#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LZIC	84328	hgsc.bcm.edu	37	1	9995639	9995639	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:9995639G>C	ENST00000377223.1	-	4	395	c.148C>G	c.(148-150)Ctg>Gtg	p.L50V	LZIC_ENST00000377213.1_Missense_Mutation_p.L50V|LZIC_ENST00000541052.1_Missense_Mutation_p.L71V|LZIC_ENST00000400903.2_Missense_Mutation_p.L50V	NM_032368.3	NP_115744.2	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing	50					response to ionizing radiation (GO:0010212)					breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		AGTTGCTCCAGAGTTTCCTTT	0.328																																					p.L50V		Atlas-SNP	.											.	LZIC	11	.	0			c.C148G						.						149.0	155.0	153.0					1																	9995639		2203	4299	6502	SO:0001583	missense	84328	exon3			GCTCCAGAGTTTC	AB060688	CCDS107.1	1p36.22	2008-02-05			ENSG00000162441	ENSG00000162441			17497	protein-coding gene	gene with protein product		610458				11712074	Standard	NM_032368		Approved	MGC15436	uc001aqm.3	Q8WZA0	OTTHUMG00000001804	ENST00000377223.1:c.148C>G	chr1.hg19:g.9995639G>C	ENSP00000366430:p.Leu50Val	70.0	0.0		78.0	28.0	NM_032368	B2R6F0|B4E2N0|Q96IU1	Missense_Mutation	SNP	ENST00000377223.1	hg19	CCDS107.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039200	0.35989	.	.	ENSG00000162441	ENST00000377223;ENST00000400903;ENST00000541052;ENST00000377213	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.63	3.39	0.38822	.	0.000000	0.64402	D	0.000001	T	0.20981	0.0505	L	0.33137	0.985	0.49130	D	0.999754	B;B	0.28512	0.214;0.087	B;B	0.20767	0.031;0.018	T	0.05037	-1.0910	9	.	.	.	.	12.5259	0.56085	0.1618:0.0:0.8382:0.0	.	71;50	B4E2N0;Q8WZA0	.;LZIC_HUMAN	V	50;50;71;50	ENSP00000366430:L50V;ENSP00000383695:L50V;ENSP00000437432:L71V;ENSP00000366418:L50V	.	L	-	1	2	LZIC	9918226	0.345000	0.24835	1.000000	0.80357	0.996000	0.88848	0.746000	0.26275	1.350000	0.45770	0.491000	0.48974	CTG	.	.		0.328	LZIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005037.1	NM_032368	
RSC1A1	6248	hgsc.bcm.edu	37	1	15988085	15988085	+	Silent	SNP	C	C	G			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:15988085C>G	ENST00000345034.1	+	1	1722	c.1722C>G	c.(1720-1722)gcC>gcG	p.A574A	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	574	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTTTTCCTGCCACAGATATTG	0.473																																					p.A574A		Atlas-SNP	.											.	RSC1A1	29	.	0			c.C1722G						.						220.0	200.0	207.0					1																	15988085		2203	4300	6503	SO:0001819	synonymous_variant	6248	exon1			TCCTGCCACAGAT	BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.1722C>G	chr1.hg19:g.15988085C>G		239.0	0.0		250.0	79.0	NM_006511	B2RBP5	Silent	SNP	ENST00000345034.1	hg19	CCDS161.1																																																																																			.	.		0.473	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	NM_006511	
DDOST	1650	hgsc.bcm.edu	37	1	20980769	20980769	+	Silent	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:20980769G>A	ENST00000375048.3	-	7	897	c.792C>T	c.(790-792)ttC>ttT	p.F264F	PINK1-AS_ENST00000451424.1_RNA|DDOST_ENST00000415136.2_Silent_p.F227F|DDOST_ENST00000602624.2_Silent_p.F247F	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	264					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGAGTCGCTGAAGAAGTCGA	0.632																																					p.F264F		Atlas-SNP	.											.	DDOST	30	.	0			c.C792T						.						38.0	35.0	36.0					1																	20980769		2164	4216	6380	SO:0001819	synonymous_variant	1650	exon7			GTCGCTGAAGAAG	D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.792C>T	chr1.hg19:g.20980769G>A		128.0	0.0		153.0	48.0	NM_005216	B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Silent	SNP	ENST00000375048.3	hg19	CCDS212.1																																																																																			.	.		0.632	DDOST-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007961.2	NM_005216	
AHDC1	27245	hgsc.bcm.edu	37	1	27875598	27875598	+	Missense_Mutation	SNP	G	G	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:27875598G>T	ENST00000247087.5	-	5	3625	c.3029C>A	c.(3028-3030)gCc>gAc	p.A1010D	AHDC1_ENST00000374011.2_Missense_Mutation_p.A1010D			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1010							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTGGGTGAGGCAGGGAGGCT	0.647																																					p.A1010D		Atlas-SNP	.											.	AHDC1	98	.	0			c.C3029A						.						28.0	30.0	30.0					1																	27875598		2203	4298	6501	SO:0001583	missense	27245	exon6			GGTGAGGCAGGGA	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3029C>A	chr1.hg19:g.27875598G>T	ENSP00000247087:p.Ala1010Asp	27.0	0.0		37.0	4.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	hg19	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339478	0.41398	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.52754	0.65;0.65	5.79	5.79	0.91817	.	0.094954	0.42053	D	0.000777	T	0.44787	0.1310	N	0.19112	0.55	0.36409	D	0.863591	P	0.46784	0.884	P	0.47206	0.541	T	0.55885	-0.8070	10	0.87932	D	0	-12.2488	18.7978	0.92003	0.0:0.0:1.0:0.0	.	1010	Q5TGY3	AHDC1_HUMAN	D	1010	ENSP00000247087:A1010D;ENSP00000363123:A1010D	ENSP00000247087:A1010D	A	-	2	0	AHDC1	27748185	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.791000	0.62460	2.735000	0.93741	0.655000	0.94253	GCC	.	.		0.647	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
TMEM61	199964	hgsc.bcm.edu	37	1	55452005	55452005	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:55452005G>A	ENST00000371268.3	+	2	525	c.251G>A	c.(250-252)gGc>gAc	p.G84D	RP11-12C17.2_ENST00000436960.1_RNA	NM_182532.1	NP_872338.1	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	84						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	4						CTGCTCATTGGCCTGCTGTGG	0.652																																					p.G84D		Atlas-SNP	.											.	TMEM61	22	.	0			c.G251A						.						93.0	93.0	93.0					1																	55452005		2203	4300	6503	SO:0001583	missense	199964	exon2			TCATTGGCCTGCT	BC029775	CCDS601.1	1p32.3	2008-02-05			ENSG00000143001	ENSG00000143001			27296	protein-coding gene	gene with protein product						12477932	Standard	NM_182532		Approved		uc001cyd.3	Q8N0U2	OTTHUMG00000009991	ENST00000371268.3:c.251G>A	chr1.hg19:g.55452005G>A	ENSP00000360315:p.Gly84Asp	72.0	0.0		125.0	36.0	NM_182532		Missense_Mutation	SNP	ENST00000371268.3	hg19	CCDS601.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732199	0.48939	.	.	ENSG00000143001	ENST00000371268	T	0.62105	0.05	4.8	3.89	0.44902	.	0.000000	0.53938	D	0.000050	T	0.67813	0.2933	L	0.32530	0.975	0.29843	N	0.829037	D	0.89917	1.0	D	0.78314	0.991	T	0.66352	-0.5945	10	0.87932	D	0	-20.7621	11.2898	0.49244	0.0855:0.0:0.9145:0.0	.	84	Q8N0U2	TMM61_HUMAN	D	84	ENSP00000360315:G84D	ENSP00000360315:G84D	G	+	2	0	TMEM61	55224593	1.000000	0.71417	0.953000	0.39169	0.209000	0.24338	5.568000	0.67385	1.241000	0.43820	0.655000	0.94253	GGC	.	.		0.652	TMEM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027683.1	NM_182532	
ARHGAP29	9411	hgsc.bcm.edu	37	1	94654393	94654393	+	Splice_Site	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:94654393C>T	ENST00000260526.6	-	15	1863	c.1681G>A	c.(1681-1683)Gga>Aga	p.G561R	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	561					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		ATAGATGTACCTGGACTTATA	0.353																																					p.G561R		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.G1681A						.						73.0	74.0	74.0					1																	94654393		2203	4299	6502	SO:0001630	splice_region_variant	9411	exon15			ATGTACCTGGACT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1681+1G>A	chr1.hg19:g.94654393C>T		234.0	0.0		215.0	9.0	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	hg19	CCDS748.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904241	0.92035	.	.	ENSG00000137962	ENST00000260526	T	0.27104	1.69	5.64	5.64	0.86602	.	0.000000	0.37530	N	0.002042	T	0.39860	0.1094	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.81914	0.995;0.762	T	0.01371	-1.1372	9	.	.	.	-25.9961	18.8715	0.92317	0.0:1.0:0.0:0.0	.	561;561	F8VWZ8;Q52LW3	.;RHG29_HUMAN	R	561	ENSP00000260526:G561R	.	G	-	1	0	ARHGAP29	94426981	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.550000	0.73905	2.937000	0.99478	0.650000	0.86243	GGA	.	.		0.353	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	Missense_Mutation
GJA8	2703	hgsc.bcm.edu	37	1	147380477	147380477	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:147380477G>A	ENST00000369235.1	+	1	395	c.395G>A	c.(394-396)aGc>aAc	p.S132N	GJA8_ENST00000240986.4_Missense_Mutation_p.S132N			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	132					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GTCAAGAAGAGCAGCGGCAGC	0.622																																					p.S132N	Melanoma(76;1255 1795 8195 52096)	Atlas-SNP	.											.	GJA8	108	.	0			c.G395A						.						58.0	67.0	64.0					1																	147380477		2203	4300	6503	SO:0001583	missense	2703	exon2			AGAAGAGCAGCGG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.395G>A	chr1.hg19:g.147380477G>A	ENSP00000358238:p.Ser132Asn	52.0	0.0		53.0	11.0	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	hg19	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	g	6.216	0.408009	0.11754	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.97529	-4.42;-4.42	4.72	4.72	0.59763	.	1.187530	0.06334	N	0.706773	D	0.90438	0.7006	L	0.36672	1.1	0.30088	N	0.808548	B	0.02656	0.0	B	0.06405	0.002	T	0.80027	-0.1554	10	0.21014	T	0.42	.	11.1292	0.48336	0.0:0.1876:0.8124:0.0	.	132	P48165	CXA8_HUMAN	N	132	ENSP00000240986:S132N;ENSP00000358238:S132N	ENSP00000240986:S132N	S	+	2	0	GJA8	145847101	1.000000	0.71417	0.993000	0.49108	0.311000	0.27955	2.809000	0.47971	2.151000	0.67156	0.436000	0.28706	AGC	.	.		0.622	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
CELF3	11189	hgsc.bcm.edu	37	1	151679692	151679692	+	Missense_Mutation	SNP	G	G	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:151679692G>T	ENST00000290583.4	-	8	1644	c.851C>A	c.(850-852)cCg>cAg	p.P284Q	CELF3_ENST00000470688.1_5'UTR|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_Missense_Mutation_p.P101Q|CELF3_ENST00000290585.4_Intron	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	284				P -> Q (in Ref. 5; AAH52491). {ECO:0000305}.	mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						GGTGGGCACCGGGCTGTAGCC	0.677																																					p.P284Q		Atlas-SNP	.											.	CELF3	49	.	0			c.C851A						.						23.0	23.0	23.0					1																	151679692		2169	4263	6432	SO:0001583	missense	11189	exon8			GGCACCGGGCTGT	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.851C>A	chr1.hg19:g.151679692G>T	ENSP00000290583:p.Pro284Gln	75.0	0.0		97.0	4.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	hg19	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	13.69	2.313326	0.40996	.	.	ENSG00000159409	ENST00000290583;ENST00000392706	T;T	0.15834	2.39;3.48	3.86	3.86	0.44501	.	0.362099	0.25558	N	0.029855	T	0.11196	0.0273	L	0.34521	1.04	0.41768	D	0.989759	P;B;B;B	0.49307	0.922;0.33;0.389;0.3	P;B;B;B	0.51895	0.683;0.265;0.159;0.227	T	0.03784	-1.1004	10	0.37606	T	0.19	-13.192	10.711	0.45984	0.0:0.1945:0.8055:0.0	.	101;284;284;283	B4DQL3;Q5SZQ8-2;Q5SZQ8;Q5SZQ8-3	.;.;CELF3_HUMAN;.	Q	284;101	ENSP00000290583:P284Q;ENSP00000376470:P101Q	ENSP00000290583:P284Q	P	-	2	0	CELF3	149946316	0.861000	0.29849	0.985000	0.45067	0.938000	0.57974	1.654000	0.37334	2.008000	0.58898	0.555000	0.69702	CCG	.	.		0.677	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
IGFN1	91156	hgsc.bcm.edu	37	1	201196307	201196307	+	Missense_Mutation	SNP	C	C	A	rs543665080		TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:201196307C>A	ENST00000335211.4	+	23	11214	c.11084C>A	c.(11083-11085)gCa>gAa	p.A3695E	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1238						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CTGGGCCAGGCAGTCAGCACT	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15052	0.0		0.0	False		,,,				2504	0.0				p.A3695E		Atlas-SNP	.											.	IGFN1	220	.	0			c.C11084A						.						36.0	22.0	27.0					1																	201196307		2201	4299	6500	SO:0001583	missense	91156	exon23			GCCAGGCAGTCAG	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.11084C>A	chr1.hg19:g.201196307C>A	ENSP00000334714:p.Ala3695Glu	106.0	0.0		127.0	6.0	NM_001164586	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	hg19	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981139	0.53827	.	.	ENSG00000163395	ENST00000335211	T	0.67865	-0.29	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.81795	0.4898	M	0.77103	2.36	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	D	0.84135	0.0414	10	0.72032	D	0.01	.	15.8823	0.79213	0.0:1.0:0.0:0.0	.	3695	F8WAI1	.	E	3695	ENSP00000334714:A3695E	ENSP00000334714:A3695E	A	+	2	0	IGFN1	199462930	0.948000	0.32251	0.947000	0.38551	0.140000	0.21249	2.084000	0.41625	2.430000	0.82344	0.655000	0.94253	GCA	.	.		0.632	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
LYG2	254773	hgsc.bcm.edu	37	2	99861811	99861811	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr2:99861811C>T	ENST00000409238.1	-	3	315	c.295G>A	c.(295-297)Gca>Aca	p.A99T	LYG2_ENST00000333017.2_Missense_Mutation_p.A99T|LYG2_ENST00000409679.1_Missense_Mutation_p.A99T|LYG2_ENST00000423800.1_Missense_Mutation_p.A99T			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	99					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						ATGATGGCTGCGATGACAGCA	0.498																																					p.A99T		Atlas-SNP	.											LYG2,NS,carcinoma,0,2	LYG2	26	.	0			c.G295A						.						115.0	103.0	107.0					2																	99861811		2203	4300	6503	SO:0001583	missense	254773	exon4			TGGCTGCGATGAC	AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.295G>A	chr2.hg19:g.99861811C>T	ENSP00000386939:p.Ala99Thr	49.0	0.0		62.0	3.0	NM_175735	Q496G2|Q53RW0	Missense_Mutation	SNP	ENST00000409238.1	hg19	CCDS2042.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697377	0.68386	.	.	ENSG00000185674	ENST00000409238;ENST00000333017;ENST00000409679;ENST00000423306	.	.	.	5.78	5.78	0.91487	Lytic transglycosylase-like, catalytic (1);Lysozyme-like domain (1);	0.000000	0.64402	D	0.000007	T	0.81113	0.4755	M	0.84585	2.705	0.52501	D	0.999953	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.82500	-0.0426	8	.	.	.	-20.2617	15.5051	0.75731	0.0:1.0:0.0:0.0	.	99;99;99	Q496G2;C9J4J0;Q86SG7	.;.;LYG2_HUMAN	T	99	.	.	A	-	1	0	LYG2	99228243	1.000000	0.71417	0.951000	0.38953	0.128000	0.20619	5.656000	0.67988	2.745000	0.94114	0.555000	0.69702	GCA	.	.		0.498	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330307.1	NM_175735	
CCSER1	401145	hgsc.bcm.edu	37	4	91230460	91230460	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr4:91230460C>T	ENST00000509176.1	+	2	1313	c.1025C>T	c.(1024-1026)gCt>gTt	p.A342V	CCSER1_ENST00000333691.8_Missense_Mutation_p.A342V|CCSER1_ENST00000432775.2_Missense_Mutation_p.A342V	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	342																	GAAACCTCTGCTGCTAATCAG	0.423																																					p.A342V		Atlas-SNP	.											.	.	.	.	0			c.C1025T						.						100.0	93.0	95.0					4																	91230460		1858	4105	5963	SO:0001583	missense	401145	exon2			CCTCTGCTGCTAA		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1025C>T	chr4.hg19:g.91230460C>T	ENSP00000425040:p.Ala342Val	191.0	0.0		217.0	70.0	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	hg19	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.340894	0.41498	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.51325	1.23;0.71;1.23	4.73	3.89	0.44902	.	0.315828	0.30510	N	0.009475	T	0.34366	0.0895	L	0.43152	1.355	0.27462	N	0.953121	B;B;B	0.28783	0.222;0.192;0.192	B;B;B	0.27262	0.046;0.043;0.078	T	0.31194	-0.9952	10	0.52906	T	0.07	-25.062	3.7418	0.08533	0.1341:0.583:0.1304:0.1524	.	342;342;342	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	V	342	ENSP00000425040:A342V;ENSP00000389283:A342V;ENSP00000329482:A342V	ENSP00000329482:A342V	A	+	2	0	FAM190A	91449483	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.463000	0.35277	1.317000	0.45149	-0.216000	0.12614	GCT	.	.		0.423	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
ZNF879	345462	hgsc.bcm.edu	37	5	178459932	178459932	+	Missense_Mutation	SNP	G	G	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr5:178459932G>T	ENST00000444149.2	+	5	1171	c.983G>T	c.(982-984)tGc>tTc	p.C328F		NM_001136116.1	NP_001129588.1	B4DU55	ZN879_HUMAN	zinc finger protein 879	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|pancreas(1)|stomach(1)	7						TTCAGTCAGTGCTCATCTCTC	0.433																																					p.C328F		Atlas-SNP	.											.	ZNF879	41	.	0			c.G983T						.						55.0	51.0	52.0					5																	178459932		692	1591	2283	SO:0001583	missense	345462	exon5			GTCAGTGCTCATC	AK300504	CCDS47352.1	5q35.3	2013-01-08			ENSG00000234284	ENSG00000234284		"""Zinc fingers, C2H2-type"", ""-"""	37273	protein-coding gene	gene with protein product							Standard	NM_001136116		Approved	DKFZp686E2433	uc003mjt.4	B4DU55	OTTHUMG00000163596	ENST00000444149.2:c.983G>T	chr5.hg19:g.178459932G>T	ENSP00000414887:p.Cys328Phe	119.0	0.0		99.0	4.0	NM_001136116		Missense_Mutation	SNP	ENST00000444149.2	hg19	CCDS47352.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106768	0.37145	.	.	ENSG00000234284	ENST00000444149	T	0.35421	1.31	4.19	4.19	0.49359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16041	0.0386	N	0.10809	0.05	0.09310	N	0.999999	P	0.49961	0.93	B	0.38264	0.269	T	0.02042	-1.1224	9	0.09590	T	0.72	-8.6998	9.5924	0.39554	0.0:0.0:0.7908:0.2092	.	328	B4DU55	ZN879_HUMAN	F	328	ENSP00000414887:C328F	ENSP00000414887:C328F	C	+	2	0	ZNF879	178392538	0.000000	0.05858	1.000000	0.80357	0.962000	0.63368	-0.070000	0.11523	2.306000	0.77630	0.467000	0.42956	TGC	.	.		0.433	ZNF879-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374447.1	NM_001136116	
TOX	9760	hgsc.bcm.edu	37	8	59852023	59852023	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr8:59852023C>T	ENST00000361421.1	-	3	469	c.249G>A	c.(247-249)ctG>ctA	p.L83L		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	83						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TCAGGTGCACCAGCGAGTGGT	0.488																																					p.L83L	Pancreas(161;610 1969 17913 21374 22725)	Atlas-SNP	.											.	TOX	83	.	0			c.G249A						.						136.0	118.0	124.0					8																	59852023		2203	4300	6503	SO:0001819	synonymous_variant	9760	exon3			GTGCACCAGCGAG		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.249G>A	chr8.hg19:g.59852023C>T		209.0	0.0		213.0	11.0	NM_014729	Q96AV5	Silent	SNP	ENST00000361421.1	hg19	CCDS34897.1																																																																																			.	.		0.488	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
LRRC69	100130742	hgsc.bcm.edu	37	8	92212905	92212905	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr8:92212905T>C	ENST00000448384.2	+	7	818	c.818T>C	c.(817-819)aTa>aCa	p.I273T	LRRC69_ENST00000343709.3_Missense_Mutation_p.I117T	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	273										endometrium(1)	1						ATGGATGACATAGAACGGTAC	0.363																																					p.I273T		Atlas-SNP	.											.	LRRC69	24	.	0			c.T818C						.						211.0	170.0	182.0					8																	92212905		692	1591	2283	SO:0001583	missense	100130742	exon7			ATGACATAGAACG	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.818T>C	chr8.hg19:g.92212905T>C	ENSP00000400803:p.Ile273Thr	280.0	0.0		298.0	90.0	NM_001129890		Missense_Mutation	SNP	ENST00000448384.2	hg19		.	.	.	.	.	.	.	.	.	.	T	7.428	0.638193	0.14386	.	.	ENSG00000214954	ENST00000343709;ENST00000448384	T;T	0.56275	0.47;0.48	5.1	5.1	0.69264	.	0.225392	0.27906	U	0.017374	T	0.52273	0.1724	M	0.62723	1.935	0.09310	N	1	B;P	0.41188	0.079;0.741	B;B	0.41988	0.043;0.372	T	0.54241	-0.8323	10	0.54805	T	0.06	-2.4112	11.2927	0.49261	0.0:0.0:0.0:1.0	.	273;117	Q6ZNQ3;Q6ZNQ3-2	LRC69_HUMAN;.	T	117;273	ENSP00000343221:I117T;ENSP00000400803:I273T	ENSP00000343221:I117T	I	+	2	0	LRRC69	92282081	0.087000	0.21565	0.005000	0.12908	0.008000	0.06430	3.978000	0.56881	1.919000	0.55581	0.459000	0.35465	ATA	.	.		0.363	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000415207.1	NM_001129890	
UCN3	114131	hgsc.bcm.edu	37	10	5416093	5416093	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:5416093T>C	ENST00000380433.3	+	2	638	c.410T>C	c.(409-411)aTc>aCc	p.I137T		NM_053049.2	NP_444277.2	Q969E3	UCN3_HUMAN	urocortin 3	137					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|digestion (GO:0007586)|positive regulation of insulin secretion (GO:0032024)|positive regulation of membrane potential (GO:0045838)|response to corticosterone (GO:0051412)|response to glucose (GO:0009749)|response to immobilization stress (GO:0035902)|response to starvation (GO:0042594)	axon terminus (GO:0043679)|extracellular space (GO:0005615)|varicosity (GO:0043196)				endometrium(1)|large_intestine(1)	2						CTCTTCAACATCGCCAAGGCC	0.627																																					p.I137T		Atlas-SNP	.											.	UCN3	13	.	0			c.T410C						.						58.0	60.0	59.0					10																	5416093		2203	4300	6503	SO:0001583	missense	114131	exon2			TCAACATCGCCAA	AF361943	CCDS7065.1	10p15.1	2013-02-28	2012-10-17		ENSG00000178473	ENSG00000178473		"""Endogenous ligands"""	17781	protein-coding gene	gene with protein product	"""stresscopin"", ""prepro-urocortin 3"""	605901				11416224	Standard	NM_053049		Approved	UCNIII, SPC	uc001ihx.1	Q969E3	OTTHUMG00000017594	ENST00000380433.3:c.410T>C	chr10.hg19:g.5416093T>C	ENSP00000369798:p.Ile137Thr	66.0	0.0		66.0	4.0	NM_053049	Q496H2|Q5SR91	Missense_Mutation	SNP	ENST00000380433.3	hg19	CCDS7065.1	.	.	.	.	.	.	.	.	.	.	T	18.73	3.686176	0.68157	.	.	ENSG00000178473	ENST00000380433	T	0.37915	1.17	5.49	5.49	0.81192	.	0.070278	0.56097	D	0.000023	T	0.53530	0.1802	L	0.51422	1.61	0.46376	D	0.999011	D	0.71674	0.998	D	0.69824	0.966	T	0.55817	-0.8081	10	0.72032	D	0.01	-21.5148	14.395	0.67005	0.0:0.0:0.0:1.0	.	137	Q969E3	UCN3_HUMAN	T	137	ENSP00000369798:I137T	ENSP00000369798:I137T	I	+	2	0	UCN3	5406093	1.000000	0.71417	0.956000	0.39512	0.737000	0.42083	7.470000	0.80973	2.096000	0.63516	0.402000	0.26972	ATC	.	.		0.627	UCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046547.1	NM_053049	
KIAA1279	26128	hgsc.bcm.edu	37	10	70775430	70775430	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:70775430C>T	ENST00000361983.4	+	7	1226	c.1124C>T	c.(1123-1125)tCt>tTt	p.S375F		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	375					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						GATGCCATCTCTGCAGTAGAA	0.413																																					p.S375F		Atlas-SNP	.											.	KIAA1279	35	.	0			c.C1124T						.						119.0	112.0	115.0					10																	70775430		2203	4300	6503	SO:0001583	missense	26128	exon7			CCATCTCTGCAGT	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1124C>T	chr10.hg19:g.70775430C>T	ENSP00000354848:p.Ser375Phe	94.0	0.0		95.0	37.0	NM_015634	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	ENST00000361983.4	hg19	CCDS7284.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317605	0.40996	.	.	ENSG00000198954	ENST00000361983	T	0.48836	0.8	5.51	4.38	0.52667	.	0.351400	0.32819	N	0.005605	T	0.26231	0.0640	N	0.14661	0.345	0.33903	D	0.638776	P	0.42649	0.786	B	0.40329	0.326	T	0.34502	-0.9826	10	0.54805	T	0.06	-20.501	2.826	0.05485	0.283:0.5395:0.0:0.1775	.	375	Q96EK5	KBP_HUMAN	F	375	ENSP00000354848:S375F	ENSP00000354848:S375F	S	+	2	0	KIAA1279	70445436	0.980000	0.34600	1.000000	0.80357	0.997000	0.91878	2.115000	0.41921	2.763000	0.94921	0.650000	0.86243	TCT	.	.		0.413	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1	NM_015634	
HTR7	3363	hgsc.bcm.edu	37	10	92616999	92616999	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:92616999T>C	ENST00000336152.3	-	1	456	c.430A>G	c.(430-432)Atc>Gtc	p.I144V	HTR7_ENST00000371719.2_Missense_Mutation_p.I144V|HTR7_ENST00000371721.3_Missense_Mutation_p.I144V|HTR7_ENST00000277874.6_Missense_Mutation_p.I144V	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	144					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TTGCCCCCGATGAGGTCGGTG	0.597																																					p.I144V		Atlas-SNP	.											.	HTR7	122	.	0			c.A430G						.						66.0	58.0	61.0					10																	92616999		2203	4300	6503	SO:0001583	missense	3363	exon1			CCCCGATGAGGTC	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.430A>G	chr10.hg19:g.92616999T>C	ENSP00000337949:p.Ile144Val	223.0	0.0		306.0	79.0	NM_019860	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	hg19	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883669	0.33255	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.10551	0.0258	N	0.10945	0.07	0.50171	D	0.99985	B;B	0.21821	0.061;0.035	B;B	0.20767	0.031;0.016	T	0.07121	-1.0789	10	0.02654	T	1	.	14.6436	0.68742	0.0:0.0:0.0:1.0	.	144;144	P34969;P34969-2	5HT7R_HUMAN;.	V	144	ENSP00000337949:I144V;ENSP00000277874:I144V;ENSP00000360784:I144V;ENSP00000360786:I144V	ENSP00000277874:I144V	I	-	1	0	HTR7	92606979	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.895000	0.48648	1.872000	0.54250	0.460000	0.39030	ATC	.	.		0.597	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
MYOF	26509	hgsc.bcm.edu	37	10	95109596	95109596	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:95109596T>C	ENST00000359263.4	-	36	4051	c.4052A>G	c.(4051-4053)aAc>aGc	p.N1351S	MYOF_ENST00000358334.5_Missense_Mutation_p.N1338S|MYOF_ENST00000371502.4_Missense_Mutation_p.N1351S|MYOF_ENST00000371501.4_Missense_Mutation_p.N1351S	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1351					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						ACTTGGAAAGTTGGGTGTCTT	0.453																																					p.N1351S		Atlas-SNP	.											.	MYOF	177	.	0			c.A4052G						.						110.0	109.0	109.0					10																	95109596		1894	4118	6012	SO:0001583	missense	26509	exon36			GGAAAGTTGGGTG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4052A>G	chr10.hg19:g.95109596T>C	ENSP00000352208:p.Asn1351Ser	177.0	0.0		209.0	59.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	hg19	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.675819	0.88445	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.53	5.53	0.82687	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.83312	0.5227	M	0.89353	3.025	0.58432	D	0.999999	D;D	0.64830	0.994;0.972	D;P	0.63877	0.919;0.721	D	0.86513	0.1811	10	0.62326	D	0.03	-27.4168	15.6595	0.77174	0.0:0.0:0.0:1.0	.	1338;1351	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	S	1338;1351;1351;1351	ENSP00000351094:N1338S;ENSP00000352208:N1351S;ENSP00000360556:N1351S;ENSP00000360557:N1351S	ENSP00000351094:N1338S	N	-	2	0	MYOF	95099586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.985000	0.88162	2.102000	0.63906	0.459000	0.35465	AAC	.	.		0.453	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
OR5J2	282775	hgsc.bcm.edu	37	11	55944717	55944717	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr11:55944717G>C	ENST00000312298.1	+	1	624	c.624G>C	c.(622-624)atG>atC	p.M208I		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M208I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					TCATTGCCATGGCCACCTTCT	0.478																																					p.M208I		Atlas-SNP	.											OR5J2,NS,carcinoma,0,1	OR5J2	98	.	1	Substitution - Missense(1)	lung(1)	c.G624C						.						168.0	128.0	141.0					11																	55944717		2201	4296	6497	SO:0001583	missense	282775	exon1			TGCCATGGCCACC	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.624G>C	chr11.hg19:g.55944717G>C	ENSP00000310788:p.Met208Ile	308.0	1.0		309.0	96.0	NM_001005492	Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	hg19	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.301242	0.00243	.	.	ENSG00000174957	ENST00000312298	T	0.34275	1.37	4.55	0.121	0.14695	GPCR, rhodopsin-like superfamily (1);	0.615899	0.15672	N	0.250346	T	0.12305	0.0299	N	0.05441	-0.05	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.32268	-0.9913	10	0.02654	T	1	.	4.0132	0.09632	0.1572:0.1288:0.5818:0.1322	.	208	Q8NH18	OR5J2_HUMAN	I	208	ENSP00000310788:M208I	ENSP00000310788:M208I	M	+	3	0	OR5J2	55701293	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-0.947000	0.03901	0.461000	0.27071	0.591000	0.81541	ATG	.	.		0.478	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492	
FAT3	120114	hgsc.bcm.edu	37	11	92533065	92533065	+	Missense_Mutation	SNP	C	C	G			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr11:92533065C>G	ENST00000298047.6	+	9	6903	c.6886C>G	c.(6886-6888)Cta>Gta	p.L2296V	FAT3_ENST00000525166.1_Missense_Mutation_p.L2146V|FAT3_ENST00000409404.2_Missense_Mutation_p.L2296V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2296	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAATACAACACTATCAGAAGC	0.403										TCGA Ovarian(4;0.039)																											p.L2296V		Atlas-SNP	.											.	FAT3	1822	.	0			c.C6886G						.						94.0	84.0	87.0					11																	92533065		1900	4119	6019	SO:0001583	missense	120114	exon9			ACAACACTATCAG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6886C>G	chr11.hg19:g.92533065C>G	ENSP00000298047:p.Leu2296Val	159.0	0.0		145.0	12.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	C	7.659	0.684550	0.14973	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.45276	0.9;0.9;0.9	5.8	1.1	0.20463	.	.	.	.	.	T	0.29126	0.0724	N	0.12961	0.28	0.80722	D	1	D	0.58268	0.982	P	0.51193	0.662	T	0.03673	-1.1014	9	0.09843	T	0.71	.	10.3138	0.43725	0.0:0.4573:0.0:0.5427	.	2296	Q8TDW7-3	.	V	2296;2296;2146	ENSP00000298047:L2296V;ENSP00000387040:L2296V;ENSP00000432586:L2146V	ENSP00000298047:L2296V	L	+	1	2	FAT3	92172713	0.017000	0.18338	0.832000	0.32986	0.986000	0.74619	0.152000	0.16302	0.154000	0.19237	-0.312000	0.09012	CTA	.	.		0.403	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ZNF423	23090	hgsc.bcm.edu	37	16	49671020	49671020	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr16:49671020C>T	ENST00000561648.1	-	4	2096	c.2043G>A	c.(2041-2043)ctG>ctA	p.L681L	ZNF423_ENST00000563137.2_Silent_p.L621L|ZNF423_ENST00000567169.1_Silent_p.L564L|ZNF423_ENST00000535559.1_Silent_p.L564L|ZNF423_ENST00000562520.1_Silent_p.L621L|ZNF423_ENST00000562871.1_Silent_p.L621L|ZNF423_ENST00000262383.2_Silent_p.L681L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	681					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AATGCACTGTCAGGTGCTGCA	0.582																																					p.L681L		Atlas-SNP	.											.	ZNF423	463	.	0			c.G2043A						.						70.0	67.0	68.0					16																	49671020		2198	4300	6498	SO:0001819	synonymous_variant	23090	exon4			CACTGTCAGGTGC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2043G>A	chr16.hg19:g.49671020C>T		182.0	0.0		249.0	77.0	NM_015069	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	hg19	CCDS32445.1																																																																																			.	.		0.582	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
ZNRF1	84937	hgsc.bcm.edu	37	16	75146313	75146313	+	IGR	SNP	G	G	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr16:75146313G>T	ENST00000335325.4	+	0	4620				RP11-252E2.1_ENST00000499110.1_RNA|LDHD_ENST00000450168.2_Silent_p.R466R|LDHD_ENST00000300051.4_Silent_p.R489R	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)	1						TTGAGCTGCCGCATGGTCTCC	0.637																																					p.R489R		Atlas-SNP	.											.	LDHD	34	.	0			c.C1465A						.						33.0	34.0	34.0					16																	75146313		2198	4300	6498	SO:0001628	intergenic_variant	197257	exon11			GCTGCCGCATGGT	AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606		chr16.hg19:g.75146313G>T		93.0	0.0		99.0	4.0	NM_153486	D3DUJ9|Q9H083	Silent	SNP	ENST00000335325.4	hg19	CCDS10912.1																																																																																			.	.		0.637	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269020.2		
SGSH	6448	hgsc.bcm.edu	37	17	78188902	78188902	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr17:78188902C>T	ENST00000326317.6	-	3	371	c.285G>A	c.(283-285)gtG>gtA	p.V95V	SGSH_ENST00000572208.1_5'UTR|SGSH_ENST00000534910.1_Intron|SGSH_ENST00000570923.1_Missense_Mutation_p.C107Y	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	95					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGAAGTGGTGCACGTCCTGGT	0.667																																					p.V95V		Atlas-SNP	.											.	SGSH	27	.	0			c.G285A						.						80.0	66.0	71.0					17																	78188902		2201	4300	6501	SO:0001819	synonymous_variant	6448	exon3			GTGGTGCACGTCC	BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.285G>A	chr17.hg19:g.78188902C>T		17.0	0.0		55.0	4.0	NM_000199	A8K5E2	Silent	SNP	ENST00000326317.6	hg19	CCDS11770.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900547	0.52227	.	.	ENSG00000181523	ENST00000535808	.	.	.	3.82	2.85	0.33270	.	.	.	.	.	T	0.46927	0.1418	.	.	.	0.80722	D	1	B	0.21225	0.053	B	0.15484	0.013	T	0.46428	-0.9192	7	0.87932	D	0	-11.5594	8.7412	0.34558	0.0:0.632:0.25:0.1181	.	107	B7Z9A6	.	Y	107	.	ENSP00000443457:C107Y	C	-	2	0	SGSH	75803497	0.941000	0.31946	0.994000	0.49952	0.977000	0.68977	0.064000	0.14437	0.807000	0.34208	0.563000	0.77884	TGC	.	.		0.667	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437695.1	NM_000199	
LRFN1	57622	hgsc.bcm.edu	37	19	39804840	39804840	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr19:39804840C>T	ENST00000248668.4	-	1	1136	c.1137G>A	c.(1135-1137)gcG>gcA	p.A379A	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	379	Ig-like.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CGGGCGCCGTCGCTTCCCCAG	0.687																																					p.A379A		Atlas-SNP	.											.	LRFN1	59	.	0			c.G1137A						.						25.0	31.0	29.0					19																	39804840		2176	4269	6445	SO:0001819	synonymous_variant	57622	exon1			CGCCGTCGCTTCC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1137G>A	chr19.hg19:g.39804840C>T		30.0	0.0		50.0	20.0	NM_020862	Q8TBS9	Silent	SNP	ENST00000248668.4	hg19	CCDS46071.1																																																																																			.	.		0.687	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862	
SHANK3	85358	hgsc.bcm.edu	37	22	51160334	51160334	+	Missense_Mutation	SNP	A	A	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr22:51160334A>T	ENST00000414786.2	+	21	4258	c.4031A>T	c.(4030-4032)gAg>gTg	p.E1344V	SHANK3_ENST00000445220.2_Missense_Mutation_p.E1360V|SHANK3_ENST00000262795.3_Missense_Mutation_p.E1374V			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1358	Pro-rich.				adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TCTGGGGTGGAGGAGGCTGAC	0.697																																					p.E1344V		Atlas-SNP	.											.	SHANK3	96	.	0			c.A4031T						.						14.0	16.0	15.0					22																	51160334		2007	4097	6104	SO:0001583	missense	85358	exon21			GGGTGGAGGAGGC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4031A>T	chr22.hg19:g.51160334A>T	ENSP00000464552:p.Glu1344Val	46.0	0.0		68.0	11.0	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	hg19		.	.	.	.	.	.	.	.	.	.	A	18.15	3.559285	0.65538	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.20738	2.05;2.05	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	M	0.83603	2.65	0.36862	D	0.888442	D;P;D	0.76494	0.998;0.808;0.999	D;B;D	0.83275	0.994;0.225;0.996	T	0.62793	-0.6779	10	0.87932	D	0	.	12.8612	0.57913	1.0:0.0:0.0:0.0	.	1358;1359;1374	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	V	1374;1360	ENSP00000442518:E1374V;ENSP00000446078:E1360V	ENSP00000442518:E1374V	E	+	2	0	SHANK3	49507200	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.610000	0.90902	1.928000	0.55862	0.379000	0.24179	GAG	.	.		0.697	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
SLC9A6	10479	hgsc.bcm.edu	37	X	135122263	135122263	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chrX:135122263G>C	ENST00000370698.3	+	15	1695	c.1660G>C	c.(1660-1662)Ggg>Cgg	p.G554R	SLC9A6_ENST00000370695.4_Missense_Mutation_p.G586R|SLC9A6_ENST00000370701.1_Missense_Mutation_p.G534R	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	554					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GACCCACAGCGGGCCTCCGCT	0.502																																					p.G586R		Atlas-SNP	.											.	SLC9A6	64	.	0			c.G1756C						.						46.0	39.0	41.0					X																	135122263		2203	4300	6503	SO:0001583	missense	10479	exon15			CACAGCGGGCCTC	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1660G>C	chrX.hg19:g.135122263G>C	ENSP00000359732:p.Gly554Arg	118.0	0.0		151.0	96.0	NM_001042537	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	hg19	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776063	0.70107	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.69685	-0.42;-0.42;-0.42	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	L	0.45698	1.435	0.80722	D	1	D;P	0.89917	1.0;0.838	D;B	0.97110	1.0;0.446	T	0.71080	-0.4696	10	0.19147	T	0.46	.	17.4825	0.87677	0.0:0.0:1.0:0.0	.	586;554	Q92581-2;Q92581	.;SL9A6_HUMAN	R	534;554;586	ENSP00000359735:G534R;ENSP00000359732:G554R;ENSP00000359729:G586R	ENSP00000359729:G586R	G	+	1	0	SLC9A6	134949929	1.000000	0.71417	0.869000	0.34112	0.742000	0.42306	9.404000	0.97306	2.343000	0.79666	0.513000	0.50165	GGG	.	.		0.502	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
TMEM257	9142	hgsc.bcm.edu	37	X	144909486	144909486	+	Silent	SNP	C	C	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chrX:144909486C>A	ENST00000408967.2	+	1	559	c.291C>A	c.(289-291)ccC>ccA	p.P97P		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	97						integral component of membrane (GO:0016021)											TGCAGTCTCCCAGGGCCCTGC	0.413																																					p.P97P		Atlas-SNP	.											.	.	.	.	0			c.C291A						.						52.0	49.0	50.0					X																	144909486		2203	4300	6503	SO:0001819	synonymous_variant	9142	exon1			GTCTCCCAGGGCC	Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.291C>A	chrX.hg19:g.144909486C>A		107.0	0.0		124.0	68.0	NM_004709	Q14CW0	Silent	SNP	ENST00000408967.2	hg19	CCDS14681.1																																																																																			.	.		0.413	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709	
MT-CYB	4519	hgsc.bcm.edu	37	M	15243	15243	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chrM:15243G>A	ENST00000361789.2	+	1	497	c.497G>A	c.(496-498)gGa>gAa	p.G166E	MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	166			G -> E (in hyperthrophic cardiomyopathy). {ECO:0000269|PubMed:10453733}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATGAATCTGAGGAGGCTACTC	0.473											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G166E		Atlas-SNP	.											.	.	.	.	0			c.G497A						.																																			SO:0001583	missense	0	exon1			TCTGAGGAGGCTA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.497G>A	chrM.hg19:g.15243G>A	ENSP00000354554:p.Gly166Glu	8.0	0.0	585	38.0	7.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.473	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
COL11A2	1302	hgsc.bcm.edu	37	6	33154431	33154431	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr6:33154431delC	ENST00000374708.4	-	5	1029	c.771delG	c.(769-771)aggfs	p.R257fs	COL11A2_ENST00000357486.1_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000395197.1_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000374714.1_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000341947.2_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000374713.1_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000361917.1_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000395194.1_Frame_Shift_Del_p.R257fs|COL11A2_ENST00000374712.1_Frame_Shift_Del_p.R257fs	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	257	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GATTTTGTGGCCTGTGAAGTC	0.587																																					p.P258fs	Melanoma(1;90 116 3946 5341 17093)	Pindel	.											.	COL11A2	124	.	0			c.772delC						.						213.0	206.0	208.0					6																	33154431		2203	4300	6503	SO:0001589	frameshift_variant	1302	exon5			.	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.771delG	chr6.hg19:g.33154431delC	ENSP00000363840:p.Arg257fs	275.0	0.0		324.0	52.0	NM_080679	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Frame_Shift_Del	DEL	ENST00000374708.4	hg19	CCDS43452.1																																																																																			.	.		0.587	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
