANKS1B_ENST00000333732.7_Missense_Mutation_p.E236G|ANKS1B_ENST00000549558.2_Missense_Mutation_p.E372G|ANKS1B_ENST00000341752.7_Missense_Mutation_p.E212G|ANKS1B_ENST00000546960.1_Missense_Mutation_p.E432G|ANKS1B_ENST00000332712.7_Missense_Mutation_p.E396G|ANKS1B_ENST00000329257.7_Missense_Mutation_p.E1206G|ANKS1B_ENST00000550693.2_Missense_Mutation_p.E396G|ANKS1B_ENST00000547446.1_Missense_Mutation_p.E341G|ANKS1B_ENST00000547010.1_Missense_Mutation_p.E722G|ANKS1B_ENST00000546568.1_Missense_Mutation_p.E372G	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	1206	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GGGTTTGTTTTCAAAGCTTTC	0.483																																					p.E1206G		Atlas-SNP	.											ANKS1B_ENST00000549493,lower_third,carcinoma,0,2	ANKS1B	180	.	0			c.A3617G						.						141.0	145.0	144.0					12																	99145188		1870	4101	5971	SO:0001583	missense	56899	exon25			TTGTTTTCAAAGC	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.3617A>G	chr12.hg19:g.99145188T>C	ENSP00000449629:p.Glu1206Gly	155.0	0.0		187.0	43.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	hg19	CCDS55872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.48|18.48	3.633442|3.633442	0.67015|0.67015	.|.	.|.	ENSG00000185046|ENSG00000185046	ENST00000341752;ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000550693;ENST00000549025;ENST00000549493;ENST00000547446;ENST00000333732;ENST00000546568;ENST00000332712;ENST00000407362;ENST00000546960|ENST00000550778	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.72394|.	-0.25;-0.23;0.86;0.11;0.86;-0.27;0.36;-0.25;-0.65;-0.21;-0.27;0.05;-0.23|.	4.78|4.78	4.78|4.78	0.61160|0.61160	.|.	0.074001|.	0.51477|.	D|.	0.000081|.	T|T	0.69324|0.69324	0.3098|0.3098	L|L	0.60455|0.60455	1.87|1.87	0.40129|0.40129	D|D	0.976694|0.976694	B;B;B;P;B;P;B;P;P;B;B;D;B|.	0.76494|.	0.007;0.386;0.267;0.768;0.332;0.547;0.004;0.855;0.528;0.004;0.296;0.999;0.018|.	B;B;B;P;B;B;B;P;B;B;B;D;B|.	0.75484|.	0.022;0.108;0.05;0.543;0.167;0.11;0.025;0.69;0.167;0.012;0.192;0.986;0.024|.	T|T	0.69960|0.69960	-0.5003|-0.5003	10|5	0.87932|.	D|.	0|.	-13.3509|-13.3509	14.5949|14.5949	0.68397|0.68397	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	341;236;236;432;396;346;420;372;456;304;722;1206;372|.	F8VPM3;F8VR14;B7Z9I9;Q7Z6G8-4;Q7Z6G8-5;B1VKB5;F8VQW6;Q7Z6G8-2;Q7Z6G8-3;F8VZR9;Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7|.	.;.;.;.;.;.;.;.;.;.;.;ANS1B_HUMAN;.|.	G|E	212;372;1206;722;1206;721;396;304;456;341;236;372;396;297;432|478	ENSP00000345510:E212G;ENSP00000448993:E372G;ENSP00000449629:E1206G;ENSP00000448512:E722G;ENSP00000331381:E1206G;ENSP00000447999:E396G;ENSP00000447312:E304G;ENSP00000448203:E456G;ENSP00000450015:E341G;ENSP00000331256:E236G;ENSP00000448205:E372G;ENSP00000332683:E396G;ENSP00000447839:E432G|.	ENSP00000331381:E1206G|.	E|K	-|-	2|1	0|0	ANKS1B|ANKS1B	97669319|97669319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.651000|7.651000	0.83577|0.83577	1.918000|1.918000	0.55548|0.55548	0.459000|0.459000	0.35465|0.35465	GAA|AAA	.	.		0.483	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
RFX4	5992	hgsc.bcm.edu	37	12	107103177	107103177	+	Silent	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr12:107103177C>T	ENST00000392842.1	+	9	1317	c.903C>T	c.(901-903)ctC>ctT	p.L301L	RFX4_ENST00000229387.5_Silent_p.L207L|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Silent_p.L310L	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	301					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						TCCACGACCTCCCAGAAAACT	0.398																																					p.L310L		Atlas-SNP	.											.	RFX4	218	.	0			c.C930T						.						90.0	79.0	83.0					12																	107103177		2203	4300	6503	SO:0001819	synonymous_variant	5992	exon9			CGACCTCCCAGAA	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.903C>T	chr12.hg19:g.107103177C>T		134.0	0.0		140.0	43.0	NM_001206691	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Silent	SNP	ENST00000392842.1	hg19	CCDS9106.1																																																																																			.	.		0.398	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491	
OXGR1	27199	hgsc.bcm.edu	37	13	97639005	97639005	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr13:97639005G>A	ENST00000298440.1	-	4	1252	c.1009C>T	c.(1009-1011)Cct>Tct	p.P337S	OXGR1_ENST00000543457.1_Missense_Mutation_p.P337S	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	337					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			ATATTTCAAGGGTTGTTTGAG	0.413																																					p.P337S		Atlas-SNP	.											.	OXGR1	46	.	0			c.C1009T						.						87.0	91.0	90.0					13																	97639005		2203	4299	6502	SO:0001583	missense	27199	exon4			TTCAAGGGTTGTT	AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.1009C>T	chr13.hg19:g.97639005G>A	ENSP00000298440:p.Pro337Ser	33.0	0.0		22.0	12.0	NM_080818	Q5T5A7|Q86TL1	Missense_Mutation	SNP	ENST00000298440.1	hg19	CCDS9482.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446444	0.25987	.	.	ENSG00000165621	ENST00000298440;ENST00000543457	T;T	0.64260	-0.09;-0.09	5.87	5.02	0.67125	.	1.111910	0.06682	N	0.768183	T	0.44008	0.1273	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.11329	0.006	T	0.14531	-1.0469	10	0.66056	D	0.02	.	7.4682	0.27334	0.1231:0.0:0.7238:0.1532	.	337	Q96P68	OXGR1_HUMAN	S	337	ENSP00000298440:P337S;ENSP00000438800:P337S	ENSP00000298440:P337S	P	-	1	0	OXGR1	96437006	0.042000	0.20092	0.746000	0.31095	0.073000	0.16967	1.065000	0.30592	2.941000	0.99782	0.655000	0.94253	CCT	.	.		0.413	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045521.3	NM_080818	
AJUBA	84962	hgsc.bcm.edu	37	14	23450783	23450783	+	Nonsense_Mutation	SNP	A	A	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr14:23450783A>C	ENST00000262713.2	-	1	1068	c.693T>G	c.(691-693)taT>taG	p.Y231*	RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Nonsense_Mutation_p.Y231*|RP11-298I3.5_ENST00000555074.1_Intron|RP11-298I3.4_ENST00000555294.1_RNA	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	231	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										GGGCCGGGGGATACGAGTGGC	0.736																																					p.Y231X		Atlas-SNP	.											.	.	.	.	0			c.T693G						.						3.0	4.0	4.0					14																	23450783		1689	3541	5230	SO:0001587	stop_gained	84962	exon1			CGGGGGATACGAG	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.693T>G	chr14.hg19:g.23450783A>C	ENSP00000262713:p.Tyr231*	64.0	0.0		57.0	26.0	NM_032876	A8MX18|D3DS37	Nonsense_Mutation	SNP	ENST00000262713.2	hg19	CCDS9581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	35|35	5.451101|5.451101	0.96205|0.96205	.|.	.|.	ENSG00000129474|ENSG00000129474	ENST00000553736|ENST00000262713;ENST00000361265	.|.	.|.	.|.	4.58|4.58	-3.49|-3.49	0.04724|0.04724	.|.	.|0.280130	.|0.29266	.|N	.|0.012654	T|.	0.13200|.	0.0320|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41520|.	-0.9504|.	3|.	.|0.02654	.|T	.|1	.|.	6.5722|6.5722	0.22545|0.22545	0.3653:0.0:0.4943:0.1404|0.3653:0.0:0.4943:0.1404	.|.	.|.	.|.	.|.	A|X	5|231	.|.	.|ENSP00000262713:Y231X	S|Y	-|-	1|3	0|2	JUB|JUB	22520623|22520623	0.320000|0.320000	0.24616|0.24616	0.461000|0.461000	0.27105|0.27105	0.971000|0.971000	0.66376|0.66376	-0.043000|-0.043000	0.12043|0.12043	-0.565000|-0.565000	0.06061|0.06061	0.459000|0.459000	0.35465|0.35465	TCC|TAT	.	.		0.736	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2		
TMEM63C	57156	hgsc.bcm.edu	37	14	77685213	77685213	+	Silent	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr14:77685213G>T	ENST00000298351.4	+	3	201	c.57G>T	c.(55-57)gtG>gtT	p.V19V	RP11-463C8.4_ENST00000557752.1_3'UTR	NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	19					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		ACATGACAGTGGATGAATGCT	0.597																																					p.V19V		Atlas-SNP	.											.	TMEM63C	77	.	0			c.G57T						.						58.0	65.0	62.0					14																	77685213		2076	4225	6301	SO:0001819	synonymous_variant	57156	exon3			GACAGTGGATGAA		CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.57G>T	chr14.hg19:g.77685213G>T		79.0	0.0		88.0	45.0	NM_020431	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Silent	SNP	ENST00000298351.4	hg19	CCDS45141.1																																																																																			.	.		0.597	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414193.1		
CCNDBP1	23582	hgsc.bcm.edu	37	15	43477752	43477752	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr15:43477752A>C	ENST00000300213.4	+	1	298	c.56A>C	c.(55-57)gAg>gCg	p.E19A	RP11-473C18.3_ENST00000565685.1_RNA|CCNDBP1_ENST00000356633.5_5'UTR|EPB42_ENST00000563128.1_Intron	NM_012142.4	NP_036274.3	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1	19	Interaction with RPLP0.|Interaction with TCF3.|Required for interaction with CCND1.				cell cycle (GO:0007049)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	13		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		TCGCCTTTGGAGCAGCTCCGG	0.692																																					p.E19A		Atlas-SNP	.											.	CCNDBP1	22	.	0			c.A56C						.						7.0	8.0	7.0					15																	43477752		2170	4231	6401	SO:0001583	missense	23582	exon1			CTTTGGAGCAGCT	AF082569	CCDS10092.1	15q14-q15	2008-07-18			ENSG00000166946	ENSG00000166946			1587	protein-coding gene	gene with protein product	"""D-type cyclin-interacting protein 1"", ""MAID protein"", ""HHM Protein"", ""grap2 cyclin interacting protein"""	607089				10801854	Standard	NM_012142		Approved	DIP1, GCIP	uc001zqv.3	O95273	OTTHUMG00000130703	ENST00000300213.4:c.56A>C	chr15.hg19:g.43477752A>C	ENSP00000300213:p.Glu19Ala	94.0	0.0		71.0	36.0	NM_012142	A8K3Q0|A8K3U2|Q6ZQN9|Q7Z519|Q8NBS7|Q8NBY2|Q9NS19|Q9NYH3|Q9UHX9	Missense_Mutation	SNP	ENST00000300213.4	hg19	CCDS10092.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.082185	0.36758	.	.	ENSG00000166946	ENST00000300213	T	0.50001	0.76	5.17	0.111	0.14619	.	0.436377	0.23727	N	0.045172	T	0.24890	0.0604	N	0.17082	0.46	0.21579	N	0.999632	B;B	0.14805	0.011;0.002	B;B	0.14578	0.011;0.003	T	0.09509	-1.0671	10	0.42905	T	0.14	-1.2368	4.3059	0.10947	0.5377:0.1835:0.2789:0.0	.	19;19	O95273-2;O95273	.;CCDB1_HUMAN	A	19	ENSP00000300213:E19A	ENSP00000300213:E19A	E	+	2	0	CCNDBP1	41265044	0.546000	0.26457	0.046000	0.18839	0.044000	0.14063	0.266000	0.18534	0.110000	0.17919	-1.004000	0.02495	GAG	.	.		0.692	CCNDBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253203.1	NM_012142	
RASGRF1	5923	hgsc.bcm.edu	37	15	79296322	79296322	+	Silent	SNP	G	G	A	rs147952942		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr15:79296322G>A	ENST00000419573.3	-	16	2593	c.2319C>T	c.(2317-2319)gcC>gcT	p.A773A	RASGRF1_ENST00000394745.3_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.A757A|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	773					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AGCTGAGGGCGGCCAGGTCCA	0.617																																					p.A773A		Atlas-SNP	.											.	RASGRF1	168	.	0			c.C2319T						.	G	,,	2,4390	4.2+/-10.8	0,2,2194	61.0	54.0	57.0		2271,2319,	-2.1	1.0	15	dbSNP_134	57	0,8586		0,0,4293	no	coding-synonymous,coding-synonymous,utr-5	RASGRF1	NM_001145648.1,NM_002891.4,NM_153815.2	,,	0,2,6487	AA,AG,GG		0.0,0.0455,0.0154	,,	757/1258,773/1274,	79296322	2,12976	2196	4293	6489	SO:0001819	synonymous_variant	5923	exon16			GAGGGCGGCCAGG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2319C>T	chr15.hg19:g.79296322G>A		74.0	0.0		69.0	41.0	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	hg19	CCDS10309.1																																																																																			.	G|1.000;A|0.000		0.617	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
TSC2	7249	hgsc.bcm.edu	37	16	2124225	2124225	+	Nonsense_Mutation	SNP	C	C	T	rs45517233|rs397515282		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr16:2124225C>T	ENST00000219476.3	+	22	3010	c.2380C>T	c.(2380-2382)Cag>Tag	p.Q794*	TSC2_ENST00000401874.2_Nonsense_Mutation_p.Q794*|TSC2_ENST00000382538.6_Nonsense_Mutation_p.Q745*|TSC2_ENST00000353929.4_Nonsense_Mutation_p.Q794*|TSC2_ENST00000350773.4_Nonsense_Mutation_p.Q794*|TSC2_ENST00000568454.1_Nonsense_Mutation_p.Q805*|TSC2_ENST00000439673.2_Nonsense_Mutation_p.Q757*	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	794					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.E793fs*9(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CTGCCTGGAGCAGGGCCTCAT	0.642			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.Q794X		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	1	Deletion - Frameshift(1)	pancreas(1)	c.C2380T	GRCh37	CM091029	TSC2	M	rs45517233	.						74.0	58.0	64.0					16																	2124225		2198	4299	6497	SO:0001587	stop_gained	7249	exon22	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CTGGAGCAGGGCC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2380C>T	chr16.hg19:g.2124225C>T	ENSP00000219476:p.Gln794*	26.0	0.0		34.0	15.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Nonsense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	C	39	7.595681	0.98381	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.35	5.35	0.76521	.	0.246642	0.34178	N	0.004196	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-13.2208	13.9587	0.64166	0.1517:0.8483:0.0:0.0	rs45517233	.	.	.	X	794;794;794;757;745;794	.	ENSP00000219476:Q794X	Q	+	1	0	TSC2	2064226	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.254000	0.58798	2.500000	0.84329	0.313000	0.20887	CAG	.	.		0.642	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
HEATR3	55027	hgsc.bcm.edu	37	16	50120257	50120257	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr16:50120257A>G	ENST00000299192.7	+	11	1696	c.1505A>G	c.(1504-1506)cAa>cGa	p.Q502R	HEATR3_ENST00000285767.4_Missense_Mutation_p.Q416R|HEATR3_ENST00000564942.1_3'UTR	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	502										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CTTTTTTCTCAACCAGGTATT	0.468																																					p.Q502R		Atlas-SNP	.											.	HEATR3	59	.	0			c.A1505G						.						29.0	29.0	29.0					16																	50120257		2198	4300	6498	SO:0001583	missense	55027	exon11			TTTCTCAACCAGG	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1505A>G	chr16.hg19:g.50120257A>G	ENSP00000299192:p.Gln502Arg	64.0	0.0		47.0	21.0	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	hg19	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.314944	0.23908	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.46819	0.86;0.87	5.82	4.73	0.59995	Armadillo-type fold (1);	0.285641	0.40640	N	0.001043	T	0.42337	0.1198	M	0.62723	1.935	0.32892	D	0.511992	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.49466	-0.8937	10	0.12103	T	0.63	.	12.0214	0.53346	0.9323:0.0:0.0677:0.0	.	416;502	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	R	416;502	ENSP00000285767:Q416R;ENSP00000299192:Q502R	ENSP00000285767:Q416R	Q	+	2	0	HEATR3	48677758	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	4.101000	0.57769	1.013000	0.39391	0.528000	0.53228	CAA	.	.		0.468	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
RFWD3	55159	hgsc.bcm.edu	37	16	74660446	74660446	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr16:74660446T>C	ENST00000361070.4	-	12	2073	c.1976A>G	c.(1975-1977)aAt>aGt	p.N659S	RFWD3_ENST00000571750.1_Missense_Mutation_p.N659S	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	659					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						GGTGGTGTGATTTTTATCTAT	0.448																																					p.N659S		Atlas-SNP	.											.	RFWD3	49	.	0			c.A1976G						.						79.0	77.0	78.0					16																	74660446		2198	4300	6498	SO:0001583	missense	55159	exon12			GTGTGATTTTTAT	AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.1976A>G	chr16.hg19:g.74660446T>C	ENSP00000354361:p.Asn659Ser	98.0	0.0		90.0	53.0	NM_018124	A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	ENST00000361070.4	hg19	CCDS32486.1	.	.	.	.	.	.	.	.	.	.	T	2.364	-0.345935	0.05208	.	.	ENSG00000168411	ENST00000361070;ENST00000444004	T	0.17854	2.25	5.49	2.44	0.29823	.	0.329029	0.37437	N	0.002082	T	0.06142	0.0159	N	0.13327	0.33	0.27598	N	0.949054	B	0.18461	0.028	B	0.16289	0.015	T	0.35871	-0.9771	10	0.06365	T	0.9	-9.7062	1.5086	0.02492	0.1306:0.2008:0.1354:0.5331	.	659	Q6PCD5	RFWD3_HUMAN	S	659;148	ENSP00000354361:N659S	ENSP00000354361:N659S	N	-	2	0	RFWD3	73217947	0.993000	0.37304	0.988000	0.46212	0.478000	0.33099	0.271000	0.18626	0.157000	0.19338	0.459000	0.35465	AAT	.	.		0.448	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436506.2	NM_018124	
GP1BA	2811	hgsc.bcm.edu	37	17	4837682	4837682	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:4837682C>G	ENST00000329125.5	+	2	1858	c.1783C>G	c.(1783-1785)Ctg>Gtg	p.L595V		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	595					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						CCGGGCCTGGCTGCTCTTCCT	0.642											OREG0024109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L595V		Atlas-SNP	.											.	GP1BA	53	.	0			c.C1783G						.						119.0	135.0	130.0					17																	4837682		2095	4214	6309	SO:0001583	missense	2811	exon2			GCCTGGCTGCTCT		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1783C>G	chr17.hg19:g.4837682C>G	ENSP00000329380:p.Leu595Val	66.0	0.0	621	51.0	25.0	NM_000173	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Missense_Mutation	SNP	ENST00000329125.5	hg19	CCDS54068.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416932	0.42918	.	.	ENSG00000185245	ENST00000329125;ENST00000438881	T	0.62105	0.05	5.02	4.04	0.47022	.	0.000000	0.27906	N	0.017380	T	0.64371	0.2592	L	0.36672	1.1	0.28487	N	0.914688	D	0.71674	0.998	D	0.63877	0.919	T	0.56805	-0.7918	10	0.41790	T	0.15	-7.7948	8.4279	0.32739	0.0:0.8952:0.0:0.1048	.	582	A5CKE2	.	V	595;569	ENSP00000329380:L595V	ENSP00000329380:L595V	L	+	1	2	GP1BA	4778423	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	0.596000	0.24044	2.360000	0.80028	0.460000	0.39030	CTG	.	.		0.642	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1		
RNF112	7732	hgsc.bcm.edu	37	17	19316310	19316310	+	Silent	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:19316310C>A	ENST00000461366.1	+	4	656	c.441C>A	c.(439-441)ggC>ggA	p.G147G	CTB-187M2.2_ENST00000579897.1_RNA|RNF112_ENST00000580109.1_Intron	NM_007148.4	NP_009079.2	Q9ULX5	RN112_HUMAN	ring finger protein 112	147						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	12						CCTCTGGGGGCCTCATCCTTA	0.662																																					p.G147G		Atlas-SNP	.											.	RNF112	37	.	0			c.C441A						.						18.0	21.0	20.0					17																	19316310		2092	4221	6313	SO:0001819	synonymous_variant	7732	exon4			TGGGGGCCTCATC	AF054587	CCDS58529.1	17p11.2	2013-01-16	2008-06-13	2008-06-13	ENSG00000128482	ENSG00000128482		"""RING-type (C3HC4) zinc fingers"""	12968	protein-coding gene	gene with protein product		601237	"""zinc finger protein 179"""	ZNF179		8660987, 9806830	Standard	NM_007148		Approved	BFP	uc010vyw.2	Q9ULX5	OTTHUMG00000059601	ENST00000461366.1:c.441C>A	chr17.hg19:g.19316310C>A		128.0	0.0		157.0	57.0	NM_007148	O60633|Q7Z5V9	Silent	SNP	ENST00000461366.1	hg19	CCDS58529.1																																																																																			.	.		0.662	RNF112-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132549.4	NM_007148	
LRRC37A2	474170	hgsc.bcm.edu	37	17	44630766	44630766	+	Splice_Site	SNP	A	A	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:44630766A>T	ENST00000576629.1	+	12	5305	c.4810A>T	c.(4810-4812)Ata>Tta	p.I1604L	ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000337845.7_Intron|LRRC37A2_ENST00000333412.3_Splice_Site_p.I1604L|ARL17A_ENST00000570550.1_Intron|ARL17A_ENST00000573185.1_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1604						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TCTAAAACAGATATGTTGTCA	0.333																																					p.I1604L		Atlas-SNP	.											.	LRRC37A2	37	.	0			c.A4810T						.						69.0	125.0	106.0					17																	44630766		2198	4294	6492	SO:0001630	splice_region_variant	474170	exon11			AAACAGATATGTT	AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.4810-1A>T	chr17.hg19:g.44630766A>T		605.0	1.0		696.0	192.0	NM_001006607	B7ZMC3	Missense_Mutation	SNP	ENST00000576629.1	hg19	CCDS42353.1	.	.	.	.	.	.	.	.	.	.	a	14.71	2.616204	0.46631	.	.	ENSG00000238083	ENST00000333412	T	0.50001	0.76	2.45	1.28	0.21552	.	.	.	.	.	T	0.51295	0.1666	L	0.53249	1.67	0.58432	D	0.999995	D;P	0.62365	0.991;0.59	P;B	0.59643	0.861;0.243	T	0.46162	-0.9211	8	.	.	.	.	4.628	0.12488	0.8352:0.0:0.1648:0.0	.	565;1604	B3KRJ4;A6NM11	.;L37A2_HUMAN	L	1604	ENSP00000333071:I1604L	.	I	+	1	0	LRRC37A2	41986082	0.812000	0.29077	0.556000	0.28293	0.019000	0.09904	0.383000	0.20651	0.340000	0.23745	0.128000	0.15822	ATA	.	.		0.333	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440299.2	NM_001006607	Missense_Mutation
SDK2	54549	hgsc.bcm.edu	37	17	71503638	71503638	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:71503638G>T	ENST00000392650.3	-	2	163	c.163C>A	c.(163-165)Cca>Aca	p.P55T	SDK2_ENST00000388726.3_Missense_Mutation_p.P55T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	55	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						AACTCCAGTGGCCAGCTGCCC	0.582																																					p.P55T		Atlas-SNP	.											.	SDK2	219	.	0			c.C163A						.						96.0	94.0	95.0					17																	71503638		692	1591	2283	SO:0001583	missense	54549	exon2			CCAGTGGCCAGCT	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.163C>A	chr17.hg19:g.71503638G>T	ENSP00000376421:p.Pro55Thr	70.0	0.0		67.0	16.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	hg19	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769011	0.90020	.	.	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.22743	1.94;1.94	5.41	5.41	0.78517	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.56097	U	0.000036	T	0.39226	0.1070	L	0.52206	1.635	0.58432	D	0.999999	D	0.55172	0.97	P	0.62298	0.9	T	0.01894	-1.1252	10	0.28530	T	0.3	.	18.8016	0.92021	0.0:0.0:1.0:0.0	.	55	Q58EX2	SDK2_HUMAN	T	55	ENSP00000376421:P55T;ENSP00000373378:P55T	ENSP00000324967:P55T	P	-	1	0	SDK2	69015233	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.696000	0.98695	2.539000	0.85634	0.561000	0.74099	CCA	.	.		0.582	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SUMO2	6613	hgsc.bcm.edu	37	17	73177179	73177179	+	Silent	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:73177179T>C	ENST00000420826.2	-	2	274	c.126A>G	c.(124-126)aaA>aaG	p.K42K	SUMO2_ENST00000314523.7_Silent_p.K42K|SUMO2_ENST00000578238.1_5'UTR	NM_006937.3	NP_008868.3			small ubiquitin-like modifier 2											NS(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					CTTTCATTAGTTTACTAAGTG	0.368																																					p.K42K		Atlas-SNP	.											.	SUMO2	4	.	0			c.A126G						.						76.0	83.0	81.0					17																	73177179		2203	4300	6503	SO:0001819	synonymous_variant	6613	exon2			CATTAGTTTACTA		CCDS45773.1, CCDS45774.1	17q25	2013-06-05	2013-06-05	2004-05-19	ENSG00000188612	ENSG00000188612			11125	protein-coding gene	gene with protein product		603042	"""SMT3 (suppressor of mif two 3, yeast) homolog 2"", ""SMT3 suppressor of mif two 3 homolog 2 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)"""	SMT3H2		8630065	Standard	NM_006937		Approved	SMT3B	uc002jne.3	P61956		ENST00000420826.2:c.126A>G	chr17.hg19:g.73177179T>C		415.0	0.0		539.0	121.0	NM_006937		Silent	SNP	ENST00000420826.2	hg19	CCDS45774.1																																																																																			.	.		0.368	SUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446614.1	NM_006937	
TMC8	147138	hgsc.bcm.edu	37	17	76129505	76129505	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:76129505C>A	ENST00000318430.5	+	6	924	c.550C>A	c.(550-552)Ctc>Atc	p.L184I	TMC8_ENST00000589691.1_5'UTR|TMC6_ENST00000322914.3_5'Flank	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	184					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			CAACACCTATCTCTTCTACGG	0.607																																					p.L184I		Atlas-SNP	.											.	TMC8	44	.	0			c.C550A						.						145.0	132.0	137.0					17																	76129505		2203	4300	6503	SO:0001583	missense	147138	exon6			ACCTATCTCTTCT	AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.550C>A	chr17.hg19:g.76129505C>A	ENSP00000325561:p.Leu184Ile	72.0	0.0		68.0	21.0	NM_152468	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Missense_Mutation	SNP	ENST00000318430.5	hg19	CCDS32749.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466793	0.63625	.	.	ENSG00000167895	ENST00000318430;ENST00000301627	T	0.61980	0.06	4.08	4.08	0.47627	.	0.154254	0.64402	D	0.000016	T	0.79131	0.4394	M	0.82517	2.595	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.82653	-0.0351	10	0.72032	D	0.01	-35.7095	13.2975	0.60305	0.0:1.0:0.0:0.0	.	184	Q8IU68	TMC8_HUMAN	I	184	ENSP00000325561:L184I	ENSP00000301627:L184I	L	+	1	0	TMC8	73641100	0.990000	0.36364	0.991000	0.47740	0.403000	0.30841	3.263000	0.51546	2.097000	0.63578	0.561000	0.74099	CTC	.	.		0.607	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3		
EPB41L3	23136	hgsc.bcm.edu	37	18	5434095	5434095	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr18:5434095C>G	ENST00000341928.2	-	7	971	c.631G>C	c.(631-633)Gat>Cat	p.D211H	EPB41L3_ENST00000544123.1_Missense_Mutation_p.D211H|EPB41L3_ENST00000342933.3_Missense_Mutation_p.D211H|EPB41L3_ENST00000400111.3_Missense_Mutation_p.D211H|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000540638.2_Missense_Mutation_p.D211H	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	211	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						ACGATGTCATCTCGCAACTGC	0.527																																					p.D211H		Atlas-SNP	.											.	EPB41L3	222	.	0			c.G631C						.						87.0	71.0	77.0					18																	5434095		2203	4300	6503	SO:0001583	missense	23136	exon7			TGTCATCTCGCAA	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.631G>C	chr18.hg19:g.5434095C>G	ENSP00000343158:p.Asp211His	163.0	0.0		150.0	7.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	C	33	5.284359	0.95517	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111;ENST00000542652	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	6.02	6.02	0.97574	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.191558	0.56097	D	0.000037	D	0.84584	0.5504	L	0.38692	1.165	0.80722	D	1	D;P;D;D;P	0.89917	1.0;0.867;1.0;1.0;0.899	D;B;D;D;P	0.91635	0.999;0.272;0.984;0.985;0.619	D	0.84023	0.0355	10	0.54805	T	0.06	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	211;211;102;211;211	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	H	211;102;211;102;211;211;292	ENSP00000343158:D211H;ENSP00000441174:D211H;ENSP00000341138:D211H;ENSP00000382981:D211H	ENSP00000343158:D211H	D	-	1	0	EPB41L3	5424095	1.000000	0.71417	0.988000	0.46212	0.965000	0.64279	7.818000	0.86416	2.857000	0.98124	0.650000	0.86243	GAT	.	.		0.527	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
ANKRD29	147463	hgsc.bcm.edu	37	18	21197723	21197723	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr18:21197723T>A	ENST00000592179.1	-	8	850	c.696A>T	c.(694-696)aaA>aaT	p.K232N	ANKRD29_ENST00000586511.1_5'Flank|ANKRD29_ENST00000284207.7_Missense_Mutation_p.K232N|ANKRD29_ENST00000322980.9_Missense_Mutation_p.K232N	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	232										breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGGGTGAGAATTTAAGCAACT	0.353																																					p.K232N		Atlas-SNP	.											.	ANKRD29	24	.	0			c.A696T						.						141.0	130.0	133.0					18																	21197723		2202	4300	6502	SO:0001583	missense	147463	exon8			TGAGAATTTAAGC	AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.696A>T	chr18.hg19:g.21197723T>A	ENSP00000468354:p.Lys232Asn	92.0	0.0		138.0	34.0	NM_173505	B2R972|Q6ZWE8|Q96LU9	Missense_Mutation	SNP	ENST00000592179.1	hg19	CCDS11879.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543892	0.65198	.	.	ENSG00000154065	ENST00000322980;ENST00000284207	T;T	0.64618	-0.11;-0.11	5.4	0.328	0.15918	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.60792	0.2296	N	0.17922	0.545	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.943;0.999	T	0.56715	-0.7933	10	0.41790	T	0.15	.	9.6631	0.39967	0.0:0.2947:0.0:0.7053	.	232;232	Q8N6D5-3;Q8N6D5	.;ANR29_HUMAN	N	232	ENSP00000323387:K232N;ENSP00000284207:K232N	ENSP00000284207:K232N	K	-	3	2	ANKRD29	19451721	0.992000	0.36948	0.998000	0.56505	0.936000	0.57629	0.254000	0.18314	0.118000	0.18165	-0.475000	0.04921	AAA	.	.		0.353	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	
DSEL	92126	hgsc.bcm.edu	37	18	65179555	65179555	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr18:65179555A>G	ENST00000310045.7	-	2	3794	c.2321T>C	c.(2320-2322)aTt>aCt	p.I774T	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	764					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GGGGAAAATAATCCTATCATG	0.383																																					p.I774T		Atlas-SNP	.											.	DSEL	196	.	0			c.T2321C						.						47.0	51.0	50.0					18																	65179555		2202	4300	6502	SO:0001583	missense	92126	exon2			AAAATAATCCTAT	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2321T>C	chr18.hg19:g.65179555A>G	ENSP00000310565:p.Ile774Thr	95.0	0.0		114.0	39.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	hg19	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	A	3.010	-0.204131	0.06180	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.16597	2.33	4.98	2.63	0.31362	.	0.369879	0.24542	U	0.037623	T	0.05640	0.0148	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34477	-0.9827	10	0.20519	T	0.43	.	3.6484	0.08194	0.5976:0.0:0.2453:0.1571	.	764	Q8IZU8	DSEL_HUMAN	T	774;764	ENSP00000310565:I774T	ENSP00000310565:I774T	I	-	2	0	DSEL	63330535	0.003000	0.15002	0.263000	0.24496	0.567000	0.35839	1.478000	0.35442	0.757000	0.33036	0.374000	0.22700	ATT	.	.		0.383	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
THAP8	199745	hgsc.bcm.edu	37	19	36530605	36530605	+	Nonsense_Mutation	SNP	G	G	A	rs201068048	byFrequency	TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr19:36530605G>A	ENST00000292894.1	-	3	836	c.292C>T	c.(292-294)Cga>Tga	p.R98*	THAP8_ENST00000538849.1_5'UTR|AC002116.7_ENST00000586962.1_RNA|THAP8_ENST00000524106.1_5'Flank	NM_152658.2	NP_689871.1	Q8NA92	THAP8_HUMAN	THAP domain containing 8	98							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TGGGTGCTTCGGGTCCTCCGC	0.632													g|||	2	0.000399361	0.0	0.0014	5008	,	,		15167	0.0		0.0	False		,,,				2504	0.001				p.R98X		Atlas-SNP	.											.	THAP8	11	.	0			c.C292T						.		stop/ARG	0,4064		0,0,2032	23.0	22.0	22.0		292	0.0	0.0	19		22	1,7843		0,1,3921	yes	stop-gained	THAP8	NM_152658.2		0,1,5953	AA,AG,GG		0.0127,0.0,0.0084		98/275	36530605	1,11907	2032	3922	5954	SO:0001587	stop_gained	199745	exon3			TGCTTCGGGTCCT	AK057453	CCDS33000.1	19q13.13	2013-01-25			ENSG00000161277	ENSG00000161277		"""THAP (C2CH-type zinc finger) domain containing"""	23191	protein-coding gene	gene with protein product		612536				12575992	Standard	NM_152658		Approved	FLJ32891	uc002oda.1	Q8NA92	OTTHUMG00000048138	ENST00000292894.1:c.292C>T	chr19.hg19:g.36530605G>A	ENSP00000292894:p.Arg98*	88.0	0.0		122.0	40.0	NM_152658	Q0P5Z7|Q96M21	Nonsense_Mutation	SNP	ENST00000292894.1	hg19	CCDS33000.1	.	.	.	.	.	.	.	.	.	.	g	21.7	4.181972	0.78677	0.0	1.27E-4	ENSG00000161277	ENST00000292894;ENST00000392182	.	.	.	3.71	0.0427	0.14218	.	2587.460000	0.00166	U	0.000000	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.4094	3.028	0.06097	0.2199:0.0:0.3864:0.3938	.	.	.	.	X	98	.	ENSP00000292894:R98X	R	-	1	2	THAP8	41222445	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.526000	0.06207	0.000000	0.14550	0.552000	0.68991	CGA	.	.		0.632	THAP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379036.1	NM_152658	
SYMPK	8189	hgsc.bcm.edu	37	19	46332347	46332347	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr19:46332347C>A	ENST00000245934.7	-	14	2110	c.1866G>T	c.(1864-1866)tgG>tgT	p.W622C	AC092301.3_ENST00000601618.1_RNA	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	622					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.W622C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CCTGGTAGAGCCAGGCGAAGG	0.642																																					p.W622C		Atlas-SNP	.											SYMPK,NS,carcinoma,0,1	SYMPK	104	.	1	Substitution - Missense(1)	lung(1)	c.G1866T						.						66.0	63.0	64.0					19																	46332347		2203	4300	6503	SO:0001583	missense	8189	exon14			GTAGAGCCAGGCG	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1866G>T	chr19.hg19:g.46332347C>A	ENSP00000245934:p.Trp622Cys	148.0	1.0		213.0	66.0	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	hg19	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	C	13.84	2.358645	0.41801	.	.	ENSG00000125755	ENST00000245934	.	.	.	4.94	4.94	0.65067	Armadillo-type fold (1);	0.074050	0.56097	D	0.000029	T	0.53722	0.1814	L	0.47016	1.485	0.80722	D	1	P;B	0.45634	0.863;0.256	B;B	0.41440	0.357;0.151	T	0.60850	-0.7181	9	0.62326	D	0.03	.	15.7509	0.77986	0.0:1.0:0.0:0.0	.	637;622	Q4LE61;Q92797	.;SYMPK_HUMAN	C	622	.	ENSP00000245934:W622C	W	-	3	0	SYMPK	51024187	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.779000	0.55379	2.312000	0.78011	0.456000	0.33151	TGG	.	.		0.642	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
PRR12	57479	hgsc.bcm.edu	37	19	50119403	50119403	+	Silent	SNP	C	C	T	rs563050549		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr19:50119403C>T	ENST00000418929.2	+	9	5436	c.5424C>T	c.(5422-5424)aaC>aaT	p.N1808N		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	987							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CAGGCGGCAACGCTACAGCAG	0.672													c|||	1	0.000199681	0.0	0.0	5008	,	,		14230	0.001		0.0	False		,,,				2504	0.0				p.N1808N		Atlas-SNP	.											.	PRR12	157	.	0			c.C5424T						.						11.0	15.0	14.0					19																	50119403		2052	4167	6219	SO:0001819	synonymous_variant	57479	exon9			CGGCAACGCTACA	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.5424C>T	chr19.hg19:g.50119403C>T		217.0	0.0		310.0	84.0	NM_020719	E9PB06|Q8N4J6	Silent	SNP	ENST00000418929.2	hg19	CCDS46143.1																																																																																			.	.		0.672	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
ACPT	93650	hgsc.bcm.edu	37	19	51293729	51293729	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr19:51293729C>G	ENST00000270593.1	+	1	58	c.58C>G	c.(58-60)Ctg>Gtg	p.L20V	CTD-2568A17.8_ENST00000594114.1_RNA|ACPT_ENST00000270594.3_Missense_Mutation_p.L20V	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	20						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		gctgctgctgctggtgctgcC	0.706																																					p.L20V		Atlas-SNP	.											ACPT,NS,carcinoma,0,1	ACPT	43	.	0			c.C58G						.						14.0	13.0	14.0					19																	51293729		2179	4266	6445	SO:0001583	missense	93650	exon1			CTGCTGCTGGTGC	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.58C>G	chr19.hg19:g.51293729C>G	ENSP00000270593:p.Leu20Val	66.0	0.0		87.0	4.0	NM_033068	C0H3P7|Q9BZG3|Q9BZG4	Missense_Mutation	SNP	ENST00000270593.1	hg19	CCDS12802.1	.	.	.	.	.	.	.	.	.	.	c	2.381	-0.342101	0.05243	.	.	ENSG00000142513	ENST00000270593;ENST00000270594	T;T	0.13089	2.79;2.62	4.41	0.74	0.18330	.	1.036450	0.07721	N	0.943623	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	10	0.32370	T	0.25	-8.5866	3.8343	0.08888	0.0:0.5162:0.2203:0.2635	.	20	Q9BZG2	PPAT_HUMAN	V	20	ENSP00000270593:L20V;ENSP00000270594:L20V	ENSP00000270593:L20V	L	+	1	2	ACPT	55985541	0.000000	0.05858	0.020000	0.16555	0.062000	0.15995	-1.802000	0.01741	0.117000	0.18138	-0.333000	0.08304	CTG	.	.		0.706	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464434.1	NM_033068	
SIGLECL1	284369	hgsc.bcm.edu	37	19	51769106	51769106	+	Missense_Mutation	SNP	C	C	T	rs149546733		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr19:51769106C>T	ENST00000316401.7	+	4	761	c.380C>T	c.(379-381)gCg>gTg	p.A127V	SIGLECL1_ENST00000597824.1_Missense_Mutation_p.A33V|CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000593968.1_3'UTR	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	489	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A127V(1)									ATTGTAATTGCGCTGCTCTTC	0.557																																					p.A127V		Atlas-SNP	.											C19orf75,rectum,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C380T						.	C	VAL/ALA	0,4406		0,0,2203	243.0	224.0	230.0		380	0.9	0.0	19	dbSNP_134	230	2,8598	2.2+/-6.3	0,2,4298	yes	missense	C19orf75	NM_173635.1	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	127/198	51769106	2,13004	2203	4300	6503	SO:0001583	missense	284369	exon4			TAATTGCGCTGCT	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.380C>T	chr19.hg19:g.51769106C>T	ENSP00000321249:p.Ala127Val	98.0	0.0		89.0	19.0	NM_173635	Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	hg19	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599762	0.28534	0.0	2.33E-4	ENSG00000179213	ENST00000316401	T	0.38560	1.13	4.38	0.863	0.19062	.	1.625570	0.03695	N	0.247752	T	0.42040	0.1185	L	0.55017	1.72	0.09310	N	1	B;D	0.56287	0.0;0.975	B;P	0.46299	0.001;0.511	T	0.28170	-1.0052	10	0.41790	T	0.15	.	4.069	0.09874	0.0:0.5631:0.2137:0.2231	.	33;127	B7ZLS6;Q8N7X8	.;CS075_HUMAN	V	127	ENSP00000321249:A127V	ENSP00000321249:A127V	A	+	2	0	C19orf75	56460918	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.247000	0.08866	0.507000	0.28148	-0.128000	0.14901	GCG	.	C|1.000;T|0.000		0.557	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635	
CECR6	27439	hgsc.bcm.edu	37	22	17600295	17600295	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr22:17600295C>G	ENST00000331437.3	-	1	1848	c.1723G>C	c.(1723-1725)Gcc>Ccc	p.A575P	CECR6_ENST00000399875.1_Missense_Mutation_p.A220P|AC006946.15_ENST00000441544.1_5'Flank	NM_031890.3	NP_114096.1	Q9BXQ6	CECR6_HUMAN	cat eye syndrome chromosome region, candidate 6	575										haematopoietic_and_lymphoid_tissue(1)	1		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.221)		TTCTGAGAGGCCACAGCCAGG	0.587																																					p.A575P		Atlas-SNP	.											.	CECR6	11	.	0			c.G1723C						.						27.0	26.0	26.0					22																	17600295		2201	4300	6501	SO:0001583	missense	27439	exon1			GAGAGGCCACAGC	AF307451	CCDS13740.1, CCDS54494.1	22q11.2	2008-06-12			ENSG00000183307	ENSG00000183307			1844	protein-coding gene	gene with protein product						11381032	Standard	NM_031890		Approved		uc002zmb.2	Q9BXQ6	OTTHUMG00000030471	ENST00000331437.3:c.1723G>C	chr22.hg19:g.17600295C>G	ENSP00000329318:p.Ala575Pro	93.0	0.0		131.0	49.0	NM_031890	A8MYY1	Missense_Mutation	SNP	ENST00000331437.3	hg19	CCDS13740.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088080	0.36855	.	.	ENSG00000183307	ENST00000399875;ENST00000331437	.	.	.	4.26	0.765	0.18470	.	0.549745	0.15959	U	0.236366	T	0.33059	0.0850	N	0.19112	0.55	0.33729	D	0.618048	P	0.50617	0.937	P	0.52424	0.698	T	0.47169	-0.9138	9	0.72032	D	0.01	.	4.3691	0.11239	0.1622:0.5443:0.0:0.2935	.	575	Q9BXQ6	CECR6_HUMAN	P	220;575	.	ENSP00000329318:A575P	A	-	1	0	CECR6	15980295	0.967000	0.33354	0.965000	0.40720	0.723000	0.41478	0.466000	0.22019	0.552000	0.29026	0.561000	0.74099	GCC	.	.		0.587	CECR6-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075359.4	NM_031890	
PRR5	55615	hgsc.bcm.edu	37	22	45132983	45132983	+	Silent	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr22:45132983C>T	ENST00000336985.6	+	8	1300	c.1023C>T	c.(1021-1023)ccC>ccT	p.P341P	PRR5-ARHGAP8_ENST00000352766.7_Intron|PRR5_ENST00000006251.7_Silent_p.P332P|PRR5_ENST00000403581.1_Silent_p.P364P|ARHGAP8_ENST00000517296.3_Intron|PRR5_ENST00000477331.1_3'UTR|PRR5-ARHGAP8_ENST00000361473.5_Intron|ARHGAP8_ENST00000389773.5_Intron	NM_181333.3	NP_851850.1	P85299	PRR5_HUMAN	proline rich 5 (renal)	341					cell cycle (GO:0007049)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)	TORC2 complex (GO:0031932)				central_nervous_system(1)|endometrium(2)|lung(6)|prostate(1)|skin(1)	11		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)		GCTCCCTGCCCCGCTCCAGCC	0.682																																					p.P364P		Atlas-SNP	.											.	PRR5	75	.	0			c.C1092T						.						22.0	25.0	24.0					22																	45132983		2202	4295	6497	SO:0001819	synonymous_variant	55615	exon10			CCTGCCCCGCTCC	AF177331	CCDS14058.1, CCDS14059.1, CCDS56232.1, CCDS74875.1	22q13.3	2011-02-10			ENSG00000186654	ENSG00000186654			31682	protein-coding gene	gene with protein product	"""protein observed with Rictor-1"""	609406				15718101, 17599906	Standard	NM_001017528		Approved	PP610, FLJ20185k, Protor-1		P85299	OTTHUMG00000150460	ENST00000336985.6:c.1023C>T	chr22.hg19:g.45132983C>T		107.0	0.0		133.0	45.0	NM_001198721	B1AHF6|B1AHG5|B3KP73|O75983|O95695|Q5BIW2|Q5EAJ8|Q5EAJ9|Q5XKJ6|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Silent	SNP	ENST00000336985.6	hg19	CCDS14058.1	.	.	.	.	.	.	.	.	.	.	C	0.712	-0.786794	0.02907	.	.	ENSG00000186654	ENST00000455389	T	0.52295	0.67	5.29	-0.903	0.10534	.	.	.	.	.	T	0.29588	0.0738	.	.	.	0.26598	N	0.97308	.	.	.	.	.	.	T	0.26573	-1.0099	5	.	.	.	.	3.0859	0.06278	0.1224:0.3422:0.361:0.1743	.	.	.	.	L	301	ENSP00000405404:P301L	.	P	+	2	0	PRR5	43511647	0.003000	0.15002	0.001000	0.08648	0.042000	0.13812	0.196000	0.17176	0.071000	0.16664	0.561000	0.74099	CCC	.	.		0.682	PRR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318200.2	NM_001017528	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47193446	47193446	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr22:47193446C>T	ENST00000337137.4	+	4	732	c.566C>T	c.(565-567)gCg>gTg	p.A189V	TBC1D22A_ENST00000406733.1_Missense_Mutation_p.A142V|TBC1D22A_ENST00000407381.3_Intron|TBC1D22A_ENST00000355704.3_Intron|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.A142V	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	189							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		AGCAGCTCAGCGCTGAGCGAA	0.652											OREG0026659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A189V		Atlas-SNP	.											.	TBC1D22A	54	.	0			c.C566T						.						39.0	34.0	36.0					22																	47193446		2203	4300	6503	SO:0001583	missense	25771	exon4			GCTCAGCGCTGAG	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.566C>T	chr22.hg19:g.47193446C>T	ENSP00000336724:p.Ala189Val	220.0	0.0	945	220.0	59.0	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	hg19	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980250	0.34942	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000406733	T;T;T	0.49432	1.8;0.78;1.8	4.55	3.53	0.40419	.	0.107163	0.64402	N	0.000005	T	0.35856	0.0946	L	0.52364	1.645	0.40273	D	0.978305	B;B	0.17667	0.023;0.023	B;B	0.11329	0.006;0.006	T	0.13872	-1.0493	10	0.17832	T	0.49	.	6.7892	0.23689	0.1742:0.7341:0.0:0.0917	.	189;189	B9A6M3;Q8WUA7	.;TB22A_HUMAN	V	189;142;142	ENSP00000336724:A189V;ENSP00000370383:A142V;ENSP00000385634:A142V	ENSP00000336724:A189V	A	+	2	0	TBC1D22A	45572110	0.796000	0.28864	0.018000	0.16275	0.854000	0.48673	1.475000	0.35409	1.129000	0.42072	0.442000	0.29010	GCG	.	.		0.652	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
OFD1	8481	hgsc.bcm.edu	37	X	13778504	13778504	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chrX:13778504C>G	ENST00000340096.6	+	16	2252	c.1925C>G	c.(1924-1926)gCc>gGc	p.A642G	OFD1_ENST00000380567.1_Missense_Mutation_p.A502G|OFD1_ENST00000380550.3_Missense_Mutation_p.A602G|OFD1_ENST00000490265.1_3'UTR	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	642	Mediates homooligomerization.|Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CAGCAAGAGGCCGAACGCTTG	0.478																																					p.A642G		Atlas-SNP	.											.	OFD1	109	.	0			c.C1925G						.						91.0	80.0	84.0					X																	13778504		2203	4300	6503	SO:0001583	missense	8481	exon16			AAGAGGCCGAACG	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1925C>G	chrX.hg19:g.13778504C>G	ENSP00000344314:p.Ala642Gly	101.0	0.0		110.0	67.0	NM_003611	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	hg19	CCDS14157.1	.	.	.	.	.	.	.	.	.	.	.	15.81	2.942782	0.53079	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.98996	-5.31;-5.18;-2.97	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	M	0.77103	2.36	0.80722	D	1	D;P;D;D;D	0.89917	0.968;0.876;1.0;1.0;0.968	P;B;D;D;P	0.91635	0.569;0.337;0.999;0.999;0.469	D	0.99727	1.1011	10	0.56958	D	0.05	-13.2959	18.8223	0.92102	0.0:1.0:0.0:0.0	.	642;602;310;502;642	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	G	602;642;502	ENSP00000369923:A602G;ENSP00000344314:A642G;ENSP00000369941:A502G	ENSP00000344314:A642G	A	+	2	0	OFD1	13688425	1.000000	0.71417	0.894000	0.35097	0.331000	0.28603	4.838000	0.62803	2.391000	0.81399	0.529000	0.55759	GCC	.	.		0.478	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611	
PRR32	100130613	hgsc.bcm.edu	37	X	125954737	125954737	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chrX:125954737C>G	ENST00000371125.3	+	2	196	c.116C>G	c.(115-117)tCc>tGc	p.S39C		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		39																	TGTCTGAGTTCCAAGCCAGAG	0.562																																					p.S39C		Atlas-SNP	.											.	.	.	.	0			c.C116G						.						76.0	60.0	65.0					X																	125954737		692	1591	2283	SO:0001583	missense	100130613	exon2			TGAGTTCCAAGCC																												ENST00000371125.3:c.116C>G	chrX.hg19:g.125954737C>G	ENSP00000360166:p.Ser39Cys	127.0	0.0		216.0	57.0	NM_001122716		Missense_Mutation	SNP	ENST00000371125.3	hg19	CCDS48163.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258030	0.39896	.	.	ENSG00000183631	ENST00000371125	T	0.38722	1.12	4.25	2.45	0.29901	.	.	.	.	.	T	0.28400	0.0702	L	0.29908	0.895	0.09310	N	1	B	0.26845	0.161	B	0.25884	0.064	T	0.26430	-1.0103	9	0.87932	D	0	.	4.7801	0.13197	0.0:0.6601:0.2176:0.1224	.	39	B1ATL7	CX064_HUMAN	C	39	ENSP00000360166:S39C	ENSP00000360166:S39C	S	+	2	0	CXorf64	125782418	0.000000	0.05858	0.006000	0.13384	0.024000	0.10985	0.464000	0.21988	0.524000	0.28502	0.600000	0.82982	TCC	.	.		0.562	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058188.1		
MT-ND1	4535	hgsc.bcm.edu	37	M	3898	3898	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chrM:3898T>C	ENST00000361390.2	+	1	592	c.592T>C	c.(592-594)Ttc>Ctc	p.F198L	MT-TN_ENST00000387400.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TM_ENST00000387377.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	198					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ACCGAACCCCCTTCGACCTTG	0.502																																					p.F198L		Atlas-SNP	.											.	.	.	.	0			c.T592C						.																																			SO:0001583	missense	10625	exon1			ACCCCCTTCGACC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.592T>C	chrM.hg19:g.3898T>C	ENSP00000354687:p.Phe198Leu	48.0	0.0		41.0	7.0	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.		0.502	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-ND1	4535	hgsc.bcm.edu	37	M	3946	3946	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chrM:3946G>A	ENST00000361390.2	+	1	640	c.640G>A	c.(640-642)Gaa>Aaa	p.E214K	MT-TN_ENST00000387400.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TM_ENST00000387377.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	214					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GCTTCAACATCGAATACGCCG	0.473																																					p.E214K		Atlas-SNP	.											.	.	.	.	0			c.G640A						.																																			SO:0001583	missense	10625	exon1			AACATCGAATACG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.640G>A	chrM.hg19:g.3946G>A	ENSP00000354687:p.Glu214Lys	41.0	0.0		45.0	18.0	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.		0.473	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-ND3	4537	hgsc.bcm.edu	37	M	10167	10167	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chrM:10167T>C	ENST00000361227.2	+	1	109	c.109T>C	c.(109-111)Tac>Cac	p.Y37H	MT-ND5_ENST00000361567.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	37					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										AATCCACCCCTTACGAGTGCG	0.393																																					p.Y37H		Atlas-SNP	.											.	.	.	.	0			c.T109C						.																																			SO:0001583	missense	0	exon1			ACCCCTTACGAGT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.109T>C	chrM.hg19:g.10167T>C	ENSP00000355206:p.Tyr37His	40.0	0.0		26.0	5.0	ENST00000361227		Missense_Mutation	SNP	ENST00000361227.2	hg19																																																																																				.	.		0.393	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
TP53	7157	hgsc.bcm.edu	37	17	7577153	7577153	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr17:7577153delC	ENST00000269305.4	-	8	974	c.785delG	c.(784-786)ggtfs	p.G262fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.G262fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.G262fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.G262fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.G262fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	262	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> C (in a sporadic cancer; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation). {ECO:0000269|Ref.23}.|GN -> PD (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G262V(19)|p.0?(8)|p.G262D(4)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262fs*83(2)|p.G262_S269delGNLLGRNS(2)|p.G262del(2)|p.G262H(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGTAGATTACCACTACTCAG	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G262fs	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,-1,2	TP53	33396	.	46	Substitution - Missense(24)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Unknown(3)|Complex - deletion inframe(1)	lung(8)|large_intestine(5)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|upper_aerodigestive_tract(4)|bone(4)|endometrium(2)|urinary_tract(2)|pancreas(2)|eye(1)|liver(1)|breast(1)|stomach(1)	c.786delT						.						40.0	37.0	38.0					17																	7577153		2203	4299	6502	SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.785delG	chr17.hg19:g.7577153delC	ENSP00000269305:p.Gly262fs	78.0	0.0		72.0	28.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ZNF254	9534	hgsc.bcm.edu	37	19	24309680	24309681	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr19:24309680_24309681delCT	ENST00000357002.4	+	4	993_994	c.878_879delCT	c.(877-879)cctfs	p.P293fs	ZNF254_ENST00000342944.6_Frame_Shift_Del_p.P208fs	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	293					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				GGAGAGAAACCTTACAAGTGTG	0.366																																					p.293_293del		Atlas-INDEL	.											.	ZNF254	88	.	0			c.877_878del						.																																			SO:0001589	frameshift_variant	9534	exon4			.	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.878_879delCT	chr19.hg19:g.24309680_24309681delCT	ENSP00000349494:p.Pro293fs	159.0	0.0		183.0	17.0	NM_203282	A4QPC0|Q86XL7	Frame_Shift_Del	DEL	ENST00000357002.4	hg19	CCDS32983.1																																																																																			.	.		0.366	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
MANEA	79694	hgsc.bcm.edu	37	6	96034580	96034584	+	Frame_Shift_Del	DEL	TCTGA	TCTGA	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	TCTGA	TCTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:96034580_96034584delTCTGA	ENST00000358812.4	+	2	399_403	c.265_269delTCTGA	c.(265-270)tctgaafs	p.SE89fs	MANEA_ENST00000369293.1_Frame_Shift_Del_p.SE89fs	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	89	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TTCCAAAGCCTCTGAACTTAACTTG	0.322																																					p.88_90del		Atlas-INDEL	.											.	MANEA	58	.	0			c.264_268del						.																																			SO:0001589	frameshift_variant	79694	exon2			.	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.265_269delTCTGA	chr6.hg19:g.96034580_96034584delTCTGA	ENSP00000351669:p.Ser89fs	119.0	0.0		112.0	18.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Frame_Shift_Del	DEL	ENST00000358812.4	hg19	CCDS5032.1																																																																																			.	.		0.322	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
ST14	6768	hgsc.bcm.edu	37	11	130079716	130079716	+	Stop_Codon_Del	DEL	T	T	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr11:130079716delT	ENST00000278742.5	+	0	2984					NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)						keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CACTGGGGTATAGGGGCCGGG	0.627																																					p.V855fs		Atlas-Indel,Pindel	.											.	ST14	82	.	0			c.2565delA						.						66.0	74.0	71.0					11																	130079716		2201	4297	6498	SO:0001567	stop_retained_variant	6768	exon19			.	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	Exception_encountered	chr11.hg19:g.130079716delT		55.0	0.0		89.0	21.0	NM_021978	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Frame_Shift_Del	DEL	ENST00000278742.5	hg19	CCDS8487.1																																																																																			.	.		0.627	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1		
AXIN1	8312	hgsc.bcm.edu	37	16	364646	364647	+	Frame_Shift_Ins	INS	-	-	A	rs192381684		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr16:364646_364647insA	ENST00000262320.3	-	3	1286_1287	c.915_916insT	c.(913-918)tatgtcfs	p.V306fs	AXIN1_ENST00000354866.3_Frame_Shift_Ins_p.V306fs|AXIN1_ENST00000481769.1_5'UTR	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	306	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.Y305*(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCGGCATTGACATAATAGGGGT	0.579																																					p.V306fs		Atlas-Indel,Pindel	.											.	AXIN1	290	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.916_917insT						.																																			SO:0001589	frameshift_variant	8312	exon3			.	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.916dupT	chr16.hg19:g.364647_364647dupA	ENSP00000262320:p.Val306fs	53.0	0.0		59.0	30.0	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Ins	INS	ENST00000262320.3	hg19	CCDS10405.1																																																																																			.	.		0.579	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
MANEA	79694	hgsc.bcm.edu	37	6	96034593	96034595	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:96034593_96034595delTGG	ENST00000358812.4	+	2	412_414	c.278_280delTGG	c.(277-282)ttggat>tat	p.93_94LD>Y	MANEA_ENST00000369293.1_In_Frame_Del_p.93_94LD>Y	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	93	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		GAACTTAACTTGGATGAACTACC	0.325																																					p.93_93del		Atlas-INDEL	.											.	MANEA	58	.	0			c.277_279del						.																																			SO:0001651	inframe_deletion	79694	exon2			.	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.278_280delTGG	chr6.hg19:g.96034593_96034595delTGG	ENSP00000351669:p.Leu93_Asp94delinsTyr	122.0	0.0		97.0	18.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	In_Frame_Del	DEL	ENST00000358812.4	hg19	CCDS5032.1																																																																																			.	.		0.325	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
VCX2	51480	hgsc.bcm.edu	37	X	8138182	8138182	+	Frame_Shift_Del	DEL	A	A	-	rs41305169		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chrX:8138182delA	ENST00000317103.4	-	3	617	c.311delT	c.(310-312)ctgfs	p.L104fs		NM_016378.2	NP_057462.2	Q9H322	VCX2_HUMAN	variable charge, X-linked 2	104	2 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.		L -> P (in dbSNP:rs41305169). {ECO:0000269|PubMed:10607842, ECO:0000269|PubMed:10903929, ECO:0000269|PubMed:15489334}.							endometrium(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				CTCCTGACTCAGGGGGTCGTG	0.667																																					p.L104fs		Atlas-INDEL	.											.	VCX2	16	.	0			c.312delG						.						27.0	34.0	32.0					X																	8138182		2157	4235	6392	SO:0001589	frameshift_variant	51480	exon3			.	AF159127	CCDS35200.1	Xp22.32	2008-02-05			ENSG00000177504	ENSG00000177504			18158	protein-coding gene	gene with protein product		300532				10607842	Standard	NM_016378		Approved	VCX-2r, VCX-2R	uc004csb.3	Q9H322	OTTHUMG00000021105	ENST00000317103.4:c.311delT	chrX.hg19:g.8138182delA	ENSP00000321309:p.Leu104fs	138.0	0.0		166.0	11.0	NM_016378	A3KPB6|Q4V9T2|Q9P0H5	Frame_Shift_Del	DEL	ENST00000317103.4	hg19	CCDS35200.1																																																																																			.	.		0.667	VCX2-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055690.1	NM_016378	
MANEA	79694	hgsc.bcm.edu	37	6	96034587	96034590	+	Frame_Shift_Del	DEL	TTAA	TTAA	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	TTAA	TTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:96034587_96034590delTTAA	ENST00000358812.4	+	2	406_409	c.272_275delTTAA	c.(271-276)cttaacfs	p.LN91fs	MANEA_ENST00000369293.1_Frame_Shift_Del_p.LN91fs	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	91	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		GCCTCTGAACTTAACTTGGATGAA	0.309																																					p.91_92del		Atlas-INDEL	.											.	MANEA	58	.	0			c.271_274del						.																																			SO:0001589	frameshift_variant	79694	exon2			.	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.272_275delTTAA	chr6.hg19:g.96034587_96034590delTTAA	ENSP00000351669:p.Leu91fs	121.0	0.0		108.0	18.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Frame_Shift_Del	DEL	ENST00000358812.4	hg19	CCDS5032.1																																																																																			.	.		0.309	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
PLEC	5339	hgsc.bcm.edu	37	8	144990483	144990518	+	In_Frame_Del	DEL	GCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGT	GCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGT	-	rs567240737		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	GCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGT	GCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr8:144990483_144990518delGCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGT	ENST00000322810.4	-	32	14051_14086	c.13882_13917delACCGGCTCGCGCACCGGCTCCCGGGCCGGCTCCCGC	c.(13882-13917)accggctcgcgcaccggctcccgggccggctcccgcdel	p.TGSRTGSRAGSR4628del	PLEC_ENST00000354958.2_In_Frame_Del_p.TGSRTGSRAGSR4469del|PLEC_ENST00000356346.3_In_Frame_Del_p.TGSRTGSRAGSR4477del|PLEC_ENST00000345136.3_In_Frame_Del_p.TGSRTGSRAGSR4491del|PLEC_ENST00000398774.2_In_Frame_Del_p.TGSRTGSRAGSR4459del|PLEC_ENST00000527096.1_In_Frame_Del_p.TGSRTGSRAGSR4514del|PLEC_ENST00000436759.2_In_Frame_Del_p.TGSRTGSRAGSR4518del|PLEC_ENST00000354589.3_In_Frame_Del_p.TGSRTGSRAGSR4491del|PLEC_ENST00000357649.2_In_Frame_Del_p.TGSRTGSRAGSR4495del	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4628	4 X 4 AA tandem repeats of G-S-R-X.|Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AGCTGCCGCGGCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGTGCGGGAGCCA	0.725																																					p.4628_4640del		Atlas-Indel,Pindel	.											.	PLEC	1144	.	0			c.13883_13918del						.																																			SO:0001651	inframe_deletion	5339	exon32			.	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13882_13917delACCGGCTCGCGCACCGGCTCCCGGGCCGGCTCCCGC	chr8.hg19:g.144990483_144990518delGCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGT	ENSP00000323856:p.Thr4628_Arg4639del	104.0	0.0		173.0	32.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	In_Frame_Del	DEL	ENST00000322810.4	hg19	CCDS43772.1																																																																																			.	.		0.725	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
AGL	178	hgsc.bcm.edu	37	1	100381999	100382000	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr1:100381999_100382000delAT	ENST00000294724.4	+	32	4771_4772	c.4293_4294delAT	c.(4291-4296)gcattafs	p.L1432fs	AGL_ENST00000370165.3_Frame_Shift_Del_p.L1432fs|AGL_ENST00000370163.3_Frame_Shift_Del_p.L1432fs|AGL_ENST00000361302.3_Frame_Shift_Del_p.L1416fs|AGL_ENST00000361522.4_Frame_Shift_Del_p.L1415fs|AGL_ENST00000361915.3_Frame_Shift_Del_p.L1432fs|AGL_ENST00000370161.2_Frame_Shift_Del_p.L1416fs	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1432					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ATGACAATGCATTAGACAATGA	0.267																																					p.1431_1431del		Atlas-Indel,Pindel	.											.	AGL	137	.	0			c.4292_4293del						.																																			SO:0001589	frameshift_variant	178	exon32			.	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.4293_4294delAT	chr1.hg19:g.100381999_100382000delAT	ENSP00000294724:p.Leu1432fs	352.0	0.0		434.0	141.0	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Frame_Shift_Del	DEL	ENST00000294724.4	hg19	CCDS759.1																																																																																			.	.		0.267	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
IARS	3376	hgsc.bcm.edu	37	9	95007263	95007270	+	Frame_Shift_Del	DEL	AATTGCGC	AATTGCGC	-	rs139380974		TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	AATTGCGC	AATTGCGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr9:95007263_95007270delAATTGCGC	ENST00000375643.3	-	27	3141_3148	c.2875_2882delGCGCAATT	c.(2875-2883)gcgcaatttfs	p.AQF959fs	IARS_ENST00000443024.2_Frame_Shift_Del_p.AQF959fs|IARS_ENST00000375629.3_Frame_Shift_Del_p.AQF12fs|IARS_ENST00000375627.1_Frame_Shift_Del_p.AQF12fs|IARS_ENST00000474340.1_5'Flank|IARS_ENST00000447699.2_Frame_Shift_Del_p.AQF849fs	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	959					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	GTGTGCTTCAAATTGCGCAGTCCCACCT	0.457																																					p.959_961del		Pindel	.											.	IARS	74	.	0			c.2876_2883del						.																																			SO:0001589	frameshift_variant	3376	exon27			.	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.2875_2882delGCGCAATT	chr9.hg19:g.95007263_95007270delAATTGCGC	ENSP00000364794:p.Ala959fs	106.0	0.0		103.0	13.0	NM_002161	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Frame_Shift_Del	DEL	ENST00000375643.3	hg19	CCDS6694.1																																																																																			.	.		0.457	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
MANEA	79694	hgsc.bcm.edu	37	6	96034580	96034596	+	Frame_Shift_Del	DEL	TCTGAACTTAACTTGGA	TCTGAACTTAACTTGGA	-			TCGA-G3-AAV7-01A-11D-A382-10	TCGA-G3-AAV7-10A-01D-A385-10	TCTGAACTTAACTTGGA	TCTGAACTTAACTTGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7a120ba7-e59d-48f3-9e72-4b0466e25e4c	07777f2e-37eb-4fc2-9804-a93484b12424	g.chr6:96034580_96034596delTCTGAACTTAACTTGGA	ENST00000358812.4	+	2	399_415	c.265_281delTCTGAACTTAACTTGGA	c.(265-282)tctgaacttaacttggatfs	p.SELNLD89fs	MANEA_ENST00000369293.1_Frame_Shift_Del_p.SELNLD89fs	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	89	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TTCCAAAGCCTCTGAACTTAACTTGGATGAACTACCA	0.327																																					p.88_94del		Pindel	.											.	MANEA	58	.	0			c.264_280del						.																																			SO:0001589	frameshift_variant	79694	exon2			.	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.265_281delTCTGAACTTAACTTGGA	chr6.hg19:g.96034580_96034596delTCTGAACTTAACTTGGA	ENSP00000351669:p.Ser89fs	123.0	0.0		110.0	24.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Frame_Shift_Del	DEL	ENST00000358812.4	hg19	CCDS5032.1																																																																																			.	.		0.327	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
